WO2013159149A1 - High oleic acid oils - Google Patents

High oleic acid oils Download PDF

Info

Publication number
WO2013159149A1
WO2013159149A1 PCT/AU2013/000426 AU2013000426W WO2013159149A1 WO 2013159149 A1 WO2013159149 A1 WO 2013159149A1 AU 2013000426 W AU2013000426 W AU 2013000426W WO 2013159149 A1 WO2013159149 A1 WO 2013159149A1
Authority
WO
WIPO (PCT)
Prior art keywords
seed
oilseed
plant
safflower
lipid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2013/000426
Other languages
English (en)
French (fr)
Inventor
Craig Christopher Wood
Qing Liu
Xue-Rong Zhou
Allan Green
Surinder Pal Singh
Cao SHIJIANG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Commonwealth Scientific and Industrial Research Organization CSIRO
Grains Research and Development Corp
Original Assignee
Commonwealth Scientific and Industrial Research Organization CSIRO
Grains Research and Development Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2012903992A external-priority patent/AU2012903992A0/en
Priority to EA201491956A priority Critical patent/EA035715B1/ru
Priority to EP13782495.9A priority patent/EP2840886B1/en
Priority to UAA201412633A priority patent/UA116538C2/uk
Priority to AU2013252489A priority patent/AU2013252489B2/en
Priority to ES13782495T priority patent/ES2843486T3/es
Priority to KR1020147033143A priority patent/KR102208924B1/ko
Priority to HK15108575.9A priority patent/HK1207938A1/xx
Priority to JP2015507304A priority patent/JP6458218B2/ja
Priority to SG11201406843WA priority patent/SG11201406843WA/en
Application filed by Commonwealth Scientific and Industrial Research Organization CSIRO, Grains Research and Development Corp filed Critical Commonwealth Scientific and Industrial Research Organization CSIRO
Priority to CA2871503A priority patent/CA2871503C/en
Priority to BR112014026900A priority patent/BR112014026900A2/pt
Priority to IN2355MUN2014 priority patent/IN2014MN02355A/en
Priority to NZ631696A priority patent/NZ631696A/en
Priority to CN201380033472.0A priority patent/CN104619164B/zh
Priority to MX2014012941A priority patent/MX379844B/es
Publication of WO2013159149A1 publication Critical patent/WO2013159149A1/en
Priority to PH12014502381A priority patent/PH12014502381B1/en
Anticipated expiration legal-status Critical
Priority to ZA2014/08233A priority patent/ZA201408233B/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C11ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11BPRODUCING, e.g. BY PRESSING RAW MATERIALS OR BY EXTRACTION FROM WASTE MATERIALS, REFINING OR PRESERVING FATS, FATTY SUBSTANCES, e.g. LANOLIN, FATTY OILS OR WAXES; ESSENTIAL OILS; PERFUMES
    • C11B1/00Production of fats or fatty oils from raw materials
    • C11B1/10Production of fats or fatty oils from raw materials by extracting
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23DEDIBLE OILS OR FATS, e.g. MARGARINES, SHORTENINGS OR COOKING OILS
    • A23D9/00Other edible oils or fats, e.g. shortenings or cooking oils
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10Seeds
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/823Reproductive tissue-specific promoters
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/19Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (1.14.19)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/19Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (1.14.19)
    • C12Y114/19006DELTA12-fatty-acid desaturase (1.14.19.6), i.e. oleoyl-CoA DELTA12 desaturase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/13Plant traits

Definitions

  • the present invention relates to extracted lipid with high levels, for example 90% to 95% by weight, oleic acid.
  • the present invention also provides genetically modified plants, particularly oilseeds such as safflower, which can used to produce the lipid.
  • methods for genotyping and selecting plants which can be used to produce the lipid.
  • Plant oils are an important source of dietary fat for humans, representing about 25% of caloric intake in developed countries (Broun et al., 1999). World production of plant oils is at least about 110 million tons per year, of which 86% is used for human consumption. Almost all of these oils are obtained from oilseed crops such as soybean, canola, safflower, sunflower, cottonseed and groundnut, or plantation trees such as palm, olive and coconut (Gunstone, 2001; Oil World Annual, 2004). The growing scientific understanding and community recognition of the impact of the individual fatty acid components of food oils on various aspects of human health is motivating the development of modified vegetable oils that have improved nutritional value while retaining the required functionality for various food applications. These modifications require knowledge about the metabolic pathways for plant fatty acid synthesis and genes encoding the enzymes for these pathways (Liu et al., 2002a; Thelen and Ohlrogge, 2002).
  • LDL low density lipoprotein
  • HDL high density lipoprotein
  • saturated fatty acids particularly myristic acid (14:0) and palmitic acid (16:0)
  • myristic acid (16:0) and palmitic acid (16:0) the principal saturates present in plant oils, have the undesirable property of raising serum LDL-cholesterol levels and consequently increasing the risk of cardiovascular disease (Zock et al., 1994; Hu et al., 1997).
  • stearic acid the other main saturate present in plant oils, does not raise LDL-cholesterol, and may actually lower total cholesterol (Bonanome and Grundy, 1988; Dougherty et al., 1995). Stearic acid is therefore generally considered to be at least neutral with respect to risk of cardiovascular disease (Tholstrup, et al., 1994).
  • unsaturated fatty acids such as the monounsaturate oleic acid (18: 1), have the beneficial property of lowering LDL-cholesterol (Mensink and Katan, 1989; Roche and Gibney, 2000), thus reducing the risk of cardiovascular disease.
  • Oil high in oleic acid also has many industrial uses such as, but not limited to, lubricants often in the form of fatty acid esters, biofuels, raw materials for fatty alcohols, plasticizers, waxes, metal stearates, emulsifiers, personal care products, soaps and detergents, surfactants, pharmaceuticals, metal working additives, raw material for fabric softeners, inks, transparent soaps, PVC stabilizer, alkyd resins, and intermediates for many other types of downstream oleochemical derivatives.
  • lubricants often in the form of fatty acid esters, biofuels, raw materials for fatty alcohols, plasticizers, waxes, metal stearates, emulsifiers, personal care products, soaps and detergents, surfactants, pharmaceuticals, metal working additives, raw material for fabric softeners, inks, transparent soaps, PVC stabilizer, alkyd resins, and intermediates for many other types of downstream oleochemical derivatives.
  • Oil processors and food manufacturers have traditionally relied on hydrogenation to reduce the level of unsaturated fatty acids in oils, thereby increasing their oxidative stability in frying applications and also providing solid fats for use in margarine and shortenings.
  • Hydrogenation is a chemical process that reduces the degree of unsaturation of oils by converting carbon-carbon double bonds into carbon- carbon single bonds. Complete hydrogenation produces a fully saturated fat.
  • the process of partial hydrogenation results in increased levels of both saturated fatty acids and monounsaturated fatty acids.
  • trans-fatty acids are now known to be as potent as palmitic acid in raising serum LDL cholesterol levels (Mensink and Katan, 1990; Noakes and Clifton, 1998) and lowering serum HDL cholesterol (Zock and Katan, 1992), and thus contribute to increased risk of cardiovascular disease (Ascherio and Willett, 1997).
  • the present inventors have produced new lipid compositions and methods of producing these lipids.
  • the present invention provides lipid extracted from an oilseed, the lipid comprising triacylglycerols (TAG) which consist of fatty acids esterified to glycerol, wherein
  • TAG triacylglycerols
  • the fatty acids comprise palmitic acid and oleic acid
  • the lipid has an oleic desaturation proportion (ODP) of less than about 0.037 and/or a palmitic-linoleic-oleic value (PLO) of less than about 0.063.
  • ODP oleic desaturation proportion
  • PLO palmitic-linoleic-oleic value
  • the lipid has one or more or all of the following features, a) about 90% to about 94%, or about 91% to about 94%, or about 91% to about
  • PUFA polyunsaturated fatty acids
  • e) less than about 1%, or less than about 0.5%, by weight of the total fatty acid content of the lipid is a-linolenic acid (ALA),
  • the ODP of the fatty acid content of the lipid is about 0.033 to about 0.01, or about 0.033 to about 0.016, or about 0.033 to about 0.023, or is about 0.03, or about 0.02, or about 0.01,
  • the PLO value of the fatty acid content of the lipid is about 0.020 to about 0.063, or about 0.020 to about 0.055, or about 0.020 to about 0.050, or about 0.050 to about 0.055, or about 0.063, or about 0.055, or about 0.050, or about 0.040, or about 0.030, or about 0.020,
  • the lipid has an oleic monounsaturation proportion (OMP) of less than about 0.02, or less than about 0.015, or about 0.005 to about 0.02,
  • OMP oleic monounsaturation proportion
  • the lipid is in the form of a purified oil
  • a-linolenic acid is undetectable in the fatty acid content of the lipid
  • the ODP of the fatty acid content of the lipid is about 0.033 to about 0.023, or about 0.033 to about 0.018,
  • the PLO value of the fatty acid content of the lipid is about 0.020 to about
  • the lipid has an oleic monounsaturation proportion (OMP) of less than about 0.02, or less than about 0.015, or about 0.005 to about 0.02.
  • OMP oleic monounsaturation proportion
  • a-linolenic acid is undetectable in the fatty acid content of the lipid
  • the lipid has an oleic monounsaturation proportion (OMP) of less than about 0.02, or less than about 0.015, or about 0.005 to about 0.02.
  • OMP oleic monounsaturation proportion
  • the PUFA is linoleic acid.
  • a-linolenic acid is undetectable in the fatty acid content of the lipid.
  • about 55% to about 80%, or about 60% to about 80%, or about 70% to about 80%, or at least about 60%, or at least about 70%, or about 60%, or about 70%, or about 80%, of the TAG content of the lipid is triolein.
  • DAG diacylglycerols
  • the lipid is in the form of an oil, wherein at least 90%, or least 95%, at least about 98%, or about 95% to about 98%, by weight of the oil is the lipid.
  • the oilseed is a non-photo synthetic oilseed.
  • non-photo synthetic oilseed include, but are not necessarily limited to, seed from safflower, sunflower, cotton or castor.
  • the non- photo synthetic oilseed is safflower seed.
  • the lipid further comprises one or more sterols.
  • the lipid is in the form of an oil, and which comprises less than about 5 mg of sterols/g of oil, or about 1.5 mg of sterols/g of oil to about 5 mg of sterols/g of oil.
  • the lipid comprises one or more or all of
  • the lipid has a volume of at least 1 litre and/or a weight of at least 1 kg, and/or which was extracted from oilseed obtained from field-grown plants.
  • the lipid has been extracted from an oilseed by crushing and comprises less than about 7% water by weight.
  • the lipid is purified lipid (solvent extracted and refined) and comprises less than about 0.1%, or less than about 0.05% water, by weight.
  • the present invention provides a composition comprising a first component which is lipid of the invention, and a second component, preferably where the composition was produced by mixing the lipid with the second component.
  • the second component can be selected from a wide range of different compounds/compositions.
  • the second component is a non-lipid substance such as an enzyme, a non-protein (non-enzymatic) catalyst or chemical (for example, sodium hydroxide, methanol or a metal), or one or more ingredients of a feed.
  • the present invention also provides a process for producing oil, the process comprising
  • oilseed comprising, and/or which is capable of producing a plant which produces oilseed comprising, oil, wherein the oil content of the oilseed is a lipid as defined in herein, and
  • the oilseed comprises a first exogenous polynucleotide which encodes a first silencing RNA which is capable of reducing the expression of a ⁇ 12 desaturase (FAD2) gene in a developing oilseed relative to a corresponding oilseed lacking the exogenous polynucleotide, and wherein the polynucleotide is operably linked to a promoter which directs expression of the polynucleotide in the developing oilseed.
  • FAD2 ⁇ 12 desaturase
  • the present invention provides a process for producing oil, the process comprising
  • TAG triacylglycerols
  • the fatty acids comprise palmitic acid and oleic acid
  • d) less than about 5.1% by weight of the total fatty acids of the oil content of the seed is palmitic acid
  • the oil content of the seed has an oleic desaturation proportion (ODP) of less than about 0.17 and/or a palmitic-linoleic-oleic (PLO) value of less than about 0.26, and
  • the safflower seed comprises a first exogenous polynucleotide which encodes a first silencing RNA which is capable of reducing the expression of a ⁇ 12 desaturase (FAD2) gene in a developing safflower seed relative to a corresponding safflower seed lacking the exogenous polynucleotide, and wherein the polynucleotide is operably linked to a promoter which directs expression of the polynucleotide in the developing safflower seed.
  • FAD2 ⁇ 12 desaturase
  • the oilseed or safflower seed comprises a second exogenous polynucleotide which encodes a second silencing RNA which is capable of reducing the expression of a palmitoyl-ACP thioesterase (FATB) gene in a developing oilseed or safflower seed relative to a corresponding oilseed or safflower seed lacking the second exogenous polynucleotide, and wherein the second exogenous polynucleotide is operably linked to a promoter which directs expression of the polynucleotide in the developing oilseed or safflower seed.
  • FTB palmitoyl-ACP thioesterase
  • the oilseed or safflower seed comprises a third exogenous polynucleotide which encodes a third silencing RNA which is capable of reducing the expression of a plastidial co6 fatty acid desaturase (FAD6) gene in a developing oilseed or safflower seed relative to a corresponding oilseed or safflower seed lacking the third exogenous polynucleotide, and wherein the third exogenous polynucleotide is operably linked to a promoter which directs expression of the polynucleotide in the developing oilseed or safflower seed.
  • FAD6 plastidial co6 fatty acid desaturase
  • the FAD2 gene is one or more or each of a GFAD2-1 gene, a GFAD2-2 gene, and a CtFAD2-lO gene, preferably a GFAD2-1 gene and/or a GFAD2-2 gene, and/or
  • the FATB gene is a CtFATB-3 gene, and/or
  • the FAD6 gene is a CtFAD6 gene.
  • the oil content of the safflower seed has one or more or all of the following features,
  • c) about 0.1% to about 15%, or about 0.1% to about 10%, or about 0.1% to about 7.5%, or about 0.1% to about 5%, or about 0.1% to about 3%, or about 2% to about 3%, or about 3%, or about 2%, by weight of the total fatty acids of the oil content of the seed is polyunsaturated fatty acids (PUFA), d) less than about 15%, or less than about 10%, or less than about 5%, or less than about 3%, or less than about 2.5%, or less than about 2.25%, or about 3%, or about 2.5%, or about 2.25%, by weight of the total fatty acids of the oil content of the seed is linoleic acid (LA),
  • LA linoleic acid
  • the lipid has an oleic monounsaturation proportion (OMP) of less than about 0.05, or less than about 0.02, or less than about 0.015, or about 0.005 to about 0.05, or about 0.005 to about 0.02,
  • OMP oleic monounsaturation proportion
  • the ODP of the oil content of the seed is about 0.17 to about 0.01, or about 0.15 to about 0.01, or about 0.1 to about 0.01, or about 0.075 to about 0.01, or about 0.050 to about 0.01, or about 0.033 to about 0.01, or about 0.033 to about 0.016, or about 0.033 to about 0.023, or is about 0.03, or about 0.02, or about 0.01, and
  • the PLO value of the oil content of the seed is about 0.20 to about 0.026, or about 0.020 to about 0.2, or about 0.020 to about 0.15, or about 0.020 to about 0.1, or about 0.020 and about 0.075, or about 0.050 and about 0.055, or is about 0.05, or about 0.040, or about 0.030, or about 0.020.
  • the step of extracting the oil comprises crushing the oilseed or the safflower seed.
  • the process further comprising a step of purifying the oil extracted from the oilseed or the safflower seed, wherein the purification step comprises one or more or all of the group consisting of: degumming, deodorising, decolourising, drying and/or fractionating the extracted oil, and/or removing at least some, preferably substantially all, waxes and/or wax esters from the extracted oil.
  • the present invention provides an oilseed whose oil content comprises, and/or which is capable of producing a plant which produces oilseed whose oil content comprises, triacylglycerols (TAG) which consist of fatty acids esterified to glycerol, and wherein
  • TAG triacylglycerols
  • the fatty acids comprise palmitic acid and oleic acid
  • the oil content of the oilseed has an oleic desaturation proportion (ODP) of less than about 0.037 and/or a palmitic-linoleic-oleic (PLO) value of less than about 0.063.
  • ODP oleic desaturation proportion
  • PLO palmitic-linoleic-oleic
  • the oilseed is a non-photo synthetic oilseed, preferably seed from safflower, sunflower, cotton or castor.
  • the oilseed comprises a first exogenous polynucleotide which encodes a first silencing RNA which is capable or reducing the expression of a ⁇ 12 desaturase (FAD2) gene in a developing oilseed relative to a corresponding oilseed lacking the exogenous polynucleotide, and wherein the first exogenous polynucleotide is operably linked to a promoter which directs expression of the polynucleotide in the developing oilseed.
  • FAD2 ⁇ 12 desaturase
  • the present invention provides a safflower seed whose oil content comprises, and/or which is capable of producing a plant which produces seed whose oil content comprises, triacylglycerols (TAG) which consist of fatty acids esterified to glycerol, and wherein
  • TAG triacylglycerols
  • the fatty acids comprise palmitic acid and oleic acid
  • the oil content of the seed has an oleic desaturation proportion (ODP) of less than about 0.17 and/or a palmitic-linoleic-oleic (PLO) value of less than about 0.26, and
  • the safflower seed comprises a first exogenous polynucleotide which encodes a first silencing RNA which is capable of reducing the expression of a ⁇ 12 desaturase (FAD2) gene in a developing safflower seed relative to a corresponding safflower seed lacking the exogenous polynucleotide, and wherein the first exogenous polynucleotide is operably linked to a promoter which directs expression of the polynucleotide in the developing safflower seed.
  • FAD2 ⁇ 12 desaturase
  • the oil content of the safflower seed has one or more of the following features,
  • a) about 80% to about 94%, or about 85% to about 94%, or about 90% to about 94%, or about 91% to about 94%, or about 91% to about 92%, or about 92%, or about 93% by weight of the total fatty acids of the oil content of the seed is oleic acid, b) less than about 5%, or less than about 4%, or less than about 3%, or less than about 2.75%, or less than about 2.5%, or about 3%, or about 2.75%, or about 2.5% by weight of the total fatty acids of the oil content of the seed is palmitic acid,
  • PUFA polyunsaturated fatty acids
  • LA linoleic acid
  • the lipid has an oleic monounsaturation proportion (OMP) of less than about
  • the ODP of the oil content of the seed is about 0.17 to about 0.01, or about 0.15 to about 0.01, or about 0.1 to about 0.01, or about 0.075 to about 0.01, or about 0.050 to about 0.01, or about 0.033 to about 0.01, or about 0.033 to about 0.016, or about 0.033 to about 0.023, or is about 0.03, or about 0.02, or about 0.01, and
  • the PLO value of the oil content of the seed is about 0.020 to about 0.26, or about 0.020 to about 0.2, or about 0.020 to about 0.15, or about 0.020 to about 0.1, or about 0.020 and about 0.075, or about 0.050 and about 0.055, or is about 0.050, or about 0.040, or about 0.030, or about 0.020.
  • the oil content of the oilseed or safflower seed is lipid which is further characterized by one or more of the above-mentioned features.
  • the oilseed or safflower seed comprises a second exogenous polynucleotide which encodes a second silencing RNA which is capable of reducing the expression of a palmitoyl-ACP thioesterase (FATB) gene in a developing oilseed or safflower seed relative to a corresponding oilseed or safflower seed lacking the second exogenous polynucleotide, and wherein the second exogenous polynucleotide is operably linked to a promoter which directs expression of the polynucleotide in the developing oilseed or safflower seed.
  • FTB palmitoyl-ACP thioesterase
  • the oilseed or safflower seed comprises a third exogenous polynucleotide which is capable of reducing the expression of a plastidial co6 fatty acid desaturase (FAD6) gene in a developing oilseed or safflower seed relative to a corresponding oilseed or safflower seed lacking the third exogenous polynucleotide, and wherein the third exogenous polynucleotide is operably linked to a promoter which directs expression of the polynucleotide in the developing oilseed or safflower seed.
  • FAD6 plastidial co6 fatty acid desaturase
  • the first silencing RNA reduces the expression of more than one endogenous gene encoding FAD2 in developing oilseed or safflower seed and/or wherein the second silencing RNA reduces the expression of more than one endogenous gene encoding FATB in developing oilseed or safflower seed.
  • first exogenous polynucleotide and either or both of the second exogenous polynucleotide and the third exogenous polynucleotide are covalently joined on a single DNA molecule, optionally with linking DNA sequences between the first, second and/or the third exogenous polynucleotides.
  • the first exogenous polynucleotide and either or both of the second exogenous polynucleotide and the third exogenous polynucleotide are under the control of a single promoter such that, when the first exogenous polynucleotide and the second exogenous polynucleotide and/or the third exogenous polynucleotide are transcribed in the developing oilseed or safflower seed, the first silencing RNA and the second silencing RNA and/or the third silencing RNA are covalently linked as parts of a single RNA transcript.
  • oilseed or safflower seed comprises a single transfer
  • DNA integrated into the genome of the oilseed or safflower seed and wherein the single transfer DNA comprises the first exogenous polynucleotide and either or both of the second exogenous polynucleotide and the third exogenous polynucleotide.
  • the oilseed or safflower seed is homozygous for the transfer DNA.
  • the first silencing RNA, the second silencing RNA and the third silencing RNA are each independently selected from the group consisting of: an antisense polynucleotide, a sense polynucleotide, a catalytic polynucleotide, a microRNA and a double stranded RNA.
  • any one or more, preferably all, of the promoters are seed specific, and preferably preferentially expressed in the embryo of developing oilseed or safflower seed.
  • the oilseed or safflower seed comprises one or more mutations in one or more FAD2 genes, wherein the mutation(s) reduce the activity of the one or more FAD2 genes in developing oilseed or safflower seed relative to a corresponding oilseed or safflower seed lacking the mutation(s).
  • the oilseed or safflower seed comprises a mutation of a FAD2 gene relative to a wild-type FAD2 gene in a corresponding oilseed or safflower seed, which mutation is a deletion, an insertion, an inversion, a frameshift, a premature translation stop codon, or one or more non-conservative amino acid substitutions.
  • the mutation is a null mutation in the FAD2 gene.
  • At least one of the mutations is in a FAD2 gene which encodes more FAD2 activity in the developing oilseed or safflower seed lacking the mutation(s) than any other FAD2 gene in the developing oilseed or safflower seed.
  • the seed is a safflower seed and the FAD2 gene is the CtFAD2- 1 gene.
  • the first silencing RNA is at least capable or reducing the expression of a CtFAD2-2 gene.
  • the seed is a safflower seed comprising an ol allele of the GFAD2-1 gene or an oil allele of the CtFAD2-l gene, or both alleles.
  • the ol allele or the oil allele of the CtFAD2- 1 gene is present in the homozygous state.
  • FAD2 protein is undetectable in the oilseed or safflower seed.
  • the seed is a safflower seed and the first silencing RNA reduces the expression of both CtFAD2- 1 and GFAD2-2 genes.
  • the seed is a safflower seed
  • the FAD2 gene is one or more of a CtFAD2-l gene, a CtFAD2-2 gene, and a QFAD2-10 gene, preferably a QFAD2-1 gene and/or a QFAD2-2 gene, and/or
  • the FATB gene is a CtFATB-3 gene, and/or
  • the FAD6 gene is a CtFAD6 gene.
  • oilseed plant or safflower plant capable of producing the seed of the invention.
  • the plant is transgenic and homozygous for each exogenous polynucleotide, and/or comprises the first exogenous polynucleotide and either or both of the second exogenous polynucleotide or the third exogenous polynucleotide.
  • the present invention provides a substantially purified and/or recombinant polypeptide which comprises amino acids having a sequence as provided in any one of SEQ ID NOs: 27 to 37, 44, 45 or 48, a biologically active fragment thereof, or an amino acid sequence which is at least 40% identical to any one or more of SEQ ID NOs: 27 to 37, 44, 45 or 48.
  • the polypeptide which is a fatty acid modifying enzyme preferably an oleate ⁇ 12 desaturase, A12-acetylenase, a palmitoleate ⁇ 12 desaturase or a palmitoyl-ACP thioesterase (FATB).
  • a fatty acid modifying enzyme preferably an oleate ⁇ 12 desaturase, A12-acetylenase, a palmitoleate ⁇ 12 desaturase or a palmitoyl-ACP thioesterase (FATB).
  • the present invention provides an isolated and/or exogenous polynucleotide comprising one or more of i) nucleotides having a sequence as provided in any one of SEQ ID NOs: 1 to 25, 40 to 43, 46 or 47,
  • nucleotides having a sequence encoding a polypeptide of the invention iii) nucleotides which hybridize to a sequence as provided in any one of SEQ ID NOs: 1 to 25, 40 to 43, 46 or 47, and
  • nucleotides having a sequence such that when expressed in a seed of an oilseed plant reduces the expression of a gene encoding at least one polypeptide of the invention.
  • polynucleotide comprises nucleotides having a sequence such that when expressed in a seed of an oilseed plant reduces the expression of a gene encoding at least one polypeptide of the invention.
  • the polynucleotide of part iv) comprises a sequence of nucleotides provided in any one of SEQ ID NOs: 49 to 51 (where thymine (T) is uracil (U)).
  • the polynucleotide of part iv) is selected from: an antisense polynucleotide, a sense polynucleotide, a catalytic polynucleotide, a microRNA, a double stranded RNA (dsRNA) molecule or a processed RNA product thereof.
  • the polynucleotide is a dsRNA molecule, or a processed RNA product thereof, comprising at least 19 consecutive nucleotides which is at least 95% identical to the complement of any one or more of SEQ ID NOs: 1 to 25, 40 to 43, 46, 47 or 49 to 51 (where thymine (T) is uracil (U)).
  • the dsRNA molecule is a microRNA (miRNA) precursor and/or wherein the processed RNA product thereof is a miRNA.
  • miRNA microRNA
  • the polynucleotide is transcribed in a developing oilseed or safflower seed under the control of a single promoter, wherein the dsRNA molecule comprises complementary sense and antisense sequences which are capable of hybridising to each other, linked by a single stranded RNA region.
  • the polynucleotide when present in a developing safflower seed,
  • FAD2 in the developing seed, the FAD2 having an amino acid sequence as provided in any one or more of SEQ ID NOs: 27, 28 or 36, preferably at least one or both of SEQ ID NOs: 27 and 28;
  • ii) reduces the expression of an endogenous gene encoding palmitoyl-ACP thioesterase (FATB) in the developing seed, the FATB having an amino acid sequence as provided in SEQ ID NO: 45; and/or iii) reduces the expression of a gene encoding an co6 fatty acid desaturase (FAD6) in the developing seed, the FAD6 having an amino acid sequence as provided in SEQ ID NO: 48.
  • FATB palmitoyl-ACP thioesterase
  • a chimeric vector comprising the polynucleotide of the invention, operably linked to a promoter.
  • the promoter is functional in an oilseed, or is a seed specific promoter, preferably is preferentially expressed in the embryo of a developing oilseed.
  • the present invention provides a recombinant cell comprising an exogenous polynucleotide of the invention, and/or a vector of the invention.
  • the cell can be any cell type such as, but not limited to, bacterial cell, yeast cell or plant cell.
  • the cell is a plant cell, preferably a plant seed cell. More preferably, the plant cell is an oilseed plant cell. Even more preferably, the plant cell is a non- photo synthetic seed cell, preferably a safflower, sunflower, cotton or castor seed cell.
  • the present invention provides a transgenic non-human organism comprising one or more of the polynucleotides of the invention, a vector of the invention, and a cell of the invention.
  • the transgenic non-human organism of is a plant. More preferably, an oilseed plant.
  • the present invention provides a method of producing the cell of the invention, the method comprising the step of introducing the polynucleotide of the invention, and/or a vector of the invention, into a cell.
  • polynucleotide of the invention and/or a vector of the invention to produce a recombinant cell.
  • the present invention provides a method of producing a transgenic oilseed plant which produces a seed of the invention, or seed thereof, the method comprising
  • the seed is safflower seed of the invention.
  • the one or more progeny plants or seed thereof comprises
  • the one or more progeny plants or seed thereof comprises one or more mutations as defined above.
  • the present invention provides a method of obtaining an oilseed plant, the method comprising
  • a progeny plant comprising both (a) the first polynucleotide or the first vector and (b) the second polynucleotide or the second vector, and further having an increased proportion of oleic acid and a decreased proportion of palmitic acid in the oil content of the seed of the plant.
  • the present invention provides a method of genotyping a safflower plant, the method comprising detecting a nucleic acid molecule of the plant, wherein the nucleic acid molecule is linked to, and/or comprises at least part of, one or more of the CtFAD2-l, GFAD2-2 or CtFAD2-10 genes, preferably at least one or both of the CtFAD2- ⁇ and QFAD2-2 genes, or at least the QFAD2-1 gene, of a safflower plant.
  • the method comprises determining the level of expression, and/or sequence, of one or more of the CtFAD2-l, CtFAD2-2 or CtFAD2-10 genes of the plant.
  • the method comprises:
  • the second nucleic acid molecule is used as a primer to reverse transcribe or replicate at least a portion of the nucleic acid molecule of the plant.
  • the nucleic acid can detected using variety of well known techniques such as, but not limited to, restriction fragment length polymorphism analysis, amplification fragment length polymorphism analysis, micro satellite amplification, nucleic acid sequencing, and/or nucleic acid amplification.
  • the method detects the absence of presence of an allele of the
  • CtFAD2- 1 gene preferably the ol allele.
  • the present invention provides a method of selecting a safflower plant from a population of safflower plants, the method comprising;
  • genotyping said population of plants using a method of the invention wherein said population of plants was obtained from a cross between two plants of which at least one plant comprises an allele of a CtFAD2-l, GFAD2-2 or CtFAD2-lO gene, preferably at least one or both of the CtFAD2- 1 and CtFAD2-2 genes, or at least the CtFAD2 -1 gene, which confers upon developing seed of said plant a reduced level of ⁇ 12 desaturase activity, relative to a corresponding seed of a safflower plant lacking said allele, and
  • the present invention provides a method of introducing an allele of a CtFAD2-l, QFAD2-2 or QFAD2- 10 gene into a safflower plant lacking the allele, the method comprising;
  • step ii) backcrossing the progeny of the cross of step i) with plants of the same genotype as the first parent plant for a sufficient number of times to produce a plant with a majority of the genotype of the first parent but comprising said allele
  • the allele confers upon developing seed of said plant a reduced level of ⁇ 12 desaturase activity, relative to a corresponding seed of a safflower plant lacking said allele, and wherein progeny plants are genotyped for the presence or absence of said allele using a method of the invention.
  • transgenic plant or progeny plants thereof, or seed thereof, produced using the method of the invention.
  • the present invention provides a method of producing seed, the method comprising,
  • the present invention provides oil obtained or obtainable by one or more of the process of the invention, from the oilseed or safflower seed of the invention, from the plant or part thereof of the invention, from the cell of the invention, and/or from the non-human transgenic organism or part thereof of the invention.
  • the present invention provides a composition comprising one or more of the lipid of the invention, the oilseed or safflower seed of the invention, the polypeptide of the invention, the polynucleotide of the invention, the vector of the invention, the host cell of the invention, or oil of the invention, and one or more acceptable carriers.
  • lipid of the invention the composition of the invention, the process of the invention, the oilseed or safflower seed of the invention, the plant or part thereof of the invention, the host cell of the invention, the non-human transgenic organism or part thereof of the invention, or oil of the invention, for the manufacture of an industrial product.
  • the present invention provides a process for producing an industrial product, the process comprising the steps of:
  • lipid of the invention i) obtaining one or more of the lipid of the invention, the composition of the invention, the oilseed or safflower seed of the invention, the plant or part thereof of the invention, the host cell of the invention, the non-human transgenic organism or part thereof of the invention, or oil of the invention,
  • step ii) optionally physically processing the one or more of the lipid of the invention, the composition of the invention, the oilseed or safflower seed of the invention, the plant or part thereof of the invention, the host cell of the invention, the non-human transgenic organism or part thereof of the invention, or oil of the invention, of step i), ii) converting at least some of the lipid of the invention, or lipid in one or more of the composition of the invention, the oilseed or safflower seed of the invention, the plant or part thereof of the invention, the host cell of the invention, the non-human transgenic organism or part thereof of the invention, or oil of the invention, or the physically processed product of step ii), to the industrial product by applying heat, chemical, or enzymatic means, or any combination thereof, to the lipid, and
  • the present invention provides a method of producing fuel, the method comprising
  • the alkyl esters are methyl esters.
  • the present invention provides a method of producing a feedstuff, the method comprising admixing one or more of the lipid of the invention, the composition of the invention, oilseed or safflower seed of the invention, the plant or part thereof of the invention, the host cell according of the invention, the non-human transgenic organism or part thereof of the invention, or oil of the invention, with at least one other food ingredient.
  • feedstuffs, cosmetics or chemicals comprising one or more of the lipid of the invention, the composition of the invention, oilseed or safflower seed of the invention, the plant or part thereof of the invention, the host cell according of the invention, the non-human transgenic organism or part thereof of the invention, or oil of the invention,
  • lipid of the invention in yet a further aspect, provided is a product produced from or using one or more of the lipid of the invention, or lipid in one or more of the composition of the invention, the process of the invention, the oilseed or safflower seed of the invention, the plant or part thereof of the invention, the host cell of the invention, the non-human transgenic organism or part thereof of the invention, or oil of the invention.
  • composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
  • FIG. 1 Phylogenetic comparison of amino acid sequences encoded by safflower FAD2- ⁇ i e gene family and divergent FAD2-like enzymes from other plants.
  • the phylogenetic tree shown was generated by use of Vector NTI (invitrogen). Included in the alignment were FAD2 desaturases (DES), hydroxylases (OH), epoxygenases (EPOX), acetylenases (ACET), and conjugases (CONJ).
  • DES FAD2 desaturases
  • OH hydroxylases
  • EPOX epoxygenases
  • AKT acetylenases
  • CONJ conjugases
  • the GeneBank accession numbers of the amino acid sequences represented in the phylogenetic tree are: coCONJ, AAK26632.1; caACET, ABC00769.1; cpEPOX, CAA76156.1; haACET, ABC59684.1; dsACET, AAO38036.1; dcACET, AAO38033.1; hhACET, AAO38031.1; haDES-2, AAL68982.1; haDES-3, AAL68983.1; luDES, ACF49507; haDES-1, AAL68982.1; ntDES, AAT72296.2; oeDES, AAW63040; siDES, AAF80560.1; ghDES-1, CAA65744.1; rcOH, AAC49010.1; atDES, AAM61113.1; pfOH:DES, AAC32755.1; plOH, ABQ01458.1; ghDES-4, AAQ16653.1; ghDES-2, CAA71199.1.(co,
  • FIG. 1 Southern blot hybridisation analysis of CtFAD2 -like genomic structure in safflower genotype SU. Genomic DNA was digested with eight different restriction enzymes prior to separation on an agarose gel. These enzymes were Accl (lane 1), Bglll (2), BamHI (3), EcoRI (4), EcoRV (5), Hindlll (6), Xbal (7) and Xhol (8). The blot was probed with radio-labelled entire coding region of GFAD2-6 and washed at low stringency conditions.
  • Figure 6 Nucleotide comparison of a region of the CtFAD2- 1 alleles from wild-type SU and three high oleic genotypes, namely S-317, CW99-OL and Lesaf496, showing a nucleotide deletion in the middle of the CtFAD2-l coding region in the mutants.
  • Figure 7. DNA sequence comparison of the CtFAD2- 1 5'UTR introns in the wild-type variety SU and the high oleic genotype S-317. Boxed DNA sequences were used to design the perfect PCR markers for high oleic specific and wild type specific PCR products.
  • FIG. 8 Real time q-PCR analysis of OFAD2-1 and OFAD2-2 mRNA levels in developing embryos of three development stages, early (7 DPA), mid (15 DPA) and late (20 DPA).
  • the safflower varieties include wild- type SU, and three high oleic varieties: S-317, CW99-OL and Lesaf496.
  • Figure 9 Real time qPCR analysis of CtFatB genes in leaf, root, and developing embryos of safflower variety SU. Em-1 (early stage), Em-2 (middle stage), and Em-3 (late stage).
  • Figure 10. A dendrogram showing the phylogenetic relationship between the safflower FAD6 sequences and representative FAD6 plastidial ⁇ 12 desaturase identified in higher plants.
  • Jatropha curcas (EU106889); Olea europaea (AY733075); Populus trichocarpa (EF147523); Arabidopsis thaliana (AY079039); Descuriana sophia (EF524189); Glycine max (AK243928); Brassica napus (L29214); Portulaca oleracea (EU376530); Arachis hypogaea (FJ768730); Ginkgo biloba (HQ694563).
  • FIG. 14 (A) Basic phytosterol structure with ring and side chain numbering. (B) Chemical structures of some of the phytosterols.
  • SEQ ID NO: 3 - cDNA encoding safflower FAD2-3.
  • SEQID NO: 5- cDNA encoding safflower FAD2-5.
  • SEQID NO: 6- cDNA encoding safflower FAD2-6.
  • SEQID NO: 12 Open reading frame encoding safflower FAD2- 1.
  • SEQID NO: 13 Open reading frame encoding safflower FAD2- 2.
  • SEQID NO: 14 Open reading frame encoding safflower FAD2- 3.
  • SEQID NO: 15 Open reading frame encoding safflower FAD2- 4.
  • SEQID NO: 16 Open reading frame encoding safflower FAD2- 5.
  • SEQID NO: 17 Open reading frame encoding safflower FAD2- 6.
  • SEQID NO: 18 Open reading frame encoding safflower FAD2- 7.
  • SEQID NO: 19 Open reading frame encoding safflower FAD2- 8.
  • SEQID NO: 20 Open reading frame encoding safflower FAD2- 9.
  • SEQID NO: 21 Open reading frame encoding safflower FAD2- 10.
  • SEQID NO: 22 Open reading frame encoding safflower FAD2- 11.
  • SEQID NO: 23 Intron sequence of safflower FAD2-1 gene.
  • SEQID NO: 24 Intron sequence of safflower FAD2-2 gene.
  • SEQID NO: 25 Intron sequence of safflower FAD2-10 gene.
  • SEQID NO: 26 - cDNA encoding truncated safflower FAD2-1 (HO mutant).
  • SEQID NO: 27 Safflower FAD2-1.
  • SEQID NO: 40 - cDNA encoding safflower FATB-2.
  • SEQ ID NO: 41 - cDNA encoding safflower FATB-3.
  • SEQ ID NO: 42 Open reading frame encoding safflower FATB-2.
  • SEQ ID NO: 43 Open reading frame encoding safflower FATB-3.
  • SEQ ID NO: 47 Open reading frame encoding safflower FAD6.
  • SEQ ID NO: 49 - QFAD2-2 sequence used in RNA silencing construct SEQ ID NO: 49 - QFAD2-2 sequence used in RNA silencing construct.
  • SEQ ID NO: 50 - CtFATB-3 sequence used in RNA silencing construct SEQ ID NO: 50 - CtFATB-3 sequence used in RNA silencing construct.
  • SEQ ID NO: 52 Arabidopsis thaliana oleosin promoter.
  • SEQ ID NO: 54 Nos polyadenylation signal.
  • SEQ ID NO: 55 Ocs polyadenylation signal.
  • SEQ ID NO: 56 Wild type QFAD2-1 sequence corresponding to region of ol allele.
  • SEQ ID NO: 170 Wild type safflower variety SU OFAD2-1 5'UTR intron.
  • the term about refers to +/- 10%, more preferably +/- 5%, more preferably +/- 4%, more preferably +/- 3%, more preferably +/- 2%, more preferably +/- 1.5%, more preferably +/- 1%, even more preferably +/- 0.5%, of the designated value.
  • the term “extracted lipid” refers to a lipid composition which comprises at least 60% (w/w) lipid and which has been extracted, for example by crushing, from a transgenic organism or part thereof.
  • the term “extracted oil” refers to an oil composition which comprises at least 60% (w/w) oil and which has been extracted from a transgenic organism or part thereof.
  • the term "purified" when used in connection with lipid or oil of the invention typically means that that the extracted lipid or oil has been subjected to one or more processing steps of increase the purity of the lipid/oil component.
  • a purification step may comprise one or more or all of the group consisting of: degumming, deodorising, decolourising, drying and/or fractionating the extracted oil.
  • the term “purified” does not include a transesterification process or other process which alters the fatty acid composition of the lipid or oil of the invention so as to increase the oleic acid content as a percentage of the total fatty acid content.
  • the fatty acid composition of the purified lipid or oil is essentially the same as that of the unpurified lipid or oil.
  • the fatty acid composition of the extracted lipid or oil such as for example the oleic, linoleic and palmitic acid contents, is essentially the same as the fatty acid composition of the lipid or oil in the plant seed from which it is obtained.
  • "essentially the same” means +/- 1%, or, preferably, +/- 0.5%.
  • ODP oleic desaturation proportion
  • ODP (%linoleic + % ⁇ -linolenic) / (% oleic + %linoleic + % a-linolenic)
  • TG603.12(5) of Example 15 has a total linoleic acid and ⁇ -linolenic acid content of 2.15% and an linoleic acid, ⁇ -linolenic acid oleic acid content of 93.88% making the ODP 0.0229.
  • PLO palmitic-linoleic-oleic value
  • TG603.12(5) of Example 15 has a total linoleic acid and palmitic content of 4.71% and an oleic acid content of 91.73% making the PLO 0.0513.
  • OMP oleic monounsaturation proportion
  • OMP (%monounsaturated fatty acids - %oleic) / %oleic
  • TG603.12(5) of Example 15 has a total monounsaturated fatty acid content excluding oleic acid (0.84% 08: 1 ⁇ 11 + 0.29% C20: l) of 1.13% and an oleic acid content of 91.73% making the OMP 0.0123.
  • corresponding refers to a cell, or plant or part thereof (such as a seed) that has the same or similar genetic background as a cell, or plant or part thereof (seed) of the invention but that has not been modified as described herein (for example, the cell, or plant or part thereof lacks an exogenous polynucleotide of the invention).
  • a corresponding cell or, plant or part thereof (seed) can be used as a control to compare, for example, one or more of the amount of oleic acid produced, FAD2 activity, FATB activity or FAD6 activity with a cell, or plant or part thereof (seed) modified as described herein.
  • a person skilled in the art is able to readily determine an appropriate "corresponding" cell, plant or part thereof (seed) for such a comparison.
  • seedoil of, or obtained using, the invention includes seedoil which is present in the seed or portion thereof such as cotyledons or embryo, unless it is referred to as “extracted seedoil” or similar terms in which case it is oil which has been extracted from the seed.
  • the seedoil is preferably extracted seedoil.
  • Seedoil is typically a liquid at room temperature.
  • the total fatty acid (TFA) content in the seedoil is >70% C18 fatty acids, preferably >90% oleic acid (08: 1 ⁇ 9).
  • the fatty acids are typically in an esterified form such as for example, TAG, DAG, acyl-CoA or phospholipid. Unless otherwise stated, the fatty acids may be free fatty acids and/or in an esterified form.
  • At least 50%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99% of the fatty acids in seedoil of the invention can be found as TAG.
  • seedoil of the invention is "substantially purified” or “purified” oil that has been separated from one or more other lipids, nucleic acids, polypeptides, or other contaminating molecules with which it is associated in the seed or in a crude extract.
  • substantially purified seedoil is at least 60% free, more preferably at least 75% free, and more preferably, at least 90% free from other components with which it is associated in the seed or extract.
  • Seedoil of the invention may further comprise non-fatty acid molecules such as, but not limited to, sterols (see Example 17).
  • the seedoil is safflower oil (Carthamus tinctorius), sunflower oil (Helianthus annus), cottonseed oil (Gossypium hirsutum), castor oil (Ricinus communis), canola oil (Brassica napus, Brassica rapa ssp.), mustard oil (Brassica juncea), other Brassica oil (e.g., Brassica napobrassica, Brassica camelina), linseed oil (Linum usitatissimum), soybean oil (Glycine max), corn oil (Zea mays), tobacco oil (Nicotiana tabacum), peanut oil (Arachis hypogaea), palm oil (Elaeis guineensis), coconut oil (Cocos nucifera), avocado oil (Persea americana), olive oil (Olea europaea), cashew oil (Anacardium occidentale), macadamia oil (Macadamia inter grifolia
  • Seedoil may be extracted from seed by any method known in the art. This typically involves extraction with nonpolar solvents such as hexane, diethyl ether, petroleum ether, chloroform/methanol or butanol mixtures, generally associated with first crushing or rolling of the seeds. Lipids associated with the starch in the grain may be extracted with water- saturated butanol.
  • the seedoil may be "de-gummed” by methods known in the art to remove polysaccharides and/or phospholipids or treated in other ways to remove contaminants or improve purity, stability, or colour.
  • the TAGs and other esters in the seedoil may be hydrolysed to release free fatty acids such as by acid or alkali treatment or by the action of lipases, or the seedoil hydrogenated, treated chemically, or enzymatically as known in the art.
  • the seedoil is processed so that it no longer comprises the TAG, it is no longer considered seedoil as referred to herein.
  • the free and esterified sterol for example, sitosterol, campesterol, stigmasterol, brassicasterol, A5-avenasterol, sitostanol, campestanol, and cholesterol
  • concentrations in the purified and/or extracted lipid or oil may be as described in Phillips et al. (2002) and/or as provided in Example 17.
  • Sterols in plant oils are present as free alcohols, esters with fatty acids (esterified sterols), glycosides and acylated glycosides of sterols.
  • Sterol concentrations in naturally occurring vegetable oils (seedoils) ranges up to a maximum of about HOOmg/lOOg.
  • Hydrogenated palm oil has one of the lowest concentrations of naturally occurring vegetable oils at about 60mg/100g.
  • the recovered or extracted seedoils of the invention preferably have between about 100 and about lOOOmg total sterol/lOOg of oil.
  • sterols are present primarily as free or esterified forms rather than glycosylated forms.
  • at least 50% of the sterols in the oils are present as esterified sterols, except for soybean seedoil which has about 25% of the sterols esterified.
  • the safflower seedoil of the invention preferably has between about 150 and about 400mg total sterol/lOOg, typically about 300mg total sterol/lOOg of seedoil, with sitosterol the main sterol.
  • the canola seedoil and rapeseed oil of the invention preferably have between about 500 and about 800 mg total sterol/lOOg, with sitosterol the main sterol and campesterol the next most abundant.
  • the corn seedoil of the invention preferably has between about 600 and about 800 mg total sterol/lOOg, with sitosterol the main sterol.
  • the soybean seedoil of the invention preferably has between about 150 and about 350 mg total sterol/lOOg, with sitosterol the main sterol and stigmasterol the next most abundant, and with more free sterol than esterified sterol.
  • the cottonseed oil of the invention preferably has between about 200 and about 350 mg total sterol/lOOg, with sitosterol the main sterol.
  • the coconut oil and palm oil of the invention preferably have between about 50 and about lOOmg total sterol/lOOg, with sitosterol the main sterol.
  • the peanut seedoil of the invention preferably has between about 100 and about 200mg total sterol/lOOg, with sitosterol the main sterol.
  • the sesame seedoil of the invention preferably has between about 400 and about 600mg total sterol/lOOg, with sitosterol the main sterol.
  • the sunflower seedoil of the invention preferably has between about 200 and 400mg total sterol/lOOg, with sitosterol the main sterol.
  • fatty acid refers to a carboxylic acid with a long aliphatic tail of at least 8 carbon atoms in length, either saturated or unsaturated. Typically, fatty acids have a carbon-carbon bonded chain of at least 12 carbons in length. Most naturally occurring fatty acids have an even number of carbon atoms because their biosynthesis involves acetate which has two carbon atoms.
  • the fatty acids may be in a free state (non-esterified) or in an esterified form such as part of a TAG, DAG, MAG, acyl-CoA (thio-ester) bound, or other covalently bound form.
  • the fatty acid is referred to herein as an "acyl" group.
  • the fatty acid may be esterified as a phospholipid such as a phosphatidylcholine (PC), phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol, or diphosphatidylglycerol.
  • PC phosphatidylcholine
  • phosphatidylethanolamine phosphatidylethanolamine
  • phosphatidylserine phosphatidylglycerol
  • phosphatidylinositol phosphatidylglycerol
  • Saturated fatty acids do not contain any double bonds or other functional groups along the chain.
  • saturated refers to hydrogen, in that all carbons (apart from the carboxylic acid [-COOH] group) contain as many hydrogens as possible.
  • the omega ( ⁇ ) end contains 3 hydrogens (CH3-) and each carbon within the chain contains 2 hydrogens (-CH2-).
  • polyunsaturated fatty acid or “PUFA” refer to a fatty acid which comprises at least 12 carbon atoms in its carbon chain and at least two alkene groups (carbon-carbon double bonds).
  • ounsaturated fatty acids refers to fatty acids that have a single double bond in their acyl chain, such as oleic acid (08: 1 ⁇ 9), C18: 1D11 and C20: l.
  • Triacylglyceride or “TAG” is glyceride in which the glycerol is esterified with three fatty acids.
  • DAG is formed as described above, and then a third acyl group is esterified to the glycerol backbone by the activity of DGAT.
  • Alternative pathways for formation of TAG include one catalysed by the enzyme PDAT and the MGAT pathway (PCT/AU2011/000794).
  • DAG is glyceride in which the glycerol is esterified with two fatty acids.
  • DAG comprises a hydroxyl group at a sn-l,3 or sn- 1,2/2,3 position, and therefore DAG does not include phosphorylated molecules such as PA or PC. DAG is thus a component of neutral lipids in a cell.
  • the precursor sTi-glycerol-3-phosphate (G-3-P) is esterified to two acyl groups, each coming from a fatty acid coenzyme A ester, in a first reaction catalysed by a glycerol- 3 -phosphate acyltransferase (GPAT) at position sn-l to form LysoPA, followed by a second acylation at position sn-2 catalysed by a lysophosphatidic acid acyltransferase (LPAAT) to form phosphatidic acid (PA).
  • GPAT glycerol- 3 -phosphate acyltransferase
  • LPAAT lysophosphatidic acid acyltransferase
  • This intermediate is then de-phosphorylated to form DAG.
  • DAG may be formed by the acylation of either sn- 1 MAG or preferably sn-2 MAG, catalysed by MGAT.
  • DAG may also be formed from TAG by removal of an acyl group by a lipase, or from PC essentially by removal of a choline headgroup by any of the enzymes CPT, PDCT or PLC.
  • the term "desaturase” refers to an enzyme which is capable of introducing a carbon-carbon double bond into the acyl group of a fatty acid substrate which is typically in an esterified form such as, for example, fatty acid CoA esters.
  • the acyl group may be esterified to a phospholipid such as phosphatidylcholine (PC), or to acyl carrier protein (ACP), to CoA, or in a preferred embodiment to PC.
  • Desaturases generally may be categorized into three groups accordingly. In one embodiment, the desaturase is a front-end desaturase.
  • ⁇ 12 desaturase and “FAD2” refer to a membrane bound ⁇ 12 fatty acid desturase which performs a desaturase reaction converting oleic acid (18: 1 ⁇ 9 ) to linoleic acid (C18:2 A9 ' 12 ).
  • ⁇ 12 desaturase activity refers to the conversion of oleic acid to linoleic acid.
  • These fatty acids may be in an esterified form, such as, for example, as part of a phospholipid, preferably in the form of PC.
  • a FAD2 enzyme as defined herein comprises three histidine- rich motifs (His boxes) (see Table 5 for examples of His boxes of enzymes of the invention).
  • His-rich motifs are highly conserved in FAD2 enzymes and have been implicated in the formation of the diiron-oxygen complex used in biochemical catalysis (Shanklin et al., 1998).
  • FAD2-1 and “CtFAD2-l” and variations thereof refer to a safflower FAD2 polypeptide whose amino acid sequence is provided as SEQ ID NO:27, such as a polypeptide encoded by nucleotides having a sequence provided as SEQ ID NO: 12.
  • a FAD2-1 gene is a gene encoding such a polypeptide or a mutant allele thereof. These terms also include naturally occurring or artificially induced or produced variants of the sequences provided.
  • FAD2-1 of the invention comprises an amino acid sequence which is at least 95% identical, more preferably at least 99% identical, to the sequence provided as SEQ ID NO:27.
  • GFAD2-1 genes include alleles which are mutant, that is, that encode polypeptides with altered desaturase activity such as reduced activity, or do not encode functional polypeptides (null alleles). Such alleles may be naturally occurring or induced by artificial mutagenesis. An example of such an allele is the FAD2-1 ol allele described herein.
  • FAD2-2 and “QFAD2-2” and variations thereof refer to a safflower FAD2 polypeptide whose amino acid sequence is provided as SEQ ID NO:28, such as a polypeptide encoded by nucleotides having a sequence provided as SEQ ID NO: 13.
  • a FAD2-2 gene is a gene encoding such a polypeptide or a mutant allele thereof. These terms also include naturally occurring or artificially induced or produced variants of the sequences provided.
  • FAD2-2 of the invention comprises an amino acid sequence which is at least 95% identical, more preferably at least 99% identical, to the sequence provided as SEQ ID NO:28.
  • GFAD2-2 genes include alleles which are mutant, that is, that encode polypeptides with altered desaturase activity such as reduced activity, or do not encode functional polypeptides (null alleles). Such alleles may be naturally occurring or induced by artificial mutagenesis.
  • FAD2-10 and “CtFAD2-10” and variations thereof refer to a safflower FAD2 polypeptide whose amino acid sequence is provided as SEQ ID NO:36, such as a polypeptide encoded by nucleotides having a sequence provided as SEQ ID NO:21.
  • a FAD2-10 gene is a gene encoding such a polypeptide or a mutant allele thereof. These terms also include naturally occurring or artificially induced or produced variants of the sequences provided.
  • FAD2-10 of the invention comprises an amino acid sequence which is at least 95% identical, more preferably at least 99% identical, to the sequence provided as SEQ ID NO:36.
  • CtFAD2-10 genes include alleles which are mutant, that is, that encode polypeptides with altered desaturase activity such as reduced activity, or do not encode functional polypeptides (null alleles). Such alleles may be naturally occurring or induced by artificial mutagenesis.
  • the term "palmitoyl-ACP thioesterase” and “FATB” refer to a protein which hydrolyses palmitoyl-ACP to produce free palmitic acid.
  • the term “palmitoyl-ACP thioesterase activity” refers to the hydrolysis of palmitoyl-ACP to produce free palmitic acid.
  • FATB-3 and “CtFATB-3” and variations thereof refer to a safflower FATB polypeptide whose amino acid sequence is provided as SEQ ID NO:45, such as a polypeptide encoded by nucleotides having a sequence provided as SEQ ID NO:43.
  • a FATB-3 gene is a gene encoding such a polypeptide or a mutant allele thereof. These terms also include naturally occurring or artificially induced or produced variants of the sequences provided.
  • FATB-3 of the invention comprises an amino acid sequence which is at least 95% identical, more preferably at least 99% identical, to the sequence provided as SEQ ID NO:45.
  • CtFATB-3 genes include alleles which are mutant, that is, that encode polypeptides with altered palmitoyl-ACP thioesterase activity such as reduced activity, or do not encode functional polypeptides (null alleles). Such alleles may be naturally occurring or induced by artificial mutagenesis.
  • plastidial co6 fatty acid desaturase As used herein, "plastidial co6 fatty acid desaturase", variations thereof, and “FAD6” refer to a chloroplast enzyme that desaturates 16: 1 and 18: 1 fatty acids to 16:2 and 18:2, respectively, on all 16: 1- or 18: l-containing chloroplast membrane lipids including phosphatidyl glycerol, monogalactosyldiacylglycerol, digalactosyl- diacylglycerol, and sulfoguinovosyldiacylglycerol.
  • FAD6 and “CtFAD6” and variations thereof refer to a safflower FAD6 polypeptide whose amino acid sequence is provided as SEQ ID NO:48, such as a polypeptide encoded by nucleotides having a sequence provided as SEQ ID NO:47.
  • a FAD6 gene is a gene encoding such a polypeptide or a mutant allele thereof. These terms also include naturally occurring or artificially induced or produced variants of the sequences provided.
  • FAD6 of the invention comprises an amino acid sequence which is at least 95% identical, more preferably at least 99% identical, to the sequence provided as SEQ ID NO:48.
  • CtFAD6 genes include alleles which are mutant, that is, that encode polypeptides with altered desaturase activity such as reduced activity, or do not encode functional polypeptides (null alleles). Such alleles may be naturally occurring or induced by artificial mutagenesis.
  • acetylenase or "fatty acid acetylenase” refers to an enzyme that introduces a triple bond into a fatty acid resulting in the production of an acetylenic fatty acid.
  • Ct is used herein before terms such as FAD2, FATB and FAD6 to indicate the enzyme/gene is from safflower.
  • RNA which is capable of reducing the expression of refers to a polynucleotide that encodes an RNA molecule that reduces (down-regulates) the production and/or activity (for example, encoding an siRNA, hpRNAi), or itself down regulates the production and/or activity (for example, is an siRNA which can be delivered directly to, for example, a cell) of an endogenous enzyme for example, a ⁇ 12 desaturase, a palmitoyl-ACP thioesterase, a plastidial co6 fatty acid desaturase, or a combination of two or more or all three thereof.
  • an endogenous enzyme for example, a ⁇ 12 desaturase, a palmitoyl-ACP thioesterase, a plastidial co6 fatty acid desaturase, or a combination of two or more or all three thereof.
  • the silencing RNA is an exogenous RNA which is produced from a transgene in the cell and which transcriptionally and/or post-transcriptionally reduces the amount of the endogenous enzyme that is produced in the cell, such as by reducing the amount of mRNA encoding the endogenous enzyme or reducing its translation.
  • the silencing RNA is typically an RNA of 21-24 nucleotides in length which is complementary to the endogenous mRNA and which may be associated with a silencing complex known as a RISC in the cell.
  • mutation(s) reduce the activity of refers to naturally occurring or man-made mutants (such as produced by chemical mutagenesis or site- specific mutagenesis) which have lower levels of the defined enzymatic activity (for example, FAD2 enzymatic activity in the seed) when compared to phenotypically normal seeds (for example, seeds which produce FAD2 enzymes which comprise the amino acid sequences provided as SEQ ID NOs 27, 28 and 36).
  • phenotypically normal safflower varieties include, but are not limited to, Centennial, Finch, Nutrasaff and Cardinal.
  • Knowles (1968) incorporated the ol allele into a safflower breeding program and released the first high oleic (HO) safflower variety "UC-1 " in 1966 in the US, which was followed by the release of improved varieties "Oleic Leed” and the Saffola series including Saffola 317 (S-317), S-517 and S-518.
  • the high oleic (olol) genotypes were relatively stable in the oleic acid level when grown at different temperatures in the field (Bartholomew, 1971).
  • Knowles (1972) also described a different allele oh at the same locus, which produced in homozygous condition between 35 and 50% oleic acid.
  • the ohoh genotype showed a strong response to temperature (Knowles, 1972).
  • the allele of the ol mutation which confers reduced FAD2-1 activity (and overall FAD2 activity) in safflower seed is a mutant FAD2-1 gene comprising the frameshift mutation (due to deletion of a single nucleotide) depicted in Figure 6 (see also Example 7 and SEQ ID NOs 26 and 38).
  • the phrase "which is capable of producing a plant which produces seed whose oil content comprises” or "which is capable of producing a plant which produces oilseed whose oil content” or variations thereof means that the plant produced from the seed, preferably an oilseed plant and more preferably a safflower plant, has the capacity to produce the oil with the defined components when grown under optimal conditions, for instance in greenhouse conditions such as those referred to in the Examples.
  • the progeny plant When in possession of seed from a plant, it is routine to grow a progeny plant from at least one of the seeds under suitable greenhouse conditions and test the oil content and fatty acid composition in seedoil from the progeny plant using standard procedures such as those described herein.
  • seed grown in a field may not meet all of the requirements defined herein due to unfavourable conditions in a particular year such heat, cold, drought, flooding, frost, pest stresses etc, such seed are nonetheless encompassed by the present invention because the seed is capable of producing a progeny plant which produces the defined oil content or fatty acid composition when grown under more favourable conditions.
  • the term "by weight” refers to the weight of a substance (for example, oleic acid, palmitic acid or PUFA such as linoleic acid or linolenic acid) as a percentage of the weight of the composition comprising the substance or a component in the composition.
  • a substance for example, oleic acid, palmitic acid or PUFA such as linoleic acid or linolenic acid
  • the weight of a particular fatty acid such as oleic acid may be determined as a percentage of the weight of the total fatty acid content of the lipid or seedoil, or the seed.
  • biofuel refers to any type of fuel, typically as used to power machinery such as automobiles, trucks or petroleum powered motors, whose energy is derived from biological carbon fixation rather than from fossil fuel.
  • Biofuels include fuels derived from biomass conversion, as well as solid biomass, liquid fuels and biogases.
  • Examples of biofuels include bioalcohols, biodiesel, synthetic diesel, vegetable oil, bioethers, biogas, syngas, solid biofuels, algae-derived fuel, biohydrogen, biomethanol, 2,5-Dimethylfuran (DMF), biodimethyl ether (bioDME), Fischer- Tropsch diesel, biohydrogen diesel, mixed alcohols and wood diesel.
  • the term "industrial product” refers to a hydrocarbon product which is predominantly made of carbon and hydrogen such as fatty acid methyl- and/or ethyl-esters or alkanes such as methane, mixtures of longer chain alkanes which are typically liquids at ambient temperatures, a biofuel, carbon monoxide and/or hydrogen, or a bioalcohol such as ethanol, propanol, or butanol, or biochar.
  • the term "industrial product” is intended to include intermediary products that can be converted to other industrial products, for example, syngas is itself considered to be an industrial product which can be used to synthesize a hydrocarbon product which is also considered to be an industrial product.
  • the term industrial product as used herein includes both pure forms of the above compounds, or more commonly a mixture of various compounds and components, for example the hydrocarbon product may contain a range of carbon chain lengths, as well understood in the art.
  • polynucleotide and “nucleic acid” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides.
  • a polynucleotide of the invention may be of genomic, cDNA, semisynthetic, or synthetic origin, double- stranded or single- stranded and by virtue of its origin or manipulation: (1) is not associated with all or a portion of a polynucleotide with which it is associated in nature, (2) is linked to a polynucleotide other than that to which it is linked in nature, or (3) does not occur in nature.
  • polynucleotides coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), ribozymes, cDNA, recombinant polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, chimeric DNA of any sequence, nucleic acid probes, and primers.
  • loci defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), ribozymes, cDNA, recombinant polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, chimeric DNA of any sequence, nucleic acid probes, and primers.
  • Preferred polynucleotides of the invention include double
  • the term "gene” is to be taken in its broadest context and includes the deoxyribonucleotide sequences comprising the transcribed region and, if translated, the protein coding region, of a structural gene and including sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of at least about 2 kb on either end and which are involved in expression of the gene.
  • the gene includes control signals such as promoters, enhancers, termination and/or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals, in which case, the gene is referred to as a "chimeric gene".
  • sequences which are located 5' of the protein coding region and which are present on the mRNA are referred to as 5' non-translated sequences.
  • sequences which are located 3' or downstream of the protein coding region and which are present on the mRNA are referred to as 3' non-translated sequences.
  • the term "gene” encompasses both cDNA and genomic forms of a gene.
  • a genomic form or clone of a gene contains the coding region which may be interrupted with non-coding sequences termed "introns", “intervening regions", or “intervening sequences.”
  • Introns are segments of a gene which are transcribed into nuclear RNA (nRNA). Introns may contain regulatory elements such as enhancers.
  • Introns are removed or "spliced out” from the nuclear or primary transcript; introns therefore are absent in the mRNA transcript.
  • the mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
  • the term "gene” includes a synthetic or fusion molecule encoding all or part of the proteins of the invention described herein and a complementary nucleotide sequence to any one of the above.
  • an “allele” refers to one specific form of a genetic sequence (such as a gene) within a cell, an individual plant or within a population, the specific form differing from other forms of the same gene in the sequence of at least one, and frequently more than one, variant sites within the sequence of the gene.
  • the sequences at these variant sites that differ between different alleles are termed "variances", “polymorphisms”, or “mutations”.
  • chimeric DNA refers to any DNA molecule that is not naturally found in nature; also referred to herein as a "DNA construct".
  • chimeric DNA comprises regulatory and transcribed or protein coding sequences that are not naturally found together in nature.
  • chimeric DNA may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
  • the open reading frame may or may not be linked to its natural upstream and downstream regulatory elements.
  • the open reading frame may be incorporated into, for example, the plant genome, in a non- natural location, or in a replicon or vector where it is not naturally found such as a bacterial plasmid or a viral vector.
  • chimeric DNA is not limited to DNA molecules which are replicable in a host, but includes DNA capable of being ligated into a replicon by, for example, specific adaptor sequences.
  • transgene is a gene that has been introduced into the genome by a transformation procedure.
  • the transgene may be in an initial transformed plant produced by regeneration from a transformed plant cell or in progeny plants produced by self-fertilisation or crossing from the initial transformant or in plant parts such as seeds.
  • the term "genetically modified” and variations thereof include introducing a gene into a cell by transformation or transduction, mutating a gene in a cell and genetically altering or modulating the regulation of a gene in a cell, or the progeny of any cell modified as described above.
  • a “genomic region” as used herein refers to a position within the genome where a transgene, or group of transgenes (also referred to herein as a cluster), have been inserted into a cell, or predecessor thereof, such that they are co-inherited in progeny cells after meiosis.
  • a "recombinant polynucleotide” or “exogenous polynucleotide” of the invention refers to a nucleic acid molecule which has been constructed or modified by artificial recombinant methods.
  • the recombinant polynucleotide may be present in a cell in an altered amount or expressed at an altered rate (e.g., in the case of mRNA) compared to its native state.
  • An exogenous polynucleotide is a polynucleotide that has been introduced into a cell that does not naturally comprise the polynucleotide.
  • exogenous DNA is used as a template for transcription of mRNA which is then translated into a continuous sequence of amino acid residues coding for a polypeptide of the invention within the transformed cell.
  • part of the exogenous polynucleotide is endogenous to the cell and its expression is altered by recombinant means, for example, an exogenous control sequence is introduced upstream of an endogenous polynucleotide to enable the transformed cell to express the polypeptide encoded by the polynucleotide.
  • an exogenous polynucleotide may express an antisense RNA to an endogenous polynucleotide.
  • a recombinant polynucleotide of the invention includes polynucleotides which have not been separated from other components of the cell-based or cell-free expression system in which it is present, and polynucleotides produced in said cell- based or cell-free systems which are subsequently purified away from at least some other components.
  • the polynucleotide can be a contiguous stretch of nucleotides existing in nature, or comprise two or more contiguous stretches of nucleotides from different sources (naturally occurring and/or synthetic) joined to form a single polynucleotide.
  • such chimeric polynucleotides comprise at least an open reading frame encoding a polypeptide of the invention operably linked to a promoter suitable of driving transcription of the open reading frame in a cell of interest.
  • the polynucleotide comprises a polynucleotide sequence which is at least 50%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%
  • a polynucleotide of, or useful for, the present invention may selectively hybridise, under stringent conditions, to a polynucleotide defined herein.
  • stringent conditions are those that: (1) employ during hybridisation a denaturing agent such as formamide, for example, 50% (v/v) formamide with 0.1% (w/v) bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (2) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1%
  • Polynucleotides of the invention may possess, when compared to naturally occurring molecules, one or more mutations which are deletions, insertions, or substitutions of nucleotide residues.
  • Polynucleotides which have mutations relative to a reference sequence can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis or DNA shuffling on the nucleic acid as described above).
  • the cell/seed/plant/organism of the invention comprises an introduced mutation or an exogenous polynucleotide which down-regulates the production and/or activity of an endogenous enzyme, typically which results in an increased production of oleic acid, and preferably a decreased production of palmitic acid and PUFA such as linoleic acid, when compared to a corresponding cell lacking the introduced mutation or exogenous polynucleotide.
  • polynucleotides examples include an antisense polynucleotide, a sense polynucleotide, a catalytic polynucleotide, a microRNA, a polynucleotide which encodes a polypeptide which binds the endogenous enzyme and a double stranded RNA.
  • RNA interference is particularly useful for specifically inhibiting the production of a particular protein.
  • This technology relies on the presence of dsRNA molecules that contain a sequence that is essentially identical to the mRNA of the gene of interest or part thereof and a sequence that is complementary thereto.
  • the dsRNA can be produced from a single promoter in a recombinant vector or host cell, where the sense and anti-sense sequences are covalently joined by a sequence, preferably an unrelated sequence, which enables the sense and anti- sense sequences in the corresponding transcript to hybridize to form the dsRNA molecule with the joining sequence forming a loop structure, although a sequence with identity to the target RNA or its complement can form the loop structure.
  • the dsRNA is encoded by a double- stranded DNA construct which has sense and antisense sequences in an inverted repeat structure, arranged as an interrupted palindrome, where the repeated sequences are transcribed to produce the hybridising sequences in the dsRNA molecule, and the interrupt sequence is transcribed to form the loop in the dsRNA molecule.
  • the design and production of suitable dsRNA molecules is well within the capacity of a person skilled in the art, particularly considering Waterhouse et al. (1998), Smith et al. (2000), WO 99/32619, WO 99/53050, WO 99/49029, and WO 01/34815.
  • a DNA is introduced that directs the synthesis of an at least partly double stranded RNA product(s) with homology, preferably at least 19 consecutive nucleotides complementary to a region of, a target RNA, to be inactivated.
  • the DNA therefore comprises both sense and antisense sequences that, when transcribed into RNA, can hybridize to form the double stranded RNA region.
  • the sense and antisense sequences are separated by a spacer region that comprises an intron which, when transcribed into RNA, is spliced out. This arrangement has been shown to result in a higher efficiency of gene silencing.
  • the double stranded RNA region may comprise one or two RNA molecules, transcribed from either one DNA region or two.
  • the presence of the double stranded molecule is thought to trigger a response from an endogenous system that destroys both the double stranded RNA and also the homologous RNA transcript from the target gene, efficiently reducing or eliminating the activity of the target gene.
  • the length of the sense and antisense sequences that hybridize should each be at least 19 contiguous nucleotides, corresponding to part of the target mRNA.
  • the full- length sequence corresponding to the entire gene transcript may be used.
  • the degree of identity of the sense and antisense sequences to the targeted transcript should be at least 85%, at least 90%, or at least 95% tol00%.
  • the RNA molecule may of course comprise unrelated sequences which may function to stabilize the molecule.
  • the RNA molecule may be expressed under the control of a RNA polymerase II or RNA polymerase III promoter. Examples of the latter include tRNA or snRNA promoters.
  • Preferred small interfering RNA (“siRNA”) molecules comprise a nucleotide sequence that is identical to about 19-21 contiguous nucleotides of the target mRNA.
  • the siRNA sequence commences with the dinucleotide AA, comprises a GC-content of about 30-70% (preferably, 30-60%, more preferably 40-60% and more preferably about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target in the genome of the organism in which it is to be introduced, for example, as determined by standard BLAST search.
  • a dsRNA of the invention comprises a nucleotide sequence provided as any one of SEQ ID NOs 49 to 51 (where each T is a U).
  • MicroRNAs are generally 19-25 nucleotides (commonly about 20-24 nucleotides in plants) non-coding RNA molecules that are derived from larger precursors that form imperfect stem-loop structures.
  • miRNAs bind to complementary sequences on target messenger RNA transcripts (mRNAs), usually resulting in translational repression or target degradation and gene silencing.
  • mRNAs target messenger RNA transcripts
  • miRNA precursor molecules are believed to be initially processed in the nucleus.
  • the pri-miRNA (containing one or more local double- stranded or "hairpin” regions as well as the usual 5' "cap” and polyadenylated tail of an mRNA) is processed to a shorter miRNA precursor molecule that also includes a stem-loop or fold-back structure and is termed the "pre-miRNA".
  • the pre-miRNAs are cleaved by distinct DICER-like (DCL) enzymes, in particular DCL-1, yielding miRNA:miRNA* duplexes. Prior to transport out of the nucleus, these duplexes are methylated.
  • DCL DICER-like enzymes
  • the miRNA strand from the miRNA:miRNA duplex is selectively incorporated into an active RNA-induced silencing complex (RISC) for target recognition.
  • RISC RNA-induced silencing complex
  • the RISC-complexes contain a particular subset of Argonaute proteins that exert sequence- specific gene repression post-transcriptionally (see, for example, Millar and Waterhouse, 2005; Pasquinelli et al., 2005; Almeida and Allshire, 2005). Cosuppression
  • homology-dependent gene silencing Genes can suppress the expression of related endogenous genes and/or transgenes already present in the genome, a phenomenon termed homology-dependent gene silencing. Most of the instances of homology dependent gene silencing fall into two classes - those that function at the level of transcription of the transgene, and those that operate post-transcriptionally.
  • Cosuppression Post-transcriptional homology-dependent gene silencing describes the loss of expression of a transgene and related endogenous or viral genes in transgenic plants. Cosuppression often, but not always, occurs when transgene transcripts are abundant, and it is generally thought to be triggered at the level of mRNA processing, localization, and/or degradation. Several models exist to explain how cosuppression works (see in Taylor, 1997). Cosuppression involves introducing an extra copy of a gene or a fragment thereof into a plant in the sense orientation with respect to a promoter for its expression. A skilled person would appreciate that the size of the sense fragment, its correspondence to target gene regions, and its degree of sequence identity to the target gene can vary. In some instances, the additional copy of the gene sequence interferes with the expression of the target plant gene. Reference is made to WO 97/20936 and EP 0465572 for methods of implementing co- suppression approaches.
  • an "expression vector” is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of one or more specified polynucleotides.
  • the expression vector is also capable of replicating within the host cell or being integrated into the host cell genome.
  • Expression vectors are typically viruses or plasmids.
  • Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in host cells of the present invention, including in fungal, algal, and plant cells.
  • operably linked refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of transcriptional regulatory element (promoter) to a transcribed sequence.
  • a promoter is operably linked to a coding sequence of a polynucleotide defined herein, if it stimulates or modulates the transcription of the coding sequence in an appropriate cell.
  • promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are ds-acting.
  • some transcriptional regulatory elements such as enhancers, need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
  • Expression vectors of the present invention contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the host cell and that control the expression of polynucleotides of the present invention.
  • expression vectors of the present invention include transcription control sequences.
  • Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription.
  • Particularly important transcription control sequences are those which control transcription initiation such as promoter, enhancer, operator and repressor sequences.
  • Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. The choice of the regulatory sequences used depends on the target organism such as a plant and/or target organ or tissue of interest.
  • Such regulatory sequences may be obtained from any eukaryotic organism such as plants or plant viruses, or may be chemically synthesized.
  • a variety of such transcription control sequences are known to those skilled in the art.
  • Particularly preferred transcription control sequences are promoters active in directing transcription in plants, either constitutively or stage and/or tissue specific, depending on the use of the plant or part(s) thereof.
  • plant expression vectors include for example, one or more cloned plant genes under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker.
  • Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
  • a promoter regulatory region e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression
  • Suitable promoters for constitutive expression in plants include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter, the Figwort mosaic virus (FMV) 35S, the sugarcane bacilliform virus promoter, the commelina yellow mottle virus promoter, the light-inducible promoter from the small subunit of the ribulose-l,5-bis-phosphate carboxylase, the rice cytosolic triosephosphate isomerase promoter, the adenine phosphoribosyltransferase promoter of Arabidopsis, the rice actin 1 gene promoter, the mannopine synthase and octopine synthase promoters, the Adh promoter, the sucrose synthase promoter, the R gene complex promoter, and the chlorophyll ⁇ / ⁇ binding protein gene promoter. These promoters have been used to create DNA vectors that have been expressed in plants, see for
  • promoters utilized in the present invention have relatively high expression in these specific tissues.
  • promoters for genes with tissue- or cell- specific, or -enhanced expression. Examples of such promoters reported in the literature include, the chloroplast glutamine synthetase GS2 promoter from pea, the chloroplast fructose- 1,6- biphosphatase promoter from wheat, the nuclear photo synthetic ST-LSl promoter from potato, the serine/threonine kinase promoter and the glucoamylase (CHS) promoter from Arabidopsis thaliana.
  • CHS glucoamylase
  • RNA-binding protein genes in plant cells, including promoters regulated by (1) heat, (2) light (e.g., pea RbcS-3A promoter, maize RbcS promoter), (3) hormones such as abscisic acid, (4) wounding (e.g., Wunl), or (5) chemicals such as methyl jasmonate, salicylic acid, steroid hormones, alcohol, Safeners (WO 97/06269), or it may also be advantageous to employ (6) organ- specific promoters.
  • heat e.g., pea RbcS-3A promoter, maize RbcS promoter
  • hormones such as abscisic acid
  • (4) wounding e.g., Wunl
  • chemicals e.g., methyl jasmonate, salicylic acid, steroid hormones, alcohol, Safeners (WO 97/06269), or it may also be advantageous to employ (6) organ- specific promoters.
  • plant storage organ specific promoter refers to a promoter that preferentially, when compared to other plant tissues, directs gene transcription in a storage organ of a plant.
  • the plant storage organ is preferably a seed.
  • the promoter only directs expression of a gene of interest in the storage organ, and/or expression of the gene of interest in other parts of the plant such as leaves is not detectable by Northern blot analysis and/or RT-PCR.
  • the promoter drives expression of genes during growth and development of the storage organ, in particular during the phase of synthesis and accumulation of storage compounds in the storage organ.
  • Such promoters may drive gene expression in the entire plant storage organ or only part thereof such as the seedcoat, embryo or cotyledon(s) in seeds of dicotyledonous plants or the endosperm or aleurone layer of seeds of monocotyledonous plants.
  • promoters can also be used to express a protein in specific tissues such as seeds or fruits.
  • the promoter for ⁇ -conglycinin or other seed-specific promoters such as the napin, zein, linin and phaseolin promoters, can be used.
  • the promoter directs expression in tissues and organs in which lipid biosynthesis take place. Such promoters act in seed development at a suitable time for modifying lipid composition in seeds.
  • the plant storage organ specific promoter is a seed specific promoter.
  • the promoter preferentially directs expression in the embryo and/or cotyledons of a dicotyledonous plant or in the endosperm of a monocotyledonous plant, relative to expression in other organs in the plant such as leaves.
  • Preferred promoters for seed-specific expression include: 1) promoters from genes encoding enzymes involved in lipid biosynthesis and accumulation in seeds such as desaturases and elongases, 2) promoters from genes encoding seed storage proteins, and 3) promoters from genes encoding enzymes involved in carbohydrate biosynthesis and accumulation in seeds.
  • Seed specific promoters which are suitable are, a flax linin promoter (e.g.
  • oilseed rape napin gene promoter (US 5,608,152), the Vicia faba USP promoter (Baumlein et al., 1991), the Arabidopsis oleosin promoter (WO 98/45461), the Phaseolus vulgaris phaseolin promoter (US 5,504,200), the Brassica Bce4 promoter (WO 91/13980), or the legumin B4 promoter (Baumlein et al., 1992), and promoters which lead to the seed-specific expression in monocots such as maize, barley, wheat, rye, rice and the like.
  • Notable promoters which are suitable are the barley lpt2 or lptl gene promoter (WO 95/15389 and WO 95/23230), or the promoters described in WO 99/16890 (promoters from the barley hordein gene, the rice glutelin gene, the rice oryzin gene, the rice prolamin gene, the wheat gliadin gene, the wheat glutelin gene, the maize zein gene, the oat glutelin gene, the sorghum kasirin gene, the rye secalin gene).
  • Other promoters include those described by Broun et al. (1998), Potenza et al. (2004), US 20070192902 and US 20030159173.
  • the seed specific promoter is preferentially expressed in defined parts of the seed such as the embryo, cotyledon(s) or the endosperm.
  • cotyledon specific promoters include, but are not limited to, the FP1 promoter (Ellerstrom et al., 1996), the pea legumin promoter (Perrin et al., 2000), and the bean phytohemagglutnin promoter (Perrin et al., 2000).
  • the seed specific promoter is not expressed, or is only expressed at a low level, in the embryo and/or after the seed germinates.
  • each promoter may independently be the same or different.
  • the 5' non-translated leader sequence can be derived from the promoter selected to express the heterologous gene sequence of the polynucleotide, or may be heterologous with respect to the coding region of the enzyme to be produced, and can be specifically modified if desired so as to increase translation of mRNA.
  • the termination of transcription is accomplished by a 3' non-translated DNA sequence operably linked in the expression vector to the polynucleotide of interest.
  • the 3' non-translated region of a recombinant DNA molecule contains a polyadenylation signal that functions in plants to cause the addition of adenylate nucleotides to the 3' end of the RNA.
  • the 3' non-translated region can be obtained from various genes that are expressed in, for example, plant cells.
  • the nopaline synthase 3' untranslated region, the 3' untranslated region from pea small subunit Rubisco gene, the 3' untranslated region from soybean 7S seed storage protein gene are commonly used in this capacity.
  • the 3' transcribed, non-translated regions containing the polyadenylate signal of Agrobacterium tumor-inducing (Ti) plasmid genes are also suitable.
  • Recombinant DNA technologies can be used to improve expression of a transformed polynucleotide by manipulating for example, the number of copies of the polynucleotide within a host cell, the efficiency with which those polynucleotide are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications.
  • the recombinant vector desirably comprises a selectable or screenable marker gene as, or in addition to, the nucleic acid sequence of a polynucleotide defined herein.
  • marker gene is meant a gene that imparts a distinct phenotype to cells expressing the marker gene and thus, allows such transformed cells to be distinguished from cells that do not have the marker.
  • a selectable marker gene confers a trait for which one can "select” based on resistance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment damaging to untransformed cells).
  • a screenable marker gene confers a trait that one can identify through observation or testing, that is, by "screening” (e.g., ⁇ -glucuronidase, luciferase, GFP or other enzyme activity not present in untransformed cells).
  • Screening e.g., ⁇ -glucuronidase, luciferase, GFP or other enzyme activity not present in untransformed cells.
  • the marker gene and the nucleotide sequence of interest do not have to be linked, since co-transformation of unlinked genes as for example, described in US 4,399,216, is also an efficient process in for example, plant transformation.
  • the actual choice of a marker is not crucial as long as it is functional (i.e., selective) in combination with the cells of choice such as a plant cell.
  • Exemplary selectable markers for selection of plant transformants include, but are not limited to, a hyg gene which encodes hygromycin B resistance; a neomycin phosphotransferase (nptlT) gene conferring resistance to kanamycin, paromomycin, G418; a glutathione-S-transferase gene from rat liver conferring resistance to glutathione derived herbicides as for example, described in EP 256223; a glutamine synthetase gene conferring, upon overexpression, resistance to glutamine synthetase inhibitors such as phosphinothricin as for example, described in WO 87/05327; an acetyltransferase gene from Streptomyces viridochromogenes conferring resistance to the selective agent phosphinothricin as for example, described in EP 275957; a gene encoding a 5-enolshikimate-3-phosphate synthase (EPSPS
  • a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker
  • Preferred screenable markers include, but are not limited to, a uidA gene encoding a ⁇ -glucuronidase (GUS) enzyme for which various chromogenic substrates are known; a ⁇ -galactosidase gene encoding an enzyme for which chromogenic substrates are known; an aequorin gene (Prasher et al., 1985) which may be employed in calcium-sensitive bioluminescence detection; a green fluorescent protein gene (Niedz et al., 1995) or derivatives thereof; or a luciferase (luc) gene (Ow et al., 1986) which allows for bioluminescence detection.
  • reporter molecule it is meant a molecule that, by its chemical nature, provides an analytically identifiable signal that facilitates determination of promoter activity by reference to protein product.
  • the recombinant vector is stably incorporated into the genome of the cell such as the plant cell.
  • the recombinant vector may comprise appropriate elements which allow the vector to be incorporated into the genome, or into a chromosome of the cell.
  • Transfer nucleic acids can be used to deliver an exogenous polynucleotide to a cell and comprise one, preferably two, border sequences and a polynucleotide of interest.
  • the transfer nucleic acid may or may not encode a selectable marker.
  • the transfer nucleic acid forms part of a binary vector in a bacterium, where the binary vector further comprises elements which allow replication of the vector in the bacterium, selection, or maintenance of bacterial cells containing the binary vector.
  • the transfer nucleic acid component of the binary vector is capable of integration into the genome of the eukaryotic cell.
  • extrachromosomal transfer nucleic acid refers to a nucleic acid molecule that is capable of being transferred from a bacterium such as Agwbacterium sp., to a eukaryotic cell such as a plant cell.
  • An extrachromosomal transfer nucleic acid is a genetic element that is well-known as an element capable of being transferred, with the subsequent integration of a nucleotide sequence contained within its borders into the genome of the recipient cell.
  • a transfer nucleic acid is flanked, typically, by two "border” sequences, although in some instances a single border at one end can be used and the second end of the transferred nucleic acid is generated randomly in the transfer process.
  • a polynucleotide of interest is typically positioned between the left border-like sequence and the right border-like sequence of a transfer nucleic acid.
  • the polynucleotide contained within the transfer nucleic acid may be operably linked to a variety of different promoter and terminator regulatory elements that facilitate its expression, that is, transcription and/or translation of the polynucleotide.
  • Transfer DNAs from Agwbacterium sp. such as Agrobacterium tumefaciens or Agrobacterium rhizogenes, and man made variants/mutants thereof are probably the best characterized examples of transfer nucleic acids.
  • P-DNA plant-DNA
  • plant-DNA comprises T-DNA border-like sequences from plants.
  • T-DNA refers to for example, T-DNA of an Agrobacterium tumefaciens Ti plasmid or from an Agrobacterium rhizogenes Ri plasmid, or man made variants thereof which function as T-DNA.
  • the T-DNA may comprise an entire T- DNA including both right and left border sequences, but need only comprise the minimal sequences required in cis for transfer, that is, the right and T-DNA border sequence.
  • the T-DNAs of the invention have inserted into them, anywhere between the right and left border sequences (if present), the polynucleotide of interest.
  • sequences encoding factors required in trans for transfer of the T-DNA into a plant cell such as vir genes, may be inserted into the T-DNA, or may be present on the same replicon as the T-DNA, or preferably are in trans on a compatible replicon in the Agrobacterium host.
  • Such "binary vector systems" are well known in the art.
  • P-DNA refers to a transfer nucleic acid isolated from a plant genome, or man made variants/mutants thereof, and comprises at each end, or at only one end, a T-DNA border-like sequence.
  • the border-like sequence preferably shares at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or at least 95%, but less than 100% sequence identity, with a T-DNA border sequence from an Agrobacterium sp. such as Agrobacterium tumefaciens or Agrobacterium rhizogenes.
  • P-DNAs can be used instead of T-DNAs to transfer a nucleotide sequence contained within the P-DNA from, for example Agrobacterium, to another cell.
  • the P-DNA before insertion of the exogenous polynucleotide which is to be transferred, may be modified to facilitate cloning and should preferably not encode any proteins.
  • the P-DNA is characterized in that it contains, at least a right border sequence and preferably also a left border sequence.
  • a "border" sequence of a transfer nucleic acid can be isolated from a selected organism such as a plant or bacterium, or be a man made variant/mutant thereof.
  • the border sequence promotes and facilitates the transfer of the polynucleotide to which it is linked and may facilitate its integration in the recipient cell genome.
  • a border- sequence is between 5-100 base pairs (bp) in length, 10-80 bp in length, 15-75 bp in length, 15-60 bp in length, 15-50 bp in length, 15-40 bp in length, 15-30 bp in length, 16-30 bp in length, 20-30 bp in length, 21-30 bp in length, 22-30 bp in length, 23-30 bp in length, 24-30 bp in length, 25-30 bp in length, or 26-30 bp in length.
  • Border sequences from T-DNA from Agrobacterium sp. are well known in the art and include those described in Lacroix et al. (2008), Tzfira and Citovsky (2006) and Glevin (2003).
  • the bacteria are made competent for gene transfer by providing the bacteria with the machinery needed for the transformation process, that is, a set of virulence genes encoded by an Agwbacterium Ti-plasmid and the T-DNA segment residing on a separate, small binary plasmid.
  • Bacteria engineered in this way are capable of transforming different plant tissues (leaf disks, calli and oval tissue), monocots or dicots, and various different plant species (e.g., tobacco, rice).
  • Transfection As used herein, the terms “transfection”, “transformation” and variations thereof are generally used interchangeably. “Transfected” or “transformed” cells may have been manipulated to introduce the polynucleotide(s) of interest, or may be progeny cells derived therefrom. Recombinant Cells
  • the invention also provides a recombinant cell, for example, a recombinant plant cell, which is a host cell transformed with one or more polynucleotides or vectors defined herein, or combination thereof.
  • a recombinant cell is used interchangeably with the term “transgenic cell” herein.
  • Suitable cells of the invention include any cell that can be transformed with a polynucleotide or recombinant vector of the invention, encoding for example, a polypeptide or enzyme described herein.
  • the cell is preferably a cell which is thereby capable of being used for producing lipid.
  • the recombinant cell may be a cell in culture, a cell in vitw, or in an organism such as for example, a plant, or in an organ such as, for example, a seed or a leaf.
  • the cell is in a plant, more preferably in the seed of a plant, more preferably in the seed of an oilseed plant such as safflower.
  • the plant cell comprises lipid or oil having the fatty acid composition as described herein.
  • Host cells into which the polynucleotide(s) are introduced can be either untransformed cells or cells that are already transformed with at least one nucleic acid. Such nucleic acids may be related to lipid synthesis, or unrelated.
  • Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing polypeptide(s) defined herein, in which case the recombinant cell derived therefrom has an enhanced capability of producing the polypeptide(s), or can be capable of producing said polypeptide(s) only after being transformed with at least one polynucleotide of the invention.
  • a recombinant cell of the invention has an enhanced capacity to produce non-polar lipid.
  • the cells may be prokaryotic or eukaryotic.
  • Preferred host cells are yeast, algal and plant cells.
  • the plant cell is a seed cell, in particular, a cell in a cotyledon or endosperm of a seed.
  • algal cells useful as host cells of the present invention include, for example, Chlamydomonas sp. (for example, Chlamydomonas reinhardtii), Dunaliella sp. , Haematococcus sp., Chlorella sp., Thraustochytrium sp., Schizochytrium sp., and Volvox sp.
  • the host cells may be of an organism suitable for a fermentation process, such as, for example, Yarrowia lipolytica or other yeasts.
  • the invention also provides a plant comprising an exogenous polynucleotide or polypeptide of the invention, a cell of the invention, a vector of the invention, or a combination thereof.
  • plant refers to whole plants, whilst the term “part thereof” refers to plant organs (e.g., leaves, stems, roots, flowers, fruit), single cells (e.g., pollen), seed, seed parts such as an embryo, endosperm, scutellum or seed coat, plant tissue such as vascular tissue, plant cells and progeny of the same.
  • plant parts comprise plant cells.
  • plant is used in it broadest sense. It includes, but is not limited to, any species of grass, ornamental or decorative plant, crop or cereal (e.g., oilseed plants, maize, soybean), fodder or forage, fruit or vegetable plant, herb plant, woody plant, flower plant, or tree. It is not meant to limit a plant to any particular structure. It also refers to a unicellular plant (e.g., microalga).
  • part thereof in reference to a plant refers to a plant cell and progeny of same, a plurality of plant cells that are largely differentiated into a colony (e.g., volvox), a structure that is present at any stage of a plant's development, or a plant tissue.
  • Such structures include, but are not limited to, leaves, stems, flowers, fruits, nuts, roots, seed, seed coat, embryos.
  • plant tissue includes differentiated and undifferentiated tissues of plants including those present in leaves, stems, flowers, fruits, nuts, roots, seed, for example, embryonic tissue, endosperm, dermal tissue (e.g., epidermis, periderm), vascular tissue (e.g., xylem, phloem), or ground tissue (comprising parenchyma, collenchyma, and/or sclerenchyma cells), as well as cells in culture (e.g., single cells, protoplasts, callus, embryos, etc.).
  • Plant tissue may be in planta, in organ culture, tissue culture, or cell culture.
  • transgenic plant refers to a plant that contains a transgene not found in a wild-type plant of the same species, variety or cultivar.
  • Transgenic plants as defined in the context of the present invention include plants and their progeny which have been genetically modified using recombinant techniques to cause production of at least one polypeptide defined herein in the desired plant or part thereof.
  • Transgenic plant parts has a corresponding meaning.
  • seed and “grain” are related terms as used herein, and have overlapping meanings.
  • “Grain” refers to mature grain such as harvested grain or grain which is still on a plant but ready for harvesting, but can also refer to grain after imbibition or germination, according to the context. Mature grain commonly has a moisture content of less than about 18-20%.
  • “Seed” includes “developing seed” as well as “grain” which is mature grain, but not grain after imbibition or germination.
  • Developing seed refers to a seed prior to maturity, typically found in the reproductive structures of the plant after fertilisation or anthesis, but can also refer to such seeds prior to maturity which are isolated from a plant. Seed development in planta is typically divided into early-, mid-, and late phases of development.
  • plant storage organ refers to a part of a plant specialized to store energy in the form of for example, proteins, carbohydrates, lipid.
  • plant storage organs are seed, fruit, tuberous roots, and tubers.
  • a preferred plant storage organ of the invention is seed.
  • the term "vegetative tissue” or “vegetative plant part” or variants thereof is any plant tissue, organ or part that does not include the organs for sexual reproduction of plants or the seed bearing organs or the closely associated tissues or organs such as flowers, fruits and seeds.
  • Vegetative tissues and parts include at least plant leaves, stems (including bolts and tillers but excluding the heads), tubers and roots, but excludes flowers, pollen, seed including the seed coat, embryo and endosperm, fruit including mesocarp tissue, seed-bearing pods and seed-bearing heads.
  • the vegetative part of the plant is an aerial plant part.
  • the vegetative plant part is a green part such as a leaf or stem.
  • Vegetative parts include those parts principally involved in providing or supporting the photo synthetic capacity of the plant or related function, or anchoring the plant.
  • the term "phenotypically normal” refers to a genetically modified plant or part thereof, particularly a storage organ such as a seed of the invention not having a significantly reduced ability to grow and reproduce when compared to an unmodified plant or plant thereof.
  • the genetically modified plant or part thereof which is phenotypically normal comprises at least one exogenous polynucleotide as defined herein and has an ability to grow or reproduce which is essentially the same as a corresponding plant or part thereof not comprising said polynucleotide(s).
  • the biomass, growth rate, germination rate, storage organ size, seed size and/or the number of viable seeds produced is not less than 90% of that of a plant lacking said exogenous polynucleotide when grown under identical conditions.
  • This term does not encompass features of the plant which may be different to the wild-type plant but which do not effect the usefulness of the plant for commercial purposes.
  • Plants provided by or contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons.
  • the plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, or pea), or other legumes.
  • the plants may be grown for production of edible roots, tubers, leaves, stems, flowers or fruit.
  • the plants may be vegetable or ornamental plants.
  • the plants of the invention may be: safflower (Carthamus tinctorius), corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), other Brassicas such as, for example, rutabaga (Brassica napobrassica), mustard (Brassica juncea), Ethiopian mustard (Brassica carinata), crambe (Crambe abyssinica), camelina (Camelina sativa), sugarbeet (Beta vulgaris), clover (Trifolium sp.), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana taba
  • C4 grasses such as Andropogon gerardi, Bouteloua curtipendula, B. gracilis, Buchloe dactyloides, Panicum virgatum, Schizachyrium scoparium, Miscanthus species for example, Miscanthus x giganteus and Miscanthus sinensis, Sorghastrum nutans, Sporobolus cryptandrus, Switchgrass (Panicum virgatum), sugarcane (Saccharum officinarum), Brachyaria; C3 grasses such as Elymus canadensis, the legumes Lespedeza capitata and Petalostemum villosum, the forb Aster azureus; and woody plants such as Quercus elUpsoidalis and Q. macrocarpa.
  • C4 grasses such as Andropogon gerardi, Bouteloua curtipendula, B. gracilis, Buchloe dactyloides, Pan
  • the plant is an angiosperm.
  • the plant is an oilseed plant, preferably an oilseed crop plant.
  • an “oilseed plant” is a plant species used for the commercial production of lipid from the seeds of the plant.
  • “Commercial production” herein means the production of lipid, preferably oil, for sale in return for revenue.
  • the oilseed plant may be oil-seed rape (such as canola), maize, sunflower, safflower, soybean, sorghum, flax (linseed) or sugar beet.
  • the oilseed plant may be other Brassicas, cotton, peanut, poppy, rutabaga, mustard, castor bean, sesame, safflower, or nut producing plants.
  • the plant may produce high levels of lipid in its fruit such as olive, oil palm or coconut.
  • Horticultural plants to which the present invention may be applied are lettuce, endive, or vegetable Brassicas including cabbage, broccoli, or cauliflower.
  • the present invention may be applied in tobacco, cucurbits, carrot, strawberry, tomato, or pepper.
  • More preferred plants are oilseed plants whose developing seeds are non-photosynthetic, also referred to as "white seeds” plants, such as safflower, sunflower, cotton and castor.
  • the transgenic plant is homozygous for each and every gene that has been introduced (transgene) so that its progeny do not segregate for the desired phenotype.
  • the transgenic plant may also be heterozygous for the introduced transgene(s), preferably uniformly heterozygous for the transgene such as for example, in Fl progeny which have been grown from hybrid seed.
  • Such plants may provide advantages such as hybrid vigour, well known in the art. Transformation of plants
  • Transgenic plants can be produced using techniques known in the art, such as those generally described in Slater et al., Plant Biotechnology - The Genetic Manipulation of Plants, Oxford University Press (2003), and Christou and Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004).
  • stably transforming As used herein, the terms “stably transforming”, “stably transformed” and variations thereof refer to the integration of the polynucleotide into the genome of the cell such that they are transferred to progeny cells during cell division without the need for positively selecting for their presence. Stable transformants, or progeny thereof, can be selected and/or identified by any means known in the art such as Southern blots on chromosomal DNA, or in situ hybridization of genomic DNA.
  • Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because DNA can be introduced into cells in whole plant tissues, plant organs, or explants in tissue culture, for either transient expression, or for stable integration of the DNA in the plant cell genome.
  • the use of Agwbacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art (see for example, US 5177010, US 5104310, US 5004863, or US 5159135).
  • the region of DNA to be transferred is defined by the border sequences, and the intervening DNA (T- DNA) is usually inserted into the plant genome. Further, the integration of the T-DNA is a relatively precise process resulting in few rearrangements.
  • Agwbacterium transformation vectors are capable of replication in E. coli as well as Agwbacterium, allowing for convenient manipulations as described (Klee et al., In: Plant DNA Infectious Agents, Hohn and Schell, eds., Springer- Verlag, New York, pp. 179-203 (1985)).
  • Acceleration methods include for example, microprojectile bombardment and the like.
  • One example of a method for delivering transforming nucleic acid molecules to plant cells is microprojectile bombardment. This method has been reviewed by Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994).
  • Non-biological particles microprojectiles
  • plastids can be stably transformed.
  • Methods disclosed for plastid transformation in higher plants include particle gun delivery of DNA containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination (US 5,451,513, US 5,545,818, US 5,877,402, US 5,932479, and WO 99/05265).
  • Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments. Application of these systems to different plant varieties depends upon the ability to regenerate that particular plant strain from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (Fujimura et al., 1985; Toriyama et al., 1986; Abdullah et al., 1986).
  • Other methods of cell transformation can also be used and include but are not limited to the introduction of DNA into plants by direct DNA transfer into pollen, by direct injection of DNA into reproductive organs of a plant, or by direct injection of DNA into the cells of immature embryos followed by the rehydration of desiccated embryos.
  • This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.
  • the development or regeneration of plants containing the foreign, exogenous gene is well known in the art.
  • the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants.
  • a transgenic plant of the present invention containing a desired polynucleotide is cultivated using methods well known to one skilled in the art.
  • regenerable wheat cells are preferably from the scutellum of immature embryos, mature embryos, callus derived from these, or the meristematic tissue.
  • transgenic plants may be grown to produce plant tissues or parts having the desired phenotype.
  • the plant tissue or plant parts may be harvested, and/or the seed collected.
  • the seed may serve as a source for growing additional plants with tissues or parts having the desired characteristics.
  • a transgenic plant formed using Agwbacterium or other transformation methods typically contains a single transgenic locus on one chromosome. Such transgenic plants can be referred to as being hemizygous for the added gene(s). More preferred is a transgenic plant that is homozygous for the added gene(s), that is, a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair.
  • a homozygous transgenic plant can be obtained by self-fertilising a hemizygous transgenic plant, germinating some of the seed produced and analyzing the resulting plants for the gene of interest.
  • transgenic plants that contain two independently segregating exogenous genes or loci can also be crossed (mated) to produce offspring that contain both sets of genes or loci.
  • Selfing of appropriate Fl progeny can produce plants that are homozygous for both exogenous genes or loci.
  • Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in Fehr, In: Breeding Methods for Cultivar Development, Wilcox J. ed., American Society of Agronomy, Madison Wis. (1987).
  • TILLING Targeting Induced Local Lesions IN Genomes
  • endogenous genes for example genes encoding a ⁇ 12 desaturase, a palmitoyl-ACP thioesterase, a co6 or a ⁇ 6 desaturase activity, or a combination of two or more thereof.
  • introduced mutations such as novel single base pair changes are induced in a population of plants by treating seeds (or pollen) with a chemical mutagen, and then advancing plants to a generation where mutations will be stably inherited.
  • DNA is extracted, and seeds are stored from all members of the population to create a resource that can be accessed repeatedly over time.
  • PCR primers are designed to specifically amplify a single gene target of interest. Specificity is especially important if a target is a member of a gene family or part of a polyploid genome.
  • dye-labeled primers can be used to amplify PCR products from pooled DNA of multiple individuals. These PCR products are denatured and reannealed to allow the formation of mismatched base pairs. Mismatches, or heteroduplexes, represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e., several plants from the population are likely to carry the same polymorphism) and induced SNPs (i.e., only rare individual plants are likely to display the mutation).
  • SNPs single nucleotide polymorphisms
  • induced SNPs i.e., only rare individual plants are likely to display the mutation.
  • Genomic fragments being assayed can range in size anywhere from 0.3 to 1.6 kb.
  • 1.4 kb fragments counting the ends of fragments where SNP detection is problematic due to noise
  • 96 lanes per assay this combination allows up to a million base pairs of genomic DNA to be screened per single assay, making TILLING a high-throughput technique. TILLING is further described in Slade and Knauf (2005), and Henikoff et al. (2004).
  • each SNP is recorded by its approximate position within a few nucleotides.
  • each haplotype can be archived based on its mobility.
  • Sequence data can be obtained with a relatively small incremental effort using aliquots of the same amplified DNA that is used for the mismatch-cleavage assay.
  • the left or right sequencing primer for a single reaction is chosen by its proximity to the polymorphism.
  • Sequencher software performs a multiple alignment and discovers the base change, which in each case confirmed the gel band.
  • Ecotilling can be performed more cheaply than full sequencing, the method currently used for most SNP discovery. Plates containing arrayed ecotypic DNA can be screened rather than pools of DNA from mutagenized plants. Because detection is on gels with nearly base pair resolution and background patterns are uniform across lanes, bands that are of identical size can be matched, thus discovering and genotyping SNPs in a single step. In this way, ultimate sequencing of the SNP is simple and efficient, made more so by the fact that the aliquots of the same PCR products used for screening can be subjected to DNA sequencing.
  • mutant plant lines are known in the art. Examples of mutagens that can be used for generating mutant plants include irradiation and chemical mutagenesis. Mutants may also be produced by techniques such as T-DNA insertion and transposon-induced mutagenesis. Mutations in any desired gene in a plant, can be introduced in a site- specific manner by artificial zinc finger nuclease (ZFN), TAL effector (TALEN) or CRISPR technologies (using a Cas9 type nuclease) as known in the art. The mutagenesis procedure may be performed on any parental cell of a plant, for example a seed or a parental cell in tissue culture.
  • ZFN zinc finger nuclease
  • TALEN TAL effector
  • CRISPR technologies using a Cas9 type nuclease
  • Chemical mutagens are classifiable by chemical properties, e.g., alkylating agents, cross-linking agents, etc.
  • Useful chemical mutagens include, but are not limited to, N-ethyl-N-nitrosourea (ENU); N-methyl-N-nitrosourea (MNU); procarbazine hydrochloride; chlorambucil; cyclophosphamide; methyl methanesulfonate (MMS); ethyl methanesulfonate (EMS); diethyl sulfate; acrylamide monomer; triethylene melamine (TEM); melphalan; nitrogen mustard; vincristine; dimethylnitrosamine; N- methyl-N'-nitro-Nitrosoguani- dine (MNNG); 7,12 dimethylbenzanthracene (DMBA); ethylene oxide; hexamethylphosphoramide; and bisulfan.
  • ENU N-ethyl-N-nitrosourea
  • gamma radiation such as that supplied by a Cesium 137 source.
  • the gamma radiation preferably is supplied to the plant cells in a dosage of approximately 60 to 200 Krad., and most preferably in a dosage of approximately 60 to 90 Krad.
  • Plants are typically exposed to a mutagen for a sufficient duration to accomplish the desired genetic modification but insufficient to completely destroy the viability of the cells and their ability to be regenerated into a plant.
  • the mutagenesis procedures described above typically result in the generation of mutants in a gene of interest at a frequency of at least 1 in 1000 plants, which means that screening of mutagenised populations of the plants is a practicable means to identify mutants in any gene of interest.
  • the identification of mutants can also be achieved by massively parallel nucleotide sequencing technologies.
  • Marker assisted selection is a well recognised method of selecting for heterozygous plants required when backcrossing with a recurrent parent in a classical breeding program.
  • the population of plants in each backcross generation will be heterozygous for the gene of interest normally present in a 1: 1 ratio in a backcross population, and the molecular marker can be used to distinguish the two alleles of the gene.
  • the embryo from immature seeds may be excised and grown up on nutrient media under sterile conditions, rather than allowing full seed maturity.
  • This process termed “embryo rescue", used in combination with DNA extraction at the three leaf stage and analysis for the desired genotype allows rapid selection of plants carrying the desired trait, which may be nurtured to maturity in the greenhouse or field for subsequent further backcrossing to the recurrent parent.
  • Any molecular biological technique known in the art which is capable of detecting a FAD2, FATB or FAD6 gene can be used in the methods of the present invention.
  • Such methods include, but are not limited to, the use of nucleic acid amplification, nucleic acid sequencing, nucleic acid hybridization with suitably labeled probes, single-strand conformational analysis (SSCA), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis (HET), chemical cleavage analysis (CCM), catalytic nucleic acid cleavage or a combination thereof (see, for example, Lemieux, 2000; Langridge et al., 2001).
  • the invention also includes the use of molecular marker techniques to detect polymorphisms linked to alleles of (for example) a FAD2, FATB or FAD6 gene which confer the desired phenotype.
  • Such methods include the detection or analysis of restriction fragment length polymorphisms (RFLP), RAPD, amplified fragment length polymorphisms (AFLP) and micro satellite (simple sequence repeat, SSR) polymorphisms.
  • RFLP restriction fragment length polymorphisms
  • RAPD RAPD
  • AFLP amplified fragment length polymorphisms
  • SSR micro satellite
  • the closely linked markers can be obtained readily by methods well known in the art, such as Bulked Segregant Analysis, as reviewed by Langridge et al. (2001).
  • PCR polymerase chain reaction
  • a primer is an oligonucleotide sequence that is capable of hybridising in a sequence specific fashion to the target sequence and being extended during the PCR.
  • Amplicons or PCR products or PCR fragments or amplification products are extension products that comprise the primer and the newly synthesized copies of the target sequences.
  • Multiplex PCR systems contain multiple sets of primers that result in simultaneous production of more than one amplicon.
  • Primers may be perfectly matched to the target sequence or they may contain internal mismatched bases that can result in the introduction of restriction enzyme or catalytic nucleic acid recognition/cleavage sites in specific target sequences. Primers may also contain additional sequences and/or contain modified or labelled nucleotides to facilitate capture or detection of amplicons.
  • target or target sequence or template refer to nucleic acid sequences which are amplified.
  • Hybridization based detection systems include, but are not limited to, the TaqMan assay and molecular beacon assay (US 5,925,517).
  • the TaqMan assay (US 5,962,233) uses allele specific (ASO) probes with a donor dye on one end and an acceptor dye on the other end such that the dye pair interact via fluorescence resonance energy transfer (FRET).
  • ASO allele specific
  • the method described in Example 7 is used in selection and breeding programs to identify and select safflower plants with the ol mutation.
  • the method comprises performing an amplification reaction on genomic DNA obtained from the plant using one or both of the following sets of primers;
  • polypeptide and “protein” are generally used interchangeably.
  • a polypeptide or class of polypeptides may be defined by the extent of identity (% identity) of its amino acid sequence to a reference amino acid sequence, or by having a greater % identity to one reference amino acid sequence than to another.
  • the query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids.
  • the GAP analysis aligns two sequences over their entire length.
  • the polypeptide or class of polypeptides may have the same enzymatic activity as, or a different activity than, or lack the activity of, the reference polypeptide.
  • the polypeptide has an enzymatic activity of at least 10% of the activity of the reference polypeptide.
  • a "biologically active fragment" is a portion of a polypeptide of the invention which maintains a defined activity of a full-length reference polypeptide for example, ⁇ 12 desaturase, palmitoyl-ACP thioesterase or ⁇ 6 desaturase activity.
  • Biologically active fragments as used herein exclude the full-length polypeptide.
  • Biologically active fragments can be any size portion as long as they maintain the defined activity.
  • the biologically active fragment maintains at least 10% of the activity of the full length polypeptide.
  • the polypeptide/enzyme comprises an amino acid sequence which is at least 50%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least at least
  • Amino acid sequence mutants of the polypeptides defined herein can be prepared by introducing appropriate nucleotide changes into a nucleic acid defined herein, or by in vitro synthesis of the desired polypeptide. Such mutants include for example, deletions, insertions, or substitutions of residues within the amino acid sequence. A combination of deletions, insertions and substitutions can be made to arrive at the final construct, provided that the final polypeptide product possesses the desired characteristics.
  • Mutant (altered) polypeptides can be prepared using any technique known in the art, for example, using directed evolution or rationale design strategies (see below). Products derived from mutated/altered DNA can readily be screened using techniques described herein to determine if they possess, or lack, ⁇ 12 desaturase, palmitoyl-ACP thioesterase or co6 ⁇ 6 desaturase activity.
  • the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified.
  • the sites for mutation can be modified individually or in series for example, by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.
  • non- conservative substitutions can be used when producing a mutant with reduced enzymatic activity.
  • Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues, but may be much longer particularly when the mutant is designed to reduce enzymatic activity.
  • Substitution mutants have at least one amino acid residue in the polypeptide removed and a different residue inserted in its place.
  • the sites of greatest interest for substitutional mutagenesis to inactivate an enzyme include sites identified as the active site(s). Other sites of interest are those in which particular residues obtained from various strains or species are identical. These positions may be important for biological activity. Conservative substitutions are shown in Table 1, while non-conservative substitutions are substitutions which are not conservative substitutions.
  • a polypeptide of the invention is a ⁇ 12 desaturase and which comprises amino acids having a sequence as provided in any one of SEQ ID NOs: 27 to 34, 36 or 37, a biologically active fragment thereof, or an amino acid sequence which is at least 40% identical to any one or more of SEQ ID NOs: NOs: 27 to 34, 36 or 37.
  • a polypeptide of the invention is oleate ⁇ 12 desaturase present in the seed (oilseed) of an oilseed plant which comprises amino acids having a sequence as provided in any one of SEQ ID NOs: 27, 28 or 36, a biologically active fragment thereof, or an amino acid sequence which is at least 40% identical to any one or more of SEQ ID NOs: 27, 28 or 36.
  • a polypeptide of the invention is a A12-acetylenase which comprises amino acids having a sequence as provided in SEQ ID NO:37, a biologically active fragment thereof, or an amino acid sequence which is at least 40% identical to SEQ ID NO:37.
  • a polypeptide of the invention is a palmitoleate ⁇ 12 desaturase which comprises amino acids having a sequence as provided in SEQ ID NO:35, a biologically active fragment thereof, or an amino acid sequence which is at least 40% identical to SEQ ID NO:35.
  • a polypeptide of the invention is a palmitoyl-ACP thioesterase (FATB) which comprises amino acids having a sequence as provided in any one of SEQ ID NOs: 44 or 45, a biologically active fragment thereof, or an amino acid sequence which is at least 40% identical to any one or more of SEQ ID NOs: 44 or 45.
  • FTB palmitoyl-ACP thioesterase
  • a polypeptide of the invention is a palmitoyl-ACP thioesterase (FATB) present in the seed of an oilseed plant which comprises amino acids having a sequence as provided in SEQ ID NO:45, a biologically active fragment thereof, or an amino acid sequence which is at least 40% identical to SEQ ID NO:45.
  • FTB palmitoyl-ACP thioesterase
  • a polypeptide of the invention is a ⁇ 6 desaturase which comprises amino acids having a sequence as provided in SEQ ID NO:48, a biologically active fragment thereof, or an amino acid sequence which is at least 40% identical to SEQ ID NO:48.
  • Preferred features of the enzymes of the invention are provided in the Examples section, in particular Example 2 in relation to safflower FAD2's.
  • Polypeptides as described herein may be expressed as a fusion to at least one other polypeptide.
  • the at least one other polypeptide is selected from the group consisting of: a polypeptide that enhances the stability of the fusion protein, and a polypeptide that assists in the purification of the fusion protein.
  • plant seeds are cooked, pressed, and/or extracted to produce crude seedoil, which is then degummed, refined, bleached, and deodorized.
  • techniques for crushing seed are known in the art.
  • oilseeds can be tempered by spraying them with water to raise the moisture content to, for example, 8.5%, and flaked using a smooth roller with a gap setting of 0.23 to 0.27 mm.
  • water may not be added prior to crushing.
  • Application of heat deactivates enzymes, facilitates further cell rupturing, coalesces the lipid droplets, and agglomerates protein particles, all of which facilitate the extraction process.
  • the majority of the seedoil is released by passage through a screw press. Cakes expelled from the screw press are then solvent extracted for example, with hexane, using a heat traced column.
  • crude seedoil produced by the pressing operation can be passed through a settling tank with a slotted wire drainage top to remove the solids that are expressed with the seedoil during the pressing operation.
  • the solid residue from the pressing and extraction, after removal of the hexane, is the seedmeal, which is typically used as animal feed.
  • the clarified seedoil can be passed through a plate and frame filter to remove any remaining fine solid particles. If desired, the seedoil recovered from the extraction process can be combined with the clarified seedoil to produce a blended crude seedoil.
  • the pressed and extracted portions are combined and subjected to normal lipid processing procedures such as, for example, degumming, caustic refining, bleaching, and deodorization. Some or all steps may be omitted, depending on the nature of the product path, e.g. for feed grade oil, limited treatment may be needed whereas for oleochemical applications, more purification steps are required.
  • Degumming is an early step in the refining of oils and its primary purpose is the removal of most of the phospholipids from the oil, which may be present as approximately 1-2% of the total extracted lipid. Addition of -2% of water, typically containing phosphoric acid, at 70-80°C to the crude oil results in the separation of most of the phospholipids accompanied by trace metals and pigments.
  • the insoluble material that is removed is mainly a mixture of phospholipids and triacylglycerols and is also known as lecithin.
  • Degumming can be performed by addition of concentrated phosphoric acid to the crude seedoil to convert non-hydratable phosphatides to a hydratable form, and to chelate minor metals that are present. Gum is separated from the seedoil by centrifugation.
  • Alkali refining is one of the refining processes for treating crude oil, sometimes also referred to as neutralization. It usually follows degumming and precedes bleaching. Following degumming, the seedoil can treated by the addition of a sufficient amount of an alkali solution to titrate all of the fatty acids and phosphoric acids, and removing the soaps thus formed.
  • Suitable alkaline materials include sodium hydroxide, potassium hydroxide, sodium carbonate, lithium hydroxide, calcium hydroxide, calcium carbonate and ammonium hydroxide. This process is typically carried out at room temperature and removes the free fatty acid fraction. Soap is removed by centrifugation or by extraction into a solvent for the soap, and the neutralised oil is washed with water. If required, any excess alkali in the oil may be neutralized with a suitable acid such as hydrochloric acid or sulphuric acid.
  • a suitable acid such as hydrochloric acid or sulphuric acid.
  • Bleaching is a refining process in which oils are heated at 90-120°C for 10-30 minutes in the presence of a bleaching earth (0.2-2.0%) and in the absence of oxygen by operating with nitrogen or steam or in a vacuum.
  • This step in oil processing is designed to remove unwanted pigments (carotenoids, chlorophyll, gossypol etc), and the process also removes oxidation products, trace metals, sulphur compounds and traces of soap. Deodorization
  • Deodorization is a treatment of oils and fats at a high temperature (200-260°C) and low pressure (0.1-1 mm Hg). This is typically achieved by introducing steam into the seedoil at a rate of about 0.1 ml/minute/100 ml of seedoil. After about 30 minutes of sparging, the seedoil is allowed to cool under vacuum. The seedoil is typically transferred to a glass container and flushed with argon before being stored under refrigeration. This treatment improves the colour of the seedoil and removes a majority of the volatile substances or odorous compounds including any remaining free fatty acids, monoacylglycerols and oxidation products.
  • Winterization is a process sometimes used in commercial production of oils for the separation of oils and fats into solid (stearin) and liquid (olein) fractions by crystallization at sub-ambient temperatures. It was applied originally to cottonseed oil to produce a solid-free product. It is typically used to decrease the saturated fatty acid content of oils.
  • Transesterification is a process that exchanges the fatty acids within and between TAGs, initially by releasing fatty acids from the TAGs either as free fatty acids or as fatty acid esters, usually fatty acid ethyl esters.
  • transesterification can be used to modify the fatty acid composition of lipids (Marangoni et al., 1995).
  • Transesterification can use either chemical or enzymatic means, the latter using lipases which may be position-specific (sn-l/3 or sn-2 specific) for the fatty acid on the TAG, or having a preference for some fatty acids over others (Speranza et al, 2012).
  • the fatty acid fractionation to increase the concentration of LC-PUFA in an oil can be achieved by any of the methods known in the art, such as, for example, freezing crystallization, complex formation using urea, molecular distillation, supercritical fluid extraction and silver ion complexing.
  • Complex formation with urea is a preferred method for its simplicity and efficiency in reducing the level of saturated and monounsaturated fatty acids in the oil (Gamez et al., 2003).
  • the TAGs of the oil are split into their constituent fatty acids, often in the form of fatty acid esters, by hydrolysis or by lipases and these free fatty acids or fatty acid esters are then mixed with an ethanolic solution of urea for complex formation.
  • the saturated and monounsaturated fatty acids easily complex with urea and crystallize out on cooling and may subsequently be removed by filtration.
  • the non-urea complexed fraction is thereby enriched with LC-PUFA.
  • Hydrogenation of fatty acids involves treatment with hydrogen, typically in the presence of a catalyst. Non-catalytic hydrogenation takes place only at very high temperatures.
  • Hydrogenation is commonly used in the processing of plant oils. Hydrogenation converts unsaturated fatty acids to saturated fatty acids, and in some cases, trans fats. Hydrogenation results in the conversion of liquid plant oils to solid or semi-solid fats, such as those present in margarine. Changing the degree of saturation of the fat changes some important physical properties such as the melting range, which is why liquid oils become semi-solid. Solid or semi-solid fats are preferred for baking because the way the fat mixes with flour produces a more desirable texture in the baked product. Because partially hydrogenated vegetable oils are cheaper than animal source fats, are available in a wide range of consistencies, and have other desirable characteristics (e.g., increased oxidative stability/longer shelf life), they are the predominant fats used as shortening in most commercial baked goods.
  • the lipid/oil of the invention has not been hydrogenated.
  • An indication that a lipid or oil has not been hydrogenated is the absence of any trans fatty acids in its TAG.
  • the lipids such as the seedoil, preferably the safflower seedoil, produced by the methods described herein have a variety of uses.
  • the lipids are used as food oils.
  • the lipids are refined and used as lubricants or for other industrial uses such as the synthesis of plastics. It may be used in the manufacture of cosmetics, soaps, fabric softeners, electrical insulation or detergents. It may be used to produce agricultural chemicals such as surfactants or emulsifiers.
  • the lipids are refined to produce biodiesel.
  • the oil of the invention may advantageously be used in paints or varnishes since the absence of linolenic acid means it does not discolour easily.
  • An industrial product produced using a method of the invention may be a hydrocarbon product such as fatty acid esters, preferably fatty acid methyl esters and/or a fatty acid ethyl esters, an alkane such as methane, ethane or a longer-chain alkane, a mixture of longer chain alkanes, an alkene, a biofuel, carbon monoxide and/or hydrogen gas, a bioalcohol such as ethanol, propanol, or butanol, biochar, or a combination of carbon monoxide, hydrogen and biochar.
  • fatty acid esters preferably fatty acid methyl esters and/or a fatty acid ethyl esters
  • an alkane such as methane, ethane or a longer-chain alkane, a mixture of longer chain alkanes
  • an alkene such as methane, ethane or a longer-chain alkane, a mixture of longer chain alkanes
  • the industrial product may be a mixture of any of these components, such as a mixture of alkanes, or alkanes and alkenes, preferably a mixture which is predominantly (>50%) C4-C8 alkanes, or predominantly C6 to CIO alkanes, or predominantly C6 to C8 alkanes.
  • the industrial product is not carbon dioxide and not water, although these molecules may be produced in combination with the industrial product.
  • the industrial product may be a gas at atmospheric pressure/room temperature, or preferably, a liquid, or a solid such as biochar, or the process may produce a combination of a gas component, a liquid component and a solid component such as carbon monoxide, hydrogen gas, alkanes and biochar, which may subsequently be separated.
  • the hydrocarbon product is predominantly fatty acid methyl esters.
  • the hydrocarbon product is a product other than fatty acid methyl esters.
  • Heat may be applied in the process, such as by pyrolysis, combustion, gasification, or together with enzymatic digestion (including anaerobic digestion, composting, fermentation).
  • Lower temperature gasification takes place at, for example, between about 700°C to about 1000°C.
  • Higher temperature gasification takes place at, for example, between about 1200°C to about 1600°C.
  • Lower temperature pyrolysis (slower pyrolysis), takes place at about 400°C, whereas higher temperature pyrolysis takes place at about 500°C.
  • Mesophilic digestion takes place between about 20°C and about 40°C. Thermophilic digestion takes place from about 50°C to about 65°C.
  • Chemical means include, but are not limited to, catalytic cracking, anaerobic digestion, fermentation, composting and transesterification.
  • a chemical means uses a catalyst or mixture of catalysts, which may be applied together with heat. The process may use a homogeneous catalyst, a heterogeneous catalyst and/or an enzymatic catalyst.
  • the catalyst is a transition metal catalyst, a molecular sieve type catalyst, an activated alumina catalyst or sodium carbonate as a catalyst.
  • Catalysts include acid catalysts such as sulphuric acid, or alkali catalysts such as potassium or sodium hydroxide or other hydroxides.
  • the chemical means may comprise transesterification of fatty acids in the lipid, which process may use a homogeneous catalyst, a heterogeneous catalyst and/or an enzymatic catalyst.
  • the conversion may comprise pyrolysis, which applies heat and may apply chemical means, and may use a transition metal catalyst, a molecular sieve type catalyst, an activated alumina catalyst and/or sodium carbonate as a catalyst.
  • Enzymatic means include, but are not limited to, digestion by microorganisms in, for example, anaerobic digestion, fermentation or composting, or by recombinant enzymatic proteins.
  • biofuel includes biodiesel and bioalcohol.
  • Biodiesel can be made from oils derived from plants, algae and fungi.
  • Bioalcohol is produced from the fermentation of sugar. This sugar can be extracted directly from plants (e.g., sugarcane), derived from plant starch (e.g., maize or wheat) or made from cellulose (e.g., wood, leaves or stems).
  • Biofuels currently cost more to produce than petroleum fuels. In addition to processing costs, biofuel crops require planting, fertilising, pesticide and herbicide applications, harvesting and transportation. Plants, algae and fungi of the present invention may reduce production costs of biofuel.
  • fatty acids can be prepared, for example, by hydrolyzing or saponifying triglycerides with acid or base catalysts, respectively, or using an enzyme such as a lipase or an esterase.
  • Fatty acid alkyl esters can be prepared by reacting a fatty acid with an alcohol in the presence of an acid catalyst.
  • Fatty acid alkyl esters can also be prepared by reacting a triglyceride with an alcohol in the presence of an acid or base catalyst.
  • Glycerol ethers can be prepared, for example, by reacting glycerol with an alkyl halide in the presence of base, or with an olefin or alcohol in the presence of an acid catalyst.
  • the lipids are transesterified to produce methyl esters and glycerol.
  • the lipids are reacted with an alcohol (such as methanol or ethanol) in the presence of a catalyst (for example, potassium or sodium hydroxide) to produce alkyl esters.
  • the alkyl esters can be used for biodiesel or blended with petroleum based fuels.
  • the alkyl esters can be directly blended with diesel fuel, or washed with water or other aqueous solutions to remove various impurities, including the catalysts, before blending. It is possible to neutralize acid catalysts with base. However, this process produces salt. To avoid engine corrosion, it is preferable to minimize the salt concentration in the fuel additive composition. Salts can be substantially removed from the composition, for example, by washing the composition with water.
  • the composition is dried after it is washed, for example, by passing the composition through a drying agent such as calcium sulfate.
  • a neutral fuel additive is obtained without producing salts or using a washing step, by using a polymeric acid, such as Dowex 50TM, which is a resin that contains sulfonic acid groups.
  • a polymeric acid such as Dowex 50TM, which is a resin that contains sulfonic acid groups.
  • the catalyst is easily removed by filtration after the esterification and etherification reactions are complete.
  • Plant triacylglycerols as a biofuel source
  • plant oils are primarily composed of various triacylglycerols (TAGs), molecules that consist of three fatty acid chains (usually 18 or 16 carbons long) esterified to glycerol.
  • TAGs triacylglycerols
  • the fatty acyl chains are chemically similar to the aliphatic hydrocarbons that make up the bulk of the molecules found in petrol and diesel.
  • the hydrocarbons in petrol contain between 5 and 12 carbon atoms per molecule, and this volatile fuel is mixed with air and ignited with a spark in a conventional engine.
  • diesel fuel components typically have 10-15 carbon atoms per molecule and are ignited by the very high compression obtained in a diesel engine.
  • TAGs have a viscosity range that is much higher than that of conventional diesel: 17.3-32.9 mmV 1 compared to 1.9-4.1 mm 2s l , respectively (ASTM D975; Knothe and Steidley, 2005). This higher viscosity results in poor fuel atomization in modern diesel engines, leading to problems derived from incomplete combustion such as carbon deposition and coking (Ryan et al., 1984). To overcome this problem, TAGs are converted to less viscous fatty acid esters by esterification with a primary alcohol, most commonly methanol.
  • the resulting fuel is commonly referred to as biodiesel and has a dynamic viscosity range from 1.9 to 6.0 mm 2 s - " 1 (ASTM D6751).
  • the fatty acid methyl esters (FAMEs) found in biodiesel have a high energy density as reflected by their high heat of combustion, which is similar, if not greater, than that of conventional diesel (Knothe, 2005).
  • the cetane number (a measure of diesel ignition quality) of the FAMEs found in biodiesel exceeds that of conventional diesel (Knothe, 2005).
  • Plant oils are mostly composed of five common fatty acids, namely palmitate (16:0), stearate (18:0), oleate (18: 1), linoleate (18:2) and linolenate (18:3), although, depending on the particular species, longer or shorter fatty acids may also be major constituents. These fatty acids differ from each other in terms of acyl chain length and number of double bonds, leading to different physical properties. Consequently, the fuel properties of biodiesel derived from a mixture of fatty acids are dependent on that composition. Altering the fatty acid profile can therefore improve fuel properties of biodiesel such as cold-temperature flow characteristics, oxidative stability and NOx emissions. Altering the fatty acid composition of TAGs may reduce the viscosity of the plant oils, eliminating the need for chemical modification, thus improving the cost- effectiveness of biofuels.
  • the lipid/oil of the invention has advantages in food applications because of its very high oleic acid content and the low levels of linoleic acid ( ⁇ 3.2%) and saturated fatty acids such as palmitic acid, and the essentially zero level of linolenic acid.
  • This provides the oil with a high oxidative stability, producing less rancidity and making it ideal for food applications where heating is required, such as in frying applications, for example for French fries.
  • the oil has a high OSI (oxidative stability index) which is measured as the length of time an oil may be held at 110°C, such as greater than 20 or 25 hours, preferably greater than 30 hours or greater than 50 hours.
  • the low levels of saturated fatty acids relative to other vegetable oils provides for health benefits since saturated fatty acids have been associated with deleterious effects on health.
  • the oils also have essentially zero trans fatty acid content which is desirable in some markets as trans fatty acids have also been associated with negative effects on heart health or raising LDL cholesterol.
  • the oil does not require hydrogenation to lower the levels of PUFA - such hydrogenation produces trans fatty acids.
  • the oils are also advantageous for reducing the incidence or severity of obesity and diabetes. They are also desirable for food applications in that they contain only naturally occurring fatty acids (Scarth and Tang, 2006).
  • feedstuffs include any food or preparation for human or animal consumption (including for enteral and/or parenteral consumption) which when taken into the body: (1) serve to nourish or build up tissues or supply energy, and/or (2) maintain, restore or support adequate nutritional status or metabolic function.
  • Feedstuffs of the invention include nutritional compositions for babies and/or young children.
  • Feedstuffs of the invention comprise for example, a cell of the invention, a plant of the invention, the plant part of the invention, the seed of the invention, an extract of the invention, the product of a method of the invention, or a composition along with a suitable carrier(s).
  • carrier is used in its broadest sense to encompass any component which may or may not have nutritional value. As the person skilled in the art will appreciate, the carrier must be suitable for use (or used in a sufficiently low concentration) in a feedstuff, such that it does not have deleterious effect on an organism which consumes the feedstuff.
  • the feedstuff of the present invention comprises a lipid produced directly or indirectly by use of the methods, cells or organisms disclosed herein.
  • the composition may either be in a solid or liquid form. Additionally, the composition may include edible macronutrients, vitamins, and/or minerals in amounts desired for a particular use. The amounts of these or other ingredients will vary depending on whether the composition is intended for use with normal individuals or for use with individuals having specialized needs such as individuals suffering from metabolic disorders and the like.
  • the foods may be produced by mixing the oil with one or more other ingredients so that the food comprises the oil, or mixed with one or more other ingredients to make a food additive such as salad dressing or mayonnaise.
  • the food or food additive may comprise 1 - 10% or more of the oil by weight.
  • the oil may be blended with other vegetable oils to provide for optimal composition or with solid fats or with palm oil to provide semisolid shortening.
  • Foods or food additives produced from the oil include salad dressing, mayonnaise, margarine, bread, cakes, biscuits (cookies), croissants, baked goods, pancakes or pancake mixes, custards, frozen desserts, non-dairy foods.
  • suitable carriers with nutritional value include, but are not limited to, macronutrients such as edible fats, carbohydrates and proteins.
  • edible fats include, but are not limited to, coconut oil, borage oil, fungal oil, black current oil, soy oil, and mono- and di-glycerides.
  • carbohydrates include, but are not limited to, glucose, edible lactose, and hydrolyzed starch.
  • proteins which may be utilized in the nutritional composition of the invention include, but are not limited to, soy proteins, electrodialysed whey, electrodialysed skim milk, milk whey, or the hydrolysates of these proteins.
  • vitamins and minerals the following may be added to the feedstuff compositions of the present invention, calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and vitamins A, E, D, C, and the B complex. Other such vitamins and minerals may also be added.
  • the components utilized in the feedstuff compositions of the present invention can be of semi-purified or purified origin.
  • semi-purified or purified is meant a material which has been prepared by purification of a natural material.
  • a feedstuff composition of the present invention may also be added to food even when supplementation of the diet is not required.
  • the composition may be added to food of any type, including, but not limited to, margarine, modified butter, cheeses, milk, yogurt, chocolate, candy, snacks, salad oils, cooking oils, cooking fats, meats, fish and beverages.
  • lipid produced in accordance with the present invention or host cells transformed to contain and express the subject genes may also be used as animal food supplements to alter an animal's tissue or milk fatty acid composition or fatty acod composition of eggs, to one more desirable for human or animal consumption, or for animal health and wellbeing.
  • animal food supplements include sheep, cattle, horses, poultry, pets such as dogs and cats and the like.
  • feedstuffs of the invention can be used in aquaculture to increase the levels of fatty acids in fish for human or animal consumption.
  • Preferred feedstuffs of the invention are the plants, seed and other plant parts such as leaves, fruits and stems which may be used directly as food or feed for humans or other animals.
  • animals may graze directly on such plants grown in the field, or be fed more measured amounts in controlled feeding.
  • compositions particularly pharmaceutical compositions, comprising one or more lipids or oils produced using the methods of the invention.
  • a pharmaceutical composition may comprise one or more of the lipids, in combination with a standard, well-known, non-toxic pharmaceutically-acceptable carrier, adjuvant or vehicle such as phosphate-buffered saline, water, ethanol, polyols, vegetable oils, a wetting agent, or an emulsion such as a water/oil emulsion.
  • the composition may be in either a liquid or solid form.
  • the composition may be in the form of a tablet, capsule, ingestible liquid, powder, topical ointment or cream. Proper fluidity can be maintained for example, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
  • composition can also include isotonic agents for example, sugars, sodium chloride, and the like.
  • isotonic agents for example, sugars, sodium chloride, and the like.
  • the composition can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents and perfuming agents.
  • Suspensions in addition to the active compounds, may comprise suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, or mixtures of these substances.
  • suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, or mixtures of these substances.
  • Solid dosage forms such as tablets and capsules can be prepared using techniques well known in the art.
  • lipid produced in accordance with the present invention can be tableted with conventional tablet bases such as lactose, sucrose, and cornstarch in combination with binders such as acacia, cornstarch or gelatin, disintegrating agents such as potato starch or alginic acid, and a lubricant such as stearic acid or magnesium stearate.
  • binders such as acacia, cornstarch or gelatin
  • disintegrating agents such as potato starch or alginic acid
  • a lubricant such as stearic acid or magnesium stearate.
  • Capsules can be prepared by incorporating these excipients into a gelatin capsule along with antioxidants and the relevant lipid(s).
  • the lipids produced in accordance with the present invention or derivatives thereof may be incorporated into commercial formulations.
  • a typical dosage of a particular fatty acid is from 0.1 mg to 20 g, taken from one to five times per day (up to 100 g daily) and is preferably in the range of from about 10 mg to about 1, 2, 5, or 10 g daily (taken in one or multiple doses). As known in the art, a minimum of about 300 mg/day of fatty acid is desirable. However, it will be appreciated that any amount of fatty acid will be beneficial to the subject.
  • Possible routes of administration of the pharmaceutical compositions of the present invention include for example, enteral and parenteral.
  • a liquid preparation may be administered orally.
  • a homogenous mixture can be completely dispersed in water, admixed under sterile conditions with physiologically acceptable diluents, preservatives, buffers or propellants to form a spray or inhalant.
  • the dosage of the composition to be administered to the subject may be determined by one of ordinary skill in the art and depends upon various factors such as weight, age, overall health, past history, immune status, etc., of the subject.
  • compositions of the present invention may be utilized for cosmetic purposes.
  • the compositions may be added to pre-existing cosmetic compositions, such that a mixture is formed, or a fatty acid produced according to the invention may be used as the sole "active" ingredient in a cosmetic composition.
  • Safflower plants (Carthamus tinctorius) genotypes SU, S-317, S-517, LeSaf496, CW99-OL, and Ciano-OL were grown from seed in the glasshouse in a perlite and sandy loam potting mix under a day/night cycle of 16 hrs (25°C)/8 hrs (22°C).
  • the wild type variety SU which is a high linoleic variety, was obtained from Heffernan Seeds in NSW. Seeds of PI 603208 (LeSaf496, ATC 120562) and CW 99-OL (ATC 120561) were obtained from the Australian Temperate Field Crops Collection.
  • Plant tissues for DNA and RNA extraction including leaves, roots, cotyledons and hypocotyls were harvested from safflower seedlings 10 days post- germination. Flowering heads were obtained at the first day of flower opening and developing embryos were harvested at three developmental stages at 7 (early), 15 (middle) and 20 (late) days post anthesis (DPA). Samples were immediately chilled in liquid nitrogen and stored at -80°C until DNA and RNA extraction was carried out.
  • Safflower florets are tubular and largely self -pollinating with generally less than 10% outcrossing (Knowles 1969). Insects, but not wind, can increase levels of out crossing in the field. The unpollinated stigma may remain receptive for several days. Each capitula (safflower head) contains about 15-30 achenes. Seed mass of the developing seed in the plant increases rapidly during the first 15 days after flowering. Oil content increases 5- to 10-fold during the period of 10-15 DAP and reaches a maximum level at about 28 DPA (Hill and Knowles 1968). Safflower seed and plants are physiologically mature about 5 weeks after flowering and the seed ready to harvest when most of the leaves have turned brown and only a tint of green remains on the bracts of the latest flowering heads. Seeds were readily harvested by rubbing the heads by hand.
  • lipid samples from single seeds for rapid fatty acid composition analysis After being harvested at plant maturity, safflower seeds were dried by storing the seeds for 3 days at 37°C and subsequently at room temperature if not analysed right away. Single seeds or pooled seeds were crushed between small filter papers and the exuded seedoil samples that soaked into the papers analysed for fatty acid composition by GC methods as described below.
  • safflower seeds were germinated on a wet filter paper in a petri dish for 1 day. A cotyledon was carefully removed from each germinated seed for lipid analysis. The remainder of each seedling was transferred to soil and the resultant plants grown to maturity followed by harvesting of seeds to maintain the transgenic line. Extraction of oil from seeds using Soxhlet apparatus
  • harvested safflower seeds were dried in an oven at 105°C overnight and then ground in a Puck Mill for 1 min.
  • the ground seed material (-250 grams) was collected into a pre-weighed thimble and weighed prior to oil extraction.
  • the oil was extracted in a Soxhlet Extraction apparatus with solvent (Petroleum Spirit 40-60 C), initially at 70-80°C. The mixture was then refluxed overnight with the solvent syphoning to the extraction flask every 15-20 min.
  • the dissolved, extracted oil was recovered by evaporating off the solvent using a rotary evaporator under vacuum. The weight of the extracted oil was measured and the oil content was determined.
  • small aliquots were diluted in chloroform and analysed by gas chromatography.
  • Leaf tissue samples were freeze-dried, weighed and total lipids extracted from samples of approximately 10 mg dry weight as described by Bligh and Dyer (1959).
  • TAG fractions were separated from other lipid components using a 2-phase thin-layer chromatography (TLC) system on pre-coated silica gel plates (Silica gel 60, Merck).
  • TLC thin-layer chromatography
  • An extracted lipid sample equivalent to 10 mg dry weight of leaf tissue was chromatographed in a first phase with hexane/diethyl ether (98/2 v/v) to remove non-polar waxes and then in a second phase using hexane/diethyl ether/acetic acid (70/30/1 v/v/v).
  • polar lipids were separated from non-polar lipids in lipid samples extracted from an equivalent of 5 mg dry weight of leaves using two- dimensional TLC (Silica gel 60, Merck), using chloroform/methanol/water (65/25/4 v/v/v) for the first direction and chloroform/methanol/NH 4 0H/ethylpropylamine (130/70/10/1 v/v/v/v) for the second direction.
  • the lipid spots, and appropriate standards run on the same TLC plates, were visualized by brief exposure to iodine vapour, collected into vials and transmethylated to produce FAME for GC analysis as follows.
  • Fatty acid methyl esters (FAME) preparation and gas chromatography (GC) analysis For fatty acid composition analysis by GC, extracted lipid samples prepared as described above were transferred to a glass tube and transmethylated in 2 mL of 1 M HC1 in methanol (Supelco) at 80°C for 3 hours. After cooling to room temperature, 1.3 mL 0.9% NaCl and 800 ⁇ ⁇ hexane were added to each tube and FAMEs were extracted into the hexane phase.
  • the FAMEs were separated by gas-chromatography (GC) using an Agilent Technologies 7890A gas chromatograph (Palo Alto, California, USA) equipped with a 30-m BPX70 column essentially as described by Zhou et al. (2011) except that the temperature ramping program was changed to initial temperature at 150°C, holding for 1 min, ramping 3°C/min to 210°C, then 50°C/min to 240°C for a final holding of 2 min. Peaks were quantified with Agilent Technologies ChemStation software (Rev B.03.01 (317), Palo Alto, California, USA).
  • lipids were extracted as described by Bligh and Dyer (1959) and dissolved in CHC1 3 . Aliquots of one mg lipid were dried with N 2 , dissolved in 1 mL of lOmM butylated hydroxytoluene in butanol: methanol (1: 1 v/v), and analysed using an Agilent 1200 series LC and 6410B electrospray ionisation triple quadrupole LC-MS. Lipids were chromatographically separated using an Ascentis Express RP- Amide column (5 cm x 2.1 mm, Supelco) and a binary gradient with a flow rate of 0.2 mL/min.
  • the mobile phases were: A, 10 mM ammonium formate in H 2 0:methanol: tetrahydrofuran (50:20:30, v/v/v); B. 10 mM ammonium formate in H 2 0:methanol: tetrahydrofuran (5:20:75, v/v/v).
  • Selected neutral lipids (TAG and DAG) and phosphocholine (PC) with fatty acids 16:0, 16:1 18:0, 18: 1, 18:2, 18:3 were analysed by multiple reaction monitoring (MRM) using a collision energy of 25 V and fragmentor of 135 V.
  • MRM multiple reaction monitoring
  • Individual MRM TAGs and DAGs were identified based on ammoniated precursor ion and product ion from neutral loss of fatty acid. TAGs and DAGs were quantified using the 10 uM tristearin external standard.
  • sterol-OTMSi derivatives were dried under a stream of nitrogen gas on a heat block at 40°C and then re-dissolved in chloroform or hexane immediately prior to GC/GC-MS analysis.
  • the sterol-OTMS derivatives were analysed by gas chromatography (GC) using an Agilent Technologies 6890A GC (Palo Alto, California, USA) fitted with an Supelco EquityTM- 1 fused silica capillary column (15 m x 0.1 mm i.d., 0.1 ⁇ film thickness), an FID, a s lit/splitless injector and an Agilent Technologies 7683B Series auto sampler and injector.
  • GC gas chromatography
  • Helium was the carrier gas. Samples were injected in splitless mode at an oven temperature of 120°C. After injection, the oven temperature was raised to 270°C at 10°C mm 1 and finally to 300°C at 5°C min -1 . Peaks were quantified with Agilent Technologies ChemStation software (Palo Alto, California, USA). GC results are subject to an error of +5% of individual component areas.
  • GC-mass spectrometric (GC-MS) analyses were performed on a Finnigan Thermoquest GCQ GC-MS and a Finnigan Thermo Electron Corporation GC-MS; both systems were fitted with an on-column injector and Thermoquest Xcalibur software (Austin, Texas, USA). Each GC was fitted with a capillary column of similar polarity to that described above. Individual components were identified using mass spectral data and by comparing retention time data with those obtained for authentic and laboratory standards. A full procedural blank analysis was performed concurrent to the sample batch. Quantification of TAG via Iatroscan
  • Chromarod-SII for TLC-FID IatroscanTM (Mitsubishi Chemical Rulece Corporation - Japan).
  • the Chromarod rack is then transferred into an equilibrated developing tank containing 70 ml of a Hexane/CHCl 3 /2-Propanol/Formic acid (85/10.716/0.567/0.0567 v/v/v/v) solvent system. After 30 min of incubation, the Chromarod rack is then dried for 3 min at 100°C and immediately scanned on an Iatroscan MK-6s TLC-FID analyser (Mitsubishi Chemical Rulece Corporation - Japan). Peak areas of a DAGE internal standard and the TAG are integrated using SIC-480II integration software (Version:7.0-E SIC System instruments Co., LTD - Japan).
  • TAG quantification is carried out in two steps. First, the DAGE internal standard is scanned in all samples to correct the extraction yields after which concentrated TAG samples are selected and diluted. Next, the amount of TAG is quantified in diluted samples with a second scan according to the external calibration using glyceryl trilinoleate as external standard (Sigma- Aldrich).
  • FAD2 cDNAs were excised from pGEMT-easy vector as EcoRI fragments and inserted into the corresponding site of the vector pENTRl l (Invitrogen, Carlsbad, CA, USA). The inserts were then cloned into the destination expression vector pYES2-DEST52, to place the open reading frames under the control of the GAL1 promoter for inducible gene expression in yeast cells, using the Gateway® Cloning recombination technology (Stratagene, La Jolla, CA, USA). The gene sequences in the resultant plasmids were verified by DNA sequencing.
  • the resulting plasmids and the pYES2-DEST52 vector lacking any cDNA insert as a control were introduced into cells of yeast Saccharomyces cerevisiae strain YPH499 by lithium acetate-mediated transformation. Expression of these candidate FAD2 genes in yeast cells with or without exogenous fatty acid substrate feeding was essentially as previously described by Zhou et al. (2006). Each experiment was carried out in triplicate.
  • the recombinant cells were grown to stationary phase at 28 °C in 5 mL LB broth supplemented with 50 mg/L rifampicin and either 50 mg/L kanamycin or 80 mg/L spectinomycin according to the selectable marker gene on the binary vector.
  • the bacteria from each culture were pelleted by centrifugation at 3000x g for 5 min at room temperature before being resuspended in 1.0 ml of infiltration buffer containing 5 mM MES, pH 5.7, 5 mM MgS0 4 and 100 ⁇ acetosyringone. The resuspended cell cultures were then incubated at 28 °C with shaking for another 3 hours.
  • Leaves were infiltrated with the Agwbacterium cell mixtures and the plants were typically grown for a further five days after infiltration before leaf discs were recovered for total lipid isolation and fatty acid analysis.
  • N. benthamiana plants were grown in growth cabinets under a constant 24°C with a 14/10 hr light/dark cycle with a light intensity of approximately 200 lux using Osram 'Soft White' fluorescent lighting placed directly over plants. Typically, 6 week old plants were used for experiments and true leaves that were nearly fully-expanded were infiltrated. All non-infiltrated leaves were removed post infiltration to avoid shading.
  • RT-qPCR Real-Time Quantitative PCR
  • Gene expression analysis was performed by quantitative RT-PCR using a BIORAD CFX96TM Real-time PCR detection system and iQTM SYBR® Green Supermix (BioRad, Hercules, CA, USA). Primers of 19-23 nucleotides in length and having a melting temperature (Tm) of about 65°C and were designed for gene-specific amplifications that would result in amplification products of about 100-200 bp. PCR reactions were carried out in 96-well plates. All RT-PCR reactions were performed in triplicate.
  • the reaction mixture contained 1 x iQTM SYBR® Green Supermix (BioRad, Hercules, CA, USA), 5 ⁇ forward and reverse primers and 400 ng of cDNA and was used at a volume of 10 uL per well.
  • the thermal cycling conditions were 95°C for 3 min, followed by 40 cycles of 95°C for 10s, 60°C for 30s and 68°C for 30s.
  • the specificity of the PCR amplification was monitored by melting curve analysis following the final step of the PCR from 60°C through 95°C at 0.1°C/sec. Additionally, PCR products were also checked for purity by agarose gel electrophoresis and confirmed by sequencing.
  • the constitutively expressed gene KASII was used as an endogenous reference to normalise expression levels.
  • the data were calibrated relative to the corresponding gene expression level following the 2 "AACt method for relative quantification (Schmittgen, 2008).
  • the data were presented as means +SD of three reactions performed on independent 96- well plates.
  • Genomic DNA of safflower seedlings, genotype "SU" was isolated from fully expanded leaves using CTAB buffer and following the method described by Paterson et al. (1993). Further purification was carried out using CsCl gradients as previously described (Liu et al., 1999). Aliquots of 10 ⁇ g of safflower genomic DNA were digested separately with eight different restriction enzymes, namely Accl, Bglll, BamHI, EcoRI, EcoRY, HmdIII, Xbal and Xhol. Genomic DNA digested with each restriction enzyme was electrophoresed through 1% agarose gels.
  • the gel was soaked in 0.5 M NaOH, 1.5 M NaCl for 30 min and the DNA blotted onto a Hybond-N + nylon membrane (Amersham, UK).
  • the filters were probed with an a-P 32 dCTP-labelled DNA fragment corresponding to the entire coding region of the safflower GFAD2-6 gene as a representative of the CtFAD2 gene family at low stringency hybridization conditions.
  • the hybridizations were performed overnight at 65°C in a solution containing 6x SSPE, 10% Denhardt's solution, 0.5% SDS and 100 ⁇ / ⁇ ⁇ denatured salmon sperm DNA. Following the hybridisation and after a brief wash in 2x SSC/0.1% SDS at 50°C, the filters were washed three times, for 20 min each time, in 0.2 x SSC/0.1% SDS at 50°C prior to autoradiography.
  • Chimeric vectors comprising genes to be used to transform Arabidopsis were introduced into A. tumefaciens strain AGL1 and cells from cultures of the transformed Agrobacterium used to treat A. thaliana (ecotype Columbia) plants using the floral dip method for transformation (Clough and Bent, 1998). Transformed safflower plants were produced as described by Belide et al. (2011) using the transformed Agrobacterial cultures.
  • RNA was isolated from 100 mg samples of frozen safflower tissues including developing embryos, leaves, roots and hypocotyls. This was done for each tissue separately using an RNeasy® Plant total RNA kit (Qiagen, Hilden, Germany) according to the supplier's protocol. The RNA concentration in the preparations was determined with a NanoDropTM spectrophotometer ND1000 (Thermo Fisher Scientific, Victoria, Australia) and the RNA concentrations were equalized before analysis. The quality and relative quantities of the RNA in each preparation were visualized by gel electrophoresis of samples through 1% (w/v) agarose gels containing formaldehyde.
  • RNA preparations were treated with RQ1 RNase-free DNase (Qiagen, Hilden, Germany) to remove contaminating genomic DNA.
  • First-strand cDNA was synthesized from 400 ng of each DNA-free RNA preparation using the Superscript III First-Strand Synthesis System (Qiagen, Hilden, Germany) with oligo(dT) 2 o primer, following the manufacturer's instructions.
  • the seed expressed safflower FAD2 cDNAs were obtained by screening a cDNA library derived from developing embryos of safflower genotype "SU" (wild- type, high linoleic acid levels).
  • Library construction began with RNA extraction from a mixture of immature embryos of different developmental stages which were harvested and ground to powder in liquid nitrogen and RNA extraction was carried out using TRIzol following the manufacturer's instruction (Invitrogen, Carlsbad, CA, USA).
  • Poly (A) -containing RNA was isolated using a Qiagen mRNA purification kit (Qiagen, Hilden, Germany).
  • First strand oligo(dT)-primed cDNA was synthesised and converted to double stranded DNA using a Stratagene cDNA synthesis kit, according to the manufacturer's instructions (Stratagen, La Jolla, CA, USA).
  • the blunt-ended cDNA was ligated with EcoRI adaptors, phosphorylated, and size fractionated by gel-filtration in a Chroma spin+TE-400 column (Clontech, CA, USA).
  • the recombinant cDNAs were propagated in the E. coli strain XL-1 Blue MRF' using a Stratagene Predigested Lambda ZAP H/EcoRI/CIAP cloning kit.
  • the library was screened using a DNA fragment corresponding to the coding region of Arabidopsis FAD2 (GenBank accession no. L26296), following the protocol previously described (Liu et al., 1999). Positive plaques were purified through two successive rounds of screening and the purified phagemids containing putative FAD2 cDNAs were excised as outlined in the Stratagene ⁇ cDNA Synthesis Kit instruction manual. Sequence analysis of the FAD2 sequences were done by the NCBI Blast program (www.ncbi.nlm.nih.gov/BLAST/). The open reading frame was predicted by using VectorNTI. Two different full length cDNAs were isolated from developing seed cDNA library and named as CtFAD2- 1 and CtFAD2-2, respectively.
  • CGP expressed sequence tag
  • EST expressed sequence tag database of safflower (cgpdb.ucdavis.edu/cgpdb2.) was interrogated using the program BLASTp for ESTs that encoded polypeptides having similarity with the A. thaliana FAD2 (GenBank accession No. L26296). At least eleven distinct FAD2 cDNA sequence contigs were identified, among which two contigs showed identical sequences with CtFAD2-l and CtFAD2-2 isolated from safflower seed cDNA library. In addition, nine different cDNAs were identified and designated as CtFAD2-3 through to CtFAD2-ll, respectively. 3'- and 5' RACE
  • the longest EST clone of each of the 9 contigs was selected as the starting point for isolation of the corresponding full length cDNA sequences.
  • the process used 3'- and 5'- Rapid Amplification of cDNA Ends (RACE) using cDNA produced from RNAs obtained from various safflower tissues including developing embryos, leaves, roots, hypocotyls and flowers.
  • RACE cDNA Ends
  • GSP Gene specific primers
  • GSP gene-specific primer
  • the ORFs were amplified using the One-step RT-PCR kit using total RNAs derived from several safflower tissues including developing embryos, leaves, roots, hypocotyls and flowers (Stratagene, La Jolla, CA, USA).
  • the primers (Table 3) used to amplify the ORFs were based on the DNA sequences located in the 5' and 3' UTR of each cDNA.
  • the amplified PCR products were cloned to vector pGEM-Teasy®, and their nucleotide sequences obtained by DNA sequencing.
  • the predicted amino acid sequences of the encoded polypeptides QFAD2-1 to QFAD2-11 shared extensive sequence identity, from about 44% to 86% identity with each other. They showed 53% to 62% sequence identity with Arabidopsis FAD2.
  • the sizes of the predicted polypeptides were in the range from 372 to 388 amino acids, that is, they were all about 380aa residues in length.
  • the cDNAs had unique 5' and 3' untranslated region (UTR) sequences, therefore the endogenous genes could readily be recognised by their UTR sequences.
  • Amplification of the protein coding regions from safflower genomic DNA resulted in identical DNA sequences with the corresponding cDNA for each of the 11 genes, indicating that there were no introns interrupting their protein-coding regions.
  • CTCGAC-3' (SEQ ID NO: 58) GA -3' (SEQ ID NO: 59)
  • CTCGAC-3' (SEQ ID NO: 60) GA -3' (SEQ ID NO: 61)
  • CTGCCA -3' (SEQ ID NO: 62)
  • TC -3' (SEQ ID NO: 63)
  • TAGCTAG -3' SEQ ID NO: CTA-3' (SEQ ID NO: 95)
  • HECGH HECGH (SEQ ID NO: 159), HDCGH (SEQ ID NO: 160), HDLGH (SEQ ID NO: 161), HRRHH (SEQ ID NO: 162), HRTHH (SEQ ID NO: 163), HRSHH (SEQ ID NO: 164), HRNHH (SEQ ID NO: 165), HVVHH (SEQ ID NO: 166), HVTHH (SEQ ID NO: 167), HAVHH (SEQ ID NO: 168), and HVLHH (SEQ ID NO: 169).
  • the predicted polypeptides of the 11 candidate CtFAD2s each contained an aromatic amino acid-rich motif at the very end of the C-terminus. Such motifs have been identified in other plant FAD2 polypeptides, and are thought to be necessary for maintaining localization in the ER (McCartney et al., 2004). Consistent with other plant membrane bound fatty acid desaturase enzymes, the predicted CtFAD2 polypeptides each contained three histidine-rich motifs (His boxes). Such His-rich motifs are highly conserved in FAD2 enzymes and have been implicated in the formation of the diiron-oxygen complex used in biochemical catalysis (Shanklin et al., 1998).
  • the first histidine motif was HECGHH, the exceptions being QFAD2-5 and -6 which had HDCGHH and HDLGHH, respectively.
  • the last amino acid of the first His box in CtFAD2-8 (HECGHQ) was a Q rather than a H.
  • the inventors looked for this motif in 55 known plant FAD2 enzymes and the H to Q substitution is also present in a diverged FAD2 homologue from Lesquerella lindheimeri with predominantly fatty acid hydroxylase activity (Genbank Accession number EF432246; Dauk et al., 2007).
  • the second histidine motif was highly conserved, as the amino acid sequence HRRHH, in several candidate safflower FAD2s, including QFAD2-1, -2, -8, -9 and -10. It was noteworthy that the amino acid N was found in QFAD2-11 at the +3 position of the motif, which was also seen in a number of functionally divergent FAD2-type enzymes including Crepis alpina CREP1, Crepis palaestina Cpal2 and sunflower vFAD2 (AY166773.1), Calendula officinalis FAC2 (AF343064.1), Rudbeckia hirta acetylenase (AY166776.1). The amino acid at this position in CtFAD2-3, -4, -5, -6 and -7 was either an S or a T.
  • the amino acid immediately preceding the first histidine box was an alanine, the same as for other plant fatty acid A12-desaturase enzymes.
  • the amino acid valine (V) rather than alanine was present at that position in QFAD2-5, while the other six CtFAD2 polypeptides had a glycine in this position. It was proposed by Cahoon et al. (2003) that a glycine substitution for alanine at this position has been found in functionally divergent FAD2 enzymes, except fatty acid A12-hydroxylase.
  • FAD2 genes are conserved in many flowering plants. All FAD2 genes studied so far contain only one intron which is located at the 5'UTR, with one exception being soybean FAD2-1 for which the intron is located in the coding region immediately following the first ATG, the translational initiation codon (Liu et al., 2001 ; Kim et al., 2006; Mroczka et al., 2010). Intron sequence divergence could be used as a measure of evolutionary distance between taxonomically closely related species (Liu et al., 2001).
  • the typical intron splice sites (AG:GT) were predicted in the 5' UTR of each CtFAD2 cDNA sequence, and PCR primers were designed based on the flanking sequences of predicted splice sites.
  • the primers are listed in Table 7.
  • Genomic DNA isolated from safflower genotype SU was used as template in PCR reactions to amplify the genomic regions corresponding to the 5'UTRs. The amplifications were accomplished in 50 ⁇ ⁇ reactions with 100 ng of genomic DNA, 20 pmol of each primer and a Hotstar (Qiagen, Hilden, Germany) supplied by the manufacturer.
  • PCR temperature cycling was performed as follows: 94°C for 15 min for one cycle, 94°C for 30s, 55°C for 1 min, 72°C for 2 min for 35 cycles; 72°C for 10 min using the Kyratec supercycler SC200 (Kyratec, Queensland, Australia).
  • the PCR products were cloned into pGEM-T Easy and then sequenced.
  • the inventors were able to obtain the predicted 5' intron from 8 of the 11 candidate CtFAD2 genes, namely CtFAD2- l, -2, -3, -4, -5, -7, -10 and -1 1.
  • the major features of these introns are given in Table 8.
  • the intron was not amplified successfully from CtFAD2-6, -8 and -9, probably due to an insufficient length of the 5' UTR in which the introns were present. It appeared that an intron-less FAD2 has not been reported, although intron loss from nuclear genes has been commonly observed in higher plants (Loguercio et al., 1998; Small et al., 2000a;b).
  • Table 7 Oligonucleotide primers used for the amplification of 5 'UTR regions of candidate FAD2 genes in safflower.
  • the intron sequence in each of the eight genes was located within the 5'-UTR of each gene, at positions that ranged from 11 to 38 bp upstream of the putative translation start codon, the first ATG in each open reading frame.
  • the intron length ranged from 104bp (OFAD2-11) to 3,090 bp (OFAD2-2) (Table 8).
  • OFAD2-1 the intron size was 1,144 bp, similar in size to introns identified in FAD2 genes from Arabidopsis (The Arabidopsis Information Resource, http://www.arabidopsis.org), cotton (Liu et al., 2001) and sesame (Sesamum indicum) (Kim et al., 2006).
  • the Arabidopsis FAD2 gene had a 1,134-bp intron just 5 bp upstream from its ATG translation initiation codon.
  • the size of the 5'-UTR intron of the Gossypium FAD2-1 gene was 1,133 bp, located 9 bp upstream from the translation initiation codon.
  • the cotton FAD2-4 and FAD2-3 genes had larger 5'-UTR introns of 2,780bp and 2,967bp, respectively, located 12 bp upstream from the translation start codon.
  • Each candidate CtFAD2 gene could be distinguished by the differences in the position and size of the 5'-UTR intron in each gene. The differences could also be important in providing for differential expression of the genes.
  • Such introns have been reported to have positive effects on the expression of reporter genes in sesame (Kim et al., 2006).
  • a corresponding intron was shown to be an effective target for posttranscriptional gene silencing of FAD2 in soybean (Mroczka et al., 2010).
  • yeast S. cerevisiae As a convenient host cell, the yeast S. cerevisiae has been used for studying the functional expression of several plant FAD2 ⁇ 12 oleate fatty acid desaturases (Covello and Reed 1996; Dyer et al., 2002; Hernandez et al., 2005). S. cerevisiae has a relatively simple fatty acid profile and it contains ample oleic acid in its phospholipid which can be used as a substrate for FAD2 enzymes. It also lacks an endogenous FAD2 activity. Therefore, the 11 candidate CtFAD2 genes were tested in yeast strain YPH499 using pYES2 derived constructs, each open reading frame under the control of the GAL1 promoter, as described in Example 1.
  • CtFAD2-l, QFAD2-2 and CtFAD2-10 were able to convert oleic acid to linoleic acid and therefore were ⁇ 12 oleate desaturases.
  • the level of 18:2 produced was lower than for the Arabidopsis AtFAD2 construct which was used as positive control.
  • QFAD2-10 produced both linoleic acid (C18:2) and hexadecadienoic acid (C16:2) using oleic acid (C18: l) and palmitoleic acid (C16: l) as substrates, respectively, while CtFAD2-9 desaturated palmitoleic acid and was therefore a ⁇ 12 palmitoleate desaturase.
  • Table 9 Fatty acid composition of yeast cells expressing selected QFAD2 genes.
  • each of the CtFAD2 ORFs was inserted in the sense orientation into a modified pORE04 binary vector between the enhanced CaMV-35S promoter and the nos3' terminator containing a polyadenylation signal sequence (Coutu et al., 2007) (SEQ ID NO: 54).
  • SEQ ID NO: 54 a polyadenylation signal sequence
  • CtFAD2-l l was initially assessed by expression in S. cerevisiae and two novel fatty acids were identified by GC-MS as 18:2 ⁇ 9( ⁇ ), ⁇ 2( ⁇ ) and 1 8 :2 ⁇ ( ⁇ ), ⁇ 2( ⁇ ) ⁇ reS p ect i ve iy Consistent with the results obtained from yeast, expression of CtFAD2-l l in N. benthamiana leaves yielded a novel 18:2 trans isomer. The methyl ester of this isomer displayed a GC retention time that was identical to that of a methyl 18:2 ⁇ 9( ⁇ ) ' 12( ⁇ ) ( Figure 4B).
  • benthamiana expression experiments indicated that CtFAD2- 11 functioned primarily as an oleate A12-desaturase lacking stereo-specificity, producing both linoleic acid and its trans-A12 isomers. In addition, it could also further desaturate the ⁇ 12 double bond of linoleic acid to form the acetylenic bond of crepenynic acid.
  • the 11 candidate CtFAD2 genes described above that were identified in safflower represent the largest FAD2 gene family observed in any plant species that has been examined to date. Although only a single FAD2 gene was identified in Arabidopsis (Okuley et al., 1994), FAD2 appears to be encoded by multiple genes in most other plant genomes studied so far.
  • Safflower is a self-pollinating diploid plant species which is most closely related to a wild diploid species Carthamus palaestinus and it is not known to have extensive genome duplication or rearrangement (Chapman and Burke, 2007).
  • the multiple FAD2 cDNAs that were identified could not be attributed to alternative splicing since the candidate FAD2 genes did not contain introns in the coding region sequence. Rather, gene duplication was more likely responsible for creating the FAD2 family complexity in safflower.
  • the topology of the phylogenetic tree showed that gene duplications may have occurred at several hierarchical levels.
  • the QFAD2-3, -4 and -5 polypeptides were more closely related to the others in that clade than they were to other safflower FAD2 sequences, indicating that more recent gene duplications may have been responsible for the emergence of this clade.
  • the oligonucleotide primers used for the analyses are listed in Table 11. Table 11. Oligonucleotide primers used for RT-qPCR in the expression profile study of safflower FAD2 genes.
  • QFAD2-2 5'- GCCTCCAAAGATTCATTCAGGTC - 3' (SEQ ID NO: 1 18) 5'- CAAGATGGATGCGATGGTAAGG -3' (SEQ ID NO: 1 19)
  • CtFAD2-4 5'- AAGGCAGGCCGTGATGCCGAT -3' (SEQ ID NO: 122) 5'- AGTATTTGATCAATCCGCTGG -3' (SEQ ID NO: 123)
  • QFAD2-7 5'- CGAATCACACCCACGGGATC -3' (SEQ ID NO: 128) 5'- CTAAAGAATTTCCATGGTGTTAC -3' (SEQ ID NO: 129)
  • CtFAD2-8 5'- GAGCAACGGAGAGAAGTAACC -3' (SEQ ID NO: 130) 5'- GAGGGATGATAGAAAGAGGTCC -3' (SEQ ID NO: 131)
  • QFAD2-10 5'- CCAACAAACAAACCATCTCTCG -3' (SEQ ID NO: 134) 5'- GAGAGACGGTGGAAGTAGGTG -3' (SEQ ID NO: 135)
  • the temporal and spatial expression pattern of the 11 CtFAD2 genes is shown in Figure 5.
  • the RT-qPCR assays showed that CtFAD2- 1 was exclusively expressed in developing seeds.
  • GFAD2-2 was expressed at low levels in seeds as well as other tissues examined.
  • no expression of CtFAD2-4, -5, -6, -7, -8, -9 was observed in developing embryos.
  • Low, yet detectable, levels of CtFAD2-10 and -11 expression were observed in developing seeds, more so in the late developmental stage as the safflower seeds approach maturity.
  • GFAD2-4, -6, -7, -9 and -11 all showed high levels of expression in the young seedling tissues including in cotyledons and hypocotyls.
  • CtFAD2-5 and -8 appeared to be root-specific and CtFAD2-10 was preferentially expressed in flower tissues, with relatively low levels detected in various other tissues examined, including developing seeds, and ten days old seedling tissues.
  • Knowles (1968) incorporated the ol allele into a safflower breeding program and released the first high oleic (HO) safflower variety "UC-1" in 1966 in the US, which was followed by the release of improved varieties "Oleic Leed” and the Saffola series including Saffola 317 (S-317), S-517 and S-518.
  • Safflower microsomes were freshly prepared from developing seeds of the high oleic genotype S-317 at mid-maturity stage, about 15 days post anthesis (DPA), as described by Stymne and Appelqvist (1978).
  • a standard 90 ⁇ ⁇ reaction mixture contained 40 ⁇ g microsomal protein, 2 nmol [ 14 C]oleoyl-CoA in 0.1 mmol potassium phosphate buffer pH7.2. Then, 10 ⁇ L ⁇ of 50 mM NADH was added and the incubation continued for an additional 5, 10 or 20 min. The reactions were stopped by adding 90 of 0.15 M acetic acid and lipid extracted with 500 CHCl 3 :MeOH (1: 1).
  • the lower CHC1 3 phase was recovered and the polar lipids from it separated by thin layer chromatography (TLC) using the solvent system CHCl 3 /MeOH/HAc/H 2 0 (90: 15: 10:3 v/v/v/v). Spots corresponding to PC were scraped off the plate and the associated fatty acyl groups were transmethylated in 2 ml of 2% sulphuric acid in MeOH at 90°C for 30 min.
  • the resultant FAMEs were separated on AgN0 3 treated TLC plates with hexane:DEE:HAc (85: 15: 1 v/v/v). 14 C labelled oleate and linoleate methylester standards were spotted on the plate as references. The plates were exposed and analysed by a Fujifilm FLA-5000 phosphorimager. The radioactivity of each sample was quantified with Fujifilm Multi Gauge software.
  • the two seed-expressed FAD2 cDNAs namely GFAD2-1 and CtFAD2-2, were amplified by PCR from three high oleic varieties: S-317, LeSaf 496 and CW99-OL and sequenced.
  • the cDNAs covering the entire coding regions of the CtFAD2- ⁇ genes from all three high oleic varieties were identical in nucleotide sequence to each other, and shared about 98% sequence identity with the CtFAD2-l cDNA derived from the wild type variety SU, including one nucleotide deletion and 22 nucleotide substitutions in the HO genotype relative to the wild-type.
  • the single base pair deletion was found at nucleotide 606 counting from the first ATG, in approximately the middle of the CtFAD2- ⁇ coding region. This deletion caused a shift in the translational reading frame that created a stop codon soon after the deletion, so that the mutant gene in the three olol varieties encoded a predicted, truncated polypeptide without the third histidine box present in the wild- type protein (Figure 6). It was noteworthy that there was a relatively high level of sequence variation in the DNA sequences near the deleted single nucleotide site of the ol allele, suggesting that additional mutations had accumulated in the mutant gene.
  • the DNA regions including the 5' UTR introns of CtFAD2- ⁇ and OFAD2-2 were also isolated from the olol mutant S-317 and compared to the wild-type introns.
  • the CtFAD2- ⁇ intron from S-317 was 1144 bp in length, 61 bp longer than the wild type SU intron which was 1083 bp in length.
  • the comparison of the nucleotide sequences of the CtFAD2- ⁇ introns showed an overall sequence identity of 76.8%, the introns differing in 27 indels and 95 single nucleotide substitutions (Figure 7).
  • the nucleotide substitutions in the mutant gene were not distributed evenly throughout the 1142 bp long region corresponding to the coding region of the defective CtFAD2-l, in that 14 of the 22 (63.6%) substitutions were present near the nucleotide deletion, most within 123bp just downstream of the single nucleotide deletion.
  • the GFAD2-2 introns in the wild-type and mutant genotypes shared an overall 99.5% sequence identity, with only 12 nucleotide substitutions and one 2-nt indel.
  • S-901 genotype was characterised by an increase of the level of oleic acid to 89.5-91.5% of total fatty acids in mature seeds. There was a reduction of saturated fatty acids, i.e palmitic acid down to about 4% and stearic acid down to about 2.5%. However, S-901 did not display a normal plant phenotype and suffered some comprised growth and yield. Morphologically it was shorter and flower heads were smaller compared to its parent line S-518. It also flowered late and contained less oil in the seeds.
  • the single nucleotide deletion- sequence polymorphism in the mutant CtFAD2- 1 allele concluded to be the causative mutation responsible for the HO phenotype, was developed as the molecular basis of a highly efficient molecular marker for tracking the mutant ol allele.
  • the inventors thus developed a molecular marker assay that allowed the identification and selection of the mutant ol allele for breeding purposes or varietal identification purposes, even when it was present in the heterozygous state.
  • Molecular marker assisted selection thereby eliminates the need to produce an extra generation of plants that must be screened for the fatty acid phenotype. Simple genetics combined with perfect molecular marker assays will make it possible for safflower breeders to quickly incorporate the high oleic trait in their breeding program.
  • CtFAD2-l between the wild type SU and high oleic genotype S-317 to easily generate a differential marker based on PCR reactions.
  • the inventors could take advantage of the relatively high sequence divergence in the 5' UTR intron of CtFAD2- 1 between the OL and ol alleles. There were stretches of highly variable sequences between these two alleles which enabled the design of unique PCR primers.
  • the following illustrative primers were designed to amplify a specific product of 315 bp long from the high-oleic genotypes carrying the olol mutant allele, but not in the wild type SU.
  • HO-Sense 5 ' - ATAAGGCTGTGTTCACGGGTTT-3 ' (SEQ ID NO: 140); and HO-Antisense: 5 ' -GCTCAGTTGGGGATAC AAGGAT-3 ' (SEQ ID NO: 141) ( Figure 7).
  • a pair of primers derived from the safflower KASII gene, ctkasll-sense: 5'- CTGAACTGCA ATTATCTAGG-3 ' (SEQ ID NO: 144) and ctkasll-antisense 5'- GGTATTGGTATTGGATGGGCG -3' (SEQ ID NO: 145) were used as the positive control to ensure the equal loading and good PCR performance of the template DNA.
  • the PCR reaction conditions were 94°C for 2 min, followed by 40 cycles of 94°C for 30 sec, 58°C for 30 sec and 72°C for 30sec.
  • the reaction products were separated by electrophoresis on a 1% agarose gel and visualized under UV light following ethidium bromide staining of the gel.
  • a fragment of about 300bp was observed in the amplification reactions for all five high oleic genotypes examined, namely S-317, S-517, CW99-OL, LeSaf496 and Ciano-OL, while such a fragment was absent for the wild-type genotype SU.
  • CtFAD2- 1 was expressed only in the developing embryos of the developing seeds and not detectably in various other tissues examined, including in leaf, root, flower, cotyledon and hypocotyls derived from young safflower seedlings.
  • CtFAD2- 1 was highly expressed in developing seeds where the rate of fatty acid metabolism was high, and led to active oil accumulation having mostly CI 8:2 in a relatively short period of time.
  • CtFAD2- 1 had its highest expression level at about the mid point in seed development, with a more moderate expression level at both early and late stages of seed development.
  • the level of normalized gene expression of the CtFAD2- 1 gene was measured in three high oleic varieties, namely S-317, Lesaff496 and CW99-OL, and compared to that in developing seeds of the wild-type genotype SU.
  • CtFAD2- 1 expression was detected in all three stages of developing embryos in the wild-type safflower genotype SU, with the highest level of expression observed at the mid- maturity stage, consistent with the previous results and verifying the temporal transcription pattern for this key FAD2 gene.
  • CtFAD2- 1 transcripts were barely detectable in the three high oleic varieties S-317, Lesaff496 and CW99-OL ( Figure 8), indicating a high level of instability of the RNA transcripts from this gene in the mutant embryos.
  • CtFAD2-2 expression could also contribute to the A12-desaturation of fatty acids for storage lipids in developing safflower seeds, but at a much lower level than for CtFAD2- 1 in the wild-type seeds, as well as being involved in A12-desaturation of fatty acids for membrane lipids in root, leaf and stem. There was no evidence that CtFAD2-2 expression was elevated in the high oleic mutant in response to, or as compensation for, the loss of QFAD2-1 activity in the developing safflower seeds of the CtFAD2 -1 mutant.
  • the drastically reduced level of CtFAD2- 1 transcripts in the HO embryos might have been caused by non-sense mediated mRNA degradation (NMD) of CtFAD2- 1 mRNAs, since a premature stop codon was found in the middle of coding sequence soon after the single nucleotide deletion.
  • NMD non-sense mediated mRNA degradation
  • the NMD system is considered to be a mechanism involved in the degradation of aberrant mRNAs that contain a premature termination codon (PTC) resulting from unexpected errors such as genomic mutations, transcriptional errors, and mis-splicing. It is a mechanism that is universally present in eukaryotes and, in particular it has been extensively studied in yeast and mammals.
  • RNA libraries Two small RNA libraries, derived from the high oleic genotype S-317 and wild type SU, were generated using pooled RNA isolated from the mid-maturity developing embryos. Bulk sequencing of the small RNA libraries was performed with Solexa technology (Hafner et al., 2008). Sequencing of these two libraries was performed on the niumina's Solexa Sequencer and the samples were run side by side. The sequencing of SU and S-317 small RNA libraries generated a total of 23,160,261 and 21,696,852 raw reads, respectively. Analysis of these reads resulted in identification of 22,860,098 and 21,427,392 sequences ranging in length from 18 to 30 nucleotides (nt), respectively.
  • the inventors performed experiments for the transient expression of CtFAD2- 1 derived from both wild-type and high oleic genotypes in N. Benthamiana leaves.
  • Each of the CtFAD2 -1 ORFs was inserted in sense orientation into a modified pORE04 binary vector under the control of the CaMV-35S promoter.
  • Agwbacterium tumefaciens strain AGL1 harbouring either the 35S:CtFAD2-l or its mutant form 35S:CtFAD2-lA was infiltrated into the underside of the fully expanded leaves of N. benthamiana together with 35S:P19, as described in Example 5. Following a period of 5 days further growth at 24°C, the infiltrated regions were excised and total RNAs were obtained from the samples using an RNeasy Mini Kit (Qiagen).
  • High levels of CtFAD2- 1 expression were observed in the N. benthamiana leaves from the 35S- CtFAD2 -1 gene derived from the wild- type SU variety. In comparison, much lower levels of expression were observed for the 35S-CtFAD2-lA gene derived from the high oleic genotype.
  • A. thaliana ecotype Col-0 plants were transformed with A. tumefaciens strain AGL1 carrying a binary vector harbouring a seed-specific promoter Fpl driving either the CtFAD2- ⁇ or the CtFAD2-lA coding region, according to the method of Clough and Bent (1998).
  • Total RNA was isolated from siliques containing mid-maturity stage embryos of progeny of the resultant transformed plants using an RNeasy Mini Kit (Qiagen). Gene expression studies were done using the RNA preparations by the Real Time RT-qPCR assays, carried out in triplicate as described above.
  • Safflower seed oil contains approximately 7% palmitic acid. This fatty acid is synthesized in the plastids of the developing seed cells, from where it is exported to the cytosol of the cells for its incorporation into triacylglycerols.
  • the key enzyme for palmitic acid export is palmitoyl- ACP thioesterase which hydrolyses the thioester bond between the palmitoyl moiety and the acyl carrier protein (ACP) to which the acyl group is covalently bound while it is synthesised in the plastid.
  • the enzyme palmitoyl- ACP thioesterase belongs to a group of soluble plastid-targeted enzymes designated FATB.
  • FATB enzyme displays specificity towards short chain saturated acyl-ACP as substrate.
  • a gene encoding FATB enzyme was initially isolated from plant species accumulating medium chain-length saturated fatty acids, such as lauric acid (C12:0) from California bay tree (Umbellularia californica). Subsequent studies demonstrated that FATB orthologues were present in all plant tissues, predominantly in seeds, with substrate specificity ranging from C8:0-ACP to C18:0-ACP. In Arabidopsis and most temperate oilseed crops including safflower, palmitic acid is the major saturated fatty acid in seed oil.
  • the cDNA library of developing safflower seeds was screened using a heterologous probe consisting of a FATB cDNA fragment from cotton ⁇ Gossypium hirsutum) as described in Example 1.
  • a heterologous probe consisting of a FATB cDNA fragment from cotton ⁇ Gossypium hirsutum
  • One full length cDNA was isolated from safflower seed cDNA library.
  • This cDNA contained an open reading frame of 1029 nucleotides in length, encoding a polypeptide of 343 amino acids. Its 5' and 3' UTRs were 236nt and 336nt in length, respectively.
  • CtFATB-T12 polypeptide had a predicted transit peptide of about 60 amino acids and a 210-amino acid residue core that contained two repeats of a helix and multi- stranded sheet fold common to the so-called hot dog fold proteins.
  • CGP Compositae Genome Project
  • EST expressed sequence tag
  • antisense primer 5' -TTCTTGGGACATGTGACGTAGAA-3 ' (SEQ ID NO:
  • CtFATB-A showed low expression levels in leaves, roots and in all three stages of developing embryos that were examined.
  • CtFATB-B was active in leaves and roots, but showed lower expression in developing embryos than in leaves and roots. This suggested that this gene might play only a minor role, if any, in fatty acid biosynthesis in developing seeds.
  • CtFATB-C demonstrated high expression levels across all the tissues examined, particularly in the developing embryos. This indicated that CtFATB-C was the key gene encoding FATB for the production of palmitic acid in safflower seed oil.
  • microsomal FAD2 enzyme has a major role in converting oleate to linoleate in the ER following export of oleic acid from the plastid and conversion to CoA esters in the cytoplasm.
  • Chloroplast omega-6 desaturase is an enzyme that desaturates 16: 1 and 18: 1 fatty acids to 16:2 and 18:2, respectively, on all 16: 1- or 18: l-containing chloroplast membrane lipids including phosphatidyl glycerol, monogalactosyldiacylglycerol, digalactosyldiaclyglycerol, and sulfoguinovosyldiacylglycerol.
  • An Arabidopsis fad6 mutant was reported to be deficient in desaturation of 16: 1 and 18: 1 to 16:2 and 18:2, respectively, on all chloroplast lipids (Browse et al., 1989).
  • cDNA sequence encode FAD6 was first isolated from Arabidopsis by Falcone et al. (1994). Since then, cDNAs encoding FAD6 and FAD6 genes have been isolated from several plant species including Brassica napus, Portulaca oleracea, soybean, and Ricinus communis.
  • the full length cDNA was subsequently obtained through 3' RACE PCR amplification using, as template, DNA extracted from a lambda cDNA library made from developing seeds of safflower (SU). PCR conditions were as described in Example 2.
  • a single oligo primer, designated ctFAD6-s2 was used in the amplification reaction in combination with Ml 3 Forward primer since the sequence for this primer was present in the vector of cDNA library.
  • the sequence of the ctFAD6-s2 primer was: 5 ' -C ATTG A AGTCGGT ATTG AT ATCTG- 3 ' (SEQ ID NO: 154).
  • a cDNA of 1545 bp was obtained which had an open reading frame of 1305 bp that encoded a candidate FAD6 polypeptide of 435 amino acids. This polypeptide shared between 60-74% amino acid sequence identity with other cloned plant FAD6 polypeptides.
  • a dendrogram showing the phylogenetic relationship between the safflower FAD6 sequence and representative FAD6 plastidial ⁇ 12 desaturase identified in higher plants was generated by Vector NTI ( Figure 10). Expression Profile of CtFAD6 by Real-Time qPCR Analysis
  • CtFAD6 The expression profile of CtFAD6 was studied by Real time RT-qPCR which was carried out using Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen) and run on an ABI 7900HT Sequence Detection System with defaults parameters as described in Example 1.
  • the primers used were: ctFAD6-S2: 5'- CATTGAAGTCGGTATTGATATCTG -3' (SEQ ID NO: 155) and ctFAD6-a2: 5' - GTTCCAACAATATCTTCCACCAGT- 3' (SEQ ID NO: 156).
  • Reactions were performed in triplicate in 10 ⁇ ⁇ total volumes containing 20 ng of total RNA template, 800 mM each primer, 0.25 ⁇ ⁇ of reverse transcriptase and 5 ⁇ ⁇ one-step RT-PCR master mix reagents. Conditions for RT and amplification were 48°C for 30 min, then 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 60 s. Expression of a reference gene safflower CtkasII was used to normalize the FAD6 expression levels. The calculations were made as described in Example 1.
  • CtFAD6 was expressed at relatively low levels in leaves, roots and three consecutive stages of developing embryos.
  • the low expression levels observed in developing seeds was consistent with the notion that FAD6 might have a relatively minor role in the desaturation of oleate in seeds.
  • Hairpin RNAs are a type of RNA molecule that have been used extensively to reduce gene expression in plants. Hairpin RNAs are typically transcribed in plant cells from a DNA construct containing an inverted repeat of a sequence derived from a gene to be silenced. The hpRNA transcript thereby has complementary sense and antisense sequences which hybridise to form a double- stranded RNA (dsRNA) region joined by a loop sequence. Such dsRNA structures are processed by endogenous silencing machineries in the plant cells to form small RNA molecules of about 21 to 24 nucleotides corresponding in sequence to the gene to be reduced in activity. These small RNAs can form complexes with endogenous proteins that specifically silence the gene of interest.
  • dsRNA double- stranded RNA
  • Such silencing can occur at the transcriptional level, mediated by DNA methylation of parts of the target gene, at the post-transcriptional level by degradation of the target mRNA, or by binding to the mRNAs to inhibit its translation and thereby reduce protein synthesis encoded by the gene.
  • the hpRNA includes a sequence that is in common between members of a gene family, the hpRNA can silence each of those genes that have the sequence.
  • Safflower has a large family of FAD2 genes, with at least 11 members identified as described herein (Examples 2 to 6). Safflower also has multiple genes encoding FATB polypeptides, with at least three members identified (Example 8), and at least one FAD6 gene (Example 9). Indeed, the experiments described above may not have identified all members of the gene families in safflower.
  • a plant binary expression vector was designed for the expression of transgenes in seeds using the promoter of an Arabidopsis Olesoinl gene (TAIR website gene annotation At4g25140) (SEQ ID NO: 52).
  • the isolated promoter was 1192bp in length starting from nucleotide 12899298 in Accession No. NC003075.7, except that within the 1198 bp sequence, 6 bp were omitted to avoid common restriction digestion sequences to aid later cloning steps.
  • the AtOleosin promoter has previously been used for strong, seed-specific expression of transgenes in safflower and Brassica species (Nykiforuk et al., 1995; Vanrooijen and Moloney, 1995).
  • This promoter was likely to be a bi-directional promoter, directing strong seed-specific expression of coding regions joined to both ends of the promoter fragment.
  • the Arabidopsis oleosin promoter shares features with the Brassica napus oleosin promoter, characterised to have a bi-functional nature (Sadanandom et al., 1996).
  • the promoter was chemically synthesised, cloned into pGEMT-Easy and the EcoRI fragment containing the promoter blunted via the Klenow fragment enzyme fill-in reaction, and ligated into the Klenow- blunted Hindlll site of pCW265 (Belide et al., 2011), generating pCW600 (AtOleosinP:: empty).
  • This vector had a selectable marker gene that encoded a hygromycin phosphotransferase (HPT), thereby allowing selection for tolerance to hygomycin in tissue culture during the transformation process.
  • the vector also included a 35S::GFP gene which allowed selection of transformed cells or tissues by fluorescence under UV light illumination.
  • the vector was designed for expression of a coding region of interest which could be inserted into a multiple cloning site situated downstream of the promoter and upstream of a nos polyadenylation signal nos ).
  • This vector served as the backbone vector for the constructs pCW602 and pCW603 described below.
  • a flax linin promoter (US 7,642,346) (SEQ ID NO: 53) was inserted as a Notl- Xhol fragment into the binary vector pT7-HELLSGATE12 (Wesley et al., 2001), generating the Gateway silencing binary vector pXZP410.
  • the vector pXZP410 had a selectable marker gene which confered resistance to kanamycin during tissue culture and allowing seed specific expression of hairpin RNA constructs under the control of the linin promoter.
  • the vector had two introns, one in the sense orientation and the other in the antisense direction with respect to the promoter, and had AttLl and AttL2 recombinational sites flanking the introns.
  • a 300 bp sequence (SEQ ID NO: 50) identical to a region of the safflower gene CtFATB-3 corresponding to nucleotides 485-784 of the CtFATB-3 cDNA was chemically synthesised and inserted into pENTR/D topo (Invitrogen) according to the manufacturer's instructions, generating a Gateway entry clone designated pCW569.
  • the primers were D28-PstI-5 (5'- CCTGC AGGTACCAATGGCTCGACGAC ACTG-3 ' ) (SEQ ID NO: 157) and D28- AscI-3 (5'- CGGCGCGCCTTCACCTCCTCATCTTTATCC-3') (SEQ ID NO: 158) respectively.
  • the primers included 5' PstI and 3' AscI restriction enzyme sites, thereby allowing the insertion of the amplified fragment into the corresponding sites of pCW569, generating pCW570.
  • This vector contained the fused regions from the CtFATB and CtFAD2-2 genes as a fragment of 1080 bp flanked by recombinational sites, AttLl and AttL2.
  • pCW603 was capable of expressing an hpRNA under the control of the AtOleosin promoter in seeds of safflower, to reduce expression of CtFATB and CtFAD2-2.
  • a 590 bp fragment (SEQ ID NO: 51) of DNA made up of a 290 bp fragment of
  • CtFAD6 corresponding to nucleotides 451 to 750 of the cDNA for CtFAD6, and a 300 bp fragment of CtFATB, as for pCW571, was chemically synthesised and inserted into pENTR/D topo, generating pCW579.
  • This construct was an entry clone vector containing the sequences from the CtFATB, CtFAD6 and CtFAD2-2 genes joined in that order as a DNA fragment of 1370 bp with flanking recombinational sites, AttLl and AttL2. Two copies of this FATB-FAD6- FAD2-2 fragment were then inserted as an inverted repeat into pXZP410 using LR clonase, generating pCW581.
  • This construct pCW581 was a binary vector having a flax linin promoter operably linked to the inverted repeat, which upon transcription in developing safflower seeds cells was capable of expressing an hpRNA to reduce expression of the CtFATB, CtFAD6 and CtFAD2-2 genes.
  • CtFAD6-CtFAD2-2 regions were enzymatically cut out of pCW571 with Notl, blunted using Klenow I fragment and then ligated into the EcoRY site of pCW600, generating pCW602.
  • pCW602 had the CtFA TB - CtFAD6- GFAD2-2 sequences under the control of the AtOleosin promoter, in contrast to pCW581 which had the same design and gene fragments except with the linin promoter.
  • both pCW571 and pCW581 had the selectable marker that conferred kanamycin tolerance.
  • the kanamycin resistance cassette of pCW571 and pCW581 was replaced with a hygromycin resistance cassette as the selectable marker gene.
  • the hygromycin resistance gene made up of the enCUP promoter:hygromycin:nos3'polyadenylation region was cut out of pCW265 with Spel- Avrll restriction digestion and used to replace the kanamycin resistance cassette in pCW571 and pCW581, thus generating pCW631 and 632, respectively.
  • constructs used in this first set of safflower transformations contained the following main elements:
  • the genetic constructs were used to transform excised cotyledons and hypocotyls of safflower variety S317 using the Agwbacterium-mediated method with rescue of regenerated shoots using grafting (Belide et al., 2011). Over 30 independent transformed shoots growing on non-transformed root- stocks (hereinafter termed To plants) were regenerated for the vector pCW603 and grown to maturity as described in Example 1. Integration of the T-DNAs in the To safflower scions was checked by PCR using T-DNA vector- specific primers as described by Belide et al. (2011).
  • Fatty acid analyses were conducted on individual ⁇ seeds obtained from the transformed safflower plants, as follows. 30 independent To plants transformed with pCW603 in the S317 genetic background were grown in the greenhouse and self- fertilised to produce seed. As many as 10 mature seed from a single seedhead from each To plant were analysed for the lipid composition using GC analysis as described in Example 1. Results of the fatty acid composition analysis from seeds of safflower S317 transformed with pCW603 are summarised in Table 13. As each transformed To safflower plant was expected to be heterozygous for the T-DNA and therefore produce a segregating population of ⁇ seeds, it was expected that the analysis of 5-10 seeds from each plant would include some null (segregant) seeds.
  • null segregant seeds were good negative controls in this experiment as they had grown and developed within the same seedhead as the transformed seeds from the same plant.
  • levels of oleic acid above 87% were observed in 6 independent lines (Lines 9, 12, 14, 20, 34 and 36) of the 30 lines generated.
  • Many of the transformed seeds had oleic acid contents in the range 87-91.7%, with linoleic acid levels of 2.15 to 5.9% and palmitic acid levels of 2.32-3.45%.
  • the levels of other fatty acids in the seeds were not significantly different to the untransformed controls.
  • the maximum oleic acid content observed in the ⁇ safflower seed transformed with pCW603 was 91.7%, compared to approximately 77% in the non-transformed S317 control seeds and the null segregant seeds.
  • the seed lipids were also significantly reduced in the levels of 16:0, decreasing from 4.5% down to as low as 2.3%.
  • the fatty acid profiles of the TAG fractions of the seedoils as purified on TLC plates were not significantly different to that of the total lipid extracted from the seeds.
  • ODP oleic acid desaturation proportion
  • PLO palmitic+linoleic to oleic proportion
  • the second most abundant oleate-containing TAG was 18:0/18: 1/18: 1, followed by 18: 1/18: 1/18:2.
  • the clearest difference between these safflower oils could also be seen in the DAG lipid class.
  • the DAG(36: 1) level was doubled in the seedoil from the transformed seed compared to the parent seed, while DAG(36:4) was reduced by up to 10%.
  • DAG(36.1) is predominantly 18:0/18: 1-DAG and DAG(36:4) is 18:2/18:2-DAG (di-linoleate).
  • the DAGs in the seed lipids were only a minor component, as the levels of total TAGs were about 100 times higher than total DAGs (Table 15).
  • the To safflower transformants containing the T-DNA from pCW603 generated Ti seed that segregated for the T-DNA yielding a set of homozygotes, hemizygotes and null segregants.
  • the ratio of these sub-populations depended on the number and linkage of T-DNA insertion events in the To plants, as was expected according to Mendelian genetics. Therefore ⁇ seeds from each To plant were analysed individually. Analysis of the lipid profiles from individual seeds clearly showed that a single seed heads contained both null and transgenic events.
  • Table 13 Lipid fatty acid composition of individual safflower Tl seeds transformed with the T-DNA of pCW603 in the S-317 background. The level of each fatty acid (%) was expressed as a percentage of the total fatty acid content.
  • TS603.12(5) denotes the plant transformed with vector pCW603, event 12, seed 5.
  • Sampl labelled as 'null' are determined via PCR analysis as non-transformed escapes in the plant transformation.
  • Seeds from the some of the transgenic lines were grown under controlled conditions (temperature, soil, optimal watering and fertilising, but under natural lighting) in the greenhouse to observe the plant morphology and growth rate. No phenotypic differences were observed between the transformed Ti plants and their null segregant siblings. Transformed seeds germinated at the same rate as the untransformed seeds and yielded seedlings having the same early seedling growth rate (vigour). All of the sown seeds became established and grew into fully fertile plants. DNA was prepared from tips of true leaves from individual plants of the Ti generation and PCR analysis was conducted to determine the ratio of null and transgenic plants. As expected, null segregants were identified.
  • the safflower seeds of the T2 generation were tested for oil composition. Seed from several plants having high levels of oleic acid (Table 13) were grown into mature plants producing second generation seed (T2 seed). These seed were harvested when mature and analysed for the fatty acid composition of their oil. The data are given in Table 16. Although the Tl seed displayed up to about 92% oleic acid, the T2 seed reached 94.6% oleic acid. The observed increase in the T2 generation relative to the Tl generation may have been due to homozygosity of the transgene, or simply to the large number of lines analysed.
  • Southern blot hybridisation analysis is used to determine the number of T-DNA insertions in each transformed line, and lines with a single T-DNA insertion are selected.
  • the oil content of T2 seeds is not significantly different to that in the control, untransformed seeds of the same genetic background and grown under the same conditions.
  • the Tl seed of safflower variety S-317 transformed with pCW631 were similarly analysed for their fatty acid composition.
  • Table 17 shows the data and the ODP and PLO metrics for these seeds.
  • the oleic acid content in lipid of these seeds was up to 94.19%.
  • the palmitic acid content of seed TS631-01 Tl (21) having the highest level of oleic acid was 2.43%, the ODP was 0.0203 and the PLO was 0.0423.
  • These analyses demonstrated that the hairpin RNA construct in pCW631 generally produced higher oleic acid levels that the construct in pCW603 when transformed into safflower of the S-317 genetic background. This observation indicated that the linin promoter used in pCW631 expressed the hairpin RNA more strongly or with a better timing of expression, or a combination of both, relative to the AtOleosin promoter used in pCW603.
  • T2 seeds of safflower variety S-317 transformed with the T-DNA from pCW631 were analysed by GC. Levels of oleic acid up to 94.95% were observed with an ODP of 0.01 and PLO of 0.035.
  • Safflower seeds and plants transformed with the T-DNAs from the constructs pCW632 and pCW602 are analysed in the same manner as for the seed and plants transformed with pCW603 and pCW631.
  • GC analysis of the Tl seed of safflower variety S-317 transformed with pCW632 showed oleic acid level of up to 94.88%, with ODP as 0.0102 and PLO as 0.0362.
  • Their T2 seeds showed up to 93.14% oleic acid, with ODP as 0.0164 and PLO as 0.0452. Extraction of larger volumes of safflower seed oil
  • T4 seeds from the homozygous transgenic line designated TS603-22.6 were harvested and total seedoil extracted using the Soxhlet apparatus as described in Example 1. Aliquots of extracted oil were analysed by GC (Table 18). A total of 643 grams oil was recovered. Extractions 2, 3, 5, and 6 were pooled, while extractions 4, 7 and 8 were pooled in a separate lot. The mixtures were further analysed for fatty acid composition by GC. The data are shown in Table 18.
  • gene silencing constructs were prepared as follows to increase the oleic acid content of safflower seed oil and decrease the ODP or PLO ratios.
  • These gene silencing constructs included combining different promoters, from non-safflower sources as well as safflower sources, to achieve maximal reduction in the safflower FAD2-2, FATB-3 and FAD6 gene expression, and further silencing more than one FAD2 gene in addition to FAD2- 2.
  • These constructs are used to transform varieties of safflower which have inactivated versions of the endogenous CtFAD2- 1 gene, such as S-317, Ciano-OL and Lesaff496.
  • This plant binary expression vector has two foreign (non-safflower) promoters with different but overlapping expression patterns in safflower seed, rather than one promoter, to produce hairpin RNA to reduce expression of the endogenous CtFATB and CtFAD2-2.
  • the two promoters are the AtOleosin promoter and the flax linin promoter and the two hpRNA expression cassettes are in the same T-DNA molecule.
  • This vector is constructed by restriction digestion of the hpRNA gene expression cassette from pCW631, having the linin promoter and hpRNA encoding region for silencing of OFAD2-2 and CtFATB, and inserted it into the T-DNA of pCW603, thus generating a construct encoding a hairpin RNA against these two safflower genes.
  • This construct is used to transform safflower varieties such as Lesaff496, Ciano-OL and S-317.
  • Table 16 Fatty acid composition of lipid from individual safflower T2 seeds transformed with the T-DNA of pCW603 background. The level of each fatty acid (%) was expressed as a percentage of the total fatty acid content.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Pregnancy & Childbirth (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physiology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Reproductive Health (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Fats And Perfumes (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/AU2013/000426 2012-04-25 2013-04-24 High oleic acid oils Ceased WO2013159149A1 (en)

Priority Applications (17)

Application Number Priority Date Filing Date Title
MX2014012941A MX379844B (es) 2012-04-25 2013-04-24 Aceites altos en acido oleico.
CA2871503A CA2871503C (en) 2012-04-25 2013-04-24 High oleic acid oils
UAA201412633A UA116538C2 (uk) 2012-04-25 2013-04-24 Насінина сафлору з високим вмістом олеїнової кислоти
AU2013252489A AU2013252489B2 (en) 2012-04-25 2013-04-24 High oleic acid oils
ES13782495T ES2843486T3 (es) 2012-04-25 2013-04-24 Aceites con alto contenido en ácido oleico
KR1020147033143A KR102208924B1 (ko) 2012-04-25 2013-04-24 고 올레산 오일
HK15108575.9A HK1207938A1 (en) 2012-04-25 2013-04-24 High oleic acid oils
JP2015507304A JP6458218B2 (ja) 2012-04-25 2013-04-24 高オレイン酸油
SG11201406843WA SG11201406843WA (en) 2012-04-25 2013-04-24 High oleic acid oils
EA201491956A EA035715B1 (ru) 2012-04-25 2013-04-24 Масла с высоким содержанием олеиновой кислоты
IN2355MUN2014 IN2014MN02355A (https=) 2012-04-25 2013-04-24
EP13782495.9A EP2840886B1 (en) 2012-04-25 2013-04-24 High oleic acid oils
BR112014026900A BR112014026900A2 (pt) 2012-04-25 2013-04-24 óleos com alto teor de ácido oleico
NZ631696A NZ631696A (en) 2012-04-25 2013-04-24 High oleic acid oils
CN201380033472.0A CN104619164B (zh) 2012-04-25 2013-04-24 高油酸油
PH12014502381A PH12014502381B1 (en) 2012-04-25 2014-10-24 High oleic acid oils
ZA2014/08233A ZA201408233B (en) 2012-04-25 2014-11-11 High oleic acid oils

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261638447P 2012-04-25 2012-04-25
US61/638,447 2012-04-25
AU2012903992A AU2012903992A0 (en) 2012-09-11 High oleic acid oils
AU2012903992 2012-09-11

Publications (1)

Publication Number Publication Date
WO2013159149A1 true WO2013159149A1 (en) 2013-10-31

Family

ID=49477642

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2013/000426 Ceased WO2013159149A1 (en) 2012-04-25 2013-04-24 High oleic acid oils

Country Status (18)

Country Link
US (2) US10323209B2 (https=)
EP (1) EP2840886B1 (https=)
JP (1) JP6458218B2 (https=)
KR (1) KR102208924B1 (https=)
CN (1) CN104619164B (https=)
AU (1) AU2013252489B2 (https=)
BR (1) BR112014026900A2 (https=)
CA (1) CA2871503C (https=)
EA (1) EA035715B1 (https=)
HK (1) HK1207938A1 (https=)
IN (1) IN2014MN02355A (https=)
MX (2) MX379844B (https=)
NZ (1) NZ631696A (https=)
PH (1) PH12014502381B1 (https=)
SG (1) SG11201406843WA (https=)
UA (1) UA116538C2 (https=)
WO (1) WO2013159149A1 (https=)
ZA (1) ZA201408233B (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017083920A1 (en) 2015-11-18 2017-05-26 Commonwealth Scientific And Industrial Research Organisation Rice grain with thickened aleurone
WO2022251893A1 (en) * 2021-05-31 2022-12-08 Commonwealth Scientific And Industrial Research Organisation Elite safflower event
US12133539B2 (en) 2019-03-19 2024-11-05 Conopco, Inc. Frozen confection

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101516181B (zh) 2006-07-14 2015-09-30 联邦科学技术研究组织 改变水稻的脂肪酸组成
WO2009129582A1 (en) * 2008-04-25 2009-10-29 Commonwealth Scientific Industrial Research Organisation Polypeptides and methods for producing triacylglycerols comprising modified fatty acids
EP2315519B1 (en) 2008-07-21 2016-08-17 Commonwealth Scientific and Industrial Research Organisation Improved cottonseed oil and uses
HK1207938A1 (en) 2012-04-25 2016-02-19 Commonwealth Scientific And Industrial Research Organisation High oleic acid oils
WO2015087058A1 (en) 2013-12-10 2015-06-18 The University Of York Desaturase nucleic acids and polypeptides
MY178434A (en) 2014-07-07 2020-10-13 Commw Scient Ind Res Org Processes for producing industrial products from plant lipids
CN105532924A (zh) * 2015-12-09 2016-05-04 四川飚毅中药材科技有限公司 一种白芍子油
EP3507370A4 (en) 2016-09-02 2020-06-24 Commonwealth Scientific and Industrial Research Organisation PLANTS WITH CHANGED PROPERTIES
US10844224B2 (en) * 2017-07-17 2020-11-24 The United States Of America, As Represented By The Secretary Of Agriculture Bio-based composites, composite materials, and adhesives
US11913006B2 (en) 2018-03-16 2024-02-27 Nuseed Global Innovation Ltd. Plants producing modified levels of medium chain fatty acids
US12245594B2 (en) 2018-12-03 2025-03-11 Newleaf Symbiotics, Inc. Methods for obtaining and using plants and plant parts with increased nutrient, oil, and/or protein content
EP3893649A4 (en) 2018-12-03 2022-10-26 Newleaf Symbiotics, Inc. METHYLOBACTERIUM COMPOSITIONS TO IMPROVE CORN YIELD
PH12021551288A1 (en) * 2018-12-03 2022-03-28 Newleaf Symbiotics Inc Methods for obtaining and using plants and plant parts with increased nutrient, oil, and/or protein content
CN110106019A (zh) * 2019-05-20 2019-08-09 无限极(中国)有限公司 一种利用裂壶藻生产复合型多不饱和脂肪酸油脂的方法
CN116121092B (zh) * 2022-11-01 2024-07-02 四川大学 多重胁迫抗性增强的重组酿酒酵母菌及其构建方法与应用

Citations (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1984002913A1 (en) 1983-01-17 1984-08-02 Monsanto Co Chimeric genes suitable for expression in plant cells
US5004863A (en) 1986-12-03 1991-04-02 Agracetus Genetic engineering of cotton plants and lines
EP0465572A1 (en) 1989-03-30 1992-01-15 Dna Plant Techn Corp Genetic engineering of novel plant phenotypes.
EP0496504A1 (en) * 1991-01-09 1992-07-29 Pioneer Hi-Bred International, Inc. Sunflower products having lower levels of saturated fatty acids
AU6178194A (en) 1993-03-11 1994-09-26 National Research Council Of Canada Enhanced regeneration system for cereals
CA2092588A1 (en) 1993-03-26 1994-09-27 Narender S. Nehra Enhanced regeneration system for cereals
US5416011A (en) 1988-07-22 1995-05-16 Monsanto Company Method for soybean transformation and regeneration
US5463174A (en) 1986-05-29 1995-10-31 Calgene Inc. Transformation and foreign gene expression in Brassica species
AU667939B2 (en) 1992-07-07 1996-04-18 Japan Tobacco Inc. Method of transforming monocotyledon
US5518908A (en) 1991-09-23 1996-05-21 Monsanto Company Method of controlling insects
WO1997020936A1 (en) 1995-12-06 1997-06-12 Zeneca Limited Modification of starch synthesis in plants
US5912416A (en) * 1997-08-05 1999-06-15 California Oils Corporation Safflower products with very high levels of unsaturated fatty acids
WO1999032619A1 (en) 1997-12-23 1999-07-01 The Carnegie Institution Of Washington Genetic inhibition by double-stranded rna
WO1999049029A1 (en) 1998-03-20 1999-09-30 Benitec Australia Ltd Control of gene expression
WO1999053050A1 (en) 1998-04-08 1999-10-21 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
US6100447A (en) 1998-02-12 2000-08-08 Applied Phytologics, Inc. Method of barley transformation
WO2001034815A1 (en) 1999-11-05 2001-05-17 Cambria Biosciences, Llc Dsrna as insect control agent
US6541257B2 (en) 1997-04-29 2003-04-01 The Regents Of The University Of California Method for preparing barley green regenerative tissue
CA2180386C (en) * 1996-07-03 2006-09-12 Lorin R. Debonte Canola oil having increased oleic acid and decreased linolenic acid content
US20060206963A1 (en) * 2002-03-21 2006-09-14 Toni Voelker Nucleic acid constructs and methods for producing altered seed oil compositions
WO2009086196A1 (en) * 2007-12-20 2009-07-09 Dow Agrosciences Llc Low saturated-fat sunflower and associated methods
US9710621B1 (en) 2011-11-02 2017-07-18 Google Inc. Platform for cloud application software

Family Cites Families (81)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4918811A (en) 1986-09-26 1990-04-24 General Electric Company Multichip integrated circuit packaging method
US4948811A (en) 1988-01-26 1990-08-14 The Procter & Gamble Company Salad/cooking oil balanced for health benefits
US6483008B1 (en) 1990-08-15 2002-11-19 Calgene Llc Methods for producing plants with elevated oleic acid content
CA2123495A1 (en) 1991-11-15 1993-05-27 Anthony J. Kinney B-ketoacyl-acp synthetase ii genes from plants
US7109392B1 (en) 1996-10-09 2006-09-19 Cargill, Incorporated Methods for increasing oleic acid content in seeds from transgenic plants containing a mutant delta 12 desaturase
US6432684B1 (en) 1997-04-11 2002-08-13 Abbott Laboratories Human desaturase gene and uses thereof
US7589253B2 (en) 1997-04-15 2009-09-15 Commonwealth Scientific And Industrial Research Organisation Fatty acid epoxygenase genes from plants and uses therefor in modifying fatty acid metabolism
CN1266460A (zh) 1997-06-05 2000-09-13 卡尔金有限责任公司 二酰甘油酰基转移酶蛋白
CA2783215C (en) 1998-03-20 2015-11-17 E.I. Du Pont De Nemours And Company Limnanthes oil genes
US6344548B1 (en) 1998-06-24 2002-02-05 The Regents Of The University Of California Diacylglycerol o-acyltransferase
WO1999067268A1 (en) 1998-06-24 1999-12-29 The Regents Of The University Of California Diacylglycerol o-acyltransferase
JP4514952B2 (ja) 1998-07-02 2010-07-28 カルジーン エルエルシー ジアシルグリセロールアシルトランスフェラーゼタンパク質
US7135617B2 (en) 1998-07-02 2006-11-14 Calgene Llc Diacylglycerol acyl transferase proteins
JP2002523048A (ja) 1998-08-20 2002-07-30 イー・アイ・デュポン・ドウ・ヌムール・アンド・カンパニー 共役二重結合の形成に関係する植物脂肪酸改質酵素の遺伝子
US6100077A (en) 1998-10-01 2000-08-08 The Trustees Of Columbia University In The City Of New York Isolation of a gene encoding diacylglycerol acyltransferase
CA2703147C (en) 1998-12-02 2014-07-29 Karlene H. Butler Plant diacylglycerol acyltransferases
WO2000032793A2 (en) 1998-12-04 2000-06-08 Calgene Llc Plant cell derived diacylglycerol acyltransferases
ATE340861T1 (de) 1998-12-17 2006-10-15 Ca Nat Research Council Diacylglyzerin-acyltransferase gen aus pflanzen
SK13872001A3 (sk) 1999-04-01 2002-06-04 Basf Plant Science Gmbh Trieda enzýmov v biosyntetickej dráhe na produkciu triacylglycerolu a rekombinantné molekuly DNA kódujúce tieto enzýmy
AUPQ005299A0 (en) 1999-04-29 1999-05-27 Commonwealth Scientific And Industrial Research Organisation Novel genes encoding wheat starch synthases and uses therefor
CA2372632C (en) 1999-05-04 2011-02-15 Basil S. Shorrosh Plant acyltransferases
AUPQ574200A0 (en) 2000-02-21 2000-03-16 Commonwealth Scientific And Industrial Research Organisation Starch branching enzyme
US6974898B2 (en) 2000-04-18 2005-12-13 Commonwealth Scientific And Industrial Research Organisation Method of modifying the content of cottonseed oil
EP2342970A3 (en) 2000-11-09 2011-07-27 Commonwealth Scientific and Industrial Research Organisation Barley with reduced SSII activity and starch and starch containing products with a reduced amylopectin content
AUPR324101A0 (en) 2001-02-21 2001-03-15 Commonwealth Scientific And Industrial Research Organisation Novel gene and uses therefor to modify pasture qualities of crops
US20030161831A1 (en) 2001-02-23 2003-08-28 Sylvaine Cases Mono-and diacylglycerol acyltransferases and methods of use thereof
US7045326B2 (en) 2001-02-23 2006-05-16 The Regents Of The University Of California Mono- and diacylglycerol acyltransferases and methods of use thereof
EP1487985B1 (en) 2002-03-16 2011-01-12 The University Of York Transgenic plants expressing enzymes involved in fatty acid biosynthesis
AUPS219802A0 (en) 2002-05-09 2002-06-06 Commonwealth Scientific And Industrial Research Organisation Barley with altered branching enzyme activity and starch and starch containing products with a reduced amylopectin content
BR0312162A (pt) 2002-06-21 2007-05-29 Monsanto Technology Llc seqüências de ácido nucléico relacionadas com a tioesterase e processos de uso para a produção de plantas com composição modificada de ácidos graxos
WO2004011671A2 (en) 2002-07-31 2004-02-05 Monsanto Technology, Llc Diacylglycerol acyltransferase nucleic acid sequences and associated products
CN1705748A (zh) 2002-08-12 2005-12-07 孟山都技术有限公司 用于增加植物中总的油类水平的方法
US7812221B2 (en) 2003-06-30 2010-10-12 Commonwealth Scientific And Industrial Research Organization Wheat with altered branching enzyme activity and starch and starch containing products derived therefrom
US7267976B2 (en) 2003-07-02 2007-09-11 E.I. Du Pont De Nemours And Company Acyltransferases for alteration of polyunsaturated fatty acids and oil content in oleaginous yeasts
AU2004284112B2 (en) 2003-10-27 2010-07-08 Commonwealth Scientific And Industrial Research Organisation Rice and products thereof having starch with an increased proportion of amylose
WO2005063988A1 (en) 2003-12-23 2005-07-14 Pioneer Hi-Bred International, Inc. Alteration of oil traits in plants
CA2497087A1 (en) 2004-03-09 2005-09-09 Commonwealth Scientific And Industrial Research Organisation Novel genes encoding proteins involved in proanthocyanidin synthesis
US8049069B2 (en) 2004-03-31 2011-11-01 Commonwealth Scientific And Industrial Research Organisation Genes involved in plant fibre development
EP2357244A3 (en) 2004-04-22 2011-11-23 Commonwealth Scientific and Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells.
CN103451246B (zh) 2004-04-22 2018-02-16 联邦科学技术研究组织 用重组细胞合成长链多不饱和脂肪酸
US8685679B2 (en) 2004-11-04 2014-04-01 E I Du Pont De Nemours And Company Acyltransferase regulation to increase the percent of polyunsaturated fatty acids in total lipids and oils of oleaginous organisms
US7700139B2 (en) 2004-12-30 2010-04-20 Commonwealth Scientific And Industrial Research Organization Method and means for improving bowel health
US7993686B2 (en) 2004-12-30 2011-08-09 Commonwealth Scientific And Industrial Organisation Method and means for improving bowel health
NZ563676A (en) * 2005-05-23 2011-01-28 Arcadia Biosciences Inc Safflower with elevated gamma-linolenic acid
US7932440B2 (en) 2005-09-08 2011-04-26 Commonwealth Scientific And Industrial Research Organisation Cotton variety
AU2006303820B2 (en) 2005-10-20 2013-06-20 Commonwealth Scientific And Industrial Research Organisation Cereals with altered dormancy
EP1806398A1 (en) 2006-01-04 2007-07-11 Monsanto S.A.S. Fad-2 mutants and high oleic plants
JP5242418B2 (ja) * 2006-02-13 2013-07-24 モンサント テクノロジー エルエルシー 核酸構築体および変化した種子油組成の生成方法
GB2436068A (en) 2006-03-18 2007-09-19 Ernest Mark Talbot Surgical contact lens
EP1837397A1 (en) 2006-03-21 2007-09-26 Monsanto S.A.S. FAD-2 mutants and high oleic plants
CN101516181B (zh) 2006-07-14 2015-09-30 联邦科学技术研究组织 改变水稻的脂肪酸组成
RU2009111266A (ru) 2006-08-29 2010-10-10 Коммонвелт Сайентифик энд Индастриал Рисерч Организейшн (AU) Синтез жирных кислот
EP1944375A1 (en) 2007-01-11 2008-07-16 Monsanto S.A.S. FAD2 mutants and high oleic acid plants
CA2592533A1 (en) 2007-01-11 2008-07-11 Commonwealth Scientific And Industrial Research Organisation Novel gene encoding myb transcription factor involved in proanthocyanidin synthesis
NZ554114A (en) 2007-04-23 2010-01-29 Agres Ltd Plants with an increased ratio of oleosin to TAG synthesising enzymes
CN101939434B (zh) 2007-05-24 2015-03-25 纳幕尔杜邦公司 用于在大豆中提高种子贮藏油脂的生成和改变脂肪酸谱的来自解脂耶氏酵母的dgat基因
WO2008157226A2 (en) 2007-06-15 2008-12-24 Hilary Koprowski Engineered plant biomass with increased oil production
WO2008157827A2 (en) 2007-06-21 2008-12-24 Michigan State University Modified composition of plant extracellular lipids using acyltransferases and fatty acid omega-oxidases
WO2009020031A1 (en) 2007-08-06 2009-02-12 Canon Kabushiki Kaisha Image sensing apparatus
WO2009027335A2 (en) 2007-08-28 2009-03-05 Basf Plant Science Gmbh Polypeptides, such as lipases, capable of altering the seed storage content in transgenic plants
AU2008329557B2 (en) 2007-11-27 2014-08-14 Commonwealth Scientific And Industrial Research Organisation Plants with modified starch metabolism
CN101951755A (zh) 2007-12-21 2011-01-19 加拿大国家研究委员会 来自藻类的二酰基甘油酰基转移酶2基因及其编码的蛋白质
US8115067B1 (en) 2008-03-27 2012-02-14 Syngenta Participations Ag Soybean cultivar 05KG030123
US7993666B2 (en) 2008-04-18 2011-08-09 Warsaw Orthopedic, Inc. Methods and compositions for treating pain comprising a statin
AU2009240795B2 (en) 2008-04-25 2014-03-20 Commonwealth Scientific And Industrial Research Organisation Recombinant cells and methods for hydroxylating fatty acids
WO2009129582A1 (en) 2008-04-25 2009-10-29 Commonwealth Scientific Industrial Research Organisation Polypeptides and methods for producing triacylglycerols comprising modified fatty acids
WO2009143397A2 (en) 2008-05-23 2009-11-26 E. I. Du Pont De Nemours And Company Novel dgat genes for increased seed storage lipid production and altered fatty acid profiles in oilseed plants
CA2653883C (en) 2008-07-17 2022-04-05 Colin Leslie Dow Jenkins High fructan cereal plants
EP2315519B1 (en) 2008-07-21 2016-08-17 Commonwealth Scientific and Industrial Research Organisation Improved cottonseed oil and uses
CA2768737A1 (en) 2008-07-21 2010-01-28 Commonwealth Scientific And Industrial Research Organisation Improved vegetable oils and uses therefor
BRPI0921467B1 (pt) 2008-11-18 2021-12-14 Commonwealth Scientific And Industrial Research Organisation Processo para a produção de óleo compreendendo ácido eicosapentaenóico (epa), ácido docosapentaenóico (dpa) e ácido docosahexaenóico (dha)
US8507754B2 (en) 2009-01-31 2013-08-13 University Of North Texas Engineering lipids in vegetative tissues of plants
BR112012002114A2 (pt) 2009-07-30 2015-09-15 Australian Capital Ventures Ltd cevadas e seu usos.
WO2011062748A1 (en) 2009-11-23 2011-05-26 E.I. Du Pont De Nemours And Company Sucrose transporter genes for increasing plant seed lipids
AU2011274301B2 (en) 2010-06-28 2015-06-11 Nuseed Global Innovation Ltd Methods of producing lipids
AR083767A1 (es) 2010-11-04 2013-03-20 Arista Cereal Technologies Pty Ltd Trigo con alto contenido de amilosa
ES3000665T3 (en) 2011-11-04 2025-03-03 Arista Cereal Tech Pty Ltd High amylose wheat - ii
AU2012327162A1 (en) 2011-12-27 2013-07-11 Commonwealth Scientific And Industrial Research Organisation Production of dihydrosterculic acid and derivatives thereof
US8809026B2 (en) 2011-12-27 2014-08-19 Commonwealth Scientific And Industrial Research Organisation Processes for producing lipids
UA119739C2 (uk) 2011-12-27 2019-08-12 Коммонвелт Сайнтіфік Енд Індастріел Рісерч Організейшн Метод отримання ліпідів
HK1207938A1 (en) 2012-04-25 2016-02-19 Commonwealth Scientific And Industrial Research Organisation High oleic acid oils

Patent Citations (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1984002913A1 (en) 1983-01-17 1984-08-02 Monsanto Co Chimeric genes suitable for expression in plant cells
US5463174A (en) 1986-05-29 1995-10-31 Calgene Inc. Transformation and foreign gene expression in Brassica species
US5004863A (en) 1986-12-03 1991-04-02 Agracetus Genetic engineering of cotton plants and lines
US5004863B2 (en) 1986-12-03 2000-10-17 Agracetus Genetic engineering of cotton plants and lines
US5159135A (en) 1986-12-03 1992-10-27 Agracetus Genetic engineering of cotton plants and lines
US5004863B1 (https=) 1986-12-03 1992-12-08 Agracetus
US5159135B1 (en) 1986-12-03 2000-10-24 Agracetus Genetic engineering of cotton plants and lines
US5569834A (en) 1988-07-22 1996-10-29 Monsanto Company Method for soybean transformation and regeneration
US5416011A (en) 1988-07-22 1995-05-16 Monsanto Company Method for soybean transformation and regeneration
EP0465572A1 (en) 1989-03-30 1992-01-15 Dna Plant Techn Corp Genetic engineering of novel plant phenotypes.
EP0496504A1 (en) * 1991-01-09 1992-07-29 Pioneer Hi-Bred International, Inc. Sunflower products having lower levels of saturated fatty acids
US5518908A (en) 1991-09-23 1996-05-21 Monsanto Company Method of controlling insects
AU667939B2 (en) 1992-07-07 1996-04-18 Japan Tobacco Inc. Method of transforming monocotyledon
US5589617A (en) 1993-03-11 1996-12-31 National Research Council Of Canada Enhanced regeneration system
AU6178194A (en) 1993-03-11 1994-09-26 National Research Council Of Canada Enhanced regeneration system for cereals
CA2092588A1 (en) 1993-03-26 1994-09-27 Narender S. Nehra Enhanced regeneration system for cereals
WO1997020936A1 (en) 1995-12-06 1997-06-12 Zeneca Limited Modification of starch synthesis in plants
CA2180386C (en) * 1996-07-03 2006-09-12 Lorin R. Debonte Canola oil having increased oleic acid and decreased linolenic acid content
US6541257B2 (en) 1997-04-29 2003-04-01 The Regents Of The University Of California Method for preparing barley green regenerative tissue
US5912416A (en) * 1997-08-05 1999-06-15 California Oils Corporation Safflower products with very high levels of unsaturated fatty acids
WO1999032619A1 (en) 1997-12-23 1999-07-01 The Carnegie Institution Of Washington Genetic inhibition by double-stranded rna
US6100447A (en) 1998-02-12 2000-08-08 Applied Phytologics, Inc. Method of barley transformation
WO1999049029A1 (en) 1998-03-20 1999-09-30 Benitec Australia Ltd Control of gene expression
WO1999053050A1 (en) 1998-04-08 1999-10-21 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
WO2001034815A1 (en) 1999-11-05 2001-05-17 Cambria Biosciences, Llc Dsrna as insect control agent
US20060206963A1 (en) * 2002-03-21 2006-09-14 Toni Voelker Nucleic acid constructs and methods for producing altered seed oil compositions
WO2009086196A1 (en) * 2007-12-20 2009-07-09 Dow Agrosciences Llc Low saturated-fat sunflower and associated methods
US9710621B1 (en) 2011-11-02 2017-07-18 Google Inc. Platform for cloud application software

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
"BIOS", 2000, SCIENTIFIC PUBLISHERS LTD
"DNA Cloning: A Practical Approach", vol. 1-4, 1995, IRL PRESS
"Essential Molecular Biology: A Practical Approach", vol. 1, 2, 1991, IRL PRESS
BUHR, T. ET AL.: "Ribozyme termination ofRNA transcripts down-regulate seed fatty acid genes in transgenic soybean", THE PLANT JOURNAL, vol. 30, no. 2, 2002, pages 155 - 163, XP002978971 *
CHRISTOUKLEE: "Handbook of Plant Biotechnology", 2004, JOHN WILEY AND SONS
FEREIDOON SHAHIDI: "Current Protocols in Food Analytical Chemistry", 2001, JOHN WILEY & SONS, INC.
GELVIN ET AL.: "Plant Molecular Biology Manual", 1990, KLUWER ACADEMIC PUBLISHERS
J. PERBAL: "A Practical Guide to Molecular Cloning", 1984, JOHN WILEY AND SONS
POUWELS ET AL.: "Cloning Vectors: A Laboratory Manual", vol. 1987, 1985, JOHN WILEY & SONS
SLATER ET AL.: "Plant Biotechnology - The Genetic Manipulation of Plants", 2003, OXFORD UNIVERSITY PRESS
WEISSBACH ET AL.: "Current Protocols in Molecular Biology", 1988, GREENE PUB. ASSOCIATES AND WILEY-INTERSCIENCE
WEISSBACHWEISSBACH: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOUR LABORATORY PRESS
WOOD, C.: "Deveolpment of super high oleic oil in safflower", 20TH INTERNATIONAL SYMPOSIUM ON PLANT LIPIDS, July 2012 (2012-07-01), XP055174916, Retrieved from the Internet <URL:http://www.isp12012.org/oralpdfs/S11%2006%20Craig%20Wood%20SH0%20safflower.pdf> [retrieved on 20130719] *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017083920A1 (en) 2015-11-18 2017-05-26 Commonwealth Scientific And Industrial Research Organisation Rice grain with thickened aleurone
US12133539B2 (en) 2019-03-19 2024-11-05 Conopco, Inc. Frozen confection
WO2022251893A1 (en) * 2021-05-31 2022-12-08 Commonwealth Scientific And Industrial Research Organisation Elite safflower event

Also Published As

Publication number Publication date
KR20150023296A (ko) 2015-03-05
PH12014502381A1 (en) 2015-01-26
BR112014026900A2 (pt) 2017-07-11
KR102208924B1 (ko) 2021-01-29
CA2871503C (en) 2023-08-29
EA201491956A1 (ru) 2015-04-30
EP2840886A4 (en) 2015-12-23
US11124737B2 (en) 2021-09-21
CN104619164A (zh) 2015-05-13
CN104619164B (zh) 2018-11-16
EP2840886B1 (en) 2020-08-12
UA116538C2 (uk) 2018-04-10
US10323209B2 (en) 2019-06-18
NZ631696A (en) 2017-02-24
MX379844B (es) 2025-03-11
PH12014502381B1 (en) 2015-01-26
US20190330558A1 (en) 2019-10-31
JP6458218B2 (ja) 2019-01-30
MX2020003964A (es) 2020-08-03
ZA201408233B (en) 2016-03-30
AU2013252489B2 (en) 2018-04-26
JP2015520257A (ja) 2015-07-16
EA035715B1 (ru) 2020-07-29
IN2014MN02355A (https=) 2015-08-14
US20130288318A1 (en) 2013-10-31
CA2871503A1 (en) 2013-10-31
SG11201406843WA (en) 2014-11-27
MX2014012941A (es) 2015-06-03
HK1207938A1 (en) 2016-02-19
AU2013252489A1 (en) 2014-11-13
EP2840886A1 (en) 2015-03-04

Similar Documents

Publication Publication Date Title
US11124737B2 (en) High oleic acid oils
US12486470B2 (en) Processes for producing industrial products from plant lipids
JP6855249B2 (ja) ドコサペンタエン酸を含む脂質
US8530724B2 (en) Altering the fatty acid composition of rice
ES2843486T3 (es) Aceites con alto contenido en ácido oleico

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13782495

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2871503

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2014/012941

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2015507304

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2013782495

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2013782495

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013252489

Country of ref document: AU

Date of ref document: 20130424

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 201491956

Country of ref document: EA

Ref document number: IDP00201407342

Country of ref document: ID

Ref document number: A201412633

Country of ref document: UA

ENP Entry into the national phase

Ref document number: 20147033143

Country of ref document: KR

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014026900

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112014026900

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20141027