WO2015013583A2 - Genome engineering - Google Patents

Genome engineering Download PDF

Info

Publication number
WO2015013583A2
WO2015013583A2 PCT/US2014/048140 US2014048140W WO2015013583A2 WO 2015013583 A2 WO2015013583 A2 WO 2015013583A2 US 2014048140 W US2014048140 W US 2014048140W WO 2015013583 A2 WO2015013583 A2 WO 2015013583A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
talen
longer
dna
repeat sequences
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/048140
Other languages
English (en)
French (fr)
Other versions
WO2015013583A8 (en
WO2015013583A3 (en
Inventor
George M. Church
Luhan Yang
Marc Guell CARGOL
Joyce Lichi YANG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Harvard University
Original Assignee
Harvard University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to RU2016106649A priority Critical patent/RU2688462C2/ru
Priority to CN202010094041.7A priority patent/CN111304230B/zh
Priority to KR1020167004663A priority patent/KR102773555B1/ko
Priority to ES14829377T priority patent/ES2715666T3/es
Priority to NZ716606A priority patent/NZ716606B2/en
Priority to SG11201600217QA priority patent/SG11201600217QA/en
Priority to EP21176056.6A priority patent/EP3916099B1/en
Priority to JP2016530062A priority patent/JP6739335B2/ja
Priority to HK16106842.9A priority patent/HK1218940B/en
Priority to CN202410183863.0A priority patent/CN118028379A/zh
Priority to KR1020237020511A priority patent/KR20230096134A/ko
Priority to US14/907,605 priority patent/US9914939B2/en
Priority to EP14829377.2A priority patent/EP3024964B1/en
Priority to EP18212761.3A priority patent/EP3483277B1/en
Priority to EP23164284.4A priority patent/EP4234703A3/en
Application filed by Harvard University filed Critical Harvard University
Priority to AU2014293015A priority patent/AU2014293015B2/en
Priority to CN201480042306.1A priority patent/CN105473773B/zh
Priority to BR112016001721-8A priority patent/BR112016001721B1/pt
Priority to CA2918540A priority patent/CA2918540A1/en
Publication of WO2015013583A2 publication Critical patent/WO2015013583A2/en
Publication of WO2015013583A8 publication Critical patent/WO2015013583A8/en
Publication of WO2015013583A3 publication Critical patent/WO2015013583A3/en
Priority to IL243560A priority patent/IL243560B/en
Anticipated expiration legal-status Critical
Priority to AU2018278911A priority patent/AU2018278911C1/en
Priority to IL272193A priority patent/IL272193B/en
Priority to AU2021202581A priority patent/AU2021202581B2/en
Priority to AU2023248167A priority patent/AU2023248167A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0696Artificially induced pluripotent stem cells, e.g. iPS
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10Cells modified by introduction of foreign genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/02Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/90Vectors containing a transposable element
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/001Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • C12N2830/003Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor tet inducible

Definitions

  • Genome editing via sequence-specific nucleases is known. See references 1, 2, and 3 hereby incorporated by reference in their entireties.
  • a nuclease-mediated double-stranded DNA (dsDNA) break in the genome can be repaired by two main mechanisms: Non-Homologous End Joining (NHEJ), which frequently results in the introduction of non-specific insertions and deletions (indels), or homology directed repair (HDR), which incorporates a homologous strand as a repair template.
  • NHEJ Non-Homologous End Joining
  • Indels non-specific insertions and deletions
  • HDR homology directed repair
  • TALENs Transcription Activator-Like Effectors Nucleases target particular DNA sequences with tandem copies of Repeat Variable Diresidue (RVD) domains. See reference 6 hereby incorporated by reference in its entirtety. While the modular nature of RVDs simplifies TALEN design, their repetitive sequences complicate methods for synthesizing their DNA constructs (see references 2, 9, and 15-19 hereby incorporated by reference in their entireties) and also impair their use with lentiviral gene delivery vehicles.
  • RVD Variable Diresidue
  • Sensitivity is still an issue because, while high editing frequencies on the order of 50% are frequently reported for some cell types, such as U20S and K562 (see references 12 and 14 hereby incorporated by reference in their entireties), frequencies are generally lower in hiPSCs. See reference 10 hereby incorporated by reference in its entirety. Recently, high editing frequencies have been reported in hiPSC and hESC using TALENs (see reference 9 hereby incorporated by reference in its entirety), and even higher frequencies with the CRISPR Cas9-gRNA system (see references 16-19 hereby incorporated by reference in their entireties. However, editing rates at different sites appear to vary widely (see reference 17 hereby incorporated by reference in its entirety), and editing is sometimes not detectable at all at some sites (see reference 20 hereby incorporated by reference in its entirety).
  • CRISPR-Cas systems rely on short guide RNAs in complex with Cas proteins to direct degradation of complementary sequences present within invading foreign nucleic acid. See Deltcheva, E. et al. CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature 471, 602-607 (201 1); Gasiunas, G., Barrangou, R., Horvath, P. & Siksnys, V. Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proceedings of the National Academy of Sciences of the United States of America 109, E2579-2586 (2012); Jinek, M.
  • CRISPR RNA crRNA fused to a normally trans-encoded tracrRNA (“trans-activating CRISPR RNA”) is sufficient to direct Cas9 protein to sequence-specifically cleave target DNA sequences matching the crRNA.
  • trans-activating CRISPR RNA a normally trans-encoded tracrRNA fused to a normally trans-encoded tracrRNA
  • Cas9 protein to sequence-specifically cleave target DNA sequences matching the crRNA.
  • gRNA homologous to a target site results in Cas9 recruitment and degradation of the target DNA. See H. Deveau et al., Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. Journal of Bacteriology 190, 1390 (Feb, 2008).
  • aspects of the present disclosure are directed to the use of modified Transcription Activator-Like Effector Nucleases (TALENs) for genetically modifying a cell, such as a somatic cell or a stem cell.
  • TALENs are known to include repeat sequences.
  • aspects of the present disclosure are directed to a method of altering target DNA in a cell including introducing into a cell a TALEN lacking repeat sequences 100 bp or longer wherein the TALEN cleaves the target DNA and the cell undergoes nonhomologous end joining to produce altered DNA in the cell.
  • repeat sequences of desired length have been removed from a TALEN.
  • the TALEN is devoid of repeat sequences of certain desired length.
  • a TALEN is provided with repeat sequences of desired length removed. According to certain aspects, a TALEN is modified to remove repeat sequences of desired length. According to certain aspects, a TALEN is engineered to remove repeat sequences of desired length.
  • aspects of the present disclosure include methods of altering target DNA in a cell including combining within a cell a TALEN lacking repeat sequences 100 bp or longer and a donor nucleic acid sequence wherein the TALEN cleaves the target DNA and the donor nucleic acid sequence is inserted into the DNA in the cell.
  • aspects of the present disclosure are directed to a virus including a nucleic acid sequence encoding a TALEN lacking repeat sequences 100 bp or longer.
  • aspects of the present disclosure are directed to a cell including a nucleic acid sequence encoding a TALEN lacking repeat sequences 100 bp or longer.
  • the TALEN lacks repeat sequences 100 bp or longer, 90 bp or longer, 80 bp or longer, 70 bp or longer, 60 bp or longer, 50 bp or longer, 40 bp or longer, 30 bp or longer, 20 bp or longer, 19 bp or longer, 18 bp or longer, 17 bp or longer, 16 bp or longer, 15 bp or longer, 14 bp or longer, 13 bp or longer, 12 bp or longer, 11 bp or longer, or 10 bp or longer.
  • aspects of the present disclosure are directed to making a TALE including combining an endonuclease, a DNA polymerase, a DNA ligase, an exonuclease, a plurality of nucleic acid dimer blocks encoding repeat variable diresidue domains and a TALE-N/TF backbone vector including an endonuclease cutting site, activating the endonuclease to cut the TALE-N/TF backbone vector at the endonuclease cutting site to produce a first end and a second end, activating the exonuclease to create a 3' and a 5' overhang on the TALE-N/TF backbone vector and the plurality of nucleic acid dimer blocks and to anneal the TALE-N/TF backbone vector and the plurality of nucleic acid dimer blocks in a desired order, activating the DNA polymerase and the DNA ligase to connect the TALE-N/TF backbone vector and the plurality of nucle
  • aspects of the present disclosure are directed to a method of altering target DNA in a stem cell expressing an enzyme that forms a co-localization complex with RNA complementary to the target DNA and that cleaves the target DNA in a site specific manner including (a) introducing into the stem cell a first foreign nucleic acid encoding an RNA complementary to the target DNA and which guides the enzyme to the target DNA, wherein the RNA and the enzyme are members of a co-localization complex for the target DNA, introducing into the stem cell a second foreign nucleic acid encoding a donor nucleic acid sequence, wherein the RNA and the donor nucleic acid sequences are expressed, wherein the RNA and the enzyme co-localize to the target DNA, the enzyme cleaves the target DNA and the donor nucleic acid is inserted into the target DNA to produce altered DNA in the stem cell.
  • aspects of the present disclosure are directed to a stem cell including a first foreign nucleic acid encoding for an enzyme that forms a co-localization complex with RNA complementary to target DNA and that cleaves the target DNA in a site specific manner.
  • aspects of the present disclosure are directed to a cell including a first foreign nucleic acid encoding for an enzyme that forms a co-localization complex with RNA complementary to target DNA and that cleaves the target DNA in a site specific manner and including an inducible promoter for promoting expression of the enzyme.
  • expression can be regulated, for example, it can be started and it can be stopped.
  • aspects of the present disclosure are directed to a cell including a first foreign nucleic acid encoding for an enzyme that forms a co-localization complex with RNA complementary to target DNA and that cleaves the target DNA in a site specific manner, wherein the first foreign nucleic acid is removable from genomic DNA of the cell using a removal enzyme, such as a transposase.
  • aspects of the present disclosure are directed to a method of altering target DNA in a cell expressing an enzyme that forms a co-localization complex with RNA complementary to the target DNA and that cleaves the target DNA in a site specific manner including (a) introducing into the cell a first foreign nucleic acid encoding a donor nucleic acid sequence, introducing into the cell from media surrounding the cell an RNA complementary to the target DNA and which guides the enzyme to the target DNA, wherein the RNA and the enzyme are members of a co-localization complex for the target DNA, wherein the donor nucleic acid sequence is expressed, wherein the RNA and the enzyme co-localize to the target DNA, the enzyme cleaves the target DNA and the donor nucleic acid is inserted into the target DNA to produce altered DNA in the cell.
  • aspects of the present disclosure are directed to the use of an RNA guided DNA binding protein for genetically modifying a stem cell.
  • the stem cell has been genetically modified to include a nucleic acid encoding for the RNA guided DNA binding protein and the stem cell expresses the RNA guided DNA binding protein.
  • donor nucleic acids for introducing specific mutations are optimized for genome editing using either the modified TALENs or the RNA guided DNA binding protein.
  • aspects of the present disclosure are directed to the modification of DNA, such as multiplex modification of DNA, in a stem cell using one or more guide RNAs (ribonucleic acids) to direct an enzyme having nuclease activity expressed by the stem cell, such as a DNA binding protein having nuclease activity, to a target location on the DNA (deoxyribonucleic acid) wherein the enzyme cuts the DNA and an exogenous donor nucleic acid is inserted into the DNA, such as by homologous recombination.
  • aspects of the present disclosure include cycling or repeating steps of DNA modification on a stem cell to create a stem cell having multiple modifications of DNA within the cell. Modifications may include insertion of exogenous donor nucleic acids.
  • exogenous nucleic acid insertions can be accomplished by a single step of introducing into a stem cell, which expresses the enzyme, nucleic acids encoding a plurality of RNAs and a plurality of exogenous donor nucleic acids, such as by co-transformation, wherein the RNAs are expressed and wherein each RNA in the plurality guides the enzyme to a particular site of the DNA, the enzyme cuts the DNA and one of the plurality of exogenous nucleic acids is inserted into the DNA at the cut site.
  • a stem cell which expresses the enzyme, nucleic acids encoding a plurality of RNAs and a plurality of exogenous donor nucleic acids, such as by co-transformation, wherein the RNAs are expressed and wherein each RNA in the plurality guides the enzyme to a particular site of the DNA, the enzyme cuts the DNA and one of the plurality of exogenous nucleic acids is inserted into the DNA at the cut site.
  • exogenous nucleic acid insertions can be accomplished in a cell by repeated steps or cycles of introducing into a stem cell, which expresses the enzyme, one or more nucleic acids encoding one or more RNAs or a plurality of RNAs and one or more exogenous nucleic acids or a plurality of exogenous nucleic acids wherein the RNA is expressed and guides the enzyme to a particular site of the DNA, the enzyme cuts the DNA and the exogenous nucleic acid is inserted into the DNA at the cut site, so as to result in a cell having multiple alterations or insertions of exogenous DNA into the DNA within the stem cell.
  • the stem cell expressing the enzyme has been genetically altered to express the enzyme such as by introducing into the cell a nucleic acid encoding the enzyme and which can be expressed by the stem cell.
  • aspects of the present disclosure include cycling the steps of introducing RNA into a stem cell which expresses the enzyme, introducing exogenous donor nucleic acid into the stem cell, expressing the RNA, forming a co-localization complex of the RNA, the enzyme and the DNA, enzymatic cutting of the DNA by the enzyme, and insertion of the donor nucleic acid into the DNA. Cycling or repeating of the above steps results in multiplexed genetic modification of a stem cell at multiple loci, i.e., a stem cell having multiple genetic modifications.
  • DNA binding proteins or enzymes within the scope of the present disclosure include a protein that forms a complex with the guide RNA and with the guide RNA guiding the complex to a double stranded DNA sequence wherein the complex binds to the DNA sequence.
  • the enzyme can be an RNA guided DNA binding protein, such as an RNA guided DNA binding protein of a Type II CRISPR System that binds to the DNA and is guided by RNA.
  • the RNA guided DNA binding protein is a Cas9 protein.
  • RNA binding protein- guide RNA complex may be used to cut multiple sites of the double stranded DNA so as to create a stem cell with multiple genetic modifications, such as multiple insertions of exogenous donor DNA.
  • a method of making multiple alterations to target DNA in a stem cell expressing an enzyme that forms a co-localization complex with RNA complementary to the target DNA and that cleaves the target DNA in a site specific manner including (a) introducing into the stem cell a first foreign nucleic acid encoding one or more RNAs complementary to the target DNA and which guide the enzyme to the target DNA, wherein the one or more RNAs and the enzyme are members of a co-localization complex for the target DNA, introducing into the stem cell a second foreign nucleic acid encoding one or more donor nucleic acid sequences, wherein the one or more RNAs and the one or more donor nucleic acid sequences are expressed, wherein the one or more RNAs and the enzyme co-localize to the target DNA, the enzyme cleaves the target DNA and the donor nucleic acid is inserted into the target DNA to produce altered DNA in the stem cell, and repeating step (a) multiple times to produce multiple alterations to the DNA in the stem cell.
  • the RNA is between about 10 to about 500 nucleotides. According to one aspect, the RNA is between about 20 to about 100 nucleotides.
  • the one or more RNAs is a guide RNA. According to one aspect, the one or more RNAs is a tracrRNA-crRNA fusion.
  • the DNA is genomic DNA, mitochondrial DNA, viral DNA, or exogenous DNA.
  • a cell may be genetically modified to reversibly include a nucleic acid encoding a DNA binding enzyme using a vector which can be easily removed using an enzyme.
  • Useful vectors methods are known to those of skill in the art and include lentivirus, adeno associated virus, nuclease and integrase mediated tarteget insertion methods and transposon mediated insertion methods.
  • the nucleic acid encoding a DNA binding enzyme that has been added, such as by using a cassette or vector can be removed in its entirety along with the cassette and vector and without leaving a portion of such nucleic acid, cassette or vector in the genomic DNA, for example.
  • Such removal is referred to in the art as “scarless” removal, as the genome is the same as it was before addition of the nucleic acid, cassette or vector.
  • One exemplary embodiment for insertion and scarless removal is a PiggyBac vector commercially available from System Biosciences.
  • Fig. 1 is directed to functional tests of re-TALENs in human somatic and stem cells.
  • FIG. 1 Schematic representation of experimental design for testing genome targeting efficiency.
  • a genomically integrated GFP coding sequence is disrupted by the insertion of a stop codon and a 68bp genomic fragment derived from the AAVS 1 locus (bottom).
  • Restoration of the GFP sequence by nuclease-mediated homologous recombination with tGFP donor (top) results in GFP+ cells that can be quantitated by FACS.
  • Re-TALENs and TALENs target identical sequences within AAVS1 fragments.
  • FIG. 10 Schematic overview depicting the targeting strategy for the native AAVS1 locus.
  • the donor plasmid, containing splicing acceptor (SA)- 2A (self-cleaving peptides), puromycin resistant gene (PURO) and GFP were described (see reference 10 hereby incorporated by reference in its entirety. The locations of PCR primers used to detect successful editing events are depicted as blue arrows.
  • SA splicing acceptor
  • PURO puromycin resistant gene
  • Fig. 2 relates to a comparison of reTALENs and Cas9-gRNAs genome targeting efficiency on CCR5 in iPSCs.
  • FIG. 1 Schematic representation of genome engineering experimental design. At the re-TALEN pair or Cas9-gRNA targeting site, a 90mer ssODN carrying a 2bp mismatch against the genomic DNA was delivered along with the reTALEN or Cas9-gRNA constructs into PGPl hiPSCs. The cutting sites of the nucleases are depicted as red arrows in the figure.
  • HDR was quantified from the fraction of reads that contained a 2bp point mutation built into the center of the ssODN (blue), and NHEJ activity was quantified from the fraction of deletions (grey)/Insertions (red) at each specific position in the genome.
  • green dashed lines are plotted to mark the outer boundary of the re-TALEN pair's binding sites, which are at positions -26bp and +26bp relative to the center of the two re-TALEN binding sites.
  • Top schematic representation of the targeted genome editing sites in CCR5.
  • the 15 targeting sites are illustrated by blue arrows below.
  • cells were co-transfected with a pair of reTALENs and their corresponding ssODN donor carrying 2bp mismatches against the genomic DNA. Genome editing efficiencies were assayed 6 days after transfection.
  • 15 Cas9- gRNAs were transfected with their corresponding ssODNs individually into PGP 1 -hiPSCs to target the same 15 sites and analyzed the efficiency 6 days after transfection.
  • Bottom the genome editing efficiency of re-TALENs and Cas9-gRNAs targeting CCR5 in PGP1 hiPSCs.
  • Panel 1 and 2 indicate NHEJ and HDR efficiencies mediated by reTALENs.
  • Panel 3 and 4 indicate NHEJ and HDR efficiencies mediated by Cas9-gRNAs.
  • NHEJ rates were calculated by the frequency of genomic alleles carrying deletions or insertions at the targeting region; HDR rates were calculated by the frequency of genomic alleles carrying 2bp mismatches.
  • Panel 5 the DNasel HS profile of a hiPSC cell line from ENCODE database (Duke DNase HS, iPS ⁇ 7 DS). Of note, the scales of different panels are different.
  • Fig. 3 is directed to a study of functional parameters governing ssODN-mediated HDR with re-TALENs ir Cas9-gRNAs in PGP1 hiPSCs.
  • PGP1 hiPSCs were co-transfected with re-TALENs pair (#3) and ssODNs of different lengths (50, 70, 90, 1 10, 130,150,170 nts). All ssODNs possessed an identical 2bp mismatch against the genomic DNA in the middle of their sequence. A 90mer ssODN achieved optimal HDR in the targeted genome. The assessment of HDR, NHEJ-incurred deletion and insertion efficiency is as described herein.
  • PGP1 hiPSCs were co-transfected with Cas9-gRNA (AAVS1) and ssODNs of different orientation (Oc: complement to gRNA; On: non-complement to gRNA) and different lengths (30, 50, 70, 90, 1 10 nt). All ssODNs possessed an identical 2bp mismatch against the genomic DNA in the middle of their sequence. A 70mer Oc achieved optimal HDR in the targeted genome.
  • Fig. 4 is directed to using re-TALENs and ssODNs to obtain monoclonal genome edited hiPSC without selection.
  • Fig. 5 Design of reTALE.
  • Fig. 6. Design and practice of TALE Single-incubation Assembly (TASA) assembly.
  • TASA TALE Single-incubation Assembly
  • TALE-N/TF backbone vectors The reaction product can be used directly for bacterial transformation.
  • the right panel illustrates the mechanism of TASA.
  • the destination vector is linearized by an endonuclease at 37°C to cut off ccdB counter-selection cassette; the exonuclease, which processes the end of blocks and linearized vectors, exposes ssDNA overhangs at the end of fragments to allow blocks and vector backbones to anneal in a designated order.
  • polymerases and ligases work together to seal the gap, producing the final constructs ready for transformation.
  • Fig. 7 The functionality and sequence integrity of Lenti-reTALEs.
  • Fig. 9 Statistical analysis of NHEJ and HDR efficiencies by reTALENs and Cas9- gR As on CCR5.
  • Fig. 10 The correlation analysis of genome editing efficiency and epigenetic state.
  • Fig. 1 The impact of homology pairing in the ssODN-mediated genome editing.
  • Gene conversion tracts progressively decrease in incidence as their lengths increase, a result very similar to gene conversion tract distributions seen with dsDNA donors, but on a highly compressed distance scale of tens of bp for the ssDNA oligo vs. hundreds of bases for dsDNA donors.
  • PGP1 iPSCs were co-transfected with combination of nuclease (C2) (Cas9-gR A) or nickase (Cc) (Cas9D10A-gRNA) and ssODNs of different orientation (Oc and On). All ssODNs possessed an identical 2bp mismatch against the genomic DNA in the middle of their sequence. The assessment of HDR is described herein.
  • Fig. 13 The design and optimization of re-TALE sequence.
  • An R package was provided to carry out this general framework for synthetic protein design.
  • Fig. 14 is a gel image showing PCR validation of the genomic insertion of Cas 9 in PGP1 cells.
  • Line 3, 6, 9, 12 are PCR product of plain PGP1 cell lines.
  • Fig. 15 is a graph of the mRNA expression level of Cas9 mRNA under the induction.
  • Fig. 16 is a graph showing genome targeting efficiency by different RNA designs.
  • Fig. 17 is a graph showing genome targeting efficiency of 44% homologous recombination achieved by a guide RNA - donor DNA fusion.
  • Fig. 18 is a diagram showing the genotype of isogenic PGP 1 cell lines generated by system decribed herein.
  • PGPl-iPS-BTHH has the single nucleotides deletion phenotype as the BTHH patient.
  • PGP1-NHEJ has 4bp deletions that generated frame-shift mutations in a different way.
  • Fig. 19 is a graph showing that cardiomyocyte derived from isogenic PGP1 iPS recapitulated defective ATP production and FIFO ATPase specific activity as demonstrated in patient specific cells.
  • aspects of the present invention are directed to the use of a TALEN that lacks certain repeat sequences, for nucleic acid engineering, for example by cutting double stranded nucleic acid.
  • the use of the TALEN to cut double stranded nucleic acid can result in nonhomologous end joining (NHEJ) or homologous recombination (HR).
  • NHEJ nonhomologous end joining
  • HR homologous recombination
  • TALEN that lacks repeat sequences for nucleic acid engineering, for example by cutting double stranded nucleic acid, in the presence of a donor nucleic acid and insertion of the donor nucleic acid into the double stranded nucleic acid, such as by nonhomologous end joining (NHEJ) or homologous recombination (HR).
  • NHEJ nonhomologous end joining
  • HR homologous recombination
  • Transcription activator- like effector nucleases are known in the art and include artificial restriction enzymes generated by fusing a TAL effector DNA binding domain to a DNA cleavage domain. Restriction enzymes are enzymes that cut DNA strands at a specific sequence.
  • Transcription activator-like effectors can be engineered to bind to a desired DNA sequence. See Boch, Jens (February 201 1). "TALEs of genome targeting”. Nature Biotechnology 29 (2): 135-6 hereby incorporated by reference in its entirety.
  • a TALEN is produced which is a restriction enzyme that is specific for any desired DNA sequence.
  • the TALEN is introduced into a cell for target nucleic acid editing in situ, such as genome editing in situ.
  • the non-specific DNA cleavage domain from the end of the Fokl endonuclease can be used to construct hybrid nucleases that are active in yeast cells, plant cells and animal cells.
  • the Fokl domain functions as a dimer, requiring two constructs with unique DNA binding domains for sites in the target genome with proper orientation and spacing. Both the number of amino acid residues between the TALE DNA binding domain and the Fokl cleavage domain and the number of bases between the two individual TALEN binding sites affect activity.
  • TALENs as described herein can be used to edit target nucleic acids, such as genomes, by inducing double-strand breaks (DSB), which cells respond to with repair mechanisms.
  • DSB double-strand breaks
  • Exemplary repair mechanisms include non-homologous end joining (NHEJ) which reconnects DNA from either side of a double-strand break where there is very little or no sequence overlap for annealing.
  • NHEJ non-homologous end joining
  • This repair mechanism induces errors in the genome via insertion or deletion (indels), or chromosomal rearrangement; any such errors may render the gene products coded at that location non- functional.
  • indels insertion or deletion
  • chromosomal rearrangement any such errors may render the gene products coded at that location non- functional.
  • the activity can be monitored by using a heteroduplex cleavage assay which detects any difference between two alleles amplified by PCR. Cleavage products can be visualized on simple agarose gels or slab gel systems. Alternatively, DNA can be introduced into a genome through NHEJ in the presence of exogenous double-stranded DNA fragments. Homology directed repair can also introduce foreign DNA at the DSB as the transfected double-stranded sequences are used as templates for the repair enzymes.
  • the TALENs described herein can be used to generate stably modified human embryonic stem cell and induced pluripotent stem cell (IPSCs) clones. According to certain aspects the TALENs described herein can be used to generate knockout species such as C. elegans, knockout rats, knockout mice or knockout zebrafish.
  • embodiments are directed to the use of exogenous DNA, nuclease enzymes such as DNA binding proteins and guide RNAs to co-localize to DNA within a stem cell and digest or cut the DNA with insertion of the exogenous DNA.
  • DNA binding proteins are readily known to those of skill in the art to bind to DNA for various purposes. Such DNA binding proteins may be naturally occurring.
  • DNA binding proteins included within the scope of the present disclosure include those which may be guided by RNA, referred to herein as guide RNA. According to this aspect, the guide RNA and the RNA guided DNA binding protein form a co-localization complex at the DNA.
  • DNA binding proteins having nuclease activity are known to those of skill in the art, and include naturally occurring DNA binding proteins having nuclease activity, such as Cas9 proteins present, for example, in Type II CRISPR systems.
  • Cas9 proteins and Type II CRISPR systems are well documented in the art. See Makarova et al., Nature Reviews, Microbiology, Vol. 9, June 201 1, pp. 467-477 including all supplementary information hereby incorporated by reference in its entirety.
  • Exemplary DNA binding proteins having nuclease activity function to nick or cut double stranded DNA. Such nuclease activity may result from the DNA binding protein having one or more polypeptide sequences exhibiting nuclease activity. Such exemplary DNA binding proteins may have two separate nuclease domains with each domain responsible for cutting or nicking a particular strand of the double stranded DNA.
  • Exemplary polypeptide sequences having nuclease activity known to those of skill in the art include the McrA-HNH nuclease related domain and the RuvC-like nuclease domain. Accordingly, exemplary DNA binding proteins are those that in nature contain one or more of the McrA-HNH nuclease related domain and the RuvC-like nuclease domain.
  • An exemplary DNA binding protein is an RNA guided DNA binding protein of a Type II
  • An exemplary DNA binding protein is a Cas9 protein.
  • Cas9 In S. pyogenes, Cas9 generates a blunt-ended double-stranded break 3bp upstream of the protospacer-adjacent motif (PAM) via a process mediated by two catalytic domains in the protein: an HNH domain that cleaves the complementary strand of the DNA and a RuvC-like domain that cleaves the non-complementary strand.
  • PAM protospacer-adjacent motif
  • the Cas9 protein may be referred by one of skill in the art in the literature as Csnl .
  • the S. pyogenes Cas9 protein is shown below. See Deltcheva et al., Nature 471, 602-607 (2011) hereby incorporated by reference in its entirety.
  • the RNA guided DNA binding protein includes homologs and orthologs of Cas9 which retain the ability of the protein to bind to the DNA, be guided by the RNA and cut the DNA.
  • the Cas9 protein includes the sequence as set forth for naturally occurring Cas9 from S. pyogenes and protein sequences having at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% homology thereto and being a DNA binding protein, such as an RNA guided DNA binding protein.
  • an engineered Cas9-gRNA system which enables RNA-guided genome cutting in a site specific manner in a stem cell, if desired, and modification of the stem cell genome by insertion of exogenous donor nucleic acids.
  • the guide RNAs are complementary to target sites or target loci on the DNA.
  • the guide RNAs can be crRNA- tracrRNA chimeras.
  • the guide RNAs can be introduced from media surrounding the cell. In this manner a method of continuously modifying a cell is provided to the extent that various guide RNAs are provided to surrounding media and with the uptake by the cell of the guide RNAs and with supplementation of the media with additional guide RNAs. Supplementation may be in a continuous manner.
  • the Cas9 binds at or near target genomic DNA.
  • the one or more guide RNAs bind at or near target genomic DNA.
  • the Cas9 cuts the target genomic DNA and exogenous donor DNA is inserted into the DNA at the cut site.
  • methods are directed to the use of a guide RNA with a Cas9 protein and an exogenous donor nucleic acid to multiplex insertions of exogenous donor nucleic acids into DNA within a stem cell expressing Cas9 by cycling the insertion of nucleic acid encoding the RNA (or providing RNA from the surrounding media) and exogenous donor nucleic acid, expressing the RNA (or uptaking the RNA), colocalizing the RNA, Cas9 and DNA in a manner to cut the DNA, and insertion of the exogenous donor nucleic acid.
  • the method steps can be cycled in any desired number to result in any desired number of DNA modifications.
  • Methods of the present disclosure are accordingly directed to editing target genes using the Cas9 proteins and guide RNAs described herein to provide multiplex genetic and epigenetic engineering of stem cells.
  • DNA binding proteins or systems such as the modified TALENS or Cas9 described herein
  • DNA binding proteins or systems such as the modified TALENS or Cas9 described herein
  • Cells according to the present disclosure include any cell into which foreign nucleic acids can be introduced and expressed as described herein. It is to be understood that the basic concepts of the present disclosure described herein are not limited by cell type.
  • Cells according to the present disclosure include somatic cells, stem cells, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, archael cells, eubacterial cells and the like.
  • Cells include eukaryotic cells such as yeast cells, plant cells, and animal cells. Particular cells include mammalian cells, such as human cells. Further, cells include any in which it would be beneficial or desirable to modify DNA.
  • Target nucleic acids include any nucleic acid sequence to which a TALEN or RNA guided DNA binding protein having nuclease activity as described herein can be useful to nick or cut.
  • Target nucleic acids include any nucleic acid sequence to which a co-localization complex as described herein can be useful to nick or cut.
  • Target nucleic acids include genes.
  • DNA such as double stranded DNA, can include the target nucleic acid and a co-localization complex can bind to or otherwise co-localize with the DNA or a TALEN can otherwise bind with the DNA at or adjacent or near the target nucleic acid and in a manner in which the co-localization complex or the TALEN may have a desired effect on the target nucleic acid.
  • target nucleic acids can include endogenous (or naturally occurring) nucleic acids and exogenous (or foreign) nucleic acids.
  • One of skill based on the present disclosure will readily be able to identify or design guide RNAs and Cas9 proteins which co-localize to a DNA or a TALEN which binds to a DNA, including a target nucleic acid.
  • One of skill will further be able to identify transcriptional regulator proteins or domains, such as transcriptional activators or transcriptional repressors, which likewise co-localize to a DNA including a target nucleic acid.
  • DNA includes genomic DNA, mitochondrial DNA, viral DNA or exogenous DNA.
  • materials and methods useful in the practice of the present disclosure include those described in Di Carlo, et al., Nucleic Acids Research, 2013, vol. 41, No. 7 4336-4343 hereby incorporated by reference in its entirety for all purposes including exemplary strains and media, plasmid construction, transformation of plasmids, electroporation of transcient gRNA cassette and donor nucleic acids, transformation of gRNA plasmid with donor DNA into Cas9-expressing cells, galactose induction of Cas9, identification of CRISPR-Cas targets in yeast genome, etc.
  • Donor nucleic acids include any nucleic acid to be inserted into a nucleic acid sequence as described herein.
  • 19bp of the selected target sequence i.e. 5'-N19 of 5'-N19-NGG-3'
  • two complementary lOOmer oligonucleotides TTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGN 19GTTTTAGAGCTAGAA ATAGCAAGTTAAAATAAGGCTAGTCC.
  • Each lOOmer oligonucleotide was suspended at lOOmM in water, mixed with equal volume and annealed in thermocycle machine (95°C, 5min; Ramp to 4°C, 0.1°C/sec).
  • the gRNA cloning vector (Addgene plasmid ID 41824) was linearized using Aflll and the vector was purified.
  • the (lOul) gRNA assembly reaction was carried out with lOng annealed lOObp fragment, lOOng destination backbone, IX Gibson assembly reaction mix (New England Biolabs) at 50°C for 30min. The reaction can be processed directly for bacterial transformation to colonize individual assemblies.
  • re-TALEs were optimized at different levels to facilitate assembly, and improve expression.
  • re-TALE DNA sequences were first co-optimized for a human codon-usage, and low mRNA folding energy at the 5' end (GeneGA, Bioconductor). The obtained sequence was evolved through several cycles to eliminate repeats (direct or inverted) longer than 1 1 bp (See Fig. 12). In each cycle, synonymous sequences for each repeat are evaluated. Those with the largest hamming distance to the evolving DNA are selected.
  • the sequence of one of re-TALE possessing 16.5 monomers as follows
  • TALEs may be used having at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to the above sequence.
  • One of skill will readily understand where the above sequence may vary while still maintaining the DNA binding activity of the TALE.
  • re-TALE dimer blocks encoding two RVDs were generated by two rounds of PCR under standard Kapa HIFI (KPAP) PCR conditions, in which the first round of PCR introduced the RVD coding sequence and the second round of PCR generated the entire dimer blocks with 36bp overlaps with the adjacent blocks.
  • PCR products were purified using QIAquick 96 PCR Purification Kit (QIAGEN) and the concentrations were measured by Nano-drop.
  • the primer and template sequences are listed in Table 1 and Table 2 below.
  • blcok7-R GAGGCCGTGCGCTTGACAGAGGACGGGAAGTAACCTCT*G*C re-TALENs and re-TALE-TF destination vectors were constructed by modifying the TALE-TF and TALEN cloning backbones (see reference 24 hereby incorporated by reference in its entirety). The 0.5 RVD regions on the vectors were re-coded and Sapl cutting site was incorporated at the designated re-TALE cloning site. The sequences of re-TALENs and re-TALE-TF backbones are provided in Fig. 20. Plasmids can be pre-treated with Sapl (New England Biolabs) with manufacturer recommended conditions and purified with QIAquick PCR purification kit (QIAGEN).
  • a (lOul) one-pot TASA assembly reaction was carried out with 200ng of each block, 500ng destination backbone, IX TASA enzyme mixture (2U Sapl, 100U Ampligase (Epicentre), lOmU T5 exonuclease (Epicentre), 2.5U Phusion DNA polymerase (New England Biolabs)) and IX isothermal assembly reaction buffer as described before (see reference 25 hereby incorporated by reference in its entirety) (5% PEG-8000, 100 mM Tris-HCl pH 7.5, 10 mM MgC12, 10 mM DTT, 0.2 mM each of the four dNTPs and 1 mM NAD). Incubations were performed at 37°C for 5min and 50 °C for 30 min.
  • TASA assembly reaction can be processed directly for bacterial transformation to colonize individual assemblies.
  • the efficiency of obtaining full length construct is -20% with this approach.
  • >90% efficiency can be achieved by a three-step assembly.
  • IX re- TALE assembly reactions are performed with 200ng of each block, IX re- TALE enzyme mixture (100U Ampligase, 12.5mU T5 exonuclease, 2.5U Phusion DNA polymerase) and IX isothermal assembly buffer at 50°C for 30min, followed by standardized Kapa HIFI PCR reaction, agarose gel electrophoresis, and QIAquick Gel extraction (Qiagen) to enrich the full length re-TALEs.
  • IX re- TALE enzyme mixture 100U Ampligase, 12.5mU T5 exonuclease, 2.5U Phusion DNA polymerase
  • IX isothermal assembly buffer at 50°C for 30min
  • 200ng re-TALE amplicons can then be mixed with 500ng Sapl-pre- treated destination backbone, IX re-TALE assembly mixture and IX isothermal assembly reaction buffer and incubated at 50 °C for 30 min.
  • the re-TALE final assembly reaction can be processed directly for bacterial transformation to colonize individual assemblies.
  • endonucleases, exonucleases, polymerases and ligases from among those known to practice the methods described herein.
  • type lis endonucleases can be used, such as: Fok 1, Bts I, Ear I, Sap I.
  • Exonucleases which are titralable can be used, such as lamda exonuclease, T5 exonuclease and Exonuclease III.
  • Non-hotstart polymerases can be used, such as phusion DNA polymerase, Taq DNA polymerase and VentR DNA polymerase.
  • Thermostable ligases can be used in this reaction, such as Ampligase, pfu DNA ligase, Taq DNA ligase.
  • different reaction conditions can be used to activate such endonucleases, exonucleases, polymerases and ligases depending on the particular species used. EXAMPLE III
  • PGP1 iPS cells were maintained on Matrigel (BD Biosciences)-coated plates in mTeSRl (Stemcell Technologies). Cultures were passaged every 5-7 days with TrypLE Express (Invitrogen). 293T and 293FT cells were grown and maintained in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) high glucose supplemented with 10% fetal bovine serum (FBS, Invitrogen), penicillin/streptomycin (pen/strep, Invitrogen), and non-essential amino acids (NEAA, Invitrogen).
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • pen/streptomycin penicillin/streptomycin
  • NEAA non-essential amino acids
  • K562 cells were grown and maintained in RPMI (Invitrogen) supplemented with 10% fetal bovine serum (FBS, Invitrogen 15%) and penicillin/streptomycin (pen/strep, Invitrogen). All cells were maintained at 37°C and 5% C02 in a humidified incubator.
  • RPMI Invitrogen
  • pen/strep penicillin/streptomycin
  • a stable 293T cell line for detecting HDR efficiency was established as described in reference 26 hereby incorporated by reference in its entirety. Specifically, the reporter cell lines bear genomically integrated GFP coding sequences disrupted by the insertion of a stop codon and a 68bp genomic fragment derived from the AAVS l locus.
  • 293T reporter cells were seeded at densities of 2 ⁇ 105 cells per well in 24-well plate and transfected them with ⁇ g of each re-TALENs plasmid and 2 ⁇ g DNA donor plasmid using Lipofectamine 2000 following the manufacturer's protocols.
  • Cells were harvested using TrypLE Express (Invitrogen) —18 h after transfection and resuspended in 200 ⁇ of media for flow cytometry analysis using an LSRFortessa cell analyzer (BD Biosciences). The flow cytometry data were analyzed using FlowJo (FlowJo). At least 25,000 events were analyzed for each transfection sample.
  • the transfection procedures were identical as described above and puromycin selection was conducted with drug concentration at 3 ⁇ g/ml 1 week after transfection.
  • the lentiviral vectors were created by standard PCR and cloning techniques.
  • the lentiviral plasmids were transfected by Lipofectamine 2000 with Lentiviral Packaging Mix (Invitrogen) into cultured 293FT cells (Invitrogen) to produce lentivirus.
  • Supernatant was collected 48 and 72h post- transfection, sterile filtered, and lOOul filtered supernatant was added to 5 x 105 fresh 293T cells with polybrene.
  • lentivirus transduced 293T cells were transfected with 30 ng plasmids carrying mCherry reporter and 500ng pUC19 plasmids using Lipofectamine 2000 (Invitrogen).
  • Cell images were analyzed using Axio Observer Z. l (Zeiss) 18 hours after transfection and harvested using TrypLE Express (Invitrogen) and resuspended in 200 ⁇ of media for flow cytometry analysis using a LSRFortessa cell analyzer (BD Biosciences). The flow cytometry data were analyzed using BD FACSDiva (BD Biosciences).
  • PGP1 iPSCs were cultured in Rho kinase (ROCK) inhibitor Y-27632 (Calbiochem) 2h before nucleofection. Transfections were done using P3 Primary Cell 4D-Nucleofector X Kit (Lonza). Specifically, cells were harvested using TrypLE Express (Invitrogen) and 2x 106 cells were resuspended in 20 ⁇ nucleofection mixture containing 16.4 ⁇ P3 Nucleofector solution, 3.6 ⁇ supplement, ⁇ g of each re-TALENs plasmid or lug Cas9 and lug gRNA construct, 2 ⁇ 1 of 100 ⁇ ssODN.
  • ROCK Rho kinase
  • reaction products were then added to 20 ⁇ of PCR mix containing 12.5 ⁇ 2X KAPA HIFI Hotstart Readymix (KAPA Biosystems) and 200 nM primers carrying Illumina sequence adaptors. Reactions were incubated at 95°C for 5min followed by 25 cycles of 98°C, 20s; 65°C, 20s and 72°C, 20s.
  • PCR products were purified by QIAquick PCR purification kit, mixed at roughly the same concentration, and sequenced with MiSeq Personal Sequencer. The PCR primers are listed in Table 5 below.
  • CAAGCAGAAGACGGCATACGAGATN1N2N3N4N5N6GTGAC illumina Index-PCR TGGAGTTCAGACGTGTGCTCTTCCGATCT
  • Barcode splitting Groups of samples were pooled together and sequenced using MiSeq 150bp paired end (PE150) (Illumina Next Gen Sequencing), and later separated based on DNA barcodes using FASTX Toolkit.
  • BLAT was used to map the paired reads independently to the reference genome and .psl files were generated as output.
  • Indels were defined as the full length reads containing 2 blocks of matches in the alignment. Only reads following this pattern in both paired end reads were considered. As a quality control, the indel reads were required to possess minimal 70nt matching with the reference genome and both blocks to be at least 20 nt long. Size and position of indels were calculated by the positions of each block to the reference genome.
  • NHEJ Non-homologous end joining
  • Homology directed recombination (HDR) efficiency Pattern matching (grep) within a
  • C reads containing only 1 bp mutation in the target site: such as XXXXXaBXXXX or XXXXXAbXXXXX
  • iPS cells on feeder- free cultures were pre-treated with mTesr-1 media supplemented with SMC4 (5 uM thiazovivin, 1 uM CHIR99021, 0.4 uM PD0325901, 2 uM SB431542) (see reference 23 hereby incorporated by reference in its entirety for at least 2 hrs prior to FACS sorting.
  • Cultures were dissociated using Accutase (Millipore) and resuspended in mTesr- 1 media supplemented with SMC4 and the viability dye ToPro-3 (Invitrogen) at concentration of 1-2 XI 07 /mL.
  • Live hiPS cells were single-cell sorted using a BD FACSAria II SORP UV (BD Biosciences) with 1 OOum nozzle under sterile conditions into 96-well plates coated with irradiated CF-1 mouse embryonic fibroblasts (Global Stem). Each well contained hES cell medium (see reference 31 hereby incorporated by reference in its entirety) with 100 ng / ml recombinant human basic Fibroblast Growth Factor (bFGF) (Millipore) supplemented with SMC4 and 5 ug / ml fibronectin (Sigma). After sorting, plates were centrifuged at 70 x g for 3 min. Colony formation was seen 4 days post sorting, and the culture media was replaced with hES cell medium with SMC4. SMC4 can be removed from hES cell medium 8 days after sorting.
  • bFGF human basic Fibroblast Growth Factor
  • human iPSCs were harvested using collagenase type IV (Invitrogen) and the cells were resuspended into 200 ⁇ of Matrigel and injected intramuscularly into the hind limbs of Rag2gamma knockout mice. Teratomas were isolated and fixed in formalin between 4 - 8 weeks after the injection. The teratomas were subsequently analyzed by hematoxylin and eosin staining.
  • TALEs known to those of skill in the art are modified or re- coded to eliminate repeat sequences.
  • TALEs suitable for modification and use in the genome editing methods in viral delivery vehicles and in various cell lines and organisms described herein are disclosed in references 2, 7- 12 hereby incorporated by reference herein in their entireties.
  • Several strategies have been developed to assemble the repetitive TALE RVD array sequences (see references 14 and 32-34 hereby incorporated by reference herein in their entireties.
  • the TALE sequence repeats remain unstable, which limits the wide utility of this tool, especially for viral gene delivery vehicles (see references 13 and 35 hereby incorporated by reference herein in their entireties.
  • one aspect of the present disclosure is directed to TALEs lacking repeats, such as completely lacking repeats.
  • Such a re-coded TALE is advantageous because it enables faster and simpler synthesis of extended TALE RVD arrays.
  • Re-coded TALE encoding 16 tandem RVD DNA recognition monomers, plus the final half RVD repeat, are devoid of any 12bp repeats (see Fig. 5a). Notably, this level of recoding is sufficient to allow PCR amplification of any specific monomer or subsection from a full-length re-TALE construct (see Fig. 5b).
  • the improved design of re-TALEs may be synthesized using standard DNA synthesis technology (see reference 36 hereby incorporated by reference in its entirety without incurring the additional costs or procedures associated with repeat- heavy sequences.
  • Genome editing NGS data was statistically analyzed as follows.
  • HDR specificity analysis an exact binomial test was used to compute the probabilities of observing various numbers of sequence reads containing the 2bp mismatch.
  • the maximum base change rates of the two windows 5 (PI and P2) were estimated.
  • P1 *P2 the expected probability of observing 2bp mismatch at the targeting site by chance as the product of these two probabilities
  • MI mutual information
  • the HDR detection limit was estimated as the smallest HDR where MI of the targeting 2bp site is higher than MI of all the other position pairs.
  • MI Mutual information
  • telomeres The function of reTALEN in comparison with the corresponding non-recoded TALEN in human cells was determined.
  • a HEK 293 cell line containing a GFP reporter cassette carrying a frame-shifting insertion was used as described in reference 37 hereby incorporated by reference in its entirety. See also Fig. la. Delivery of TALENs or reTALENs targeting the insertion sequence, together with a promoter-less GFP donor construct, leads to DSB-induced HDR repair of the GFP cassette, so that GFP repair efficiency can be used to evaluate the nuclease cutting efficiency. See reference 38 hereby incorporated by reference in its entirety.
  • reTALENs induced GFP repair in 1.4% of the transfected cells similar to that achieved by TALENs (1.2%) (see Fig. lb).
  • the activity of reTALENs at the AAVS 1 locus in PGP 1 hiPSCs was tested (see Fig. lc) and successfully recovered cell clones containing specific insertions (see Fig. ld,e), confirming that reTALENs are active in both somatic and pluripotent human cells.
  • lentiviral particles were packaged encoding re-TALE-2A-GFP and were tested for activity of the re-TALE-TF encoded by viral particles by transfecting a mCherry reporter into a pool of lenti-reTALE-2A-GFP infected 293T cells.
  • 293T cells transduced by lenti-re-TALE-TF showed 36X reporter expression activation compared with the reporter only negative (see Fig. 7a,b,c).
  • the sequence integrity of the re-TALE-TF in the lentiviral infected cells was checked and full-length reTALEs in all 10 of the clones tested were detected, (see Fig. 7d).
  • a next- generation sequencing platform (Genome Editing Assessment System) was developed to identify and quantify both NHEJ and HDR gene editing events.
  • a re-TALEN pair and a Cas9-gRNA were designed and constructed, both targeting the upstream region of CCR5 (re-TALEN, Cas9-gRNA pair #3 in Table 3), along with a 90nt ssODN donor identical to the target site except for a 2bp mismatch (see Fig. 2a).
  • the nuclease constructs and donor ssODN were transfected into hiPSCs.
  • HDR efficiency was measured by the percentage of reads containing the precise 2bp mismatch.
  • NHEJ efficiency was measured by the percentage of reads carrying indels.
  • re-TALEN pairs and Cas9-gRNAs targeted to fifteen sites at the CCR5 genomic locus were built to determine editing efficiency (see Fig. 2c, see Table 3). These sites were selected to represent a wide range of DNasel sensitivities (see reference 39 hereby incorporated by reference in its entirety.
  • the nuclease constructs were transfected with the corresponding ssODNs donors (see Table 3) into PGP1 hiPSCs. Six days after transfection, the genome editing efficiencies at these sites were profiled (Table 6).
  • Highly-performing ssODNs in hiPSCs were designed as follows. A set of ssODNs donors of different lengths (50-170nt), all carrying the same 2bp mismatch in the middle of the spacer region of the CCR5 re-TALEN pair #3 target sites was designed. HDR efficiency was observed to vary with ssODN length, and an optimal HDR efficiency of -1.8% was observed with a 90 nt ssODN , whereas longer ssODNs decreased HDR efficiency (see Fig. 3 a).
  • the low level of incorporation that was observed may be due to processes unrelated to the dsDNA cut, as seen in experiments in which genomes are altered by a ssDNA donor alone see reference 42 hereby incorporated by reference in its entirety. Meanwhile, the low level of HDR present when the ssODN is ⁇ 40bp away may be due to a combination of weakened homology on the mismatch-containing side of the dsDNA cut along with insufficient ssODN oligo length on the other side of the dsDNA break.
  • the ssODNs DNA donor design for Cas9-gRNA mediated targeting was tested.
  • Cas9- gRNA (C2) targeting the AAVS 1 locus was constructed and ssODN donors of variable orientations (Oc: complementary to the gRNA and On: non-complementary to the gRNA) and lengths (30, 50, 70, 90, 1 10 nt) were designed.
  • Oc achieved better efficiency than On, with a 70mer Oc achieving an optimal HDR rate of 1.5%.
  • GEAS revealed that re-TALEN pair #3 achieved precise genome editing with an efficiency of ⁇ 1% in hiPSCs, a level at which correctly edited cells can usually be isolated by screening clones.
  • HiPSCs have poor viability as single cells.
  • Optimized protocols described in reference 23 hereby incorporated by reference in its entirety along with a single-cell FACS sorting procedure was used to establish a robust platform for single hiPSCs sorting and maintenance, where hiPSC clones can be recovered with survival rates of >25%.
  • This method was combined with a rapid and efficient genotyping system to conduct chromosomal DNA extraction and targeted genome amplification in 1-hour single tube reactions, enabling large scale genotyping of edited hiPSCs. Together, these methods comprise a pipeline for robustly obtaining genome-edited hiPSCs without selection.
  • a method for genome editing in cells including a human cell, for example a human stem cell, wherein the cell is genetically modified to include a nucleic acid encoding an enzyme that forms a co-localization complex with RNA complementary to the target DNA and that cleaves the target DNA in a site specific manner.
  • an enzyme includes an RNA guided DNA binding protein, such as an RNA-guided DNA binding protein of a Type II CRISPR system.
  • An exemplary enzyme is Cas9.
  • the cell expresses the enzyme and guide RNA is provided to the cell from the media surrounding the cell. The guide RNA and the enzyme form a co-localization complex at target DNA where the enzyme cuts the DNA.
  • a donor nucleic acid may be present for insertion into the DNA at the cut site, for example by nonhomologous end joining or homologous recombination.
  • the nucleic acid encoding an enzyme that forms a co-localization complex with RNA complementary to the target DNA and that cleaves the target DNA in a site specific manner, such as Cas9 is under the influence of a promoter, such as the nucleic acid can be activated and silenced.
  • a promoter such as the nucleic acid can be activated and silenced.
  • promoters are well known to those of skill in the art.
  • One exemplary promoter is the dox inducible promoter.
  • the cell is genetically modified by having reversibly inserted into its genome the nucleic acid encoding an enzyme that forms a co- localization complex with RNA complementary to the target DNA and that cleaves the target DNA in a site specific manner.
  • the nucleic acid can be removed by use of a reagent, such as a transposase. In this manner, the nucleic acid can be easily removed after use.
  • a continuous genome editing system in human induced pluripotent stem cells (hiPSCs) using a CRISPR system includes use of a hiPSC line with Cas9 reversibly inserted in the genome (Cas9- hiPSCs); and gRNAs which have been modified from their native form to allow their passage from media surrounding the cells into the cells for use with the Cas9.
  • Such gRNA has been treated with a phosphatase in a manner to remove phosphate groups.
  • Genome editing in the cell is carried out with Cas9 by supplementing phosphatase treated gRNA in the tissue culture media.
  • Embodiments of the present disclosure include single editing of hiPSCs for biological research and therapeutic applications, multiplex editing of hiPSCs for biological research and therapeutic applications, directional hiPSCs evolution and phenotype screening of hiPSCs and its derivative cells.
  • other cell lines and organisms described herein can be used in addition to stem cells.
  • the method described herein can be used to animal cells such as mouse or rat cells so that stable Cas9 integrated mouse cells and rat cells can be generated and tissue specific genome editing can be conducted by locally introducing phosphatase treated gRNA from media surrounding the cells.
  • other Cas9 derivatives can be inserted into many cell lines and organisms, and targeted genomic manipulations, such as sequence specific nicking, gene activation, suppression and epigenetic modification can be conducted.
  • aspects of the present disclosure are directed to making stable hiPSCs with Cas9 inserted into the genome.
  • aspects of the present disclosure are directed to modifying RNA to enable entry into a cell through the cell wall and co-localization with Cas9 while avoiding the immune response of the cell.
  • Such modified guide RNA can achieve optimal transfection efficiencies with minimal toxicity.
  • aspects of the present disclosure are directed to optimzied genome editing in Cas9- hiPSCs using phosphatase treated gRNA.
  • aspects of the present disclosure include eliminating Cas9 from hiPSCs to achieve scarless genome editing, where the nucleic acid encoding Cas9 has been reversibly placed into the cell genome.
  • aspects of the present disclosure include biomedical engineering using hiPSCs with Cas9 inserted into the genome to create desired genetic mutations.
  • Such engineered hiPSCs maintain pluripotency and can be successfully differentiated into various cell types, including cardiomyocyte, which fully recapitulate the phenotype of patient cell lines.
  • aspects of the present disclosure include libraries of phosphatase treated gRNAs for multiplex genome editing. Aspects of the present disclosure include generating a library of PGP cell lines with each one carrying 1 to a few designated mutations in the genome, which can serve as resource for drug screening. Aspects of the present disclosure include generating PGP 1 cell lines with all the retrotranselements barcoded with different sequences to track the location and activity of this element.
  • Cas9 was encoded under the dox inducible promoter and the construct was placed into a Piggybac vector which can be inserted into and removed out of the genome with the help of Piggybac transposase. PCR reaction validated the stable insertion of the vector (see Fig. 14). The inducible Cas9 expression was determined via RT-QPCR. The mRNA level of Cas9 increased 1000X after 8 hours of lug/mL DOX supplementation in the culture media and the level of Cas9 mRNA dropped to normal level ⁇ 20 hours after withdrawal of the DOX. (See Fig. 15).
  • the Cas9-hiPSC system based genome editing bypasses the transfection procedure of Cas9 plasmid/RNA, a large construct usually with ⁇ 1% transfection efficiency in hiPSCs.
  • the present Cas9-hiPSC system can serve as a platform to perform high efficient genomic engineering in human stem cells.
  • the Cas9 cassette introduced into the hiPSCs using Piggybac system can be removed out from the genome easily upon introducing of transposases.
  • RNA encoding gRNA was generated and supplemented into Cas9-iPS culture medium in complex with liposome.
  • Phosphatase treated native RNA without any capping achieved the optimal HDR efficiency of 13%, 30X more than previously reported 5'Cap-Mod RNA (see Fig. 16).
  • guide RNA is physically attached to the donor DNA.
  • a method is provided of coupling Cas9 mediated genomic cutting and ssODN-mediated HDR, thus stimulating sequence specific genomic editing.
  • gRNA linked with DNA ssODN donor with optimized concentration achieved 44% HDR and unspecific NHEJ 2% (see Fig. 17).
  • this procedure does not incurred visible toxicity as observed with nucleofection or electroporation.
  • the present disclosure provides an in vitro engineered RNA structure encoding gRNA, which achieved high transfection efficiency, genome editing efficiency in collaboration with genomically inserted Cas9.
  • the present disclosure provides a gRNA-DNA chimeric construct to couple a genomic cutting event with the homology directed recombination reaction.
  • a Cas9 cassette is inserted into the genome of hiPSC cells using a reversible vector. Accordingly, a Cas9 cassette was reversibly inserted into the genome of hiPSC cells using a PiggyBac vector. The Cas9 cassette was removed from the genome edited hiPSCs by transfecting the cell with transposase-encoding plasmid. Accordingly, aspects of the present disclosure include use of a reversible vector, which is known to those of skill in the art. A reversible vector is one which can be inserted into a genome, for example, and then removed with a corresponding vector removal enzyme.
  • Such vectors and corresponding vector removal enzymes are known to those of skill in the art.
  • a screen was performed on colonized iPS cells and colonies devoid of Cas9-cassette were recovered as confirmed by PCR reaction. Accordingly, the present disclosure provides method of genome editing without affecting the rest of the genome by having a permanent Cas9 cassette present in the cell.
  • iPSCs patient- derived induced pluripotent stem cells
  • Cas9-iPGPl cell lines and phosphatase treated guide RNA bound to DNA were used to generated three iPSC lines that are isogenic except for the sequence at TAZ exon 6, which was identified to carry single nucleotide deletion in Barth syndrome patients. Single round of RNA transfection achieved -30% HDR efficiency.
  • Modified Cas9-iPGPl cells with desired mutations were colonized (see Fig. 18) and the cell lines were differentiated into cardiomyocyte. Cardiomyocyte derived from the engineered Cas9-iPGPl fully recapitulated the cardiolipin, mitochondrial, and ATP deficits observed in patient-derived iPSCs and in the neonatal rat TAZ knockdown model (see Fig. 19). Accordingly, methods are provided for correcting mutations causing diseases in pluripotent cells followed by differentiation of the cells into desired cell types.
  • Aspirate mTeSRl gently rinse the cells with DPBS at 2 mL/well of a six-well plate. Aspirate the DPBS, add 2 mL/well of Versene, and put the culture back to incubator at 37°C until they become rounded up and loosely adherent, but not detached. This requires 3-7 min.
  • Programs B-016 was selected and nucleofect cells by pressing button X.
  • RNA preparation Change the medium to mTesrl the next day and after 72 hours of transfection;add puromycin at final concentration at lug/ml. And the line will be set up within 7 days. .
  • RNA Purify RNA using MEGAclear. (Purified RNA can be stored at -80 for several months).
  • TALE nucleases Genetic engineering of human pluripotent cells using TALE nucleases. ssolino,C, Morbitzer,R., Lutge,F., Dannemann,N., Lahaye,T. and Cathomen,T. (201 1) A novel TALE nuclease scaffold enables high genome editing activity in combination with low toxicity. Nucleic acids research, 39, 9283-93. g,Q., Lee,Y., Schaefer,E.A.K., Peters,D.T., Veres,A., Kim,K., Kuperwasser,N., Motola,D.L.,
  • Penheiter,S.G. Ma,A.C, Leung,A.Y.H., et al. (2012) In vivo genome editing using a high- efficiency TALEN system. Nature, 490, 1 14-1 18. iller,J.C, Tan,S., Qiao,G., Barlow,K. a, Wang,J., Xia,D.F., Meng,X., Paschon,D.E.,
  • TALE nuclease architecture for efficient genome editing. Nature biotechnology, 29, 143-8. olkers,M., Maggio,L, Liu,J., Janssen,J.M., Miselli,F., Mussolino,C, Recchia,A., Cathomen,T. and Goncalves,M. a F. V (2012) Differential integrity of TALE nuclease genes following adenoviral and lentiviral vector gene transfer into human cells. Nucleic acids research, 10.1093/nar/gksl446. eyon,D., Tsai,S.Q., Khayter,C, Foden,J.
  • Double-stranded break can be repaired by single-stranded oligonucleotides via the ATM/ATR pathway in mammalian cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Transplantation (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Saccharide Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2014/048140 2013-07-26 2014-07-25 Genome engineering Ceased WO2015013583A2 (en)

Priority Applications (24)

Application Number Priority Date Filing Date Title
EP23164284.4A EP4234703A3 (en) 2013-07-26 2014-07-25 Genome engineering
KR1020167004663A KR102773555B1 (ko) 2013-07-26 2014-07-25 게놈 조작
ES14829377T ES2715666T3 (es) 2013-07-26 2014-07-25 Ingeniería genómica
NZ716606A NZ716606B2 (en) 2013-07-26 2014-07-25 Genome engineering
SG11201600217QA SG11201600217QA (en) 2013-07-26 2014-07-25 Genome engineering
EP21176056.6A EP3916099B1 (en) 2013-07-26 2014-07-25 Genome engineering
JP2016530062A JP6739335B2 (ja) 2013-07-26 2014-07-25 ゲノムエンジニアリング
HK16106842.9A HK1218940B (en) 2013-07-26 2014-07-25 Genome engineering
CN202410183863.0A CN118028379A (zh) 2013-07-26 2014-07-25 基因组工程
KR1020237020511A KR20230096134A (ko) 2013-07-26 2014-07-25 게놈 조작
US14/907,605 US9914939B2 (en) 2013-07-26 2014-07-25 Genome engineering
EP14829377.2A EP3024964B1 (en) 2013-07-26 2014-07-25 Genome engineering
EP18212761.3A EP3483277B1 (en) 2013-07-26 2014-07-25 Genome engineering
RU2016106649A RU2688462C2 (ru) 2013-07-26 2014-07-25 Геномная инженерия
AU2014293015A AU2014293015B2 (en) 2013-07-26 2014-07-25 Genome engineering
CN202010094041.7A CN111304230B (zh) 2013-07-26 2014-07-25 基因组工程
CN201480042306.1A CN105473773B (zh) 2013-07-26 2014-07-25 基因组工程
BR112016001721-8A BR112016001721B1 (pt) 2013-07-26 2014-07-25 Método in vitro de alteração do dna-alvo em célula-tronco tendo ácido nucleico que codifica enzima cas9
CA2918540A CA2918540A1 (en) 2013-07-26 2014-07-25 Methods of altering target dna in cells, and corresponding cells
IL243560A IL243560B (en) 2013-07-26 2016-01-11 Genome engineering
AU2018278911A AU2018278911C1 (en) 2013-07-26 2018-12-12 Genome engineering
IL272193A IL272193B (en) 2013-07-26 2020-01-22 Genome engineering
AU2021202581A AU2021202581B2 (en) 2013-07-26 2021-04-27 Genome engineering
AU2023248167A AU2023248167A1 (en) 2013-07-26 2023-10-13 Genome engineering

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361858866P 2013-07-26 2013-07-26
US61/858,866 2013-07-26

Publications (3)

Publication Number Publication Date
WO2015013583A2 true WO2015013583A2 (en) 2015-01-29
WO2015013583A8 WO2015013583A8 (en) 2015-03-05
WO2015013583A3 WO2015013583A3 (en) 2015-04-23

Family

ID=52390824

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/048140 Ceased WO2015013583A2 (en) 2013-07-26 2014-07-25 Genome engineering

Country Status (13)

Country Link
US (4) US10563225B2 (cg-RX-API-DMAC7.html)
EP (4) EP3483277B1 (cg-RX-API-DMAC7.html)
JP (4) JP6739335B2 (cg-RX-API-DMAC7.html)
KR (2) KR102773555B1 (cg-RX-API-DMAC7.html)
CN (3) CN105473773B (cg-RX-API-DMAC7.html)
AU (4) AU2014293015B2 (cg-RX-API-DMAC7.html)
BR (1) BR112016001721B1 (cg-RX-API-DMAC7.html)
CA (1) CA2918540A1 (cg-RX-API-DMAC7.html)
ES (1) ES2715666T3 (cg-RX-API-DMAC7.html)
IL (2) IL243560B (cg-RX-API-DMAC7.html)
RU (2) RU2688462C2 (cg-RX-API-DMAC7.html)
SG (3) SG11201600217QA (cg-RX-API-DMAC7.html)
WO (1) WO2015013583A2 (cg-RX-API-DMAC7.html)

Cited By (84)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9068179B1 (en) 2013-12-12 2015-06-30 President And Fellows Of Harvard College Methods for correcting presenilin point mutations
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US9322006B2 (en) 2011-07-22 2016-04-26 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
WO2016150855A1 (en) * 2015-03-20 2016-09-29 Danmarks Tekniske Universitet Crispr/cas9 based engineering of actinomycetal genomes
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9546384B2 (en) 2013-12-11 2017-01-17 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse genome
WO2017186550A1 (en) * 2016-04-29 2017-11-02 Basf Plant Science Company Gmbh Improved methods for modification of target nucleic acids
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
WO2018049168A1 (en) 2016-09-09 2018-03-15 The Board Of Trustees Of The Leland Stanford Junior University High-throughput precision genome editing
US9938521B2 (en) 2014-03-10 2018-04-10 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10)
US9982279B1 (en) 2017-06-23 2018-05-29 Inscripta, Inc. Nucleic acid-guided nucleases
US9982278B2 (en) 2014-02-11 2018-05-29 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10011849B1 (en) 2017-06-23 2018-07-03 Inscripta, Inc. Nucleic acid-guided nucleases
US10017760B2 (en) 2016-06-24 2018-07-10 Inscripta, Inc. Methods for generating barcoded combinatorial libraries
CN108368520A (zh) * 2015-11-04 2018-08-03 菲特治疗公司 多能细胞的基因组工程改造
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
EP3464594A1 (en) * 2016-06-01 2019-04-10 Kws Saat Se Hybrid nucleic acid sequences for genome engineering
US10337001B2 (en) 2014-12-03 2019-07-02 Agilent Technologies, Inc. Guide RNA with chemical modifications
US10385359B2 (en) 2013-04-16 2019-08-20 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10428319B2 (en) 2017-06-09 2019-10-01 Editas Medicine, Inc. Engineered Cas9 nucleases
US10428310B2 (en) 2014-10-15 2019-10-01 Regeneron Pharmaceuticals, Inc. Methods and compositions for generating or maintaining pluripotent cells
EP3383409A4 (en) * 2015-12-02 2019-10-02 The Regents of The University of California COMPOSITIONS AND METHOD FOR MODIFYING A TARGET NUCLEIC ACID
US10457960B2 (en) 2014-11-21 2019-10-29 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10767175B2 (en) 2016-06-08 2020-09-08 Agilent Technologies, Inc. High specificity genome editing using chemically modified guide RNAs
EP3541945A4 (en) * 2016-11-18 2020-12-09 Genedit Inc. COMPOSITIONS AND METHODS OF MODIFICATION OF TARGET NUCLEIC ACIDS
US11028388B2 (en) 2014-03-05 2021-06-08 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa
US11130999B2 (en) 2017-07-31 2021-09-28 Regeneron Pharmaceuticals, Inc. Cas-ready mouse embryonic stem cells and mice and uses thereof
US11141493B2 (en) 2014-03-10 2021-10-12 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US11180793B2 (en) 2015-04-24 2021-11-23 Editas Medicine, Inc. Evaluation of Cas9 molecule/guide RNA molecule complexes
US11236313B2 (en) 2016-04-13 2022-02-01 Editas Medicine, Inc. Cas9 fusion molecules, gene editing systems, and methods of use thereof
US11242525B2 (en) 2014-03-26 2022-02-08 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating sickle cell disease
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11268092B2 (en) 2018-01-12 2022-03-08 GenEdit, Inc. Structure-engineered guide RNA
US11306309B2 (en) 2015-04-06 2022-04-19 The Board Of Trustees Of The Leland Stanford Junior University Chemically modified guide RNAs for CRISPR/CAS-mediated gene regulation
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11339437B2 (en) 2014-03-10 2022-05-24 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US11390884B2 (en) 2015-05-11 2022-07-19 Editas Medicine, Inc. Optimized CRISPR/cas9 systems and methods for gene editing in stem cells
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11499151B2 (en) 2017-04-28 2022-11-15 Editas Medicine, Inc. Methods and systems for analyzing guide RNA molecules
US11512311B2 (en) 2016-03-25 2022-11-29 Editas Medicine, Inc. Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US20230002760A1 (en) * 2015-03-25 2023-01-05 Editas Medicine, Inc. Crispr/cas-related methods, compositions and components
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11566263B2 (en) 2016-08-02 2023-01-31 Editas Medicine, Inc. Compositions and methods for treating CEP290 associated disease
US11597924B2 (en) 2016-03-25 2023-03-07 Editas Medicine, Inc. Genome editing systems comprising repair-modulating enzyme molecules and methods of their use
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11667911B2 (en) 2015-09-24 2023-06-06 Editas Medicine, Inc. Use of exonucleases to improve CRISPR/CAS-mediated genome editing
US11680268B2 (en) 2014-11-07 2023-06-20 Editas Medicine, Inc. Methods for improving CRISPR/Cas-mediated genome-editing
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US11884915B2 (en) 2021-09-10 2024-01-30 Agilent Technologies, Inc. Guide RNAs with chemical modification for prime editing
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11911415B2 (en) 2015-06-09 2024-02-27 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for improving transplantation
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11920128B2 (en) 2013-09-18 2024-03-05 Kymab Limited Methods, cells and organisms
US11963982B2 (en) 2017-05-10 2024-04-23 Editas Medicine, Inc. CRISPR/RNA-guided nuclease systems and methods
WO2024105633A1 (en) 2022-11-18 2024-05-23 Kyoto Prefectural Public University Corporation Compositions for mitophagy induction and uses thereof
US12031132B2 (en) 2018-03-14 2024-07-09 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
US12058986B2 (en) 2017-04-20 2024-08-13 Egenesis, Inc. Method for generating a genetically modified pig with inactivated porcine endogenous retrovirus (PERV) elements
US12110545B2 (en) 2017-01-06 2024-10-08 Editas Medicine, Inc. Methods of assessing nuclease cleavage
US12123033B2 (en) 2019-10-24 2024-10-22 Integrated Dna Technologies, Inc. Modified double-stranded donor templates
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12201699B2 (en) 2014-10-10 2025-01-21 Editas Medicine, Inc. Compositions and methods for promoting homology directed repair
US12254959B2 (en) 2019-07-03 2025-03-18 Integrated Dna Technologies, Inc. Identification, characterization, and quantitation of CRISPR-introduced double-stranded DNA break repairs
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12286727B2 (en) 2016-12-19 2025-04-29 Editas Medicine, Inc. Assessing nuclease cleavage
US12338436B2 (en) 2018-06-29 2025-06-24 Editas Medicine, Inc. Synthetic guide molecules, compositions and methods relating thereto
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12416015B2 (en) 2017-09-15 2025-09-16 The Board Of Trustees Of The Leland Stanford Junior University Multiplex production and barcoding of genetically engineered cells
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12460231B2 (en) 2014-04-02 2025-11-04 Editas Medicine, Inc. Crispr/CAS-related methods and compositions for treating primary open angle glaucoma
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12509680B2 (en) 2023-05-31 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences

Families Citing this family (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT2847335T (pt) 2012-04-25 2018-09-28 Regeneron Pharma Alvejamento mediado por nuclease com vetores de alvejamento grandes
SG10201704932UA (en) 2012-12-17 2017-07-28 Harvard College Rna-guided human genome engineering
CN115261411A (zh) 2013-04-04 2022-11-01 哈佛学院校长同事会 利用CRISPR/Cas系统的基因组编辑的治疗性用途
EP3019595A4 (en) 2013-07-09 2016-11-30 THERAPEUTIC USES OF A GENERIC CHANGE WITH CRISPR / CAS SYSTEMS
EP3155116A4 (en) 2014-06-10 2017-12-27 Massachusetts Institute Of Technology Method for gene editing
WO2016065364A1 (en) * 2014-10-24 2016-04-28 Life Technologies Corporation Compositions and methods for enhancing homologous recombination
US12180263B2 (en) 2014-11-06 2024-12-31 President And Fellows Of Harvard College Cells lacking B2M surface expression and methods for allogeneic administration of such cells
CN116059378A (zh) 2014-12-10 2023-05-05 明尼苏达大学董事会 用于治疗疾病的遗传修饰的细胞、组织和器官
US10968426B2 (en) 2015-05-08 2021-04-06 President And Fellows Of Harvard College Universal donor stem cells and related methods
JP6968416B2 (ja) 2015-06-01 2021-11-17 テンプル ユニバーシティー オブ ザ コモンウェルス システム オブ ハイヤー エデュケーション Rna誘導性の、hiv感染の処置のための、方法および組成物
WO2016196887A1 (en) 2015-06-03 2016-12-08 Board Of Regents Of The University Of Nebraska Dna editing using single-stranded dna
US9790490B2 (en) 2015-06-18 2017-10-17 The Broad Institute Inc. CRISPR enzymes and systems
KR102840885B1 (ko) 2015-06-18 2025-07-30 더 브로드 인스티튜트, 인코퍼레이티드 표적외 효과를 감소시키는 crispr 효소 돌연변이
AU2016279062A1 (en) 2015-06-18 2019-03-28 Omar O. Abudayyeh Novel CRISPR enzymes and systems
US10166255B2 (en) 2015-07-31 2019-01-01 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
WO2017040511A1 (en) * 2015-08-31 2017-03-09 Agilent Technologies, Inc. Compounds and methods for crispr/cas-based genome editing by homologous recombination
KR101885901B1 (ko) 2015-11-13 2018-08-07 기초과학연구원 5' 말단의 인산기가 제거된 rna를 포함하는 리보핵산단백질 전달용 조성물
CA3005878A1 (en) 2015-11-19 2017-05-26 The Brigham And Women's Hospital, Inc. Lymphocyte antigen cd5-like (cd5l)-interleukin 12b (p40) heterodimers in immunity
US11441146B2 (en) * 2016-01-11 2022-09-13 Christiana Care Health Services, Inc. Compositions and methods for improving homogeneity of DNA generated using a CRISPR/Cas9 cleavage system
CN106957856B (zh) * 2016-01-12 2020-07-28 中国科学院广州生物医药与健康研究院 无毛模型猪的重构卵及其构建方法和模型猪的构建方法
US11286478B2 (en) 2016-04-19 2022-03-29 The Broad Institute, Inc. Cpf1 complexes with reduced indel activity
WO2017184768A1 (en) 2016-04-19 2017-10-26 The Broad Institute Inc. Novel crispr enzymes and systems
EP3474849B1 (en) 2016-06-27 2025-05-21 The Broad Institute, Inc. Compositions and methods for detecting and treating diabetes
US11359234B2 (en) 2016-07-01 2022-06-14 Microsoft Technology Licensing, Llc Barcoding sequences for identification of gene expression
US20180004537A1 (en) * 2016-07-01 2018-01-04 Microsoft Technology Licensing, Llc Molecular State Machines
US10669558B2 (en) 2016-07-01 2020-06-02 Microsoft Technology Licensing, Llc Storage through iterative DNA editing
EP3500669A4 (en) * 2016-08-16 2020-01-22 The Regents of the University of California METHOD FOR SEARCHING FOR LOW ABUNDANCE SEQUENCES BY HYBRIDIZATION (FLASH)
WO2018064208A1 (en) 2016-09-28 2018-04-05 The Broad Institute, Inc. Systematic screening and mapping of regulatory elements in non-coding genomic regions, methods, compositions, and applications thereof
GB2604416B (en) 2016-10-18 2023-03-15 Univ Minnesota Tumor infiltating lymphocytes and methods of therapy
WO2018089386A1 (en) 2016-11-11 2018-05-17 The Broad Institute, Inc. Modulation of intestinal epithelial cell differentiation, maintenance and/or function through t cell action
WO2018152120A1 (en) * 2017-02-14 2018-08-23 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Methods of engineering human induced pluripotent stem cells to produce liver tissue
WO2018170184A1 (en) 2017-03-14 2018-09-20 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
US12331319B2 (en) 2017-04-12 2025-06-17 The Broad Institute, Inc. Respiratory and sweat gland ionocytes
US12208140B2 (en) 2017-04-21 2025-01-28 The Broad Institute, Inc. Targeted delivery to beta cells
WO2018204777A2 (en) 2017-05-05 2018-11-08 The Broad Institute, Inc. Methods for identification and modification of lncrna associated with target genotypes and phenotypes
JP2020530307A (ja) 2017-06-30 2020-10-22 インティマ・バイオサイエンス,インコーポレーテッド 遺伝子治療のためのアデノ随伴ウイルスベクター
US11634725B2 (en) 2017-11-03 2023-04-25 University Of Florida Research Foundation, Inc. Methods and compositions for plant pathogen resistance in plants
CN112272516B (zh) 2018-04-06 2023-05-30 儿童医疗中心有限公司 用于体细胞重新编程和调整印记的组合物和方法
WO2019222545A1 (en) 2018-05-16 2019-11-21 Synthego Corporation Methods and systems for guide rna design and use
WO2019246553A1 (en) * 2018-06-21 2019-12-26 Memorial Sloan Kettering Cancer Center Compositions & methods for monitoring dna repair
EP3830256A2 (en) 2018-07-31 2021-06-09 The Broad Institute, Inc. Novel crispr enzymes and systems
AU2019398101B2 (en) 2018-12-10 2025-12-18 Amgen Inc. Mutated piggybac transposase
EP4031660A1 (en) 2019-09-20 2022-07-27 The Broad Institute, Inc. Novel type vi crispr enzymes and systems
WO2021224633A1 (en) 2020-05-06 2021-11-11 Orchard Therapeutics (Europe) Limited Treatment for neurodegenerative diseases
IL301368A (en) 2020-10-21 2023-05-01 Massachusetts Inst Technology Systems, Methods, and Compositions for Site-Specific Genetic Engineering Using Programmable Insertion Using Site-Specific Targeting Elements (PASTE)
TW202233660A (zh) 2020-10-30 2022-09-01 美商安進公司 過表現胰島素樣生長因子受體突變體以調節igf補充
WO2023077148A1 (en) 2021-11-01 2023-05-04 Tome Biosciences, Inc. Single construct platform for simultaneous delivery of gene editing machinery and nucleic acid cargo
CA3244180A1 (en) 2021-12-22 2023-06-29 Tome Biosciences, Inc. CO-ADMINISTRATION OF A GENE EDITOR CONSTRUCTION AND A PATTERN DONOR
WO2023205744A1 (en) 2022-04-20 2023-10-26 Tome Biosciences, Inc. Programmable gene insertion compositions
WO2023225670A2 (en) 2022-05-20 2023-11-23 Tome Biosciences, Inc. Ex vivo programmable gene insertion
WO2024020587A2 (en) 2022-07-22 2024-01-25 Tome Biosciences, Inc. Pleiopluripotent stem cell programmable gene insertion
WO2024138194A1 (en) 2022-12-22 2024-06-27 Tome Biosciences, Inc. Platforms, compositions, and methods for in vivo programmable gene insertion
WO2024234006A1 (en) 2023-05-11 2024-11-14 Tome Biosciences, Inc. Systems, compositions, and methods for targeting liver sinusodial endothelial cells (lsecs)
WO2025050069A1 (en) 2023-09-01 2025-03-06 Tome Biosciences, Inc. Programmable gene insertion using engineered integration enzymes
WO2025064408A1 (en) 2023-09-18 2025-03-27 The Broad Institute, Inc. Compositions and methods for treating cardiovascular disease
WO2025224107A1 (en) 2024-04-22 2025-10-30 Basecamp Research Ltd Method and compositions for detecting off-target editing
WO2025224182A2 (en) 2024-04-23 2025-10-30 Basecamp Research Ltd Single construct platform for simultaneous delivery of gene editing machinery and nucleic acid cargo

Family Cites Families (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5641670A (en) * 1991-11-05 1997-06-24 Transkaryotic Therapies, Inc. Protein production and protein delivery
KR20020086508A (ko) 2000-02-08 2002-11-18 상가모 바이오사이언스 인코포레이티드 약물 발견용 세포
CA2445398A1 (en) * 2000-05-10 2001-11-15 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Resistance to acetohydroxyacid synthase-inhibiting herbicides
CN100575485C (zh) * 2002-01-23 2009-12-30 犹他大学研究基金会 使用锌指核酸酶的定向染色体诱变
US20050032186A1 (en) 2002-12-09 2005-02-10 Kim Jin-Soo Regulatory zinc finger proteins
EP1713919A2 (en) 2004-02-13 2006-10-25 Novozymes A/S Protease variants
DE102005062662A1 (de) 2005-12-23 2007-06-28 Basf Ag Verfahren zur Herstellung optisch aktiver Alkohole
ES2719789T3 (es) 2007-03-02 2019-07-16 Dupont Nutrition Biosci Aps Cultivos con resistencia mejorada a fagos
US8546553B2 (en) 2008-07-25 2013-10-01 University Of Georgia Research Foundation, Inc. Prokaryotic RNAi-like system and methods of use
US20100076057A1 (en) 2008-09-23 2010-03-25 Northwestern University TARGET DNA INTERFERENCE WITH crRNA
WO2010054108A2 (en) 2008-11-06 2010-05-14 University Of Georgia Research Foundation, Inc. Cas6 polypeptides and methods of use
PH12012500097A1 (en) * 2009-07-21 2011-01-27 Shanghai Inst Organic Chem Potent small molecule inhibitors of autophagy, and methods of use thereof
HUE041436T2 (hu) 2009-12-10 2019-05-28 Univ Minnesota Tal-effektor-közvetített DNS-módosítás
NO332016B1 (no) 2009-12-29 2012-05-21 Stiftelsen Sintef Prøvebehandlingskassett og fremgangsmåte for å behandle og/eller analysere en prøve under sentrifugalkraft
GB201000591D0 (en) 2010-01-14 2010-03-03 Ucb Pharma Sa Bacterial hoist strain
MX336731B (es) * 2010-01-28 2016-01-28 Harvard College Composiciones y metodos para potenciar la actividad de proteasoma.
US10087431B2 (en) 2010-03-10 2018-10-02 The Regents Of The University Of California Methods of generating nucleic acid fragments
WO2011143124A2 (en) 2010-05-10 2011-11-17 The Regents Of The University Of California Endoribonuclease compositions and methods of use thereof
WO2011146121A1 (en) 2010-05-17 2011-11-24 Sangamo Biosciences, Inc. Novel dna-binding proteins and uses thereof
WO2012164565A1 (en) 2011-06-01 2012-12-06 Yeda Research And Development Co. Ltd. Compositions and methods for downregulating prokaryotic genes
JP6072788B2 (ja) 2011-07-25 2017-02-01 サンガモ バイオサイエンシーズ, インコーポレイテッド 嚢胞性線維症膜コンダクタンス制御因子(cftr)遺伝子を改変するための方法および組成物
US8450107B1 (en) 2011-11-30 2013-05-28 The Broad Institute Inc. Nucleotide-specific recognition sequences for designer TAL effectors
GB201122458D0 (en) 2011-12-30 2012-02-08 Univ Wageningen Modified cascade ribonucleoproteins and uses thereof
KR20180009383A (ko) 2012-02-24 2018-01-26 프레드 헛친슨 켄서 리서치 센터 이상혈색소증 치료를 위한 조성물 및 방법
CN108285491B (zh) 2012-02-29 2021-08-10 桑格摩生物科学股份有限公司 治疗亨廷顿氏病的方法和组合物
WO2013141680A1 (en) 2012-03-20 2013-09-26 Vilnius University RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX
US9637739B2 (en) 2012-03-20 2017-05-02 Vilnius University RNA-directed DNA cleavage by the Cas9-crRNA complex
WO2013176772A1 (en) 2012-05-25 2013-11-28 The Regents Of The University Of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
EP2880171B1 (en) 2012-08-03 2018-10-03 The Regents of The University of California Methods and compositions for controlling gene expression by rna processing
CN110643600A (zh) 2012-10-23 2020-01-03 基因工具股份有限公司 用于切割靶dna的系统及其用途
LT3138910T (lt) 2012-12-06 2017-11-10 Sigma-Aldrich Co. Llc Crispr pagrįstas genomo modifikavimas ir reguliavimas
ES2786193T3 (es) 2012-12-12 2020-10-09 Broad Inst Inc Modificación por tecnología genética y optimización de sistemas, métodos y composiciones enzimáticas mejorados para la manipulación de secuencias
US8697359B1 (en) * 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products
SG10201707569YA (en) 2012-12-12 2017-10-30 Broad Inst Inc Delivery, Engineering and Optimization of Systems, Methods and Compositions for Sequence Manipulation and Therapeutic Applications
NZ712727A (en) 2013-03-14 2017-05-26 Caribou Biosciences Inc Compositions and methods of nucleic acid-targeting nucleic acids
US20140349400A1 (en) 2013-03-15 2014-11-27 Massachusetts Institute Of Technology Programmable Modification of DNA
US9234213B2 (en) 2013-03-15 2016-01-12 System Biosciences, Llc Compositions and methods directed to CRISPR/Cas genomic engineering systems
CN115261411A (zh) 2013-04-04 2022-11-01 哈佛学院校长同事会 利用CRISPR/Cas系统的基因组编辑的治疗性用途
EP2999788B1 (en) 2013-05-22 2020-07-08 Northwestern University Rna-directed dna cleavage and gene editing by cas9 enzyme from neisseria meningitidis
WO2014191521A2 (en) 2013-05-29 2014-12-04 Cellectis New compact scaffold of cas9 in the type ii crispr system
US20160138047A1 (en) 2013-06-14 2016-05-19 Cellectis Improved polynucleotide sequences encoding tale repeats
WO2014204725A1 (en) 2013-06-17 2014-12-24 The Broad Institute Inc. Optimized crispr-cas double nickase systems, methods and compositions for sequence manipulation
WO2015086795A1 (en) 2013-12-13 2015-06-18 Cellectis Cas9 nuclease platform for microalgae genome engineering

Non-Patent Citations (25)

* Cited by examiner, † Cited by third party
Title
BHAYA, D.; DAVISON, M.; BARRANGOU, R.: "CRISPR-Cas systems in bacteria and archaea: versatile small RNAs for adaptive defense and regulation", ANNUAL REVIEW OF GENETICS, vol. 45, 2011, pages 273 - 297, XP055118832, DOI: doi:10.1146/annurev-genet-110410-132430
BOCH; JENS: "TALEs of genome targeting", NATURE BIOTECHNOLOGY, vol. 29, no. 2, February 2011 (2011-02-01), pages 135 - 6, XP055077654, DOI: doi:10.1038/nbt.1767
CARROLL,D.: "Genome engineering with zinc-finger nucleases", GENETICS, vol. 188, 2011, pages 773 - 82, XP055036700, DOI: doi:10.1534/genetics.111.131433
CERMAK, T.; DOYLE, E. L.; CHRISTIAN, M.; WANG, L.; ZHANG, Y.; SCHMIDT, C.; BALLER, J. A.; SOMIA, N. V. ET AL.: "Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting", NUCLEIC ACIDS RESEARCH, 2011
DELTCHEVA ET AL., NATURE, vol. 471, 2011, pages 602 - 607
DELTCHEVA, E. ET AL.: "CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III", NATURE, vol. 471, 2011, pages 602 - 607, XP055308803, DOI: doi:10.1038/nature09886
DI CARLO ET AL., NUCLEIC ACIDS RESEARCH, vol. 41, no. 7, 2013, pages 4336 - 4343
GASIUNAS, G.; BARRANGOU, R.; HORVATH, P.; SIKSNYS, V: "Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 109, 2012, pages E2579 - 2586, XP055068588, DOI: doi:10.1073/pnas.1208507109
GEIPLER, R.; SCHOLZE, H.; HAHN, S.; STREUBEL, J.; BONAS, U.; BEHRENS, S. E.; BOCH, J.: "Transcriptional Activators of Human Genes with Programmable DNA-Specificity", PLOS ONE, vol. 6, no. 5, 2011, pages e19509
H. DEVEAU ET AL.: "Phage response to CRISPR-encoded resistance in Streptococcus thermophilus", JOURNAL OF BACTERIOLOGY, vol. 190, February 2008 (2008-02-01), pages 1390, XP002679468, DOI: doi:10.1128/JB.01412-07
JINEK, M. ET AL.: "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", SCIENCE, vol. 337, 2012, pages 816 - 821, XP055299674, DOI: doi:10.1126/science.1225829
JINEK,M.; CHYLINSKI,K.; FONFARA,L.; HAUER,M.; DOUDNA,J.A.; CHARPENTIER,E.: "A programmable dual-RNA-Guided DNA endonuclease in adaptive bacterial immunity", SCIENCE, vol. 337, 2012, pages 816 - 821, XP055299674, DOI: doi:10.1126/science.1225829
JINKE ET AL., SCIENCE, vol. 337, 2012, pages 816 - 821
LI, T.; HUANG, S.; ZHAO, X.; WRIGHT, D. A.; CARPENTER, S.; SPALDING, M. H.; WEEKS, D. P.; YANG, B.: "Modularly assembled designer TAL effector nucleases for targeted gene knockout and gene replacement in eukaryotes", NUCLEIC ACIDS RESEARCH, 2011
MAKAROVA ET AL.: "Nature Reviews", MICROBIOLOGY, vol. 9, June 2011 (2011-06-01), pages 467 - 477
MALI,P.; YANG,L.; ESVELT,K.M.; AACH,J.; GUELL,M.; DICARLO,J.E.; NORVILLE,J.E.; CHURCH,G.M.: "RNA-Guided human genome engineering via Cas9", SCIENCE, 2013
MILLER, JEFFREY: "A TALE nuclease architecture for efficient genome editing", NATURE BIOTECHNOLOGY, vol. 29, no. 2, February 2011 (2011-02-01), pages 143 - 8
MORBITZER, R.; ELSAESSER, J.; HAUSNER, J.; LAHAYE, T.: "Assembly of custom TALE-type DNA binding domains by modular cloning", NUCLEIC ACIDS RESEARCH, 2011
PEREZ-PINERA,P.; OUSTEROUT,D.G.; GERSBACH,C.A.: "Advances in targeted genome editing", CURRENT OPINION IN CHEMICAL BIOLOGY, vol. 16, 2012, pages 268 - 77, XP055065262, DOI: doi:10.1016/j.cbpa.2012.06.007
SAPRANAUSKAS, R. ET AL.: "The Streptococcus thermophilus CRISPR/Cas system provides immunity in Escherichia coli", NUCLEIC ACIDS RESEARCH, vol. 39, 2011, pages 9275 - 9282, XP055265024, DOI: doi:10.1093/nar/gkr606
STORICI,F.; DURHAM,C.L.; GORDENIN,D.A.; RESNICK,M.A.: "Chromosomal site-specific double-strand breaks are efficiently targeted for repair by oligonucleotides in yeast", PNAS, vol. 100, 2003, pages 14994 - 14999, XP055401991, DOI: doi:10.1073/pnas.2036296100
SYMINGTON,L.S.; GAUTIER,J.: "Double-strand break end resection and repair pathway choice", ANNUAL REVIEW OF GENETICS, vol. 45, 2011, pages 247 - 71
WEBER, E.; GRUETZNER, R.; WERNER, S.; ENGLER, C.; MARILLONNET, S.: "Assembly of Designer TAL Effectors by Golden Gate Cloning", PLOS ONE, vol. 6, no. 5, 2011, pages e19722, XP009162844, DOI: doi:10.1371/journal.pone.0019722
WOOD,A.J.; LO,T.-W.; ZEITLER,B.; PICKLE,C.S.; RALSTON,E.J.; LEE,A.H.; AMORA,R.; MILLER,J.C.; LEUNG,E.; MENG,X. ET AL.: "Targeted genome editing across species using ZFNs and TALENs", SCIENCE, vol. 333, 2011, pages 307, XP055102329, DOI: doi:10.1126/science.1207773
ZHANG, FENG: "Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription", NATURE BIOTECHNOLOGY, vol. 29, no. 2, February 2011 (2011-02-01), pages 149 - 53, XP055005146, DOI: doi:10.1038/nbt.1775

Cited By (177)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9322006B2 (en) 2011-07-22 2016-04-26 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10385359B2 (en) 2013-04-16 2019-08-20 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US12037596B2 (en) 2013-04-16 2024-07-16 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10975390B2 (en) 2013-04-16 2021-04-13 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US9340800B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College Extended DNA-sensing GRNAS
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US11920128B2 (en) 2013-09-18 2024-03-05 Kymab Limited Methods, cells and organisms
US11390887B2 (en) 2013-11-07 2022-07-19 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10640788B2 (en) 2013-11-07 2020-05-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAs
US10190137B2 (en) 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10208317B2 (en) 2013-12-11 2019-02-19 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse embryonic stem cell genome
US11820997B2 (en) 2013-12-11 2023-11-21 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a genome
US10711280B2 (en) 2013-12-11 2020-07-14 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse ES cell genome
US9546384B2 (en) 2013-12-11 2017-01-17 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse genome
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US9068179B1 (en) 2013-12-12 2015-06-30 President And Fellows Of Harvard College Methods for correcting presenilin point mutations
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US10435715B2 (en) 2014-02-11 2019-10-08 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US11795479B2 (en) 2014-02-11 2023-10-24 The Regents Of The University Of Colorado CRISPR enabled multiplexed genome engineering
US10364442B2 (en) 2014-02-11 2019-07-30 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US9982278B2 (en) 2014-02-11 2018-05-29 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US11345933B2 (en) 2014-02-11 2022-05-31 The Regents Of The University Of Colorado CRISPR enabled multiplexed genome engineering
US11078498B2 (en) 2014-02-11 2021-08-03 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10465207B2 (en) 2014-02-11 2019-11-05 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10351877B2 (en) 2014-02-11 2019-07-16 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US11639511B2 (en) 2014-02-11 2023-05-02 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10266849B2 (en) 2014-02-11 2019-04-23 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US11702677B2 (en) 2014-02-11 2023-07-18 The Regents Of The University Of Colorado CRISPR enabled multiplexed genome engineering
US10731180B2 (en) 2014-02-11 2020-08-04 The Regents Of The University Of Colorado CRISPR enabled multiplexed genome engineering
US10669559B2 (en) 2014-02-11 2020-06-02 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10240167B2 (en) 2014-02-11 2019-03-26 Inscripta, Inc. CRISPR enabled multiplexed genome engineering
US10711284B2 (en) 2014-02-11 2020-07-14 The Regents Of The University Of Colorado CRISPR enabled multiplexed genome engineering
US11028388B2 (en) 2014-03-05 2021-06-08 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa
US11141493B2 (en) 2014-03-10 2021-10-12 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US9938521B2 (en) 2014-03-10 2018-04-10 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10)
US11268086B2 (en) 2014-03-10 2022-03-08 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating Leber's Congenital Amaurosis 10 (LCA10)
US12234449B2 (en) 2014-03-10 2025-02-25 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for treating Leber's congenital amaurosis 10 (LCA10)
US11339437B2 (en) 2014-03-10 2022-05-24 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US11242525B2 (en) 2014-03-26 2022-02-08 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating sickle cell disease
US12460231B2 (en) 2014-04-02 2025-11-04 Editas Medicine, Inc. Crispr/CAS-related methods and compositions for treating primary open angle glaucoma
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12201699B2 (en) 2014-10-10 2025-01-21 Editas Medicine, Inc. Compositions and methods for promoting homology directed repair
US10428310B2 (en) 2014-10-15 2019-10-01 Regeneron Pharmaceuticals, Inc. Methods and compositions for generating or maintaining pluripotent cells
US11680268B2 (en) 2014-11-07 2023-06-20 Editas Medicine, Inc. Methods for improving CRISPR/Cas-mediated genome-editing
US11697828B2 (en) 2014-11-21 2023-07-11 Regeneran Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US10457960B2 (en) 2014-11-21 2019-10-29 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US10337001B2 (en) 2014-12-03 2019-07-02 Agilent Technologies, Inc. Guide RNA with chemical modifications
US10900034B2 (en) 2014-12-03 2021-01-26 Agilent Technologies, Inc. Guide RNA with chemical modifications
WO2016150855A1 (en) * 2015-03-20 2016-09-29 Danmarks Tekniske Universitet Crispr/cas9 based engineering of actinomycetal genomes
US20230002760A1 (en) * 2015-03-25 2023-01-05 Editas Medicine, Inc. Crispr/cas-related methods, compositions and components
US11535846B2 (en) 2015-04-06 2022-12-27 The Board Of Trustees Of The Leland Stanford Junior University Chemically modified guide RNAS for CRISPR/Cas-mediated gene regulation
US11851652B2 (en) 2015-04-06 2023-12-26 The Board Of Trustees Of The Leland Stanford Junior Compositions comprising chemically modified guide RNAs for CRISPR/Cas-mediated editing of HBB
US11306309B2 (en) 2015-04-06 2022-04-19 The Board Of Trustees Of The Leland Stanford Junior University Chemically modified guide RNAs for CRISPR/CAS-mediated gene regulation
US11180793B2 (en) 2015-04-24 2021-11-23 Editas Medicine, Inc. Evaluation of Cas9 molecule/guide RNA molecule complexes
US11390884B2 (en) 2015-05-11 2022-07-19 Editas Medicine, Inc. Optimized CRISPR/cas9 systems and methods for gene editing in stem cells
US11911415B2 (en) 2015-06-09 2024-02-27 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for improving transplantation
US11667911B2 (en) 2015-09-24 2023-06-06 Editas Medicine, Inc. Use of exonucleases to improve CRISPR/CAS-mediated genome editing
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
CN108368520B (zh) * 2015-11-04 2023-01-17 菲特治疗公司 多能细胞的基因组工程改造
CN108368520A (zh) * 2015-11-04 2018-08-03 菲特治疗公司 多能细胞的基因组工程改造
EP3383409A4 (en) * 2015-12-02 2019-10-02 The Regents of The University of California COMPOSITIONS AND METHOD FOR MODIFYING A TARGET NUCLEIC ACID
US11085057B2 (en) 2015-12-02 2021-08-10 The Regents Of The University Of California Compositions and methods for modifying a target nucleic acid
US11597924B2 (en) 2016-03-25 2023-03-07 Editas Medicine, Inc. Genome editing systems comprising repair-modulating enzyme molecules and methods of their use
US11512311B2 (en) 2016-03-25 2022-11-29 Editas Medicine, Inc. Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency
US12049651B2 (en) 2016-04-13 2024-07-30 Editas Medicine, Inc. Cas9 fusion molecules, gene editing systems, and methods of use thereof
US11236313B2 (en) 2016-04-13 2022-02-01 Editas Medicine, Inc. Cas9 fusion molecules, gene editing systems, and methods of use thereof
WO2017186550A1 (en) * 2016-04-29 2017-11-02 Basf Plant Science Company Gmbh Improved methods for modification of target nucleic acids
EP3868880A1 (en) * 2016-04-29 2021-08-25 Basf Plant Science Company GmbH Improved methods for modification of target nucleic acids
EP4166661A1 (en) * 2016-04-29 2023-04-19 BASF Plant Science Company GmbH Fused donor - guide nucleic acid and methods for modification of target nucleic acids
EP4166660A1 (en) * 2016-04-29 2023-04-19 BASF Plant Science Company GmbH Improved methods for modification of target nucleic acids using fused guide rna - donor molecules
US11608499B2 (en) 2016-04-29 2023-03-21 Basf Plant Science Company Gmbh Methods for modification of target nucleic acids
EP3464594A1 (en) * 2016-06-01 2019-04-10 Kws Saat Se Hybrid nucleic acid sequences for genome engineering
CN109642232A (zh) * 2016-06-01 2019-04-16 Kws种子欧洲股份公司 用于基因组改造的杂合核酸序列
US12084668B2 (en) 2016-06-01 2024-09-10 KWS SAAT SE & co., KGaA Hybrid nucleic acid sequences for genome engineering
US10767175B2 (en) 2016-06-08 2020-09-08 Agilent Technologies, Inc. High specificity genome editing using chemically modified guide RNAs
US10294473B2 (en) 2016-06-24 2019-05-21 The Regents Of The University Of Colorado, A Body Corporate Methods for generating barcoded combinatorial libraries
US11584928B2 (en) 2016-06-24 2023-02-21 The Regents Of The University Of Colorado, A Body Corporate Methods for generating barcoded combinatorial libraries
US10287575B2 (en) 2016-06-24 2019-05-14 The Regents Of The University Of Colorado, A Body Corporate Methods for generating barcoded combinatorial libraries
US10017760B2 (en) 2016-06-24 2018-07-10 Inscripta, Inc. Methods for generating barcoded combinatorial libraries
US11566263B2 (en) 2016-08-02 2023-01-31 Editas Medicine, Inc. Compositions and methods for treating CEP290 associated disease
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
WO2018049168A1 (en) 2016-09-09 2018-03-15 The Board Of Trustees Of The Leland Stanford Junior University High-throughput precision genome editing
US11760998B2 (en) 2016-09-09 2023-09-19 The Board Of Trustees Of The Leland Stanford Junior University High-throughput precision genome editing
EP3510151B1 (en) * 2016-09-09 2024-07-03 The Board of Trustees of the Leland Stanford Junior University High-throughput precision genome editing
EP4431607A3 (en) * 2016-09-09 2024-12-11 The Board of Trustees of the Leland Stanford Junior University High-throughput precision genome editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
EP3541945A4 (en) * 2016-11-18 2020-12-09 Genedit Inc. COMPOSITIONS AND METHODS OF MODIFICATION OF TARGET NUCLEIC ACIDS
US12286727B2 (en) 2016-12-19 2025-04-29 Editas Medicine, Inc. Assessing nuclease cleavage
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US12110545B2 (en) 2017-01-06 2024-10-08 Editas Medicine, Inc. Methods of assessing nuclease cleavage
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US12058986B2 (en) 2017-04-20 2024-08-13 Egenesis, Inc. Method for generating a genetically modified pig with inactivated porcine endogenous retrovirus (PERV) elements
US11499151B2 (en) 2017-04-28 2022-11-15 Editas Medicine, Inc. Methods and systems for analyzing guide RNA molecules
US11963982B2 (en) 2017-05-10 2024-04-23 Editas Medicine, Inc. CRISPR/RNA-guided nuclease systems and methods
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US12297466B2 (en) 2017-06-09 2025-05-13 Editas Medicine, Inc. Engineered Cas9 nucleases
US11098297B2 (en) 2017-06-09 2021-08-24 Editas Medicine, Inc. Engineered Cas9 nucleases
US10428319B2 (en) 2017-06-09 2019-10-01 Editas Medicine, Inc. Engineered Cas9 nucleases
US12180502B2 (en) 2017-06-23 2024-12-31 Inscripta, Inc. Nucleic acid-guided nucleases
US9982279B1 (en) 2017-06-23 2018-05-29 Inscripta, Inc. Nucleic acid-guided nucleases
US10011849B1 (en) 2017-06-23 2018-07-03 Inscripta, Inc. Nucleic acid-guided nucleases
US11697826B2 (en) 2017-06-23 2023-07-11 Inscripta, Inc. Nucleic acid-guided nucleases
US10626416B2 (en) 2017-06-23 2020-04-21 Inscripta, Inc. Nucleic acid-guided nucleases
US10337028B2 (en) 2017-06-23 2019-07-02 Inscripta, Inc. Nucleic acid-guided nucleases
US12195749B2 (en) 2017-06-23 2025-01-14 Inscripta, Inc. Nucleic acid-guided nucleases
US10435714B2 (en) 2017-06-23 2019-10-08 Inscripta, Inc. Nucleic acid-guided nucleases
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11866794B2 (en) 2017-07-31 2024-01-09 Regeneron Pharmaceuticals, Inc. Cas-ready mouse embryonic stem cells and mice and uses thereof
US11130999B2 (en) 2017-07-31 2021-09-28 Regeneron Pharmaceuticals, Inc. Cas-ready mouse embryonic stem cells and mice and uses thereof
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US12416015B2 (en) 2017-09-15 2025-09-16 The Board Of Trustees Of The Leland Stanford Junior University Multiplex production and barcoding of genetically engineered cells
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US11268092B2 (en) 2018-01-12 2022-03-08 GenEdit, Inc. Structure-engineered guide RNA
US12031132B2 (en) 2018-03-14 2024-07-09 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12338436B2 (en) 2018-06-29 2025-06-24 Editas Medicine, Inc. Synthetic guide molecules, compositions and methods relating thereto
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12254959B2 (en) 2019-07-03 2025-03-18 Integrated Dna Technologies, Inc. Identification, characterization, and quantitation of CRISPR-introduced double-stranded DNA break repairs
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12123033B2 (en) 2019-10-24 2024-10-22 Integrated Dna Technologies, Inc. Modified double-stranded donor templates
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11884915B2 (en) 2021-09-10 2024-01-30 Agilent Technologies, Inc. Guide RNAs with chemical modification for prime editing
WO2024105633A1 (en) 2022-11-18 2024-05-23 Kyoto Prefectural Public University Corporation Compositions for mitophagy induction and uses thereof
US12509680B2 (en) 2023-05-31 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12516308B2 (en) 2023-12-19 2026-01-06 President And Fellows Of Harvard College Suppression of pain by gene editing

Also Published As

Publication number Publication date
CN111304230A (zh) 2020-06-19
RU2019114217A3 (cg-RX-API-DMAC7.html) 2020-07-16
RU2016106649A3 (cg-RX-API-DMAC7.html) 2018-08-10
SG10201913000PA (en) 2020-03-30
KR20160035017A (ko) 2016-03-30
NZ716606A (en) 2022-03-25
RU2688462C2 (ru) 2019-05-21
EP3024964A2 (en) 2016-06-01
AU2014293015B2 (en) 2019-01-24
EP4234703A3 (en) 2023-09-06
JP2024029218A (ja) 2024-03-05
US20220235382A1 (en) 2022-07-28
EP4234703A2 (en) 2023-08-30
KR20230096134A (ko) 2023-06-29
AU2014293015A1 (en) 2016-02-11
EP3024964B1 (en) 2018-12-19
JP2022033922A (ja) 2022-03-02
ES2715666T3 (es) 2019-06-05
IL272193A (en) 2020-03-31
IL243560B (en) 2020-02-27
AU2018278911A1 (en) 2019-01-03
WO2015013583A8 (en) 2015-03-05
BR112016001721B1 (pt) 2023-10-03
WO2015013583A3 (en) 2015-04-23
CN105473773B (zh) 2024-03-08
SG11201600217QA (en) 2016-02-26
CN111304230B (zh) 2024-10-08
EP3916099B1 (en) 2023-04-12
RU2019114217A (ru) 2019-08-23
AU2021202581A1 (en) 2021-05-27
AU2018278911B2 (en) 2021-01-28
JP2016528894A (ja) 2016-09-23
US20150031133A1 (en) 2015-01-29
EP3483277A1 (en) 2019-05-15
JP7419328B2 (ja) 2024-01-22
US12473575B2 (en) 2025-11-18
RU2764757C2 (ru) 2022-01-21
AU2023248167A1 (en) 2023-12-14
AU2018278911C1 (en) 2021-09-23
AU2021202581B2 (en) 2023-07-13
IL272193B (en) 2022-05-01
RU2016106649A (ru) 2017-08-31
US10563225B2 (en) 2020-02-18
CA2918540A1 (en) 2015-01-29
HK1218940A1 (en) 2017-03-17
SG10201800259WA (en) 2018-02-27
EP3916099A1 (en) 2021-12-01
KR102773555B1 (ko) 2025-02-26
CN105473773A (zh) 2016-04-06
US11306328B2 (en) 2022-04-19
EP3024964A4 (en) 2017-01-18
JP2020110152A (ja) 2020-07-27
BR112016001721A2 (pt) 2017-09-05
EP3483277B1 (en) 2021-07-07
JP6993063B2 (ja) 2022-01-13
CN118028379A (zh) 2024-05-14
US9914939B2 (en) 2018-03-13
JP6739335B2 (ja) 2020-08-12
IL243560A0 (en) 2016-02-29
US20160369301A1 (en) 2016-12-22
US20150031132A1 (en) 2015-01-29

Similar Documents

Publication Publication Date Title
AU2021202581B2 (en) Genome engineering
RU2812848C2 (ru) Геномная инженерия
HK40097139A (en) Genome engineering
HK40008471A (en) Genome engineering
NZ754903A (en) Genome engineering
NZ754903B2 (en) Genome engineering
NZ754904B2 (en) Genome engineering
HK1218940B (en) Genome engineering
NZ716606B2 (en) Genome engineering
NZ754902B2 (en) Genome engineering
BR122022013043B1 (pt) COMBINAÇÃO COMPREENDENDO UMA CÉLULA-TRONCO GENETICAMENTE MODIFICADA PARA INCLUIR UM ÁCIDO NUCLEICO QUE CODIFICA UMA ENZIMA Cas9, UM RNA GUIA COMPLEMENTAR AO DNA-ALVO E UMA SEQUÊNCIA DE ÁCIDO NUCLEICO DOADOR

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201480042306.1

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14829377

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 243560

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2918540

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2016530062

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 201480042306.1

Country of ref document: CN

Ref document number: 122022013043

Country of ref document: BR

Ref document number: 14907605

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2014829377

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016001721

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2014293015

Country of ref document: AU

Date of ref document: 20140725

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20167004663

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2016106649

Country of ref document: RU

Kind code of ref document: A

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14829377

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 112016001721

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160126