WO2012006633A1 - Chimeric clotting factors - Google Patents

Chimeric clotting factors Download PDF

Info

Publication number
WO2012006633A1
WO2012006633A1 PCT/US2011/043597 US2011043597W WO2012006633A1 WO 2012006633 A1 WO2012006633 A1 WO 2012006633A1 US 2011043597 W US2011043597 W US 2011043597W WO 2012006633 A1 WO2012006633 A1 WO 2012006633A1
Authority
WO
WIPO (PCT)
Prior art keywords
clotting factor
factor
chimeric
moiety
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/043597
Other languages
English (en)
French (fr)
Inventor
Joe Salas
Robert Peters
Alan Bitonti
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bioverativ Therapeutics Inc
Original Assignee
Biogen Idec Hemophilia Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA2804280A priority Critical patent/CA2804280A1/en
Priority to MX2013000301A priority patent/MX2013000301A/es
Priority to EA201291482A priority patent/EA201291482A1/ru
Priority to DK11738538.5T priority patent/DK2591099T3/da
Priority to NZ605400A priority patent/NZ605400A/en
Priority to SG2012096608A priority patent/SG186875A1/en
Priority to JP2013518877A priority patent/JP2013534427A/ja
Priority to KR1020137003461A priority patent/KR20140002601A/ko
Priority to AU2011274423A priority patent/AU2011274423B2/en
Application filed by Biogen Idec Hemophilia Inc filed Critical Biogen Idec Hemophilia Inc
Priority to US13/809,289 priority patent/US20130216513A1/en
Priority to CN2011800424499A priority patent/CN103180439A/zh
Priority to BR112013000652A priority patent/BR112013000652A2/pt
Priority to EP11738538.5A priority patent/EP2591099B1/en
Publication of WO2012006633A1 publication Critical patent/WO2012006633A1/en
Anticipated expiration legal-status Critical
Priority to US15/221,420 priority patent/US10968442B2/en
Priority to US17/222,636 priority patent/US20210355473A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/644Coagulation factor IXa (3.4.21.22)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/36Blood coagulation or fibrinolysis factors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/745Blood coagulation or fibrinolysis factors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/745Blood coagulation or fibrinolysis factors
    • C07K14/755Factors VIII, e.g. factor VIII C (AHF), factor VIII Ag (VWF)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2839Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily
    • C07K16/2848Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily against integrin beta3-subunit-containing molecules, e.g. CD41, CD51, CD61
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/6432Coagulation factor Xa (3.4.21.6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/6437Coagulation factor VIIa (3.4.21.21)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/647Blood coagulation factors not provided for in a preceding group or according to more than one of the proceeding groups
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/96Stabilising an enzyme by forming an adduct or a composition; Forming enzyme conjugates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21021Coagulation factor VIIa (3.4.21.21)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21022Coagulation factor IXa (3.4.21.22)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies

Definitions

  • Initiation of the extrinsic clotting pathway is mediated by the formation of a complex between tissue factor, which is exposed as a result of injury to a vessel wall, and Factor Vila. This complex then converts Factors IX and X to their active forms. Factor Xa converts limited amounts of prothrombin to thrombin on the tissue factor- bearing cell. This resulting thrombin is then able to diffuse away from the tissue- factor bearing cell and activate platelets, and Factors V and VIII, making Factors Va and Villa. During the propagation phase of coagulation, Factor Xa is generated by Factor IXa (in complex with factor Villa) on the surface of activated platelets.
  • Factor Xa in complex with the cefaclor Factor Va, activates prothrombin into thrombin, generating a thrombin burst.
  • the cascade culminates in the conversion of fibrinogen to fibrin by thrombin, which results in the formation of a fibrin clot.
  • Factor VII and tissue factor are key players in the initiation of blood coagulation.
  • Factor VII is a plasma glycoprotein that circulates in blood as a single-chain zymogen.
  • the zymogen is catalytically inactive.
  • single-chain Factor VII may be converted to two-chain Factor Vila by a variety of factors in vitro
  • Factor Xa is an important physiological activator of Factor VII.
  • the conversion of zymogen Factor VII into the activated two-chain molecule occurs by cleavage of the peptide bond linking the Arginine residue at amino acid position 152 and the lie residue at amino acid position 153.
  • tissue factor, phospholipids and calcium ions the two-chain Factor Vila activates Factor X or Factor IX.
  • Factor Vila is thought to be the physiologic initiator of the clotting cascade by acting at the surface of a TF- bearing cell, typically a damaged endothelial cell, and generating the initial amount of thrombin that then diffuses to platelets to activate them and prime them for the propagation phase of thrombin generation.
  • recombinant FVIIa acts by activating Factor X on the surface of activated platelets, bypassing the need for FIXa or FVIIIa to generate a thrombin burst during the propagation phase of coagulation. Since FVIIa has relatively low affinity for platelets, recombinant FVIIa is dosed at supra-physiological levels. This process is thought be tissue factor- independent
  • Human factor IX circulates as a single-chain glycoprotein (mol wt 57,000). It is present in plasma as a zymogen and is converted to a serine protease, Factor I a (more commonly referred to as FIXa ⁇ , by Factor XIa (activated plasma thromboplastin antecedent) in the presence of calcium ions. In the activation reaction, two internal peptide bonds are hydrolyzed in Factor IX. These cleavages occur at a specific arginyl-alanine peptide bond and a specific arginyl-valine peptide bond.
  • Factor IXaf is composed of a light chain (mol wt approximately equal to 18,000 ⁇ and a heavy chain (mol wt approximately equal to 28,000), and these chains are held together by a disulfide bond.
  • Factor X is also synthesized as a single-chain polypeptide containing the light and. heavy chains connected by an Arg-Lys-Arg tripeptide. The single-chain molecule is then converted to the light and heavy chains by cleavage of two (or more) internal peptide bonds. In plasma, these two chains are linked together by a disulfide bond, forming Factor X.
  • Activated Factor X, Factor Xa participates in the final common pathway whereby prothrombin is converted to thrombin, which in turn converts fibrinogen to fibrin.
  • Clotting factors have been administered to patients to improve hemostasis for some time.
  • the advent of recombinant D A technology has significantly improved
  • recombinant activated factor VII has become widely used for the treatment of major bleeding, such as that which occurs in patients having haemophilia A or B, deficiency of coagulation Factors XI or VII, defective platelet function, thrombocytopenia, or von Wiliebrand's disease.
  • Recombinant factor IX is therapeutically useful as well.
  • the instant invention relates to chimeric clotting factors which have enhanced activity.
  • the present invention features inter alia methods for making chimeric clotting factors, the chimeric clotting factors made using these methods, and methods for improving hemostasis using these clotting factors.
  • the chimeric clotting factors of the invention possess enhanced pharmacokinetic properties, have reduced clearance rates, have improved man ufac curability, have reduced thrombogenicity, have enhanced activity, or more than one of these characteristics.
  • improved clotting factors of the invention have increased activity where needed, e.g., by targeting the clotting factor to platelets or by being present in a subject in an activatable form (a non-naturally occurring activatable form) that is activated at the site of clot formation.
  • the invention pertains to a chimeric clotting factor which comprises a clotting factor selected from the group consisting of FVII, FIX and FX and a targeting moiety which binds to platelets and optionally a spacer moiety between the clotting factor and the targeting moiety.
  • the clotting factor comprises a structure represented by the formula A B C, wherem A is the clotting factor; wherem B is a spacer moiety; and wherein C is at least one targeting moiety which binds to platelets.
  • the clotting factor comprises a structure from amino terminus to carboxy terminus represented by a formula selected from the group consisting of: A B C; C B A
  • the clotting factor exhibits increased generation of thrombin in the presence of platelets as compared to an appropriate control lacking the at least one targeting moiety.
  • the clotting factor comprises a scaffold moiety and, optionally, a second spacer moiety.
  • the clotting factor further comprises D and E, wherein D is a spacer moiety; and E is a scaffold moiety and wherein the chimeric clotting factor comprises a structure from amino terminus to carboxy terminus represented by a formula selected from the group consisting of: A B C D E; A D E B C; E D A B C; C B A D E; E D C B A; and C B E D A.
  • E is a dimeric Fc region comprising a first Fc moiety, Fl and a second Fc moiety, F2.
  • the clotting factor is expressed as a polypeptide comprising a cleavable scFc (cscFc) linker interposed between two Fc moieties, wherein the cscFc linker is adjacent to at least one enzymatic cleavage site which results in cleavage of the cscFc polypeptide linker.
  • cscFc cleavable scFc
  • the cscFc linker is adjacent to at least one enzymatic cleavage site which results in cleavage of the cscFc linker
  • polypeptide linker is flanked by two enzymatic cleavage sites which are recognized by the same or by different enzymes.
  • the polypeptide linker has a length of about 10 to about 50 amino acids.
  • the polypeptide linker has a length of about 20 to about 30 amino acids.
  • the polypeptide linker comprises a giy/ser peptide.
  • the gly/ser peptide is of the formula (Gly 4 Ser)n, or
  • n is a positive integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10.
  • the (Gly 4 Ser n linker is selected from the group consisting of (Gly 4 Ser)6, Ser(Gly 4 Ser)6, (Gly 4 Ser)4 and. Ser(Gly 4 Ser)4.
  • the clotting factor comprises two polypeptide chains.
  • the chimeric clotting factor has a strurure selected from the group consisting of: A linked to Fl via a spacer moiety and C linked to F2; A linked to F l via a spacer moiety and C linked to F2 via a spacer moiety; A linked to Fl and C is Jinked to F2 via a spacer moiety; A finked to F l via a spacer moiety and C is linked to F2 via a spacer moiety.
  • a chimeric clotttig factor comprises two polypeptides wherein the first polypeptide comprises the moieties A B F1; A B F 1 ; A B F 1 ; or A B Fl D C and the second polypeptide comprises the moieties C F2; C D F2; F2 D C; or F2 D C, wherein the two polypeptide chains form an Fc region.
  • the targeting moiety is fused to at least one of the polypeptide chains of the Fc region . In one embodiment, the targeting moiety is fused to at least one of F 1 and F2 directly. In one embodiment, the targeting moiety is fused to at least one of Fl and F2 via a spacer moiety. In one embodiment, the targeting moiety is fused to at least one of Fl and F2 via a cleavable linker. In one embodiment, the targeting moiety is selected, from the group consisting of: an antibody molecule, an antigen binding fragment of an antibody molecule, an scFv molecule, a receptor binding portion of a receptor, a peptide. In one embodiment, wherein the targeting moiety binds to resting platelets.
  • the targeting moiety selectively binds to activated platelets. In one embodiment, the targeting moiety selectively binds to a target selected from the group consisting of: GPIba, GPVI, and the nonactive form of GPIIb/IIIa. In one embodiment, the targeting moiety selectively binds to a target selected from the group consisting of: the active form of GPIIb/IIIa, P selectin, GMP--33, LAMP-1, LAMP-2, CD40L, and LOX-1. In one embodiment, the targeting moiety binds to the GPIb complex In one embodiment, the targeting moiety is a peptide selected from the group consisting of: PS4, OS1, and OS2. In one embodiment, the targeting moiety comprises an antibody variable regions from an antibody selected from the group consisting of: SCE5, MB9, and AP3.
  • the clotting factor is Factor VII.
  • the clotting factor is a high specific activity variant of
  • the clotting factor is Factor IX. In one embodiment, the clotting factor is a high specific activity variant of Factor IX. In one embodiment, the clotting factor is Factor X. In one embodiment, clotting factor is a high specific activity variant of Factor X.
  • the clotting factor is secreted by a cell in active form. In one embodiment, the clotting factor is activated in vivo.
  • the chimeric clotting factor comprises a heterologous enzymatic cleavage site not naturally present in the dotting factor.
  • the enzymatic cleavage site is genetically fused, to the amino terminus of the heavy chain moiety of the clotting factor.
  • the clotting factor comprises a scaffold moiety is a protein molecule which increases the hydrodvnamic radius of the chimeric clotting factor.
  • the scaffold moiety if present, is selected from the group consisting of albumin and XTEN*
  • the invention pertains to a polypeptide comprising FVII, which FVII comprises a heterologous enzymatic cleavage site activatable by a component of the clotting cascade.
  • the polypeptide comprises a scaffold moiety and, optionally, a spacer moiety.
  • the scaffold moiety is a dimeric Fc region comprising a first Fc moiety, Fl and a second Fc moiety, F2.
  • the clotting factor comprises two polypeptide chains.
  • the chimeric clotting factor has a struture selected from the group consisting of: the clotting factor linked to the first Fc moiety via a spacer moiety; the clotting factor linked to the second Fc moiety via a spacer moiety; the clotting factor is directly linked to Fl ; and. the clotting factor is directly linked to F2.
  • the chimeric clotting factor further comprises a targeting moiety.
  • the chimeric clotting factor is synthesized as a single polypeptide chain comprising a cscFc linker.
  • the cscFc linker is linked to (e.g., directly linked or adjacent to) at least one enzymatic cleavage site which results in cleavage of the linker,
  • the at least one enzymatic cleavage site is an intracellular processing site.
  • the cscFc linker is flanked by two enzymatic cleavage sites which are recognized by the same or by different enzymes.
  • the cscFc linker has a length of about 10 to about 50 amino acids. In one embodiment, the cscFc linker has a length of about 20 to about 30 amino acids.
  • the cscFc linker comprises a gly/ser peptide.
  • the gly/ser peptide is of the formula (Gly 4 Ser)n, or Ser(Gly 4 Sef)n wherein n is a positive integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10.
  • the (Gly 4 Ser)n linker is selected from the group consisting of (Gly 4 Ser)6, Ser(Gly 4 Ser)6, (Gly 4 Ser)4 and. Ser(G1y 4 Ser)4.
  • the clotting factor is a high specific activity variant of Factor VII.
  • the heterologous enzymatic cleavage site present in the chimeric clotting factor is cleaved at the site of clot formation.
  • the cleavage site is selected from the group consisting of: a factor XIa cleaveage site, a factor Xa cleavage site, and a thrombin cleavage site.
  • the enzymatic cleavage site is genetically fused to the amino terminus of the heavy chain moiety of the clotting factor.
  • the targeting moiety binds to resting platelets. In one embodiment, the targeting moiety selectively binds to activated platelets.
  • the targeting moiety selectively binds to a target selected from the group consisting of: GPIba, GPVI, and the nonactive form of GPIIb/IIIa. In one embodiment, the targeting moiety selectively binds to a target selected from the group consisting of: the active form of GPIIb/IIIa, P selectin, GMP- 33, LAMP , LAMP-2, CD40L, and LOX-1.
  • the scaffold moiety is a protein molecule which increases the hydrodynamic radius of the chimeric clotting factor.
  • the scaffold moiety if present, is selected from the group consisting of albumin and ⁇ ®
  • the invention pertains to a linear sequence of moieties from amino terminus to carboxy terminus selected from the group consisting of: A B C; C B A; A B C D E; A D E B C, E D A B C, C B A D E, E D C B A, C B E D A, wherein A an activatable clotting factor, B is absent or is a linker, C is a targeting moiety, D is absent or is a linker, and E is a scaffold moiety.
  • the clotting factor comprises a light and heavy chain of a clotting factor and each of the light and heavy chains are expressed as separate polypeptide chains.
  • the invention pertains to a nucleic acid molecule encoding a chimeric clotting factor of the invention.
  • the nucleic acid molecule is present in a vector.
  • the vector further comprises a nucleotide sequence encoding an enzyme which cleaves at least one of the enzymatic cleavage sites.
  • the invention pertains to a host cell comprising the expression vector of the invention.
  • the host cell expresses an enzyme capable of intracellular processing.
  • the enzyme is endogenous to the cell In one embodiment, the enzyme is heterologous to the cell.
  • the invention pertams to a method for producing a chimeric clotting factor comprising culturing the host cell in culture and recovering the chimeric clotting factor from the medium.
  • the invention pertams to a processed, heterodimeric polypeptide comprising two polypeptide chains, wherein said processed,
  • heterodimeric polypeptide is made by expressing the vector in a cell cultured in cell culture medium and isolating the mature, heterodimeric polypeptide from the culture medium.
  • the invention pertains to a composition comprising a chimeric clotting factor and a pharmaceutically acceptable carrier.
  • the invention pertams to a composition comprising the nucleic acid molecule of the invention and a pharmaceutically acceptable carrier.
  • the invention pertains to a method for improving hemostasis in a subject, comprising administering the composition of the invention.
  • the invention pertains to an chimeric clotting factor
  • a targeting moiety which comprises a fight chain moiety and a heavy chain moiety of a clotting factor, and at least one targeting moiety, wherein said targeting moiety (i) specifically binds to platelets, (ii) is not interposed between the light and heavy chains of the clotting factor, and wherein said chimeric clotting factor exhibits increased generation of thrombin in the presence of platelets as compared, to an appropriate control lacking the at least one targeting moiety.
  • the invention pertains to an chimeric clotting factor, which comprises the moieties A-B-C-D-E in linear sequence wherein A is a clotting factor, an activatable clotting factor, or an activated clotting factor: B is absent or is a linker; C is a targeting moiet ⁇ '; D is absent or is a linker; and E is absent or is a scaffold moiety.
  • the invention pertains to an chimeric clotting factor, which comprises a linear sequence of moieties from amino terminus to carboxy terminus selected from the group consisting of: ABC; ABCDE;
  • A is a clotting factor, an activatable clotting factor or an activated clotting factor
  • B is absent or is a linker
  • C is a targeting moiet ⁇ '.
  • D is absent or is a linker
  • E is a scaffold moiety.
  • the invention pertains to an chimeric clotting factor, w r hich comprises a linear sequence of moieties from amino terminus to carboxy terminus selected from the group consisting of: ABF1 :F2;
  • the invention pertains to an chimeric clotting factor which comprises a light chain moiety and a heavy chain moiety of a clotting factor, and at least one targeting moiety, wherein said targeting moiety specifically binds to platelets, wherein the chimeric clotting factor comprises a disulfide linked Fc region which comprises two polypeptide chains.
  • Figure 1 illustrates exemplary chimeric clotting factor constracts comprising a targeting domain. These exemplary constructs comprise an Fc region.
  • Figure 2 illustrates exemplary chimeric clotting factor constructs comprising a targeting domain. These exemplary constructs comprise a cieavable single chain Fc
  • Figure 3 illustrates exemplary chimeric clotting factor constracts which comprise a targeting domain and wherein the clotting factor moiety lacks a Gla domain. These exemplary constructs comprise an Fc region.
  • Figure 4 illustrates exemplary chimeric clotting factor constructs which comprise a targeting domain and wherein the clotting factor moiety lacks a G1a domain. These exemplary constructs comprise a cleavable single chain Fc (cscFc) in which the scFc linker is processed, by a cell in which it is expressed, to form a two chain Fc region.
  • cscFc cleavable single chain Fc
  • Figure 5 illustrates exemplary chimeric clotting factor constmcts which are activated (e.g., after activation in vitro or by separate expression of the fight and heavy chains of the clotting factor) or which are activatable, i.e., comprise a moiety which is cleavable in vivo at the site of a clot (see panels D and E).
  • These exemplary constructs comprise an Fc region.
  • Constructs A, B, and C did not express well in early experiments.
  • Figure 6 illustrates exemplary chimeric clotting factor constructs which are activated (e.g., after activation in vitro or by separate expression of the light and heavy chains of the clotting factor) or which are activatable, i.e., comprise a moiety which is cleavable in vivo at the site of a clot.
  • These exemplary constmcts comprise a cleavable single chain Fc (cscFc) in which the scFc linker is processed by a cell in which it is expressed to form a two chain Fc region,
  • Figure 7 illustrates exemplary chimeric clotting factor constmcts comprising a targeting domain.
  • Figure 8 illustrates exemplary chimeric clotting factor constmcts which comprise a targeting domain and wherein the clotting factor moiety lacks a Gla domain.
  • Figure 9 illustrates exemplary chimeric clotting factor constructs which are activated (e.g., after activation in vitro or by separate expression of the light and. heavy chains of the clotting factor) or which are activatable, i.e., comprise a moiety which is cleavable in vivo at the site of a clot.
  • Figure 10 shows SDS PAGE for purification and activation of FVXX-01 1.
  • Figure 1 1 shows SDS PAGE for purification of active FVII-053.
  • Figure 12 shows schematics of F VII- 01 1 and FVII-102 and shows binding of
  • FVIII-01 1 and FVH-027 to activated platelets determined by FACS.
  • Figure 13 shows thrombin generation assay to measure activity of FVII-027
  • Figure 14 shows that PAC-1 eliminates increased binding to platelets and increased rates of thrombin generation associated with FVII-027.
  • Figure 15 shows constructs used in a thrombin generation assay to measure activity of FVII-037 and Novoseven in the presence of activated platelets.
  • Figure 16 shows a thrombin generation assay to measure activity of FVII-037 and. N ovoseven in the presence of activated platelets.
  • Figure 17 shows the constructs used in the thrombin generation assay to measure activity of FVII-044, FVTT-045, FVII-046, FVII-01 1 and Novoseven in the presence of activated platelets shown in Figure 18.
  • Figure 18 show r s a thrombin generation assay to measure activity of FVII-044, FVII-Q45. FVII-046, FVII-011 and No voseven in the presence of activated platelets.
  • Figure 19 shows the constructs used in the thrombin generation assay to measure activity of FVII-047, FVII-048, FVII-049, FVII-011 and Novoseven in the presence of activated platelets shown in Figure 20.
  • Figure 20 shows a thrombin generation assay to measure activity of FVII-047, FVII-048, FVII-049, F VII-01 1 and Novoseven in the presence of activated platelets.
  • Figure 21 show r s the construct used in the thrombin generation assay to measure activity of FVH-053 and FVII-011 in the presence of activated platelets shown in Figure 22,
  • Figure 22 shows a thrombin generation assay to measure activity of F VII- 053 and FVII-011 in the presence of activated platelets
  • Figure 23 shows that PAC-1 eliminates increased rate of thrombin generation associated with FVII-053
  • Figure 24 shows the constructs used in the Western blot analysis of FVIIFc species following transient transfection of HEK 293 cells and protein A pulldown shown in Figure 25,
  • Figure 25 shows Western blot analysis of FVOFc species following transient transfection of HEK 293 cells and protein A pulldown.
  • Figure 26 shows Western blot of protein A immunoprecipitation following transient transfection of pSY -FW-024 with or without pSYN-PC5-003.
  • Lane 1 pSYN-FVII-024, non reducing;
  • lane 2 pSYN-FVII-024, non reducing;
  • lane 3 pSYN-
  • Figure 27 shows Western blot analysis (Fc western) of FVIIFc species following transient transfection of HEK 293 cells and protein A pulldown .
  • Figure 28 shows F VII- 039 and FVfl-040 treatment by FX la
  • Figure 29 shows that an FVIIaFc variant targeted to active form of GPIIbllla shows an increased rate of thrombin generation.
  • Figure 30 shows a Rotation Thromoboelastometr (ROTEM) assay to measure the activity of FVXI-088 and wild type recombinant FVIIaFc in hemophilia A human blood. Clotting Time, Clot Forming Time and Alpha Angle parameters are shown.
  • ROTEM Rotation Thromoboelastometr
  • Figure 31 shows exemplary cleavage sites and illustrative positions of such cleavage sites in activatable clotting factor constructs.
  • FVII is used as an example.
  • Figure 32 shows cleavage of the constructs illustrated in Figure 31.
  • Figure 33 shows additional activatable constructs and a Western blot illustrating their cleavage .
  • Figure 34 shows the results of a thrombin generation assay using the FVII-062 and -090 constructs.
  • FVII-062 is a negative control which lacks a thrombin cleavage site, so the conts tract cannot be activated.
  • FVII-090 contains the ALRPR cleavage site and so is activatable by thrombin.
  • Figure 35 illustrates the cleavage of high specific activity FVII variants.
  • FVII heavy chai -Fc and light chain Fc collapse in 1 band because the heavy chain loses a glycosylation site after insertion of the trypsin 170 loop and becomes smaller.
  • Figure 36 illustrates the results of a thrombin generation assay using FVII-090 and FVII- 100.
  • Figure 37 illustrates the results of a thrombin generation assay using FVII-090 and FVII-115,
  • Figure 38 illustrates amidolytic activity of activatable FVIIFC activated with thrombin
  • Amidolytic activity of the activatable variants can be measured following thrombin activation and there is increased, amidolytic activity for the high specific activity variants as compared to FVII-090.
  • hirudin is added to inhibit thrombin cleavage of the chromogenic substrate. In this manner, the thrombin does not interfere with, the ability to detect FVIIa activity.
  • Figure 39 illustrates the results of an assay measuring activation of FX by FVTIa using substrate S2765, which is not cleaved by FVIIa.
  • 10 uM of FX was incubated with FVIIaFc for 15 minutes at 37°C. The reaction was quenched with EDTA and substrate was added.
  • Figure 39 shows the results of the
  • Figure 40 shows FXa generation activity by "activatable FVTJFc.”
  • the experiment shown in Figure 40 shows that there is an increase in FX activation activity for the high specific activity variants.
  • FVIIFc 100 nM
  • thrombin 100 nM
  • Hirudin was added to inhibit the thrombin.
  • FX (lOuM) was added, followed by EDTA to inhibit the reaction.
  • the activity of FX was measured by detecting the FXa substrate.
  • Figure 41 illustrates exemplary activatable construct formats, including an activatable monomer structure used in FVII- 118, FVII- 119, and FVII- 127.
  • Figure 42 illustrates the efficiency of thrombin cleavage of activatable constructs, specifically monomelic (FVII-1 18 and -119) as compared to the heterodimeric (FVXI-090).
  • Figure 43 illustrates the results of a thrombin generation assay to compare wild type activatable FVIIFc (FVII- 118) to the high specific activity variant (FVII- 127).
  • Figure 44A illustrates several targeted constructs. In this instance, an
  • FIG. 44B illustrates the results of thrombin generation assays in platelet-rich FVIII-deficiei plasma using these constructs. N7 is the Novoseven control.
  • Figure 44C illustrates the binding of recombinant FVIIaFe variants to platelets by FACs.
  • FIG. 45 A illustrates several targeted FVIIa constructs which include
  • Figure 45B shows the results of thrombin generation assays in platelet-rich FVIII-deficient.
  • Figure 45 C shows the results of binding of rF VTIaFc variants to platelets by FACS.
  • Figure 46A shows several targeted. FVIIa constructs that target GPIb- aipha using peptides that bind to that molecule, specifically, the PS4, OS1 , and OS2 peptides.
  • Figure 46B shows the results of thrombin generation assays in platelet-rich FVIII-deficient plasma using the C terminal peptide constructs shown in Figure 46A.
  • Figure 47 A shows the results of thrombin genera tion assays in platelet- rich FVIII-deficient plasma using the N terminal peptide constructs shown in Figure 46A.
  • Figure 47B shows a direct comparison of FVII-045 and FVII-048.
  • Figure 48 shows the binding of FV11-045 and F VII -048 and wild type
  • FVIIaFc FVIIaFc to platelets as determined by FACS.
  • the figure also shows the affinity of the targeting peptides as reported in Bernard et al. Biochemistry 2008, 47:4674-4682.
  • Figure 49A shows an exemplary targeted FV111 construct.
  • Figure 49B shows the results of a thrombin generation assay in FVXII deficient platelet-rich plasma. In this experiment, the assay was activated with tissue factor (top panel) or by platelet activation (bottom panel).
  • Figure 50 shows results of an experiment measuring half life of a targeted FVII construct comprising a gla domain (FVII-01 1) and lacking a gla domain (FVn-028).
  • Figure 51A shows several FIX construct comprising targeting moieties, in this case SCE5 scFv.
  • Figure 5 IB shows the results of thrombin generation assays in platelet-rich FIX-deficient plasma using the constmcts of Figure 51 A.
  • Figure 51C illustrates that both FIX-068 and FIX-088 have at least 4 times more activity than FiX-042 as measured by Thrombin generation.
  • Figure 52A shows the results of a thrombin generation assay- comparing FTX-090 and Benefix.
  • Figure 52B shows that the activity of FXX-090 is almost 4 times that of Benefix.
  • Figure 53 A shows a targeted FIX construct comprising a peptide that binds to GPIb, present on resting and activated platelets.
  • Figure 53 B shows the results of thrombin generation assays in platelet-rich FIX deficient plasma.
  • the present invention relates to chimeric clotting factors.
  • the present invention is based, at least in part, on the development of novel ways to enhance the efficacy, pharmacokinetic properties, and/or manufacturability of clotting factors.
  • improved clotting factors of the invention have increased activity where needed, e.g., by targeting the clotting factor to platelets or by being present in a subject in an activatable form (a non-naturally occurring activatable form) that is activated at the site of clot formation. This can be accomplished, e.g., by targeting the clotting factors or by making them in an activatable form.
  • the subject clotting factors are targeted to the site of coagulation.
  • a targeting moiety which targets the clotting factor to resting or activated platelets By incorporating a targeting moiety which targets the clotting factor to resting or activated platelets, the activity of a dotting factor can be enhanced.
  • a targeting moiety which targets the clotting factor to resting or activated platelets the activity of a dotting factor can be enhanced.
  • exogenous FVTIa likely generates FXa/FIXa in a TF independent manner, most effective at the surface of activated platelets where other cloiting factors are localized.
  • FVIla has a relatively short halt-life (-2.3 hours) in humans. This short half-life likely contributes to the need, to dose recombinant F VTIa multiple times to control a bleed.
  • FVIla targeting clotting factors, and in particular FVTIa, to platelets improves efficiency.
  • the targeting moiety can be positioned at a number of places in a chimeric doting factor.
  • Exemplary structures of targeted chimeric clotting factors are set forth, e.g., in Figures 1-4, 7, 8, 17, 19, 21, 44, 46, 49, 51 , and 53.
  • a chimeric clotting factor of the invention is made in a form that is acti atable at the cite of coagulation.
  • exogenous clotting factors are only efficacious when given in the activated form.
  • activated dotting factors are rapidly inactivated by endogenous pathways (e.g. antithrombin III, TFPI), leading to clearance of the active form and a short effective half life. Giving higher doses does not solve this problem as it can result in thrombogenic effects.
  • the invention pertains to an "activatable" chimeric clotting factor constructs which comprise a heterologous enzymatic cleavage site not normally present in the clotting factor.
  • heterologous enzymatic cleavage site is one for an enzyme produced during the clotting cascade.
  • the heterologous cleavage site of an activatable construct comprises a Factor XIa, Xa, or thrombin cleavage site.
  • Exemplary FXIa cleavage sites include, e.g.,: TQSFNDFTR and SVSQTSKLTR.
  • Exemplary thrombin cleavage sites include, e.g.,: DFLAEGGGVR, TT 1KPR, and ALRPR.
  • a heterologous cleavage site is interposed between the light and heavy chains of the clotting factor.
  • a heterologous cleavage site is not interposed between the two chains of the clotting factor.
  • the heterologous cleavage site is amino terminal to the heavy chain of the clotting factor.
  • the heterologous cleavage site is present in a cleavable linker can be positioned at a number of places in a chimeric cloting factor.
  • exemplary structures of activatable chimeric clotting factors are set forth, e.g., in Figures 5, 6, 9, 29, 27, 31, and 41. Exemplary such constructs are activated in the presence of clot formation and are described in more detail below,
  • a chimeric clotting factor of the invention comprises a scaffold, e.g., to enhance the hydrodynamic radius of the molecule.
  • a chimeric clotting factor of the invention may be a fusion protein.
  • Exemplary scaffolds include, e.g.. FcRn binding moieties (e.g., complete Fc regions or portions thereof which bind to FcRn), single chain Fc regions (ScFc regions, e.g., as described in US 2008/0260738, WO 2008/012543, or WO 2008/1439545), cleaveable scFc regions (comprising a cscFc regions as described herein), less complicated proteins or portions thereof, e.g., XTen polypeptides*", or albumin.
  • FcRn binding moieties e.g., complete Fc regions or portions thereof which bind to FcRn
  • ScFc regions single chain Fc regions
  • cleaveable scFc regions comprising a cscFc regions as described herein
  • less complicated proteins or portions thereof e.g., XTen polypeptides*", or albumin.
  • a chimeric clotting factor of the invention employs an Fc region or an FcRn binding portion thereof as a scaffold moiety.
  • the Fc moiety to which the chimeric clotting factor is fused is a naturally occurring (or wild type (WT)) Fc moiety.
  • WT wild type
  • the Fc moiety comprises one or more variations in sequence.
  • the Fc moiety is a scFc moiety (e.g., comprising a non-cleavable or a cscFc linker).
  • a scFc moiety e.g., comprising a non-cleavable or a cscFc linker.
  • an unprocessed molecule comprises a cleavable single chain Fc region in which the component Fc moieties are genetically-fused in a single polypeptide chain forming a functional, single chain, dimeric Fc region.
  • the cscFc linker can link the Fc moieties that will comprise the dimeric Fc region of the polypeptide in tandem or may link one Fc moiety to a non-Fc moiety of the construct, e.g., a clotting factor or targeting moiety, which is, in turn, linked to a second Fc moiety.
  • the cscFc linker is interposed between the Fc moieties that comprise the scFc region and is flanked by at least one enzymatic cleavage site, e.g., an intracellular enzymatic processing sites.
  • the scFc linker is flanked by two enzymatic cleavage sites resulting in the excision of the linker (e.g., all or substantially all of the linker) when the protein encoded by the nucleic acid molecule is processed in a cell
  • the scFc linker is adjacent to at least one enzymatic cleaveage site that allows for excision of the linker in vitro after the polypeptide has been secreted by a cell or comprises at least one enzymatic cleaveage site that allows for cleavage of the linker in vivo after the construct is administered to a subject.
  • the such a polypeptide comprises scFc region(s) encoded in a single open reading frame (O F) as part of one contiguous nucleotide sequence in unprocessed form
  • the cscFc linker is enzymatically cleaved (e.g., prior to administration or in vivo after administration), resulting in a polypeptide which is a heterodimeric molecule comprising an Fc region which is not fused in a single amino acid chain, i.e.. the resulting processed construct has a Fc region which comprises two polypeptide chains.
  • all or substantially all of the linker is excised, while in some embodiments, a portion of the cleavage site may remain, e.g., four arginines of the RRRR cleavage site.
  • the scFc linker is flanked by two processing sites for cleavage.
  • the two processing sites can be the same or different.
  • at least one processing site is a cluster of basic amino acid, residues as recognized by arginine kex2/furin enzymes. Such enzymes cleave immediately C- terminal to an arginine residue.
  • at least one cleavage site is one that may be cleaved in vivo, for example a cleavage site recognized by thrombin.
  • a chimeric clotting factor of the invention is manufactured in an activated form in the context of an scFc molecule comprising a csFc linker.
  • Factor VII is generally produced recombinantly as a zymogen, and. requires activation during manufacturing to produce the active form for administration.
  • a chimeric clotting factor of the invention is secreted from the cell in which it is expressed, in active form to improve
  • such clotting factors can be produced by incorporating a single chain Fc region into the molecule.
  • Single chain Fc regions are formed by dimerization of Fc moieties which are present in a single polypeptide chain.
  • such a construct comprises an scFc polypeptide linker linking the two Fc moieties of the scFc which is adjacent to at least one intracellular processing site. Cleavage of such a construct is delayed until late in the secretory pathway, e.g., when the protein colocalizes with active processing enzymes in the rrans-Golgi apparatus.
  • a cell expressing a construct encoding a polypeptide of the invention endogenous! ⁇ ' expresses an enzyme which cleaves the scFc linker at one or more processing sites resulting in a dimeric molecule comprising two polypeptide chains.
  • a cell expressing a construct encoding a polypeptide of the invention exogenously expresses an enzyme which cleaves the scFc linker at one or more processing sites.
  • a chimeric clotting factor of the invention can combine two or more of these features to create an optimized construct e.g. targeting an activatable fusion protein constract to resting platelets, such that it can be activated efficiently as well as at a higher local concentration at the site of active coagulation.
  • exemplary such combination constructs include chimeric clotting factors that are both targeted and comprise an scFc linker for enhanced processing.
  • a constract of the invention is targeted, and activatable.
  • the invention pertains to a polypeptide having the structure as set forth in the Figures.
  • the invention pertains to a polypeptide having the sequence set forth in the accompanying sequence listing or the the nucleic acid molecule encoding such polypeptides.
  • the invention pertains to a mature form of a polypeptide having the sequence set forth in the accompanying sequence listing. It will be understood that these constructs and nucleic acid molecules encoding them can be used to improve heraostasis in a subject.
  • protein or “polypeptide” refers to a polymer of two or more of the natural amino acids or non-natural amino acids.
  • amino acid includes alanine (Ala or A); arginine (Arg or
  • isoleucine (lie or 1): leucine (Leu or L); lysine (Lys or K); methionine (Met or M); phenylalanine (Phe or F); proline (Pro or P); serine (Ser or S ⁇ ; threonine (Thr or T); tryptophan (Tip or W); tyrosine (Tyr or Y); and valine (Val or V).
  • Non- traditional amino acids are also within the scope of the invention and include norleucine, ornithine, norvaline, homoserine, and other amino acid residue analogues such as those described in Elknan ei al. Meth. Enzym. 202:301-336 (1991 ).
  • the term "polar amino acid'" includes amino acids that have net zero charge, but have non-zero partial charges in different portions of their side chains (e.g. M, F, W, S, Y, N, Q, C). These amino acids can participate in hydrophobic interactions and electrostatic interactions.
  • the term "charged amino acid” include amino acids that can have non-zero net charge on their side chains (e.g. R, K, H, E, D). These amino acids can participate in hydrophobic interactions and electrostatic interactions.
  • amino acid substitution refers to the replacement of at least one existing amino acid residue in a predetermined amino acid sequence (an amino acid sequence of a starting polypeptide) with a second, different “replacement” amino acid residue.
  • amino acid insertion refers to the incorporation of at least one additional amino acid into a predetermined amino acid, sequence. While the insertion will usually consist of the insertion of one or two amino acid, residues, the present larger "peptide insertions", can be made, e.g. insertion of about three to about five or even up to about ten, fifteen, or twenty amino acid residues. The inserted residue(s) may be naturally occurring or non-naturally occurring as disclosed above.
  • amino acid deletion refers to the removal of at least one amino acid residue from a predetermined amino acid sequence.
  • Polypeptides may be either monomers or multimers.
  • a protein of the invention is a dimer.
  • a dimeric polypeptide of the invention may comprise two polypeptide drains or may consist of one polypeptide chain (e.g., in the case of an scFc molecule).
  • the dimers of the invention are homodimers, comprising two identical monomelic subunits or polypeptides (e.g., two identical Fc moieties or two identical biologically active moieties), in another embodiment, the dimers of the in vention are heterodimers, comprising two non-identical monomelic subunits or polypeptides (e.g., comprising two different clotting factors or portions thereof or one clotting factor only). See, e.g., U.S. patent 7404956, incorporated herein by reference.
  • polypeptide linkers refers to a peptide or polypeptide sequence (e.g., a synthetic peptide or polypeptide sequence) which connects two domains in a linear amino acid sequence of a polypeptide chain.
  • the polypeptides of invention are encoded by nucleic acid molecules that encode polypeptide linkers which either directly or indirectly connect the two Fc moieties which make up the construct. These linkers are referred to herein as “scFc linkers” and the scFc linker is interposed, between the two Fc moieties of a polypeptide which comprises it.
  • the scFc linker connects two Fc moieties contiguously in the linear polypeptide sequence, it is a "direct" linkage.
  • the scFc linkers may link the first Fc moiety to a binding moiety which is, in turn, linked to the second Fc moiety, thereby forming an indirect linkage.
  • These scFc linkers permit the formation of a single chain genetic construct.
  • the polypeptides also comprise enzymatic cleavage sites which result in the scFc linker being eleavabie (a cscFc linker) and, in one embodiment, substantially excised, (e.g., during processing by a cell).
  • the resulting processed polypeptide is a dimeric molecule comprising at least two amino acid chains and substantially lacking extraneous linker amino acid sequences.
  • all or substantially all of the linker is excised, while in some embodiments, a portion of the cleavage site may remain, e.g., four arginines of the RRRR cleavage site.
  • another type of polypeptide linker herein referred to as a "spacer” may be used to connect different moieties, e.g., a clotting factor or targeting moiety to an Fc moiety on the polypeptide.
  • This type of linker may provide flexibility to the polypeptide molecule. Spacers are not typically cleaved; however in certain embodiments, such cleavage may be desirable. Exemplary positions of spacers are shown in the accompanying drawings. Spacers can be located between the clotting factors, targeting moieties, and/or scaffolds, e.g., at the N or C terminus of these moieties. In one embodiment, these linkers are not removed during processing.
  • a third type of linker which may be present in a chimeric clotting factor of the invention is herein referred to as a "cleavable linker" which comprises a heterologous cleavage site (e.g., a factor XIa, Xa, or thrombin cleavage site) and which may include additional spacer linkers on either the N terminal of C terminal or both sides of the cleavage site. Exemplary locations for such sites are shown in the accompanying drawings and include, e.g., placement adjacent to targeting moieties. In another embodiment, such linkers may be adjacent to a clotting factor or portion thereof.
  • a heterologous cleavage site e.g., a factor XIa, Xa, or thrombin cleavage site
  • additional spacer linkers on either the N terminal of C terminal or both sides of the cleavage site. Exemplary locations for such sites are shown in the accompanying drawings and include, e.g., placement adjacent to targeting moie
  • a cleavable linker may be fused to the N terminus of the heavy chain of a clotting factor to make an activatable form of the clotting factor.
  • the cleavable linker may include additional spacer linkers at the N terminus of the cleavage site, but requires direct fusion at the C- terminus of the cleavage site to the amino terminus of the heavy chain of the clotting factor.
  • gly-ser polypeptide linker refers to a peptide that consists of glycine and serine residues.
  • An exemplary gly/ser polypeptide linker comprises the amino acid sequence (Gly 4 Ser) n. (SEQ ID NO;4)
  • Another exemplary gly/ser polypeptide linker comprises the amino acid sequence S(Gly 4 Ser) n .
  • a polypeptide or amino acid sequence "derived from” a designated polypeptide or protein refers to the origin of the polypeptide.
  • the polypeptide or amino acid sequence which is derived from a particular sequence has an amino acid sequence that is essentially identical to that sequence or a portion thereof, wherein the portion consists of at least 10-20 amino acids, preferably at least z l 20-30 amino acids, more preferably at least 30-50 amino acids, or which is otherwise identifiable to one of ordinary skill in the art as having its origin in the sequence,
  • Polypeptides derived from another peptide may have one or more mutations relative to the starting polypeptide, e.g..
  • the polypeptide comprises an amino acid sequence which is not naturally occurring.
  • Such variants necessarily have less than 100% sequence identity or similarity with the starting antibody.
  • the variant will have an amino acid sequence from about 75% to less than 100% amino acid sequence identity or similarity with the amino acid sequence of the starting polypeptide, more preferably from about 80% to less than 100%, more preferably from about 85% to less than 100%, more preferabl from about 90% to less than 100% (e.g.
  • the variant molecule there is one amino acid difference between a starting polypeptide sequence and the sequence derived therefrom. Identit or similarity with respect to this sequence is defined herein as the percentage of amino acid residues in the candidate sequence that are identical (i.e. same residue) with the starting amino acid residues, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity.
  • polypeptides of the invention comprise an amino acid sequence (e.g., at least one clotting factor or Fc moiety or domain) derived from a human protein sequence.
  • polypeptides may comprise one or more amino acids from another mammalian species.
  • a clotting factor, Fc domain, or targeting moiety may be derived from a non-human species and included in the subject polypeptides.
  • one or more amino acids may be present in a polypeptide which are derived from a non-human species.
  • Preferred polypeptides of the invention are not immunogenic.
  • polypeptides of the invention may be altered such that they vary in amino acid sequence from the naturally occurring or native polypeptides from which they were derived, while retaining the desirable activity of the native polypeptides.
  • nucleotide or amino acid substitutions leading to conservative substitutions or changes at "non-essential" amino acid residues may be made.
  • An isolated nucleic zz acid molecule encoding a non-natural variant of a polypeptide derived, from an immunoglobulin can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of the immunoglobulin such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein.
  • Mutations may be introduced by standard techniques, such as site-directed mutagenesis and. PCR-mediated mutagenesis.
  • polypeptides of the invention may comprise conservative amino acid substitutions at one or more amino acid residues, e.g., at essential or nonessential amino acid residues.
  • a "conservative amino acid substitution” is one in which the amino acid, residue is replaced with an amino acid residue having a similar side chain.
  • Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid
  • a nonessential amino acid residue in a polypeptide may be replaced with another amino acid, residue from the same side chain family.
  • a string of amino acids can be replaced with a structurally similar string that differs in order and/or composition of side chain family members.
  • mutations may be introduced randomly along all or part of a coding sequence, such as by saturation mutagenesis, and the resultant mutants can be incorporated into polypeptides of the invention and. screened for their ability to bind to the desired target.
  • a “linear sequence” or a “sequence” is the order of amino acids in a polypeptide in an amino to carboxyl terminal direction in which residues that neighbor each other in the sequence are contiguous in the primary structure of the polypeptide.
  • the terms "linked,” “fused”, or “fusion” refer to linkage via a peptide bonds (e.g., genetic fusion), chemical conjugation or other means.
  • a peptide bonds e.g., genetic fusion
  • polypeptide linkers which link the molecules or moieties via peptide bonds.
  • the terms "genetically fused,” “genetically linked” or “genetic fusion” are used interchangeably and refer to the co-linear, covending linkage or attachment of two or more proteins, polypeptides, or fragments thereof via their individual peptide backbones, through genetic expression of a single polynucleotide molecule encoding those proteins, polypeptides, or fragments.
  • Such genetic fusion results in the expression of a single contiguous genetic sequence.
  • Preferred genetic fusions are in frame, i.e., two or more open reading frames (ORFs) are fused, to form a continuous longer ORF, in a manner that maintains the correct reading frame of the original ORFs.
  • ORFs open reading frames
  • the resulting recombinant fusion protein is a single polypeptide containing two or more protein segments that correspond to polypeptides encoded by the original ORFs (which segments are not normally so joined in nature).
  • the single polypeptide is cleaved during processing to yield dimeric molecules comprising two polypeptide chains.
  • Fc region is defined as the portion of a polypeptide which corresponds to the Fc region of native immunoglobulin, i.e. , as formed by the dimeric association of the respective Fc domains of its two heavy chains.
  • a native Fc region is homodimeric and. comprises two polypeptide chains.
  • scFc region single-chain Fc region
  • scFc region refers to a synthetic dimeric Fc region comprised of Fc domains genetically linked within a single polypeptide chain (i.e., encoded in a single contiguous genetic sequence).
  • Fc domain refers to the portion of a single immunoglobulin heavy chain beginning in the hinge region just upstream of the papain cleavage site (i.e. residue 216 in IgG, taking the first residue of heavy chain constant region to be 114) and ending at the C-terminus of the antibody. Accordingly, a complete Fc domain comprises at least a hinge domain, a CH2 domain, and a CH3 domain.
  • an Fc domain portion includes an amino acid, sequence of an Fc domain or derived from an Fc domain.
  • an Fc moiety comprises at least one of: a hinge (e.g., upper, middle, and/or lower hinge region) domain, a CH2 domain, a CH3 domain, a CH4 domain, or a variant, portion, or fragment thereof.
  • an Fc moiety comprises a complete Fc domain (i.e., a hinge domain, a CH2 domain, and a CH3 domain).
  • a Fc moiety comprises a hinge domain (or portion z4 thereof) fused to a CH3 domain (or portion thereof).
  • an Fc moiety comprises a CH2 domain (or portion thereof) fused to a CH3 domain (or portion thereof). In another embodiment, an Fc moiety consists of a CH3 domain or portion thereof. In another embodiment, an Fc moiety consists of a hinge domain (or portion thereof) and a CH3 domain (or portion thereof). In another embodiment, a Fc moiety consists of a CH2 domain (or portion thereof) and a CH3 domain. In another embodiment, a Fc moiety consists of a hinge domain (or portion thereof) and. a CH2 domain (or portion thereof). In one embodiment, an Fc moiety lacks at least a portion of a CH2 domain (e.g., all or part of a CH2 domain).
  • half-life refers to a biological half-life of a particular polypeptide in vivo.
  • Half-life may be represented by the time required for half the quantity administered to a subject to be cleared from the circulation and/or other tissues in the animal.
  • the curve is usually biphasic with a rapid, a-phase and longer ⁇ -phase.
  • the a-phase typically represents an equilibration of the administered Fc polypeptide between the intra- and extra-vascular space and is, in part, determined, by the size of the polypeptide.
  • the ⁇ -phase typically represents the catabolism of the polypeptide in the intravascular space. Therefore, in a preferred embodiment, the term half-life as used herein refers to the half-life of the polypeptide in the ⁇ -phase.
  • the typical ⁇ phase half-life of a human antibody in humans is 21 days.
  • moiety refers to a component part or constituent of a chimeric polypeptide.
  • targeting moiety refers to a molecule, fragment thereof or a component of a polypeptide which localizes or directs the polypeptides of the invention to a desired, site or cell.
  • a construct of the invention comprises a "targeting moiety" which enhances the activity of the polypeptide, e.g., by localizing the molecule to a desired site.
  • a moiety may be, e.g., an antibody or variant thereof (e.g., and scFv) or a peptide.
  • such a targeting moiety may be a polypeptide, a receptor binding portion of a ligand, or a ligand binding portion of a receptor which is linked to a polypeptide of the invention and binds to the desired target, e.g., on a cell or tissue.
  • the targeting moiety may be genetically fused to a construct, chemically conjugated to the construct or linked to the construct via a spacer.
  • targeting moieties may be attached to a construct of the invention by formation of a bond between the targeting moiety and an Fc moiety of a construct, where the targeting moiety comprises a first functional group and the Fc moiety comprises a second functional group, and where the first and second functional groups are capable of reacting with each other to form a chemical bond (see, e.g., U.S. patent 7381408).
  • a targeting moiety binds to platelets. Exemplary targeting moieties are described in more detail below.
  • a targeting moiety for use in a construct of the invention comprises an antibody variant.
  • antibody variant or “modified antibody” includes an antibody which does not occur in nature and which has an amino acid sequence or amino acid side chain chemistry which differs from that of a naturally-derived antibody by at least one amino acid or amino acid modification as described herein.
  • antibody variant includes synthetic forms of antibodies which are altered such that they are not naturally occurring, e.g..
  • antibodies that comprise at least two heavy chain portions but not two complete heavy chains (such as, domain deleted antibodies or minibodies); multispecific forms of antibodies (e.g., bispecific, trispecific, etc.) altered to bind to two or more different antigens or to different epitopes on a single antigen); heav chain molecules joined to scFv molecules; single-chain antibodies; diabodies; triabodies; and antibodies with altered, effector function and the like.
  • scFv molecule includes binding molecules which consist of one light chain variable domain (VL) or portion thereof, and one heavy chain variable domain (VTI) or portion thereof wherein each variable domain (or portion thereof) is derived from the same or different antibodies.
  • scFv molecules preferably comprise an scFv linker interposed between the VH domain and the VL domain.
  • ScFv molecules are known in the art and are described, e.g., in US patent 5,892,019, Ho et al, 1989. Gene 77:51 ; Bird et al. 1988 Science 242:423; Pantoliano et al. 1991. Biochemistry 30: 10117; Milenic et al. 1991. Cancer Research 51 :6363; Takkinen et al. 1991. Protein Engineering 4:837.
  • a "scFv linker” as used herein refers to a moiety interposed between the VL and. VH domains of the scFv. scFv linkers preferably maintain the scFv molecule in a antigen binding conformation.
  • a scFv linker comprises or consists of an scFv linker peptide.
  • a scFv linker peptide comprises or consists of a gly-ser polypeptide linker.
  • a scFv linker comprises a disulfide bond.
  • glycosylation refers to the eovalent linking of one or more carbohydrates to a polypeptide.
  • giycosylation is a posttranslational event which can occur within the intracellular milieu of a ceil or extract therefrom.
  • the term giycosylation includes, for example, N-linked giycosylation (where one or more sugars are linked to an asparagine residue) a d/or O-linked giycosylation (where one or more sugars are linked to an amino acid residue having a hydroxy! group (e.g., serine or threonine).
  • a molecule of the invention is glycosylated.
  • a molecule of the invention is aglycosylated.
  • a molecule of the invention has reduced giycosylation as compared to that in a wild type Fc region.
  • disulfide bond includes the covalent bond formed, between two sulfur atoms.
  • the amino acid, cysteine comprises a thiol group that can form a disulfide bond or bridge with a second thiol group.
  • the CHI and CL regions are linked by native disulfide bonds and the two heavy chains are linked by two native disulfide bonds at positions corresponding to 239 and 242 using the Kabat numbering system (position 226 or 229, EU numbering system).
  • vectors used in accordance with the present invention as a vehicle for introducing into and expressing a desired polynucleotide in a cell.
  • vectors may easily be selected from the group consisting of plasmids, phages, viruses and retroviruses.
  • vectors compatible with the instant invention will comprise a selection marker, appropriate restriction sites to facilitate cloning of the desired gene and. the ability to enter and/or replicate in eukaryotic or prokaryotic cells.
  • DMA elements which are derived from animal viruses such as bovine papilloma viras, polyoma virus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV or MOMLV) or SV40 virus.
  • cells which have integrated the DNA into their chromosomes may be selected by introducing one or more markers which allow selection of transfected host cells.
  • the marker may provide for prototrophy to an auxotrophic host, biocide resistance (e.g., antibiotics) or resistance to heavy metals such as copper.
  • the selectable marker gene can either be directly linked to the DNA sequences to be expressed, or introduced into the same cell by cotransformation.
  • an inducible expression system can be employed. Additional elements may also be needed for optimal synthesis of mR A. These elements may include signal sequences, splice signals, as well as transcriptional promoters, enhancers, and termination signals.
  • a secretion signal e.g., any one of several well characterized bacteria! leader peptides (e.g., pelB, phoA, or ompA), can be fu sed, in- frame to the N terminus of a polypeptide of the invention to obtain optimal secretion of the polypeptide.
  • the term "host ceil'" refers to a cell that has been transformed with a vector constructed using recombinant DNA techniques and encoding at least one heterologous gene.
  • the terms “cell” and “cell culture” are used interchangeably to denote the source of protein unless it is clearly specified otherwise.
  • reco very of protein from the “cells” may mean either from spun down whole cells, or from the cell culture containing both the medium and the suspended cells.
  • the host cell line used for protein expression is most preferably of mammalian origin; those skilled in the art are credited with ability to preferentially determine particular host cell lines which are best suited for the desired gene product to be expressed therein. Exemplary host cell lines include, but are not limited to, DG44 and DUXB11
  • Host cell lines are typically available from commercial services, the American Tissue Culture Collection or from published literature.
  • the polypeptides of the invention can also be expressed in non-mammalian cells such as bacteria or yeast or plant cells.
  • non-mammalian cells such as bacteria or yeast or plant cells.
  • various unicellular non- mammalian microorganisms such as bacteria can also be transformed; i.e. those capable of being grown in cultures or fermentation.
  • Bacteria which are susceptible to transformation, include members of the enterobacteriaceae, such as strains of Escherichia coli or Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus; Streptococcus, and Haemophilus influenzae.
  • the polypeptides when expressed in bacteria, the polypeptides typically become part of inclusion bodies. The polypeptides must be isolated, purified and then assembled into functional molecules.
  • eukaryotie microbes may also be used.
  • Saccharomyces cerevisiae or common baker's yeast, is the most commonly used among eukaryotie microorganisms although a number of other strains are commonly available including Pichia pastoris.
  • the plasmid YRp7 for example, (Stinchcomb et a!., (1979), Nature, 282:39; Kingsman et ah, (1979), Gene, 7: 141 ; Tschemper et a , (1980), Gene, 10: 157 ⁇ is commonly used.
  • This plasmid already contains the TRPI gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, (1977), Genetics, 85: 12 ⁇ .
  • the presence of the trpi iesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting
  • endogenous refers to molecules (e.g. nucleic acid and/or protein molecules) that are naturally present in a cell.
  • exogenous'Or “heterologous” refers to such molecules that are not normally found in a given context, e.g., in a cell or in a polypeptide.
  • an exogenous or heterologous molecule may be introduced into a cell and are only present after manipulation of the cell, e.g., by transfection or other forms of genetic engineering or a heterologous amino acid sequence may be present in a protein in which it is not naturally found.
  • cleavage site refers to a site recognized by an enzyme. Certain enzymatic cleavage sites comprise an intracellular processing site.
  • a polypeptide has an enzymatic cleavage site cleaved by an enzyme that is activated during the clotting cascade, such that cleavage of such sites occurs at the site of clot formation.
  • Exemplary such sites include e.g., those recognized by thrombin, Factor XIa or Factor Xa
  • Exemplary FXIa cleavage sites include, e.g. TQSFNDFTR and SVSQTSKLTR.
  • Exemplary thrombin cleavage sites include, e.g, DFLAEGGGVR, TTKIKPR, LVPRG SEQ ID NO:35) and ALRPR.
  • Other enzymatic cleavage sites are known in the art.
  • processing site refers to a type of enzymatic cleavage site in a polypeptide which is the target for enzymes that function after translation of the polypeptide. In one embodiment, such enzymes function during transport from the Golgi lumen to the trans-Goigi compartment. Intracellular processing enzymes cleave polypeptides prior to secretion of the protein from the cell. Examples of such processing sites include, e.g., those targeted by the PACE/furin (where PACE is an acronym for Paired basic Amino acid Cleaving Enzyme) family of endopeptidases.
  • administration of a polypeptide includes subjects, such as mammalian subjects, that would benefit from administration of polypeptides of the invention, e.g., to improve hemostasis.
  • a "chimeric protein” or “fusion protein”, as used herein, refers to any protein comprised of a first amino acid sequence derived, from a first source, bonded,, covalently or non-covalently, to a second amino acid sequence derived from a second source, wherein the first and second source are not the same.
  • a first source and a second source that are not the same can include two different biological entities, or two different proteins from the same biological entity, or a biological entity and a non-biological entity.
  • a chimeric protein can include for example, a protein derived, from at least 2 different biological sources,
  • a biological source can include any non- synthetically produced nucleic acid or amino acid sequence (e.g.
  • a synthetic source can include a protein or nucleic acid sequence produced chemically and not by a biological system (e.g. solid phase synthesis of amino acid sequences).
  • a chimeric protein can also include a protein derived from at least 2 different synthetic sources or a protein derived from at least one biological source and at least one synthetic source.
  • a chimeric protein may also comprise a first amino acid sequence derived from a first source, covalently or non-eovalently linked to a nucleic acid, derived from any source or a small organic or inorganic molecule derived from any source.
  • the chimeric protein may comprise a linker molecule between the first and second amino acid sequence or between the first amino acid sequence and the nucleic acid, or between the first amino acid sequence and. the small organic or inorganic molecule.
  • clotting factor refers to molecules, or analogs thereof naturally occurring or recombinant! ⁇ ' produced which prevent or decrease the duration of a bleeding episode in a subject. In other words, it means molecules having pro-clotting activity, i.e., are responsible for the conversion of fibrinogen into a mesh of insoluble fibrin causing the blood to coagulate or clot.
  • Clotting activity means the ability to participate in a cascade of biochemical reactions that culminates in the formation of a fibrin clot and/or reduces the severity, duration or frequency of hemorrhage or bleeding episode.
  • Hemostasia means the stopping or slowing of bleeding or hemorrhage; or the stopping or slowing of blood flow through a blood vessel or body part.
  • Hemostatic disorder means a genetically inherited or acquired condition characterized by a tendency to hemorrhage, either spontaneously or as a result of trauma, due to an impaired ability or inability to form a fibrin clot. Examples of such disorders include the hemophilias.
  • hemophilia A factor VIII deficiency
  • hemophilia B factor IX deficiency or "Christmas disease”
  • hemophilia C factor XI deficiency, mild bleeding tendency
  • Von Willebrand disease factor Xi deficiency (PTA deficiency)
  • Factor XII deficiency deficiencies or structural abnormalities in fibrinogen, prothrombin, Factor V, Factor VII, Factor X or factor XIII, Bernard-Soulier syndrome is a defect or deficiency in GPIb.
  • GPIb the receptor for vWF
  • GPIb the receptor for vWF
  • primary hemostasis primary hemostasis
  • Naegeii Glanzman and Naegeii
  • the chimeric molecules of the invention can be used prophylacticly.
  • prophylactic treatment refers to the administration of a molecule prior to a bleeding episode.
  • the subject in need of a general hemostatic agent is undergoing, or is about to undergo, surgery.
  • the chimeric protein of the invention can be administered prior to or after surgery as a prophylactic.
  • the chimeric protein of the invention can be administered during or after surgery to control an acute bleeding episode.
  • the surger can include, but is not limited to, liver transplantation, liver resection, or stem cell transplantation
  • On-demand treatment includes treatment for a bleeding episode, hemarthrosis, muscle bleed, oral bleed, hemorrhage, hemorrhage into muscles, oral hemorrhage, trauma, trauma capitis (head trauma), gastrointestinal bleeding, intracranial hemorrhage, intra-abdominal hemorrhage, intrathoracic hemorrhage, bone fracture, central nervous system bleeding, bleeding in the retropharyngeal space, bleeding in the retroperitoneal space, or bleeding in the illiopsoas sheath.
  • the subject may be in need of surgical prophylaxis, peri-operative management, or treatment for surgery.
  • Such surgeries include, e.g., minor surgery, major surgery, tooth extraction, tonsillectomy, inguinal herniotomy, synovectomy, total knee replacement, craniotomy, osteosynthesis, trauma surgery, intracranial surgery, intra-abdominal surgery, intrathoracic surgery, or joint replacement surgery.
  • acute bleeding refers to a bleeding episode regardless of the underlying cause.
  • a subject may have trauma, uremia, a hereditary bleeding disorder (e.g., factor VII deficiency) a platelet disorder, or resistance owing to the development of antibodies to clotting factors.
  • Treat, treatment, treating, as used herein refers to, e.g., the reduction in severit of a disease or condition; the reduction in the duration of a disease course; the amelioration of one or more symptoms associated with, a disease or condition; the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition, the prophylaxis of one or more symptoms associated with a disease or condition.
  • the invention pertains to improved versions of factors
  • Exemplary chimeric clotting factor constructs of the invention are set forth in the accompanying Figures. Although the Figures generally illustrate the clotting Factor as a single chain (in its zymogen form) it will be understood that the clotting factor may also be present in its active form in a construct of the invention, e.g. as a two chain, disulfide bonded form.
  • a chimeric clotting factor of the invention is expressed by a cell in active form.
  • a chimeric clotting factor is expressed in inactive form and is subsequently activated under appropriate conditions in vitro such that the active form of the clotting factor is present in the construct.
  • a chimeric clotting factor of the invention comprises a clotting factor in inactive form and the clotting factor is activated in vivo after administration.
  • an scFc scaffold can be used to produce an active form of a molecule.
  • Certain clotting factors are produced recombinant! ⁇ ' as zymogens and, therefore, require activation during manufacturing.
  • Active forms of Factors VII, IX, and X are comprised, of dimeric molecules in which the heavy and light chain are linked only by a disulfide bond.
  • a chimeric clotting factor is activated, prior to administration to a subject to improve hemostasis.
  • Methods for activating clotting factors are known in the art.
  • a chimeric clotting factor of the invention is contacted with media containing CaCl 2 at a concentration of approximately 5 mM.
  • a chimeric clotting factor of the invention is secreted in active form by a cell in which it is expressed.
  • an active chimeric clotting factor is made by expressing the heavy and light chain of a clotting factor as separate polypeptides.
  • the N-terminus of the heavy chain of the clotting factor is modified to comprise an intracellular processing site which delays the acti vation of the clotting factor during synthesis until later in the secretory pathway, (i.e. until protein colocafizes with active processing enzymes in the trans- Goigi network), leading to greater productivity.
  • intracellular processing sites include those recognized by furin.
  • cleavage sites for this family of enzymes include an amino acid sequence comprising the motif Arg-Xaa- Lys/Arg-Arg.
  • an active construct of the invention is made in the context of an Fc fusion protein, e.g., using an scFc linker (e.g., a cscfc linker ⁇ .
  • an scFc linker e.g., a cscfc linker ⁇ .
  • the invention pertains to processed (e.g., mature) polypeptides in which the at least one cleavage site adjacent to an scFc polypeptide linker has been cleaved such that the molecule is no longer a single polypeptide chain such that the polypeptide is comprised of at least two polypeptide chains (owing to cleavage at the enzymatic cleavage site(s) PI and/or P2).
  • such processed polypeptides comprise a clotting factor or portion thereof linked to the second Fc moiety (i.e., the second Fc moiety when counting from the amino terminus to the carboxy terminus prior to cleavage of the polypeptide linker) which has a free amino terminus after cleavage of the polypeptide linker.
  • a clotting factor attached to the N-terminus of the second Fc moiety is catalytically active, e.g., has enzymatic activity.
  • a clotting factor attached to the N-terminus of the second Fc moiety is secreted by a cell as a zymogen requiring further enzymatic processing of the clotting factor in order to be fully activated.
  • the invention pertains to clotting factors which are secreted from cells in active or activated form without the need for further activation during processing.
  • Factor VII is generally produced recombinantly as a zymogen and requires activation during manufacturing to produce the active form for administration.
  • a polypeptide of the invention is secreted from the cell in which it is expressed in active form to improve manufacturability.
  • such clotting factors can be produced by expressing the light chain of a clotting factor and the heavy chain of a clotting factor separately in the context of an scFc molecule comprising a cscFc linker. Activation of such a construct is delayed until late in the secretory pathway during processing, e.g., when the protein colocalizes with active processing enzymes in the trans-Golgi apparatus.
  • a clotting factor of the invention is a mature form of Factor VII or a variant thereof.
  • Factor VII FVII, F7: also referred to as Factor 7, coagulation factor VII, serum factor VII, serum prothrombin conversion accelerator, SPCA, proconvertin and eptacog alpha
  • FVII includes a G1a domain, two EGF domains (EGF-1 and EGF-2), and a serine protease domain (or peptidase SI domain) that is highly conserved among all members of the peptidase SI family of serine proteases, such as for example with chymotrypsin.
  • FVII occurs as a single chain zymogen, an activated, zymoge -like two- chain polypeptide and. a fully activated two-chain form.
  • zymogen-like protein or polypeptide refers to a protein that has been activated by proteolytic cleavage, but still exhibits properties that are associated, with a zymogen, such as, for example, low or no activity, or a conformation that resembles the conformation of the zymogen form of the protein.
  • the two-chain activated form of FVII when it is not bound to tissue factor, the two-chain activated form of FVII is a zymogen-like protein; it retains a conformation similar to the undeaved FVII zymogen, and, thus, exhibits very low activity.
  • the two-chain activated form of FVII Upon binding to tissue factor, the two-chain activated form of FVII undergoes conformational change and acquires its full activity as a coagulation factor.
  • Exemplary FVII variants include those with increased specific activity, e.g., mutations that increase the activity of FVII by increasing its enzymatic activity ( cat or Km). Such variants have been described in the art and include, e.g., mutant forms of the molecule as described for example in Persson et al. 2001. PNAS
  • a variant form of FVII includes the mutations Exemplar ⁇ ' mutations include V 158D-E296V-M298Q.
  • a variant form of FVII includes a replacement of amino acids 608-619 (LQQSRKVGDSPN, corresponding to the 170- loop) from the FVII mature sequence with amino acids EASYFGK from the 170-loop of trypsin.
  • High specific activity variants of FIX are also known in the art. Fir example, Simioni et al. (2009 N.E. Journal of Medicine 361 : 1671 ) describe an R338L mutation. Chang et al. (1988 JBC 273: 12089) and Pierri et al. (2009 Human Gene Therapy 20:479) describe an R338A mutation. Other mutations are known in the art and include those described, e.g., in Zogg and Brandstetter.
  • a clotting factor of the invention is a mature form of Factor VIII or a variant thereof.
  • FVIII functions in the intrinsic pathway of blood, coagulation as a cofactor to accelerate the activation of factor X by factor IXa, a reaction that occurs on a negatively charged phospholipid surface in the presence of calcium ions.
  • FVIII is synthesized as a 2351 amino acid single-chain polypeptide having the domain structure A 1 - A2-B-A3 -C 1 -C2. Wehar, G. A. et al, Nature 312:337-342 ( 1984) and Toole, J. J. et al, Nature 312:342-347 (1984).
  • FVIII The domain structure of FVIII is identical to that of the homologous coagulation factor, factor V (FV). Kane, W. H. et ah, PNAS (USA) 83:6800-6804 (1986) and Jenny, R, J. et al., PNAS (USA) 84:4846-4850 (1987).
  • the FVIII A-domains are 330 amino acids and have 40% amino acid identity with each other and to the A-domain of FV and the plasma copper-binding protein ceruloplasmin. Takahashi, N. et al, PNAS (USA) 81 :390-394 (1984).
  • Each C -domain is 150 amino acids and exhibits 40% identity to the C-domains of FV, and to proteins that bind glycoconjugates and negati vely charged phospholipids. Stubbs, J. D. et al., PNAS (USA) 87:8417-8421 (1990).
  • the FVIII B-domain is encoded by a single exon and exhibits little homology to any known protein including FV B-domain. Gitschier, J. et al., Nature 312:326-330 (1984) and Cripe, L. D. et al, Biochemistry 31 :3777-3785 (1992). [001 2] FViil is secreted into plasma as a heterodimer of a heavy chain
  • FVIII is stabilized by binding to von Wiliebrand factor. More specifically, the FVIII light chain is bound by noncovalent interactions to a primary binding site in the amino terminus of von Wiliebrand factor. Upon proteolytic activation by thrombin, FVIII is activated to a heterotrimer of 2 heavy chain fragments (A l, a 50 kDa fragment, and A2, a 43 kDa fragment) and the light chain (A3-C1-C2, a 73 kDa chain).
  • FVIIIa The active form of FVIII (FVIIIa) thus consists of an Al-subunit associated through the divalent metal ion linkage to a thrombin-cleaved A3-C1-C2 light chain and a free A2 subunit associated with the Al domain through an ion association.
  • FVIIIa The active form of FVIII (FVIIIa) thus consists of an Al-subunit associated through the divalent metal ion linkage to a thrombin-cleaved A3-C1-C2 light chain and a free A2 subunit associated with the Al domain through an ion association.
  • a clotting factor comprises a B-domain deleted version of factor VIII, "B-domain” of Factor VIII, as used herein, is the same as the B-domain known in the art that is defined by internal amino acid sequence identity and sites of proteolytic cleavage, e.g., residues Ser741 -Argl 648 of full-length human Factor VIII.
  • the other human Factor I domains are defined by the following amino acid residues: A l, residues Alal-Arg372; A2, residues Ser373-Arg740; A3, residues Serl690-Asn2019; CI, residues Lys2020-Asn2172: C2, residues Ser2173 - Tyr2332.
  • the A3-C1-C2 sequence includes residues Serl690-Tyr2332.
  • the remaining sequence, residues Glul649-Argl 689, is usually referred to as the a3 acidic region.
  • the locations of the boundaries for all of the domains, including the B- domains, for porcine, mouse and canine Factor VIII are also known in the art.
  • the B domain of Factor VIII is deleted ("B-domain-deleted factor VIII" or " HDD FVIII").
  • An example of a BDD FVIII is REFACTO ® (recombinant BDD FVIII with S743/Q1638 fusion), which is known in the art.
  • a "B-domain-deleted Factor VIII” may have the full or partial deletions disclosed in U.S. Pat. Nos. 6,316,226, 6,346,513, 7,041 ,635, 5,789,203, 6,060,447, 5,595,886, 6,228,620, 5,972,885, 6,048,720, 5,543,502, 5,610,278, 5, 171,844, 5, 112.950, 4,868, 112, and 6,458,563, each of which is incorporated herein by reference in its entirety.
  • a B-domain-deleted Factor VIII sequence of the present invention comprises any one of the deletions disclosed at col. 4, line 4 to col 5, line 28 and examples 1 -5 of U.S. Pat. No. 6,316,226 (also in US 6,346,513),
  • a B-domain deleted Factor VIII is the full or partial deletions disclosed in U.S. Pat. Nos. 6,316,226, 6,346,513, 7,041 ,635, 5,789,203, 6,060,447, 5,
  • S743/Q1638 B-domain deleted Factor VIII (SQ version Factor VIII) (e.g., Factor VIII having a deletion from amino acid 744 to amino acid 1637, e.g., Factor VIII having amino acids 1 -743 and amino acids 1638-2332 of SEQ ID NO: 6, i.e., SEQ ID NO: 2).
  • a B-domain-deleted Factor VIII of the present invention has a deletion disclosed at col 2, lines 26-51 and examples 5-8 of U.S. Patent No. 5,789,203 (also US 6,060,447, US 5,595,886, and US 6,228,620).
  • a B-domain-deleted Factor VIII has a deletion described in col.
  • a B-domain-deleted Factor VIII has a deletion of most of the B domain, but still contains amino-terminal sequences of the B domain that are essential for in vivo proteolytic processing of the primary translation product into two polypeptide chain, as disclosed in WO 91/09122, which is incorporated herein by reference in its entirety.
  • a B-domain-deleted Factor VIII is constructed with a deletion of amino acids 747-1638, i.e., virtually a complete deletion of the B domain. Hoeben R.C., et al. J.
  • a B-domain-deleted Factor VIII may also contain a deletion of amino acids 771-1666 or amino acids 868-1562 of Factor VIII. Meuiien P., et al. Protein Eng. 2(4): 301 -6 (1988), incorporated herein by reference in its entirety. Additional B domain deletions that are part of the invention include:
  • the invention pertains to a targeted version of FVIII, wherein the targeting (i) specifically binds to platelets, (ii) is not interposed between the light and heavy chains of the clotting factor, and wherein said chimeric clotting factor exhibits increased generation of thrombin in the presence of platelets as compared to an appropriate control lacking the at least one targeting moiety.
  • a clotting factor of the invention is a mature form of Factor IX or a variant thereof Factor IX circulates as a 415 amino acid, single chain plasma zymogen (A, Vysotchin et al., J. Biol. Chem. 268, 8436 (1993)).
  • the zymogen of FIX is activated by FXIa or by the tissue factor/FVIIa complex. Specific cleavages between arginine-alanine 145-146 and arginine-valine 180-181 result in a light chain and a heavy chain linked by a single disulfide bond between cysteine 132 and cysteine 289 (S.
  • FIX FIX-dependent blood clotting proteins
  • FVII vitamin K-dependent blood clotting proteins
  • FX and protein C B. Furie and B. Furie, supra.
  • the approximately 45 amino acids of the amino terminus comprise the gamma-carboxyglutamic acid, or gla, domain.
  • EGF epidermal growth factor homology domains
  • an activation peptide and the catalytic "heavy chain" which is a member of the serine protease family
  • A Vysotchin et al., J. Biol. Chem. 268, 8436 (1993); S. Spitzer et al, Biochemical Journal 265, 219 (1990); H, Brandstetter et al., Proc. Natl. Acad Sci. USA 92, 9796 (1995)).
  • a clotting factor of the invention is a mature form of Factor X.
  • Factor X is a vitamin-K dependent glycoprotein of a molecular weight of 58.5 kDa, which is secreted from liver cells into the plasma as a zymogen.
  • Initially factor X is produced as a prepropeptide with a signal peptide consisting in total of 488 amino acids.
  • the signal peptide is cleaved off by signal peptidase during export into the endoplasmatic reticulum, the propeptide sequence is cleaved off after gamma carboxylation took place at the first 1 1 glutamic acid residues at the N-terminus of the mature N-terminal chain.
  • a further processing step occurs by cleavage between Argl 82 and Serl 83.
  • This processing step also leads concomitantly to the deletion of the tripepti.de Argl80-Lysl81-Argl82.
  • the resulting secreted factor X zymogen consists of an N-terminal light chain of 139 amino acids (M, 16,200) and a C-terminal heavy chain of 306 amino acids (M, 42,000) which are covalentiy linked via a disulfide bridge between Cysl72 and Cys342.
  • Further posttranslational processing steps include the .beta, -hydroxy! ah on of Asp 103 as well as N- and O-type glycosylation.
  • the present invention may also employ precursor truncated forms thereof thai have activity, allelic variants and species variants, variants encoded by splice variants, and other variants, including polypeptides that have at least 40%, 45%, 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the mature form of the clottmg factor and which retain the ability to promote clot formation.
  • modified FVII polypeptides and variants thereof which retain at least one activity of a FVII, such as TF binding, factor X binding, phospholipid binding, and/or coagulant activity of a FVII may be employed.
  • the activity can be altered, such as reduced or increased, as compared to a wild-type clotting factor so long as the level of activity retained is sufficient to yield a detectable effect.
  • Exemplary sequences of clotting factors that can be used in the constructs of the invention are found in the accompanying sequence listing.
  • Exemplary modified polypeptides include, but are not limited to, tissue-specific isoforms and allelic variants thereof, synthetic molecules prepared by translation of nucleic acids, proteins generated by chemical synthesis, such as syntheses that include ligation of shorter polypeptides, through recombinant methods, proteins isolated from human and. non-human tissue and cells, chimeric polypeptides and modified forms thereof.
  • the instant clotting factors may also consist of fragments or portions of WT molecules that are of sufficient length or include appropriate regions to retain at least one activity (upon activation if needed) of a full-length mature polypeptide.
  • Exemplary clotting factor variants are known in the art.
  • Gla domain refers to the conserved membrane binding motif which is pesent In vitamin K-dependent proteins, such as as prothrombin, coagulation factors VII, IX and. X, proteins C, S, and Z. These proteins require vitamin K for the posttranslational synthesis of g-carboxyglutamic acid, an amino acid clustered in the N-terminal Gla domain of these proteins. All glutamic residues present in the domain are potential carboxylation sites and many of t em are therefore modified by carboxylation. In the presence of calcium ions, the Gla domain interacts with phospholipid membranes that include phosphatidylserine. The Gla domain also plays a role in binding to the FVIIa cofactor, tissue factor (TF).
  • TF tissue factor
  • the Gia domain of FVIIa is loaded with seven Ca2+ ions, projects three hydrophobic side chains in the direction of the cell membrane for interaction with phospholipids on the cell surface, and has significant contact with the C-terminal domain of TF.
  • Gla domain of factor VII comprises the uncommon amino acid _- carboxyglutamic acid (Gla), which plays a vital role in the binding of clotting factors to negatively charged phospholipid surfaces.
  • Ga uncommon amino acid _- carboxyglutamic acid
  • the GLA domain is responsible for the high-affinity binding of calcium ions. It starts at the N- terminal extremity of the mature form of proteins and ends with a conserved aromatic residue. A conserved. Gia-x(3)-Gla-x-Cys motif is found in the middle of the domain which seems to be important for substrate recognition by the carboxylase.
  • Gla domain has been found to be important in the sequence of events whereby the protease domain of FVIIa initiates contact with sTF (Biochemical and Biophysical Research Communications. 2005. 337: 1276).
  • clearance of clotting factors may be significantly mediated through Gla interactions, e.g., on liver cells and clearance receptors, e.g., EPCR.
  • targeted, clotting factors are modified to lack a Gla domain.
  • the Gla domain is responsible for mediating clearance of clotting factors via multiple pathways, such as binding to liver cells, clearance receptors such as EPCR. etc. Thus, eliminating the Gla domain has beneficial effects on half life of clotting factors.
  • Gla domain is also generally required for activity by localizing clotting factors to sites of coagulation, the inclusion of a platelet targeting domain moiety targets the Gla deleted, clotting factor to platelets.
  • a clotting factor of the invention comprises a targeting moiety and lacks a Gla domain.
  • the Gla domain is present at the amino terminus of the light chain and. consists of amino acids 1-35.
  • exemplary clotting factors are indicated in the accompanying sequence listing. This domain can be removed using standard molecular biology techniques, replaced with a targeting domain, and. the modified fight chain incorporated into a construct of the invention.
  • a cleavage site may be introduced into constructs lacking a Gla domain to facilitate activation of the molecule.
  • such a cleavage site may be introduced between the amino acids that are cleaved when the clotting factor is activated (e.g., between amino acids 152 and 153 in the case of Factor VII).
  • Exemplar ⁇ ' clotting factors lacking a Gla domain are shown in the accompanying figures
  • a cleavage site may be introduced into constructs lacking a Gla domain to facilitate activation of the molecule.
  • a cleavage site may be introduced between the amino acids that are cleaved when the clotting factor is activated (e.g., between amino acids 152 and 153 in the case of Factor VII).
  • Exemplary clotting factors lacking a Gla domain are shown in the accompanying figures,
  • Exemplary clotting factors are those of mammalian, e.g., human, origin. The sequences of exemplary clotting factors are presented in the
  • a clotting factor of the invention is targeted to platelets to enhance its efficacy by localizing the clotting factor to the site of coagulation using a "targeting moiety" which binds to a target molecule expressed on platelets.
  • a targeting moiety which binds to a target molecule expressed on platelets.
  • the targeted molecules are not expressed on cells or tissues other than platelets, i.e., the targeting moieties specifically bind to platelets.
  • receptors/conformations found on resting platelets are targeted. By doing so, sites for coagulation could be primed for enhanced efficacy. Targeting such molecule may also extend half life of the clotting factor and/or prevent clearance. Examples of such targets include Gplb of the Gplb/V/ ' IX complex, and GpVI and. nonactive form of GPIIb/IIIa.
  • receptors/conformations only found on activated platelets are targeted in order to localize the clotting factor to site of active coagulation.
  • targets include, e.g., the active form of GpIIb/IIIa as well as CD62P.
  • a polypeptide of the invention comprises a
  • targeting moiety which has affinity for and binds to platelets.
  • a targeting moiety binds to the GPIb complex, e.g. GPIb-alpha.
  • targeting moieties include the peptides PS4, 081 , and OS2 which bind to both active and nonactive platelets (Benard et al. 2008 Biochemistry
  • a targeting moiety binds to the active
  • a targeting moiety binds to both the active/nonacti e conformation of GPIIbllla.
  • An example of such a targeting moiety is the variable region of the AP3 antibody (Peterson et al. 2003. Hemostasis, Thrombosis, and Vascular Biology 101 :937; WO 2010115866).
  • the chimeric clotting factors of the invention can comprise one or more than one targeting moiety. Exemplary configurations are set forth in the accompanying Figures. Additionally, two or more targeting moieties may be linked to each other (e.g., via a spacer) in series, and the tandem array operably linked, to a construct of the in vention. When two or more targeting moieties are present in a chimeric clotting factor of the invention, the moieties may be the same or different.
  • a targeting moiety is fused to a chimeric clotting factor of the invention by a cleaveable linker which may be cleaved to remove the targeting moiety at the site of a clot.
  • a targeting moiety is not attached via a cleaveable linker and, therefore, is not cleaved at the site of a clot.
  • the targeting moiety is located on the N- or C- terminus of factor VIII.
  • a targeting moiety is located, on the C-terminus of FVII, FIX, FX, or the C-terminus of either or both chains of FVIIa, FIXa, of FXa.
  • the targeting moiety may be positioned at the N or C terminus of the second Fc chain, or the C-terminus of either or both Fc chains.
  • a targeting moiety is not genetically fused directly to a construct, but rather is finked via a spacer or a chemical bond, to the construct.
  • targeting moieties may be attached to a construct of the invention by formation of a bond between the targeting moiety and an Fc moiety of a construct, where the targeting moiety comprises a first functional group and the Fc moiety- comprises a second functional group, and where the first and second functional groups are capable of reacting with each other to form a chemical bond, (see, e.g., U.S. patent 7381408).
  • a polypeptide of the invention comprises at least one of an antigen binding site (e.g., an antigen binding site of an antibody, antibody variant, or antibody fragment), a polypeptide, a receptor binding portion of l igand, or a ligand binding portion of a receptor which specifically binds to platelets, e.g., resting or activated platelets.
  • an antigen binding site e.g., an antigen binding site of an antibody, antibody variant, or antibody fragment
  • a polypeptide e.g., a receptor binding portion of l igand, or a ligand binding portion of a receptor which specifically binds to platelets, e.g., resting or activated platelets.
  • exemplary targeting moieties include scFv molecules or peptides which bind to molecules to be targeted. Examples of targeting moieties are found in the instant examples and Figures. Other molecules useful as targeting moieties can readily be selected by one of skill in the art based upon the teaching herein.
  • a polypeptide of the invention comprises at least one antigen binding portion (e.g., binding site) of an antibody.
  • the antigen binding portion targets the polypeptide to platelets
  • a a polypeptide of the invention may comprise an antigen binding portion.
  • antigen-binding portion refers to a polypeptide fragment of an immunoglobulin, antibody, or antibody variant which binds antigen or competes with intact antibody (i.e., with the intact antibody from which they were derived) for antigen binding (i.e., specific binding ⁇ .
  • said antigen binding portions can be derived from any of the antibodies or antibody variants described supra.
  • Antigen binding portions can be produced by recombinant or biochemical methods that are well known in the art. Exemplary antigen-binding portions include Fv, Fab, Fab', and (Fab')?, as well as scFv molecules.
  • a chimeric dotting factor of the invention may comprise a binding site from single chain binding molecule (e.g., a single chain variable region or scFv).
  • single chain binding molecule e.g., a single chain variable region or scFv.
  • Techniques described for the production of single chain antibodies can be adapted to produce single chain binding molecules.
  • Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain antibody. Techniques for the assembly of functional Fv fragments in E coli may also be used (Skerra et a!., Science .242: 1038-104! (1988)).
  • a polypeptide of the invention comprises one or more binding sites or regions comprising or consisting of a single chain variable region sequence (scFv).
  • Single chain variable region sequences comprise a single polypeptide having one or more antigen binding sites, e.g., a VL domain linked by a flexible linker to a VH domain.
  • the VL and/or VH domains may be derived from any of the antibodies or antibody variants described supra.
  • ScFv molecules can be constructed in a Vn-lmker-VL orientation or VL-linker-Vn orientation.
  • the flexible linker that links the VL and V3 ⁇ 4 domains that make up the antigen binding site preferably comprises from about 10 to about 50 amino acid residues.
  • the polypeptide linker is a gly-ser polypeptide linker.
  • An exemplary gly/ser polypeptide linker is of the formula (Gly4Ser)n, wherein n is a positive integer (e.g., 1, 2. 3, 4, 5, or 6).
  • Other polypeptide linkers are known in the art.
  • Antibodies having single chain variable region sequences e.g. single chain Fv antibodies
  • methods of making said single chain antibodies are well-known in the art (see e.g., Ho et al. 1989. Gene 77:51; Bird et ai. 1988 Science 242:423; Pantoiiano et al 1991 , Biochemistry 30: 101 17; Milenic et al. 1991. Cancer Research 51:6363; Takkinen et al 1991. Protein Engineering 4:837).
  • a scFv molecule employed in a polypeptide of the invention is a stabilized scFv molecule.
  • the stabilized cFv molecule may comprise a scFv linker interposed between a VH domain and a VL domain, wherein the VH and VL domains are linked by a disulfide bond between an amino acid in the Vn and an amino acid in the VL domain.
  • the stabilized scFv molecule may comprise a scFv linker having an optimized length or composition.
  • the stabilized scFv molecule may comprise a VH or VL domain having at least one stabilizing amino acid substitution(s).
  • a stabilized scFv molecule may hav e at least two of the above listed stabilizing features.
  • Stabilized scFv molecules have improved protein stability or impart improved, protein stability to the polypeptide to which it is operably linked.
  • Preferred scFv linkers of the invention improve the thermal stability of a polypeptide of the invention by at least about 2°C or 3°C as compared to a conventional polypeptide Comparisons can be made, for example, between the scFv molecules of the invention.
  • the stabilized scFv molecule comprises a
  • Polypeptides of the invention may comprise a variable region or portion thereof (e.g. a VL and/or VH domain) derived, from an antibody using art recognized protocols.
  • the variable domain may be derived from antibody produced in a non-human mammal, e.g., murine, guinea pig, primate, rabbit or rat, by immunizing the mammal with the antigen or a fragment thereof. See Harlow & Lane, supra, incorporated by reference for all purposes.
  • the immunoglobulin may be generated by multiple subcutaneous or intraperitoneal injections of the relevant antigen (e.g., purified tumor associated antigens or cells or cellular extracts comprising such antigens) and an adjuvant.
  • variable region may be derived from polyclonal antibodies harvested from the serum of an immunized mammal, it is often desirable to isolate individual lymphocytes from the spleen, lymph nodes or peripheral blood to provide homogenous preparations of monoclonal antibodies (MAbs) from which the desired variable region is derived.
  • MAbs monoclonal antibodies
  • Rabbits or guinea pigs are typically used for making polyclonal antibodies.
  • Mice are typically used for making monoclonal antibodies.
  • Monoclonal antibodies can be prepared against a fragment by injecting an antigen fragment into a mouse, preparing "hybridomas" and.
  • hybridomas for an antibody that specifically binds to the antigen.
  • an immortal tumor cell line e.g. a myeloma cell line
  • hybrid cells or "hybridomas" which are both immortal and capable of producing the antibody genetically encoded, by the B cell.
  • the resulting hybrids are segregated into single genetic strains by selection, dilution, and regrowth with each individual strain comprising specific genes for the formation of a single antibody. They produce antibodies which are homogeneous against a desired, antigen and, in reference to their pure genetic parentage, are termed "monoclonal".
  • Hybridoma cells thus prepared are seeded and. grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells.
  • suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells.
  • reagents, cell lines and media for the formation, selection and growth of hybridomas are commercially available from a number of sources and standardized protocols are well established.
  • culture medium in which the hybridoma cells are growing is assayed for production of monoclonal antibodies against the desired antigen.
  • the binding specificity of the monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro assay, such as a radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (EL1SA).
  • RIA radioimmunoassay
  • EL1SA enzyme-linked immunosorbent assay
  • the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp 59- 103 (Academic Press, 1986) ⁇ .
  • the monoclonal antibodies secreted by the subclones may be separated from culture medium, ascites fluid or serum by conventional purification procedures such as. for example, affinity chromatography (e.g., proteiii-A, protein-G, or protein-L affinity chromatography), hydroxylapatite chromatography, gel electrophoresis, or dialysis.
  • affinity chromatography e.g.
  • antibodies may be screened for binding to platelets of a specific activation state or to a specific region or desired fragment of the antigen without binding to other nonoverlapping fragments of the antigen.
  • the latter screening can be accomplished by determining binding of an antibody to a collection of deletion mutants of the antigen and determining which deletion mutants bind to the antibody. Binding can be assessed, for example, by Western blot or ELISA. The smallest fragment to show specific binding to the antibody defines the epitope of the antibody.
  • epitope specificity can be determined by a competition assay- is which a test and reference antibody compete for binding to the antigen. If the test and reference antibodies compete, then they bind to the same epitope or epitopes sufficiently proximal such that binding of one antibody interferes with binding of the other.
  • DNA encoding the desired, monoclonal antibodyor binding site thereof may be readily isolated and sequenced using any of the conventional procedures described, supra for the isolation of constant region domain sequences (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
  • the isolated and. subcloned hybridoma cells serve as a preferred source of such DNA. More particularly, the isolated DNA (which may be synthetic as described herein) may be used to clone the desired variable region sequences for incorporation in the polypeptides of the invention.
  • the binding site is derived from a fully human antibody.
  • Human or substantially human antibodies may be generated in transgenic animals (e.g., mice) that are incapable of endogenous immunoglobulin production (see e.g., U.S. Pat. Nos. 6,075,181 , 5,939,598, 5,591,669 and 5,589,369, each of which is incorporated herein by reference).
  • transgenic animals e.g., mice
  • transgenic animals e.g., mice
  • transgenic animals e.g., mice
  • 6,075,181 , 5,939,598, 5,591,669 and 5,589,369 each of which is incorporated herein by reference.
  • it has been described that the homozygous deletion of the antibody heavy-chain joining region in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of a human immunoglobulin gene array to such germ line mutant mice will result in the production of human antibodies upon antigen challenge.
  • the polypeptides of the invention may comprise antigen binding sites, or portions thereof, derived, from modified forms of antibodies.
  • modified forms include, e.g., minibodies, diabodies, triabodies, nanobodies, camelids, Dabs, tetravalent antibodies, intradiabodies (e.g., Jendreyko et al. 2003. J. Biol. Chem. 278:47813), fusion proteins (e.g., antibody cytokine fusion proteins, proteins fused to at least a portion of an Fc receptor), and bispecific antibodies.
  • Other modified antibodies are described, for example in U.S. Pat. No. 4,745,055; EP
  • a chimeric clotting factor of the invention comprises an antigen binding site or region which is a diabody or an antigen binding site derived therefrom.
  • Diabodies are dimeric, tetravalent molecules each having a polypeptide similar to scFv molecules, but usually having a short (e.g., less than 10 and preferably 1-5) amino acid residue linker connecting both variable domains, such that the VL and VH domains on the same polypeptide chain cannot interact.
  • a polypeptide of the invention comprises a diabody which is operably linked to the N-terminus and/or C-terminus of at least one genetically-fused Fc region (i.e., scFc region).
  • a polypeptide of the in vention comprises a single domain binding molecule (e.g. a single domain antibody) as a targeting moiety.
  • exemplary single domain molecules mclude an isolated heavy chain variable domain (VH) of an antibody, i.e., a heavy chain variable domain, without a light chain variable domain, and an isolated light chain variable domain (VL) of an antibody, i.e., a light chain variable domain, without a heavy chain variable domain,.
  • Exemplary single- domain antibodies employed in the binding molecules of the invention include, for example, the Camelid heavy chain variable domain (about 1 18 to 136 amino acid residues) as described in Hamers-Casterman, et al, Nature 363:446-448 (1993), and Dumoulin, et al., Protein Science 11 :500-515 (2002).
  • Other exemplary single domain antibodies include single VH or VL domains, also known as Dabs® (Domantis Ltd.. Cambridge, UK).
  • Yet other single domain antibodies include shark antibodies (e.g., shark Ig-NARs).
  • V- NARs comprise a homodimer of one variable domain (V- NAR) and five C-like constant domains (C-NAR), wherein diversity is concentrated in an elongated CDR3 region varying from 5 to 23 residues in length.
  • C-NAR C-like constant domains
  • VHH the heavy chain variable region
  • VHH variable regions The main differences between camelid VHH variable regions and those derived from conventional antibodies (VH) include (a) more hydrophobic amino acids in the light chain contact surface of VH as compared to the corresponding region in VHH, (b) a longer CDR3 in VHH, and (c) the frequent occurrence of a disulfide bo d between CDR1 and CDR3 in VHH.
  • Methods for making single domain binding molecules are described in US Patent Nos 6.005,079 and 6,765,087, both of which are incorporated herein by reference.
  • Exemplary single domain antibodies comprising VHH domains include Nanobodies ⁇ (Abiynx NV, Ghent, Belgium),
  • Exemplary antibodies from which binding sites can be derived for use in the binding molecules of the invention are known in the art.
  • Examples of such targeting moieties inlcude SCE5 and MB 9 variable regions which bind active platelets only (Schwarz et al. 2004 FASEB Journal express article 10.1096/fj.04-
  • a targeting moiety binds to both the active/nonactive conformation of GPHbllla.
  • An example of such a targeting moiety is the variable region of the AP3 antibody (Peterson et al, 2003. Hemostasis, Thrombosis, and Vascular Biology 101 :937; WO 2010115866).
  • the polypeptides of the invention comprise one or more platelet binding sites derived from a non-- immunoglobulin binding molecule.
  • non-immunoglobulin binding- molecules are binding molecules whose binding sites comprise a portion (e.g., a scaffold or framework) which is derived from a polypeptide other than an
  • binding molecules comprising binding sites not derived, from antibody molecules include receptor binding sites and ligand. binding sites which bind to platelets,
  • Non-immunoglobulin binding molecules may be identified by selection or isolation of a target-binding variant from a library of binding molecules having artificially diversified binding sites. Diversified libraries can be generated. using completely random approaches (e.g., error-prone PGR, exon shuffling, or directed evolution) or aided by art-recognized design strategies. For example, amino acid positions that are usually involved, when the binding site interacts with its cognate target molecule can be randomized, by insertion of degenerate codons, trinucleotides, random peptides, or entire loops at corresponding positions within the nucleic acid which encodes the binding site (see e.g., U.S. Pub. No. 20040132028).
  • the location of the amino acid positions can be identified by investigation of the crystal structure of the binding site in complex with the target molecule.
  • Candidate positions for randomization include loops, flat surfaces, helices, and binding cavities of the binding site.
  • amino acids within the binding site that are likely candidates for diversification can be identified using techniques known in the art.
  • the diversified library may then be subjected to a selection or screening procedure to obtain binding molecules with the desired binding characteristics, e.g. specific binding platelets using methods known in the art.
  • Selection can be achieved by art-recognized methods such as phage display, yeast display, or ribosome display.
  • molecules known in the art to bind to platelets may be employed in the constructs of the invention.
  • peptides which bind to GPIba as described in the art e.g., PS4, 0S1 , or 0S2 may be used (Benard et al. 2008. Biochemistry 47:4674-4682).
  • Clotting factors given for bypass therapy are efficacious when given in the activated form, since exogenous clotting factors are often not activated with sufficient kinetics to be effective. However, they are also rapidly inactivated by endogenous pathways (e.g., by anti hrombin III or TFPI), leading to clearance of the active form and a short effective half life.
  • a chimeric clotting factor of the invention is "activatable.” Such activatable constructs circulate as an enhanced zymogen with a longer half life, but can be readily cleaved at the site of clotting when necessary.
  • an activatable construct of the invention comprises a cieavable linker comprising, e.g., a factor XIa, Xa, or thrombin cleavage site (which is cleaved by factor XIa, Xa, or thrombin, respectively) leading to formation of the active form of the clotting factor at the site of a clot.
  • a factor FXIa cleavage sites include, e.g., TQSFNDFTR and SVSQTSKLTR.
  • Exemplar ⁇ ' thrombin cleavage sites include, e.g., DFLAEGGGVR, TTKI PR, and a sequence comprising or consisting of ALRPR (e.g. ALRPRWGGA)).
  • the cieavable linker may be flanked on one or more sides (upstream, downstream or both) by a spacer moiety.
  • the cieavable linker is interposed between the light chain and heavy chain of the clotting factor. In another embodiment, the cieavable linker is not interposed between the light chain and heavy chain of the clotting factor. In one embodiment, the cieavable linker is located amino terminal to the heavy chain. [00237] Exemplary activatable constructs are shown in the accompanying
  • Some embodiments of the invention comprise a scaffold moiety, which can be selected from, e.g., a protein moiety, cscFc region, a Fc moiety, albumin, XTEN, etc.
  • the scaffold is a protein moiety.
  • a moiety may comprise a complete protein or a portion therof, or a synthetic molecule.
  • Preferred protein moieties are of a sufficient molecular size that they improve the half life of a chimeric clotting factor of the invention when incorporated into a construct.
  • an artificial protein, XTEN may be included in a construct as a scaffold (Schellenberger et al. 2009. 27: 1 1 86).
  • XTEN an artificial protein, XTEN
  • albumin e.g., human serum albumin
  • serum albumin for example, HSA
  • HSA serum albumin
  • various domains and sub-domains of HSA have a structure thai is quite amenable to mutation or randomization for the generation of serum albumin scaffold-based protein l ibraries.
  • albumin e.g., fragments thereof, that may be used in the present invention are known, e.g., U.S. Patent No. 7,592,010; U.S. Patent No. 6,686,179; and Schulte, Thrombosis Res. 124 Suppl. 2;S6-S8 (2009), each of which is incorporated herein by reference in its entirety.
  • the invention provides for polypeptides comprising at least one genetically fused Fc region or portion thereof within a single polypeptide chain (i.e., polypeptides comprising a single-chain Fc (scFc) region) in one embodiment, comprising a cscFc.
  • polypeptides comprising at least one genetically fused Fc region or portion thereof within a single polypeptide chain (i.e., polypeptides comprising a single-chain Fc (scFc) region) in one embodiment, comprising a cscFc.
  • a chimeric clotting factor which comprises a clotting factor selected from the group consisting of FVII, FIX and FX and a targeting moiety which binds to platelets and optionally a spacer moiety between the clotting factor and the targeting moiety.
  • polypeptide comprising FVII which FVII comprises a heterologous enzymatic cleavage site activatable by a component of the clotting cascade.
  • the invention provides unprocessed, polypeptides in which at least two Fc moieties or domains (e.g., 2, 3, 4, 5, 6, or more Fc moieties or domains) within the same linear polypeptide chain that are capable of folding (e.g., intramolecularly or intermolecularly folding) to form one functional scFc region which is linked by an Fc polypeptide linker.
  • a polypeptide of the invention is capable of binding, via its scFc region, to at least one Fc receptor (e.g. an FcRn, an FcyR receptor (e.g., FeyRlil), or a complement protein (e.g. Cl q)) in order to improve half life or trigger an immune effector function (e.g., antibody-dependent cytotoxicity (ADCC), phagocytosis, or complement-dependent cytotoxicity (CDCC) and/or to improve manufacturability).
  • ADCC antibody-dependent cytotoxicity
  • phagocytosis
  • polypeptides of alternative designs are within the scope of the invention.
  • a polypeptide comprises the moieties:
  • Formula (I) comprises at least an A or B and optionally both.
  • a and B if both present, can be the corresponding heavy and light chains of a clotting factor.
  • Formula (I) comprises at least a PI or P2 and optionally both.
  • P I and P2, if both present, can be the same or different.
  • Formula (I) comprises at least a Fl and F2.
  • F l and F2, if both present, can be the same or different.
  • Exemplary polypeptides according to formula 1 include: A-F1-P1- L-
  • Fl and F2 each comprise a CH2 and CH3 moiety.
  • a polypeptide of the invention comprises two polypeptide chains where the first polypeptide chain comprises A linked to a first Fc moiety and where the second, polypeptide chain comprises B linked to a second Fc moiety, where Fl and F2 dimerize to form an Fc region.
  • a and B are optionally present and are clotting factors or portions thereof.
  • A is the light chain of a clotting factor and B is the heavy chain of a clotting factor.
  • B is the light chain of a clotting factor and A is the heavy chain of a clotting factor.
  • the polypeptide when A and B associate in the polypeptide, the polypeptide then forms a functional clotting factor, e.g., FVII, FIX or FX. .
  • a functional clotting factor e.g., FVII, FIX or FX.
  • such a polypeptide is enzymatically active upon secretion from a cell.
  • Fc moieties useful as Fl and F2 for producing the polypeptides of the present invention may be obtained from a number of different sources.
  • an Fc moiety of the polypeptide is derived from a human
  • the Fc moiety may be derived from an immunoglobulin of another mammalian species, including for example, a rodent (e.g. a mouse, rat, rabbit, guinea pig) or non-human primate (e.g. chimpanzee, macaque) species.
  • the polypeptide Fc domain or portion thereof may be derived from any immunoglobulin class, including gM, IgG, IgD, IgA and IgE, and any mmunoglobulin isotype, including IgGl, IgG2, IgG3 and IgG4, In a preferred embodiment, the human isotype IgGl is used.
  • Fc moiety gene sequences e.g. human constant region gene sequences
  • Constant region domains comprising an Fc moiety sequence can be selected having a particular effector function (or lacking a particular effector function) or with a particular modification to reduce immunogenicity.
  • Many sequences of antibodies and antibody- encoding genes have been published and suitable Fc moiety sequences (e.g. hinge, CH2, and/or CH3 sequences, or portions thereof) can be derived from these sequences using art recognized techniques.
  • the genetic material obtained using any of the foregoing methods may then be altered or synthesized to obtain polypeptides of the present invention. It will further be appreciated that the scope of this invention encompasses alleles, variants and mutations of constant region DMA sequences.
  • Fc moiety sequences can be cloned, e.g., using the polymerase chain reaction and primers which are selected to amplify the domain of interest.
  • mRNA can be isolated from hybridoma, spleen, or lymph cells, reverse transcribed into DNA, and antibody genes amplified by PGR.
  • PCR amplification methods are described in detail in U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800, 159; 4,965, 188; and in, e.g., "PGR Protocols: A Guide to Methods and Applications" Xtmis ei al.
  • PGR may be initiated by consensus constant region primers or by more specific primers based on the published heavy and light chain DNA and amino acid sequences. As discussed above, PGR also may be used to isolate DNA clones encoding the antibody light and heavy chains. In this case the libraries may be screened by consensus primers or larger homologous probes, such as mouse constant region probes.
  • primer sets suitable for amplification of antibody genes are known in the art (e.g., 5 ' primers based on the N -terminal sequence of purified antibodies (Benhar and. Pastan. 1994. Protein Engineering 7: 1509); rapid, amplification of cDNA ends (Ruberti, F. et al. 1994. J. Immunol. Methods 173:33); antibody leader sequences (Larrick et al. 1989 Biochem. Biophys. Res. Commun. 160: 1250). The cloning of antibody sequences is further described in Newman et al, U.S. Pat. No. 5,658,570, filed. January 25, 1995, which is incorporated by reference herein.
  • the polypeptides of the invention may comprise two or more Fc moieties ⁇ e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more Fc moieties). These two or more Fc moieties can form a Fc region. In one embodiment, the Fc moieties may be of different types. In one embodiment, at least one Fc moiety present in the polypeptide comprises a hinge domain or portion thereof. In another embodiment, the polypeptide of the invention comprises at feast one Fc moiety which comprises at least one CH2 domain or portion thereof. In another embodiment, the polypeptide of the invention comprises at least one Fc moiety which comprises at least one CH3 domain or portion thereof.
  • the polypeptide of the invention comprises at least one Fc moiety which comprises at least one CH4 domain or portion thereof. In another embodiment, the polypeptide of the invention comprises at least one Fc moiety which comprises at least one hinge domain or portion thereof and. at least one CFG domain or portion thereof (e.g, in the hinge-CH2 orientation). In another embodiment, the polypeptide of the invention comprises at least one Fc moiety which comprises at least one CH2 domain or portion thereof and at least one CH3 domain or portion thereof (e.g, in the CH2-CH3 orientation). In another embodiment, the polypeptide of the invention comprises at least one Fc moiety comprising at least one hinge domain or portion thereof, at least one CH2 domain or portion thereof, and. least one CH3 domain or portion thereof, for example in the orientation hinge-CH2-CH3, hinge-CH3-CH2, or CH2-CH3-hinge.
  • the polypeptide comprises at least one complete Fc region derived, from one or more immunoglobulin heavy chains (e.g. , an Fc domain including hinge, CH2, and CH3 domains, although these need not be derived from the same antibody).
  • the polypeptide comprises at least two complete Fc regions derived from one or more immunoglobulin heavy chains.
  • the complete Fc moiety is derived from a human IgG immunoglobulin heavy chain (e.g., human IgGl ).
  • a polypeptide of the invention comprises at least one Fc moiety comprising a complete CH3 domain (about amino acids 341-438 of an antibody Fc region according to EU numbering). In another embodiment, a polypeptide of the invention comprises at least one Fc moiety comprising a complete CH2 domain (about amino acids 231-340 of an antibody Fc region according to EU numbering). In another embodiment, a polypeptide of the invention comprises at least one Fc moiety comprising at least a CH3 domain, and at least one of a hinge region (about amino acids 216-230 of an antibody Fc region according to EU numbering), and. a CH2 domain.
  • a polypeptid e of the invention comprises at least one Fc moiety comprising a hinge and a CH3 domain.
  • a polypeptide of the invention comprises at least one Fc moiety comprising a hinge, a CH 2 , and a CH 3 domain.
  • the Fc moiety is derived from a human IgG immunoglobulin heavy chain (e.g., human IgGl).
  • an Fc moiety comprises or consists of amino acids corresponding to EU numbers 221 to 447.
  • a polypeptide of the invention comprises at least one Fc moiety comprising an FcRn binding partner.
  • An FcRn binding partner is a molecule or portion thereof that can be speci ically bound by the FcRn receptor with consequent active transport by the FcRn receptor of the FcRn binding partner.
  • Specifically bound refers to two molecules forming a complex that is relatively stable under physiologic conditions. Specific binding is characterized by a high affinity and a low to moderate capacity as distinguished from nonspecific binding which usually has a low affinity with a moderate to high capacity. Typically, binding is considered specific when the affinity constant KA is higher than 10" M " ! . or more preferably higher than 10 s M "1 . If necessary, non-specific binding can be reduced without substantially affecting specific binding by varying the binding conditions.
  • the appropriate binding conditions such as concentration of the molecules, ionic strength of the solution, temperature, time allowed for binding, concentration of a blocking agent (e.g. serum albumin, milk casein), etc., may be optimized by a skilled artisan using routine techniques.
  • the FcRn receptor has been isolated from several mammalian species including humans. The sequences of the human FcRn, monkey FcR rat FcRn, and mouse FcRn are known (Story et ai. 1994, J. Exp. Med. 180:2377).
  • the FcRn receptor binds IgG (but not other immunoglobulin classes such as IgA, IgM, IgD, and IgE) at relatively low H, actively transports the IgG transcellulariy in a luminal to serosal direction, and then releases the IgG at relatively higher pH found in the interstitial fluids. It is expressed in adult epithelial tissue (U.S. Pat. Nos.
  • FcRn binding partners of the present invention encompass molecules that can be specifically bound by the FcRn receptor including whole IgG, the Fc fragment of IgG, and other fragments that include the complete binding region of the FcRn receptor.
  • the region of the Fc portion of IgG that binds to the FcRn receptor has been described based, on X-ray crystallography (Burmeister et al. 1994, Nature
  • the major contact area of the Fc with the FcRn is near the junction of the CH2 and CH3 domains. Fc-FcRn contacts are all within a single Ig heavy chain.
  • the FcRn binding partners include whole IgG, the Fc fragment of IgG, and. other fragments of IgG that include the complete binding region of FcRn.
  • the major contact sites include amino acid residues 248, 250-257, 272, 285, 288, 290-291, 308-311 , and 314 of the CH2 domain and amino acid, residues 385-387, 428, and. 433-436 of the CH3 domain.
  • the Fc region of IgG can be modified according to well recognized procedures such as site directed, mutagenesis and the like to yield modified IgG or Fc fragments or portions thereof that will be bound by FcRn.
  • modifications include modifications remote from the FcRn contact sites as well as modifications within the contact sites that preserve or even enhance binding to the FcRn,
  • the following single amino acid residues in human IgGl Fc (Fc ⁇ ) can be substituted without significant loss of Fc binding affinity for FcRn: P238A, S239A, K246A, K248A, D249A, M252A, T256A, E258A, T260A, D265A, S267.A, H268A, E269A, D270A, E272A, L274A, N276A, Y278A, D280A, V282A, E283A, H285A, N286A, T289A, K290A, R
  • one specific embodiment incorporates the N297A mutation, removing a highly conserved N-glycosylation site.
  • N297A may be used to modif Fc, regardless of the biologically active molecule (e.g., EPO, IFN, Factor VII, Factor IX, T20).
  • FcRn binding partner For example, one embodiment incorporates N297A, removing a highly conserved N-glycosylation site. The effect of this mutation is to reduce immunogenicity, thereby enhancing circulating half life of the FcRn binding partner, and to render the FcRn binding partner incapable of binding to FcyRI, FeyRILA, FcyRIIB, and FcyRIIIA, without compromising affinity for FcRn (Routledge et al 1995, Transplantation 60:847: Friend et al 1999, Transplantation 68: 1632: Shields et al. 1995, J, Biol. Chem. 276:6591).
  • affmity for FcRn may be increased beyond that of wild type in some instances.
  • This increased affinity may reflect an increased "on” rate, a decreased “off rate or both an increased “on” rate and a decreased “off” rate.
  • Mutations believed to impart an increased affinity for FcRn include T256A, T307A, E380A, and N434A (Shields et ah 2001, J. Biol. Chem. 276:6591).
  • At least three human Fc gamma receptors appear to recognize a binding site on IgG within the lower hinge region, generally amino acids 234-237. Therefore, another example of new functionality and potential decreased immunogenicity may arise from mutations of this region, as for example by replacing amino acids 233 -236 of human IgGl "ELLG” to the corresponding sequence from IgG2 "PVA" (with one amino acid deletion). It has been shown that FeyRI, FcyRIL and FcyRIII, which mediate various effector functions will not bind to IgGl when such mutations have been introduced. Ward and Ghetie 1995, Therapeutic
  • the FcRn binding partner is a polypeptide including the sequence PK SSMIS TP (SEQ ID NO: 12) and optionally further including a sequence selected from HQSLGTQ (SEQ ID NO: 13), HQNLSDGK (SEQ ID NO: 14), HQNISDCK (SEQ ID NO: 24), or VISSHLGQ (SEQ ID NO: 25) (U.S. Pat. No. 5,739,277).
  • FcRn receptors can bind a single Fc molecule. Crystailographic data suggest that each FcRn molecule binds a single polypeptide of the Fc
  • linking the FcRn binding partner, e.g., an Fc fragment of an IgG, to a biologically active molecule provides a means of deli vering the biologically active molecule orally, buccally, sublmgually, rectaily, vaginally, as an aerosol administered nasally or via a pulmonary route, or via an ocular route.
  • the chimeric protein can be administered invasively, e.g., subcutaneously, intravenously.
  • the constant region domains or portions thereof making up an Fc moiety of a polypeptide of the invention may be derived from different
  • a polypeptide of the invention may comprise a CH2 domain or portion thereof derived from an IgG l molecule and a CH3 region or portion thereof derived from an IgG3 molecule.
  • a polypeptide can comprise an Fc moiety comprising a hinge domain derived, in part, from an IgGl molecule and, in part, from an IgG3 molecule.
  • an Fc moiety may be altered such that it varies in amino acid sequence from a naturally occurring antibody molecule.
  • a polypeptide of the invention comprises an scFc region comprising one or more truncated Fc moieties that are nonetheless sufficient to confer Fc receptor (Fc ) binding properties to the Fc region.
  • the portion of an Fc domain that binds to FcRn comprises from about amino acids 282-438 of IgGl, EU numbering (with the primary contact sites being amino acids 248, 250-257, 272, 285, 288, 290-291, SOS- S I 1, and 314 of the CH2 domain and amino acid residues 385-387, 428, and 433-436 of the CH3 domain.
  • an Fc moiety of a polypeptide of the invention may comprise or consist of an FcRn binding portion.
  • FcRn binding portions may be derived from heavy chains of any isotype, including IgGl, IgG2, IgG3 and IgG4.
  • an FcRn binding portion from an antibody of the human isotype IgGl is used.
  • an FcRn binding portion from an antibody of the human isotype IgG4 is used.
  • a polypeptide of the invention lacks one or more constant region domains of a complete Fc region, i.e., they are partially or entirely deleted.
  • polypeptides of the invention will lack an entire CH2 domain (ACH2 constructs). Those skilled, in the art will appreciate that such constructs may be preferred due to the regulatory properties of the CH2 domain on the catabolic rate of the antibody.
  • polypeptides of the invention comprise CH2 domain-deleted Fc regions derived from a vector (e.g., from IDEC Pharmaceuticals, San Diego) encoding an IgGi human constant region domain (see, e.g., WO 02/060955A2 and WG02/096948A2),
  • This exemplary vector is engineered, to delete the CH2 domain and provide a synthetic vector expressing a domain-deleted. IgG; constant region.
  • these exemplary constructs are preferably engineered to fuse a binding CH3 domain directly to a hinge region of the respective Fc domain.
  • a spacer moiety may be placed between a hinge region and a CH2 domain and/or between a CH2 and a CH3 domams.
  • compatible constructs could be expressed wherein the CH2 domain has been deleted and the remaining CH3 domain (synthetic or unsynthetic) is joined to the hinge region with a 5 - 20 amino acid spacer moiety.
  • Such a spacer moiety may be added, for instance, to ensure that the regulatory elements of the constant region domain remain free and accessible or that the hinge region remains flexible.
  • any linker peptide compatible with the instant invention will be relatively non-immunogenic and not prevent proper folding of the scFc region.
  • the polypeptides of the invention may- comprise a dimeric Fc region comprising Fc moieties of the same, or substantially the same, sequence composition (herein termed a "homodimeric Fc region").
  • the polypeptides of the invention may comprise a dimeric Fc region comprising at least two Fc moieties which are of different sequence composition (i.e., herein termed a "heterodimeric Fc region").
  • the heterodimeric Fc region comprises an amino acid substitution in a first Fc moiety (e.g., an amino acid substitution of Asparagine at EU position 297 ⁇ , but not in a second Fc moiety.
  • the Fc region is hemi-giycosylated.
  • the heteromeric scFc region may comprise a first, glycosylated. Fc moiety (e.g., a glycosylated CH2 region) and a second, aglycosylated, Fc moiety (e.g., an aglycosylated CH2 region), wherein a linker is interposed between the glycosylated and aglycosylated Fc moieties.
  • the Fc region is fully glycosylated, i.e., all of the Fc moieties are gly cosylated.
  • the Fc region may be aglycosylated, i.e., none of the Fc moieties are glycosylated.
  • an Fc moiety employed in a polypeptide of the invention is altered, e.g., by amino acid mutation (e.g., addition, deletion, or substitution).
  • an Fc moiety has at least one amino acid substitution as compared to the wild-type Fc from which the Fc moiety is derived.
  • a variant comprises at least one amino acid mutation (e.g., substitution) as compared to a wild type amino acid at the corresponding position of the human IgG l Fc region.
  • the amino acid substitution(s) of an Fc variant may be located at a position within the Fc moiety referred to as corresponding to the position number that that residue would be given in an Fc region in an antibody (as set forth using the EU numbering convention).
  • corresponding to the position number that that residue would be given in an Fc region in an antibody as set forth using the EU numbering convention.
  • One of skill in the art can readily generate alignments to determine what the EU number corresponding to a position in an Fc moiety would be.
  • the Fc variant comprises a substitution at an amino acid position located in a hinge domain or portion thereof. In another embodiment, the Fc variant comprises a substitution at an amino acid position located in a CH2 domain or portion thereof. In another embodiment, the Fc variant comprises a substitution at an amino acid position located in a CH3 domain or portion thereof. In another embodiment, the Fc variant comprises a substitution at an amino acid position located in a CH4 domain or portion thereof.
  • polypeptides of the invention comprise an amino acid sequence
  • the polypeptides of the invention may comprise, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid substitutions.
  • the amino acid substitutions are spatially positioned from each other by an interval of at least 1 amino acid position or more, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid positions or more.
  • the engineered amino acids are spatially positioned, apart from each other by an interval of at least 5, 10, 15, 20, or 25 amino acid positions or more.
  • the Fc variant confers a change in at least one effector function imparted by an Fc region comprising said wild-type Fc domain (e.g., an improvement or reduction in the ability of the Fc region to bind to Fc receptors (e.g. FcyRI, FcyRII, or FcyRIII) or complement proteins (e.g. Clq), or to trigger antibody-dependent cytotoxicity (ADCC), phagocytosis, or complement-dependent cvtotoxicit ⁇ ' (CDCC)).
  • Fc receptors e.g. FcyRI, FcyRII, or FcyRIII
  • complement proteins e.g. Clq
  • ADCC antibody-dependent cytotoxicity
  • phagocytosis phagocytosis
  • CDC complement-dependent cvtotoxicit ⁇ '
  • the Fc variant provides an engineered cysteine residue
  • the polypeptides of the invention may employ art-recognized Fc variants which is known to impart a change (e.g., an enhancement or reduction) in effector function and/or FcR or FcRn binding.
  • a binding molecule of the invention may include, for example, a change (e.g., a substitution) at one or more of the amino acid positions disclosed in International PCX Publications WO88/07089A1 , W096/14339A1, WO98/05787A1, W098/23289A1 , W099/51642A1 ,
  • the specific change (e.g., the specific substitution of one or more amino acids disclosed, in the art) may be made at one or more of the disclosed amino acid positions, in another embodiment, a different change at one or more of the disclosed amino acid positions (e.g., the different substitution of one or more amino acid position disclosed in the art) may be made.
  • a polypeptide of the invention comprises an amino acid substitution to an Fc moiety which alters the antigen-independent effector functions of the antibody, in particular the circulating half-life of the antibody.
  • polypeptides exhibit either increased or decreased binding to
  • FcRn when compared to polypeptides lacking these substitutions and, therefore, have an increased or decreased half-life in serum, respectively.
  • Fc variants with improved affinity for FcRn are anticipated to have longer serum half-lives, and such molecules have useful applications in methods of treating mammals where long half-life of the administered polypeptide is desired, e.g., to treat a chronic disease or disorder (see,e.g, US Patents 7,348,004, 7,404,956, and 7,862,820).
  • Fc variants with decreased FcRn binding affinity are expected, to have shorter half-lives, and such molecules are also useful, for example, for administration to a mammal where a shortened, circulation time may be advantageous, e.g.
  • the polypeptides of the invention exhibit reduced transport across the epithelium of kidney glomeruli from the vasculature. In another embodiment, the polypeptides of the invention exhibit reduced transport across the blood brain barrier (BBB) from the brain, into the vascular space.
  • BBB blood brain barrier
  • a polypeptide with altered FcRn binding comprises at least one Fc moiety (e.g, one or two Fc moieties) having one or more amino acid substitutions within the "FcRn binding loop' " of an Fc moiety.
  • the FcRn binding loop is comprised of amino acid residues 280-299 (according to EU numbering) of a wild-type, full-length, Fc moiety.
  • a polypeptide of the invention having altered FcRn binding affinity comprises at least one Fc moiety (e.g, one or two Fc moieties) having one or more amino acid substitutions within the 15 A FcRn "contact zone.”
  • the temi 15 A FcRn "contact zone” includes residues at the following positions of a wild- type, full-length Fc moiety: 243-261, 275-280, 282-293, 302-319, 336- 348, 367, 369, 372-389, 391 , 393, 408, 424, 425-440 (EU numbering).
  • a polypeptide of the invention having altered FcRn binding affinity comprises at least one Fc moiety' (e.g, one or two Fc moieties) having one or more amino acid substitutions at an amino acid position corresponding to any one of the following EU positions: 256, 277-281, 283-288, 303-309, 313, 338, 342, 376, 381, 384, 385, 387, 434 (e.g., N434A or N434K), and 438.
  • Exemplary amino acid substitutions which altered FcRn binding activity are disclosed in international PCX Publication No. WO05/047327 which is incorporated by reference herein.
  • a polypeptide of the invention may also comprise an art recognized, amino acid, substitution which alters the glycosylation of the polypeptide.
  • the scFc region of the binding polypeptide may comprise an Fc moiety having a mutation leading to reduced, glycosylation (e.g., N- or O-linked
  • glycosylation or may comprise an altered glycoform of the wild-type Fc moiety (e.g., a low fucose or fucose-free glycan).
  • a polypeptide of the invention comprises at least one Fc moiety having engineered cysteine residue or analog thereof which is located, at the solvent-exposed, surface.
  • the engineered cysteine residue or analog thereof does not interfere with an effector function conferred by the scFc region. More preferably, the alteration does not interfere with the ability of the scFc region to bind to Fc receptors (e.g. FcyRI, FcyRII, or FcyRIII) or complement proteins (e.g. Clq), or to trigger immune effector function (e.g., antibody-dependent cytotoxicity (ADCC), phagocytosis, or complement-dependent cytotoxicity (CDCC)).
  • Fc receptors e.g. FcyRI, FcyRII, or FcyRIII
  • complement proteins e.g. Clq
  • an unprocessed polypeptide of the invention may comprise a genetically fused Fc region (i.e., scFc region) having two or more of its constituent Fc moieties independently selected from the Fc moieties described herein.
  • the Fc moieties of a dimeric Fc region are the same. In another embodiment, at least two of the Fc moieties are different.
  • the Fc moieties of the polypeptides of the invention comprise the same number of amino acid residues or they may differ in length by one or more amino acid residues (e.g., by about 5 amino acid residues (e.g., I, 2, 3, 4, or 5 amino acid residues), about 10 residues, about 15 residues, about 20 residues, about 30 residues, about 40 residues, or about 50 residues).
  • the Fc moieties of the polypeptides of the invention may differ in sequence at one or more amino acid positions.
  • at least two of the Fc moieties may differ at about 5 amino acid positions (e.g., 1, 2, 3, 4, or 5 amino acid positions), about 10 positions, about 15 positions, about 20 positions, about 30 positions, about 40 positions, or about 50 positions).
  • polypeptide l inkers refers to a peptide or polypeptide sequence (e.g., a synthetic peptide or polypeptide sequence) which connects two domains in a linear amino acid sequence of a polypeptide chain.
  • the polypeptides of invention are encoded by nucleic acid molecules that encode polypeptide linkers which either directly or indirectly connect the two Fc moieties which make up the construct,. These linkers are referred to herein as "scFc linkers”. If the scFc linker connects two Fc moieties contiguously in the linear polypeptide sequence, it is a "direct" linkage.
  • the scFc linkers may link the first Fc moiety to a binding moiety which is, in turn, linked to the second Fc moiety, thereby forming an indirect linkage.
  • These scFc linkers (L) result in the formation of a single chain genetic construct.
  • the scFc polypeptides also comprise enzymatic cleavage sites which result in the scFc linker being cleavable (an cscFc linker) and, in one embodiment, substantially excised (e.g., during processing by a cell).
  • the processed molecule is a dimeric molecule comprising at least two amino acid chains and substantially lacking extraneous linker amino acid sequences, in some embodiments, all or substantially all of the linker is excised, while in some embodiments, a portion of the cleavage site may remain, e.g., four argmines of the RRRR cleavage site.
  • another type of polypeptide linker herein referred to as a "spacer” may be used to connect different moieties, e.g., a clotting factor or a targeting moiety to an Fc moiety .
  • This type of polypeptide linker may provide flexibility to the polypeptide molecule. Spacers are not typically cleaved, however such cleavage may be desirable. Exemplary positions of spacers are shown in the accompanying drawings. Spacers can be located between the clotting factors, targeting moieties, and/or scaffolds, e.g., at the or C terminus of these moieties. In one embodiment, these linkers are not removed, during processing.
  • a third type of linker which may be present in a chimeric clotting factor of the invention is a cleavable linker which comprises a cleavage site (e.g., a factor XIa, Xa, or thrombin cleavage site) and which may include additional spacer linkers on either the N terminal of C terminal or both sides of the cleavage site.
  • cleavable linkers when incorporated into a clotting factor result in a chimeric molecule having a heterologous cleavage site. Exemplary locations for such sites are shown in the accompanying drawings and include, e.g., adjacent to targeting moieties, In another embodiment, such linkers may be adjacent to a clotting factor or portion thereof.
  • a cleavable linker may be fused to the N terminus of the heavy chain of a clotting factor to make an activatable form of the clotting factor.
  • the cleavable linker may include additional spacer linkers at the N terminus of the cleavage site, but require direct fusion at the C- terminus of the cleavage site to the amino terminus of the heavy chain of the clotting factor.
  • an unprocessed polypeptide of the instant invention comprises two or more Fc domains or moieties linked via a cscFc linker to form an Fc region comprised in a single polypeptide chain.
  • the cscFc linker is flanked by at least one enzymatic cleavage site , e.g., a site for processing by an intracellular enzyme. Cleavage of the polypeptide at the at least one enzymatic cleavage site results in a polypeptide which comprises at least two polypeptide chains.
  • an cscFc linker links F l or F2 to , e.g., a clotting factor, optionally via a cleavage site.
  • polypeptide linkers may optionally be used in a construct of the invention, e.g., to connect a clotting factor or targeting moiety to an Fc moiety.
  • One type of poilype tide linker is referred to here as spacers.
  • Some exemplar)' locations of spacers that can be used in connection with the invention include, e.g., polypeptides comprising GlySer amino acids such as those set forth in the accompanying figures and described in more detail below.
  • a spacer may be adjacent to one or more moieties each independently selected from clotting factor, scaffold moiety, e.g., Fc, cleavage site, and a targeting moiety.
  • the polypeptide linker is synthetic, i.e., non- naturally occurring.
  • a polypeptide linker includes peptides (or polypeptides) (which may or may not be naturally occurring ⁇ which comprise an amino acid sequence that links or genetically fuses a first linear sequence of amino acids to a second linear sequence of amino acids to which it is not naturally linked or genetically fused in nature.
  • the polypeptide linker may comprise non-naturally occurring polypeptides which are modified forms of naturally occurring polypeptides (e.g., comprising a mutation such as an addition, substitution or deletion).
  • polypeptide linker may comprise non-naturally occurring amino acids, in another embodiment, the polypeptide linker may comprise naturally occurring amino acids occurring in a linear sequence that does not occur in nature. In still another embodiment, the polypeptide linker may comprise a naturally occurring polypeptide sequence.
  • a polypeptide linker can be used to fuse identical Fc moieties, thereby forming a homomeric scFc region.
  • a polypeptide linker can be used to fuse different Fc moieties (e.g. a wild-type Fc moiety and an Fc moiety variant), thereb forming a heteronieric scFc region.
  • a polypeptide linker comprises or consists of a gly-ser linker.
  • an scFc or cscFc linker comprises at least a portion of an immunoglobulin hinge and a gly-ser linker.
  • the term "gly-ser linker” refers to a peptide that consists of glycine and serine residues.
  • An exemplary giy/ser linker comprises an amino acid sequence of the formula (Gly 4 Ser)n (SEQ ID NO: 4), wherein is a positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10).
  • a preferred giy/ser linker is (Gly 4 Ser) 2 (SEQ ID NO:29) , (Gly 4 Ser) 4 (SEQ ID NO:6), or (Gly 4 Ser) 6 .
  • SEQ ID NO: 5 Another exemplary gly-ser linker is GGGSSGGGSG (SEQ ID NO: 30).
  • said gly-ser linker may be inserted between two other sequences of the polypeptide linker (e.g., any of the polypeptide linker sequences described herein).
  • a gly-ser linker is attached at one or both ends of another sequence of the polypeptide linker (e.g., any of the polypeptide linker sequences described herein).
  • a polypeptide linker of the invention comprises at least a portion of an upper hinge region (e.g., derived from an IgGl , IgG2, IgG3, or IgG4 molecule), at least a portion of a middle hinge region (e.g., derived from an IgGl , IgG2, IgG3, or IgG4 molecule) and. a series of gly/ser amino acid residues (e.g., a gly/ser linker such as (Gly 4 Ser)n) (SEQ ID O:4)).
  • an upper hinge region e.g., derived from an IgGl , IgG2, IgG3, or IgG4 molecule
  • a middle hinge region e.g., derived from an IgGl , IgG2, IgG3, or IgG4 molecule
  • a series of gly/ser amino acid residues e.g., a gly/ser linker such
  • Polypeptide linkers of the invention are at least one amino acid in length and can be of varying lengths.
  • a polypeptide linker of the invention is from about 1 to about 50 amino acids in length.
  • the term "about” indicates +/- two amino acid residues. Since linker length must be a positive interger, the length of from about 1 to about 50 amino acids in length, means a length of from 1-3 to 48-52 amino acids in length.
  • a polypeptide linker of the invention is trom about 10-20 amino acids in length.
  • a polypeptide linker of the invention is from about 15 to about 50 amino acids in length.
  • a polypeptide linker of the invention is trom about 20 to about 45 amino acids in length. In another embodiment, a polypeptide linker of the invention is from about 15 to about 35 or about 20 to about 30 amino acids in length. I another embodiment, a polypeptide linker of the invention is from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, or 60 amino acids in length. In one embodiment, a peptide linker of the invention is 20 or 30 amino acids in length.
  • Polypeptide linkers can be introduced into polypeptide sequences using techniques known in the art. Modifications can be confirmed by DNA sequence analysis. Plasmid DNA can be used to transform host cells for stable production of the polypeptides produced,
  • one or more enzymatic cleavage site(s) is linked to e.g., flanks or is adjacent to, a cscFc linker (L) of an unprocessed polypeptide of the invention.
  • Such cleavage sites can be upstream or downstream of the cscFc liner or both.
  • a cleavage site is linked, (e.g., directly or indirectly) to one or both ends of a cscFc linker (L).
  • a nucleic acid molecule of the invention specifies a polypeptide represented by the formula:
  • Formula (I) comprises at least an A or B and optionally both.
  • a and B if both present, can be the corresponding heaw and light chains of a clotting factor.
  • Formula (I) comprises at least a PI or P2 and optionally both.
  • P I and P2, if both present, can be the same or different.
  • Formula (I) comprises at least a Fl and F2.
  • F l and F2, if both present, can be the same or different.
  • a Factor XIa or Xa cleavage site may be incorporated into a construct of the invention, e.g., in a cieavable linker.
  • Exemplary FXIa cleavage sites include, e.g, TQSF DFTR and SVSQTSKLTR.
  • Exemplary thrombin cleavage sites include, e.g, DFLAEGGGVR, TTK1KPR, LVPRG SEQ ID O:35) and ALRPRVVGGA Other useful cleavage sites are known in the art.
  • some portion of the linker may remain after cleavage at the at least one enzymatic cleavage site.
  • two cleavage sites may be included in a polypeptide of the invention.
  • all or substantially all of the linker is excised, while in some embodiments, a portion of the cleavage site may remain, e.g., four arginines of the RRRR cleavage site.
  • the invention relates to a nucleic acid construct comprising a nucleic acid sequence encoding the chimeric proteins of the invention. It will be understood that because of the degeneracy of the code, a variety of nucleic acid sequences will encode the amino acid sequence of the polypeptide.
  • the desired polynucleotide can be produced by de novo solid-phase DNA synthesis or by PGR mutagenesis of an earlier prepared polynucleotide.
  • Oligonucieotide-mediated mutagenesis is one method for preparing a substitution, in- frame insertion, or alteration (e.g., altered codon) to introduce a codon encoding an amino acid substitution (e.g., into an Fc variant moiety).
  • the starting polypeptide DNA is altered by hybridizing an oligonucleotide encoding the desired mutation to a single-stranded DNA template. After hybridization, a DNA polymerase is used to synthesize an entire second complementary strand of the template that incorporates the oligonucleotide primer.
  • genetic engineering e.g. , primer-based PGR mutagenesis, is sufficient to incorporate an alteration, as defined herein, for producing a polynucleotide encoding a polypeptide of the invention.
  • a polynucleotide sequence encoding the chimeric protein is inserted into an appropriate expression vehicle, i. e. , a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence, or in the case of an RNA viral vector, the necessary elements for replication and translation.
  • an appropriate expression vehicle i. e. , a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence, or in the case of an RNA viral vector, the necessary elements for replication and translation.
  • the nucleic acid encoding the chimeric protein is inserted into the vector in proper reading frame.
  • the expression vector is then trans fected into a suitable target cell which will express the polypeptide.
  • Transfection techniques known in the art include, but are not limited to, calcium phosphate precipitation (Wigler et al. 1978, Cell 14 : 725) and electroporation (Neumann et al. 1982, EMBO, J. 1 : 841).
  • a variety of host-expression vector systems may be utilized to express the chimeric proteins described, herein in eukaryotic cells.
  • the eukaryotic cell is an animal cell, including mammalian cells (e. g.
  • the DNA encoding the chimeric protein may also code for a signal sequence that will permit the chimeric protein to be secreted.
  • a signal sequence that will permit the chimeric protein to be secreted.
  • the signal sequence is cleaved by the cell to form the mature chimeric protein.
  • Various signal sequences are known in the art e. g. , native factor VII signal sequence, native factor IX signal sequence and the mouse IgK light chain signal sequence.
  • the chimeric protein can be recovered by lysmg the cells.
  • the chimeric protein of the invention can be synthesized in a transgenic animal, such as a rodent, goat, sheep, pig, or cow.
  • transgenic animals refer to non-human animals that have incorporated a foreign gene into their genome. Because this gene is present in germiine tissues, it is passed from parent to offspring. Exogenous genes are introduced into single-celled embryos (Brinster et al. 1985, Proc, Natl. Acad.Sci. USA 82 : 4438). Methods of producing transgenic animals are known in the art. including transgenics that produce immunoglobulin molecules (Wagner et al 1981, Proc. Natl. Acad. Sci.
  • the expression vectors can encode for tags that permit for easy purification or identification of the recombinantly produced protein.
  • tags include, but are not limited to, vector pUR278 (Ruther et al. 1983, EMBO j. 2: 1791) in which the chimeric protein described herein coding sequence may be ligated into the vector in frame with the lac z coding region so that a hybrid protein is produced;
  • pGEX vectors may be used to express proteins with a glutathione S-transferase (GST) tag. These proteins are usually soluble and can easily be purified, from cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
  • the vectors include cleavage sites (e. g. PreCission Protease (Pharmacia, Peapack, N. J. )) for easy removal of the tag after purification.
  • expression vector systems may be employed. These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA.
  • Expression vectors may include expression control sequences including, but not limited to, promoters (e.g., naturally-associated or heterologous promoters), enhancers, signal sequences, splice signals, enhancer elements, and transcription termination sequences.
  • promoters e.g., naturally-associated or heterologous promoters
  • enhancers e.g., signal sequences, splice signals, enhancer elements, and transcription termination sequences.
  • the expression control sequences are eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells.
  • Expression vectors may also utilize DNA elements which are derived from animal viruses such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV or MOMLV), cytomegalovirus (CMV), or SV40 virus. Others involve the use of polycistronic systems with internal ribosome binding sites.
  • expression vectors contain selection markers (e.g. , ampiciliin-resistance, hygromycin-resistance, tetracycline resistance or neomycin resistance ⁇ to permit detection of those cells transformed with the desired DNA sequences (see, e.g.. Itakura et al., US Patent 4,704,362), Cells which have integrated the DNA into their chromosomes may be selected by introducing one or more markers which allow selection of transfected host cells.
  • the marker may provide for prototrophy to an auxotrophic host, biocide resistance (e.g., antibiotics) or resistance to heavy metals such as copper.
  • the selectable marker gene can either be directly linked to the DNA sequences to be expressed, or introduced into the same cell by cotransformation.
  • a preferred expression vector is NEOSPLA (U.S. Patent No.
  • This vector contains the cytomegalovirus promoter/enhancer, the mouse beta gfobin major promoter, the SV40 origin of replication, the bovine growth hormone poiyadenylation sequence, neomycin phosphotransferase exon 1 and exon 2, the dihvdrofolate reductase gene and leader sequence.
  • This vector has been found to result in very high level expression of antibodies upon incorporation of variable and constant region genes, transfection in cells, followed by selection in G418 containing medium and methotrexate amplification.
  • Vector systems are also taught in U.S. Fat. Nos. 5,736, 137 and 5,658,570, each of which is incorporated by reference in its entirety herein. This system provides for high expression levels, e.g., > 30 pg/cell/day.
  • Other exemplary vector systems are disclosed e.g., in U.S. Patent No. 6,413,777.
  • polypeptides of the invention of the instant invention may be expressed using polycistronic constructs.
  • multiple gene products of interest such as multiple polypeptides of multimer binding protein may be produced from a single polycistronic construct.
  • These systems advantageously use an internal ribosome entry site (IRES) to provide relatively high levels of polypeptides of the invention in eukaryotic host cells.
  • IRS internal ribosome entry site
  • the expression vector may be introduced into an appropriate host cell. That is, the host cells may be transformed. Introduction of the plasmid into the host cell can be accomplished, by various techniques well known to those of skill in the art. These include, but are not limited to, transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, cell fusion with enveloped D A, microinjection, and infection with intact virus. See, Ridgway, A. A. G. "Mammalian Expression Vectors" Chapter 24,2, pp. 470-472 Vectors, Rodriguez and Denhardt, Eds. (Butterworths, Boston, Mass. 1988).
  • piasmid introduction into the host is via electroporation.
  • the transformed cells are grown under conditions appropriate to the production of the light chains and heavy chains, and assayed for heavy and/or light chain protein synthesis.
  • Exemplary assay techniques include enzyme -linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or fiourescence-activated cell sorter analysis (FACS), immunohistochemistry and the like.
  • transformation shall be used in a broad sense to refer to the introduction of DNA into a recipient host cell that changes the genotype and consequently results in a change in the recipient cell.
  • host cells refers to cells that have been transformed with vectors constructed using recombinant DNA techniques and encoding at least one heterologous gene.
  • the terms “cell” and “cell culture” are used interchangeably to denote the source of polypeptide unless it is clearly specified otherwise.
  • recovery of polypeptide from the “cells” may mean either from spun down whole cells, or from the cell culture containing both the medium and the suspended cells.
  • the host cell line used for protein expression is most preferably of mammalian origin; those skilled in the art are credited with ability to preferentially determine particular host cell lines which are best suited for the desired gene product to be expressed therein.
  • Exemplary host cell lines include, but are not limited to, DG44 and DUXB1 1 (Chinese Hamster Ovary lines, DHFR minus), HELA (human cervical carcinoma), CVI (monkey kidney line), COS (a derivative of CVI with SV40 T antigen), R1610 (Chinese hamster fibroblast) BALBC/3T3 (mouse fibroblast), HAK (hamster kidney line), SF2/0 (mouse myeloma), F3.times.63-Ag3.653 (mouse myeloma), BFA-lclBPT (bovine endothelial cells), RAJI (human lymphocyte ⁇ , PerC6, and 293 (human kidney).
  • a host cell endogenously expresses an enzyme (or the enzymes) necessary to cleave an scFc linker (e.g., if such a linker is present and contains intracellular processing site(s)) during processing to form the mature polyptide. During this processing, the scFc linker may be substantially removed to reduce the presence of extraneous amino acids.
  • a host cell is transformed to express one or more enzymes which are exogenous to the cell such that processing of an scFc linker occurs or is improved.
  • an enzyme which may be endogenously or exogenously expressed by a cell is a member of the furin family of enzymes.
  • U.S. Pat. No. 5,460,950 issued to Barr et al, describes recombinant PACE and. the coexpression of PACE with a substrate precursor polypeptide of a heterologous protein to improve expression of active, mature heterologous protein.
  • Possible substrate precursors disclosed in this patent include a precursor of Factor IX.
  • Other family members in the mammalian furin/ subtil isin/ ex2p ⁇ like proprotein convertase (PC) family in addition to PACE are reported to include PC1/PC3, PC2, PC4, PC5/6 (hereinafter referred to simply as PC5), PACE4, and LPC/PC7/PC8/SPC7.
  • proprotein convertases generally include, beginning from the amino terminus, a signal peptide, a propeptide (that may be autocatalytically cleaved), a subtilisin-like catalytic domain characterized by Asp, His, Ser, and.
  • PCS Asn/Asp residues, and a Homo B domain that is also essential for catalytic activity and characterized by an Arg-Gly-Asp (RGD) sequence
  • PACE, PACE4, and PCS also include a Cys-rich domain, the function of which is unknown.
  • PCS has isoforms with and without a transmembrane domain; these different isoforms are known as PC5B and. PC5A, respectively.
  • PACE and PACE4 have been reported to have partially overlapping but distinct substrates.
  • PACE4 in striking contrast to PACE, has been reported to be incapable of processing the precursor polypeptide of FIX.
  • U.S. Pat. No. 5,840,529 issued to Seidah et al, discloses nucleotide and. amino acid sequences for human PC7 and the notable ability of PC7, as compared to other PC family members, to cleave HIV g l60 to gpl20 and gp41.
  • Genes encoding the polypeptides of the invention can also be expressed in non-mammalian cells such as bacteria or yeast or plant cells.
  • non-mammalian cells such as bacteria or yeast or plant cells.
  • various unicellular non-mammalian microorganisms such as bacteria can also be transformed; i.e., those capable of being grown in cultures or fermentation.
  • Bacteria, which are susceptible to transformation include members of the enterobacteriaceae, such as strains of Escherichia colt or Salmonella;
  • Bacillaceae such as Bacillus subtilis; Pneumococcus; Streptococcus, and
  • Haemophilus influenzae when expressed in bacteria, the polypeptides typically become part of inclusion bodies. The polypeptides must be isolated, purified and then assembled into functional molecules.
  • eukaryotic microbes may also be used.
  • Saccharomyces cerevisiae or common baker's yeast, is the most commonly used among eukaryotic microorganisms although a number of ot er strains are commonly available.
  • the plasmid YRp7 for example, (Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al, Gene, 7: 141 (1979); Tschemper et al, Gene, 10: 157 (1980) ⁇ is commonly used.
  • This plasmid already contains the TRP1 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics, 85: 12 (1977)).
  • the presence of the trpl lesion as a characteristic of the yeast host cell genome then pro vides an effective en vironment for detecting transformation by growth in the absence of tryptophan.
  • yeast hosts such Pichia may also be employed.
  • Yeast expression vectors having expression control sequences (e.g., promoters), an origin of replication, termination sequences and the like as desired.
  • Typical promoters include 3- phosphoglycerate kinase and other glycolytic enzymes.
  • Inducible yeast promoters include, among others, promoters from alcohol dehydrogenase, isocytochrome C, and enzymes responsible for methanol, maltose, and galactose utilization.
  • polypeptide-coding nucleotide sequences can be incorporated in transgenes for introduction into the genome of a transgenic animal and subsequent expression in the milk of the transgenic animal (see, e.g. , Deboer et al., US 5,741,957, Rosen, US 5,304,489, and Meade et al, US 5,849,992).
  • Suitable transgenes include coding sequences for polypeptides in operable linkage with, a promoter and. enhancer from a mammary gland specific gene, such as casein or beta lactoglobulin.
  • the solutions of polypeptides can be purified by the customary chromatography methods, for example gel filtration, ion-exchange chromatography, chromatography over DEAE-cellulose or (immuno-)affmity chromatography, e.g., after preferential biosynthesis of a synthetic hinge region polypeptide or prior to or subsequent to the HIC chromatography step described herein.
  • An affinity tag sequence e.g. a His(6) tag
  • a host cell of the invention comprises a genetic construct encoding a polypeptide comprising an scFe scaffold, and. one or more enzymes that can process a cscFc linker.
  • the construct and the enzyme(s) can be expressed using a single vector or two vectors.
  • the invention pertains to nucleic acid molecules which encode a polypeptide of the invention.
  • the nucleic acid molecule encodes a chimeric clotting factor selected from the group consisting of FVII, FIX and FX and which comprises a targeting moiety which binds to platelets and optionally a spacer moiety between the clotting factor and the targeting moiety.
  • the invention pertains to a nucleic acid molecule encoding a polypeptide comprising FVII, which FVII which comprises a heterologous enzymatic cleavage site activatable by a component of the
  • the chimeric clotting factor can be purified according to standard procedures of the art, including ammonium sulfate precipitatioii, affinity column chromatography, HPI.C purification, gel electrophoresis and the like (see generally Scopes, Protein Purification (Springer- Verlag, N.Y.. (1982)) and see specifically the methods used in the instant Examples. Substantially pure proteins of at least about 90 to 95% homogeneity are preferred, and 98 to 99% or more homogeneity most preferred, for pharmaceutical uses.
  • the invention in another embodiment, relates to a method of treating a subject with a hemostatic disorder comprising administering a therapeutically effective amount of an enhanced clottng factor of the Invention.
  • compositions for administration to a subject include nucleic acid molecules which comprise a nucleotide sequence encoding a chimeric clotting factor of the invention (for gene therapy applications) as well as polypeptide molecules.
  • an enhanced cloting factor composition of the invention is administered in combination with at least one other agent that promotes hemostasis.
  • Said other agent that promotes hemostasis Is a therapeutic with demonstrated clotting activity.
  • hemostatic agent can include Factor V, Factor VII, Factor VIII, Factor IX, Factor X, Factor XI, Factor XII, Factor XIII, prothrombin, or fibrinogen or activated forms of any of the preceding.
  • the clotting factor of hemostatic agent can also include anti-fibrino lytic drugs, e.g., epsilon-amino-caproic acid, tranexamic acid.
  • the composition e.g., the polypeptide or nucleic acid molecule encoding the polypeptide
  • the composition is one m which the clotting factor is present in active form when administered, to a subject.
  • Such an activated molecule may be expressed, by a cell in active form or may be activated in vitro prior to administration to a subject.
  • the composition is one in which the clotting factor is present in activatable form and the clotting factor is activated in vivo at the site of clotting after administration to a subject.
  • the chimeric clotting factor of the invention can be administered intravenously, subcutaneously, intramuscularly, or via any mucosal surface, e.g., orally, sublingual! ⁇ -', buccal K . sublingually, nasally, rec tally, vaginally or via pulmonary route.
  • the chimeric protein can be implanted within or linked to a biopolvmer solid support that allows for the slow release of the chimeric protein to the desired site.
  • the pharmaceutical composition can take the form of tablets or capsules prepared by conventional means.
  • the composition can also be prepared as a liquid for example a syrup or a suspension.
  • the liquid can include suspending agents (e.g. sorbitol syrup, cellulose derivatives or hydrogenated edible fats), emulsifying agents (lecithin or acacia), non-aqueous vehicles (e.g. almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils), and preservatives (e.g.
  • compositions can also include flavoring, coloring and sweetening agents.
  • the composition can be presented as a dry product for constitution with water or another suitable vehicle.
  • composition may take the form of tablets, lozenges or fast dissolving films according to conventional protocols.
  • the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray from a pressurized, pack or nebulizer (e.g. in PBS), with a suitable propeliant, e.g., dichlorodifluoromethane, triehlorofluoromethane, dichlorotetrafluoromethane, carbon dioxide or other suitable gas.
  • a pressurized aerosol the dosage unit can be determined by providing a valve to deliver a metered amount.
  • the route of administration of the polypeptides of the invention is parenteral.
  • parenteral as used herein includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, recta! or vaginal administration.
  • the intravenous form of parenteral administration is preferred.. While all these forms of administration are clearly contemplated as being within the scope of the invention, a form for administration would be a solution for injection, in particular for intravenous or intraarterial injection or drip.
  • a suitable pharmaceutical composition for injection may comprise a buffer (e.g. acetate, phosphate or citrate buffer), a surfactant (e.g. polysorbate), optionally a stabilizer agent (e.g. human albumin), etc.
  • a buffer e.g. acetate, phosphate or citrate buffer
  • a surfactant e.g. polysorbate
  • a stabilizer agent e.g. human albumin
  • Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • pharmaceutically acceptable carriers include, but are not limited to, 0.01-0.1M and preferably 0.05M phosphate buffer or 0.8% saline.
  • Intravenous vehicles include sodium phosphate solutions, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishes, electrolyte replenishes, such as those based on Ringer's dextrose, and the like.
  • Preservatives and other additives may also be present such as for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the composition must be sterile and should be fluid, to the extent that easy syringability exists. It should be stable under the conditions of manufacture and. storage and will preferably be preserved, against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g. , glycerol, propyiene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like.
  • isotonic agents for example, sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin,
  • sterile injectable solutions can be prepared by
  • an active compound e.g., a polypeptide by itself or in combination with other active agents
  • dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • sterile powders for the preparation of sterile injectable solutions the preferred, methods of preparation are vacuum drying and freeze-drying, which yields a powder of an active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the preparations for injections are processed, filled into containers such as ampoules, bags, bottles, syringes or vials, and sealed under aseptic conditions according to methods known in the art. Further, the preparations may be packaged and sold in the form of a kit. Such articles of manufacture will preferably have labels or package inserts indicating that the associated compositions are useful for treating a subject suffering from, or predisposed to clotting disorders.
  • the pharmaceutical composition can also be formulated for rectal administration as a suppository or retention enema, e.g., containing conventional suppository bases such as cocoa butter or other glycerides,
  • compositions of the present invention for the treatment of conditions vary depending upon many different factors, including means of administration, target site, physiological state of the patient, whether the patient is human or an animal, other medications administered, and whether treatment is prophyiactic or therapeutic.
  • the patient is a human but non-human mammals including transgenic mammals can also be treated.
  • Treatment dosages may be titrated using routine methods known to those of skill in the art to optimize safety and efficacy.
  • the dose of a biologically active moiety can range from about 25 to 100 lU/kg, e.g., 0.417 mg/kg to 1.67 mg/kg.
  • the dose of a biologically active moiety e.g., comprising FVIII
  • the dose of a biologically active moiety can range from about 25 to 65 Hi/kg, e.g., 0,003125 mg/kg to 0.008125 mg/kg.
  • the dose of a biologically active moiety e.g., comprising FVII
  • Dosages can range from 1000 ug/kg to 0.1 ng/kg body weight. In one embodiment, the dosing range is lug/kg to 100 ug/kg.
  • the protein can be
  • In vitro assays may be employed to determine optimal dose ranges and/ or schedules for administration.
  • In vitro assays that measure clotting factor activity are known in the art, e. g. , STA- CLOT Vlla-rTF clotting assay. Additionally, effective doses may be extrapolated from dose-response curves obtained from animal models, e. g. , a hemophiliac dog (Mount et al. 2002, Blood 99 (8): 2670),
  • Doses intermediate in the above ranges are also intended to be within the scope of the invention.
  • Subjects can be administered such doses daily, on alternative days, weekly or according to any other schedule determined by empirical analysis.
  • An exemplary treatment entails administration in multiple dosages over a prolonged period, for example, of at least six months.
  • two or more polypeptides may be administered simultaneously, in which case the dosage of each polypeptide administered falls within the ranges indicated.
  • Polypeptides of the invention can be administered on multiple occasions. Intervals between single dosages can be daily, weekly, monthly or yearly. Intervals can also be irregular as indicated by measuring blood levels of modified polypeptide or antigen in the patient. Alternatively, polypeptides can be administered, as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life of the polypeptide in the patient.
  • compositions containing the polypeptides of the invention or a cocktail thereof are administered to a patient not already in the disease state to enhance the patient's resistance or minimize effects of disease. Such an amount is defined to be a
  • prophylactic effective dose A relatively low dosage is administered at relatively infrequent intervals over a long period of time. Some patients continue to recei ve treatment for the rest of their li es.
  • Polypeptides of the invention can optionally be administered in combination with other agents that are effective in treating the disorder or condition in need of treatment (e.g., prophylactic or therapeutic).
  • the administration of polypeptides of the invention in conjunction or combination with an adjunct therapy means the sequential, simultaneous, coextensive, concurrent, concomitant or contemporaneous administration or application of the therapy and the disclosed polypeptides.
  • Those skilled in the art will appreciate that the administration or application of the various components of the combined therapeutic regimen may be timed, to enhance the overall effectiveness of the treatment. A skilled artisan (e.g. a physician) would be readily be able to discern effective combined therapeutic regimens without undue experimentation based on the selected adjunct therapy and the teachings of the instant specification.
  • polypeptides of the instant invention may be used in conjunction or combination with an agent or agents (e.g. to provide a combined therapeutic regimen).
  • agents with which a polypeptide of the invention may be combined include agents that represent the current standard of care for a particular disorder being treated. Such agents may be chemical or biologic in nature.
  • biological or “biologic agent” refers to any pharmaceutically active agent made from living organisms and/or their products which is intended for use as a therapeutic.
  • the amount of agent to be used in combination with the polypeptides of the instant invention may vary by subject or may be administered according to what is known in the art. See for example, Bruce A Chabner et ah, Antineoplastic Agents, in GOODMAN & OILMAN'S THE PHARMACOLOGICAL BASIS OF THERAPEUTICS 1233-1287 ((Joel G. Hardman et a!., eds., 9 lh ed. 1996). In another embodiment, an amount of such an agent consistent with the standard of care is administered.
  • the polypeptides of the present invention may be administered in a pharmaceutically effective amount for the in vivo treatment of clotting disorders.
  • the polypeptides of the invention can be formulated to facilitate administration and promote stability of the active agent.
  • pharmaceutical compositions in accordance with, the present invention comprise a pharmaceutically acceptable, non-toxic, sterile carrier such as physiological saline, non-toxic buffers, preservatives and the like.
  • the pharmaceutical compositions of the present invention may be administered in single or multiple doses to provide for a pharmaceutically effective amount of the polypeptide.
  • a chimeric clotting factor of the invention can be administered as a nucleic acid molecule.
  • Nucleic acid molecules can be administered using techniques known in the art, including via vector, plasmid. liposome, DNA injection, electroporation, gene gun, intravenously injection or hepatic artery infusion.
  • the chimeric clotting factors of the invention may be administered to a human or other animal in accordance with the aforementioned methods of treatment in an amount sufficient to produce a therapeutic or prophylactic effect.
  • the chimeric proteins of the invention have many uses as will be recognized by one skilled in the art, including, but not limited to methods of treating a subject with a disease or condition.
  • the disease or condition can include, but is are not limited to, hemostatic disorders.
  • the invention relates to a method of treating a subject having a hemostatic disorder comprising administering a therapeutically effective amount of at least one chimeric clotting factor of the invention.
  • the chimeric clotting factors of the invention treat or prevent a hemostatic disorder by promoting the formation of a fibrin clot.
  • the chimeric clotting factor of the invention can activate any member of a coagulation cascade.
  • the clotting factor can be a participant in the extrinsic pathway, the intrinsic pathway or both.
  • a chimeric clotting factor of the invention can be used to treat hemostatic disorders, e.g., those known to be treatable with the particular clotting factor present in the chimeric dotting factor.
  • hemostatic disorders that may be treated by administration of the chimeric protein of the invention include, but are not limited to. hemophilia A, hemophilia B, von Willebrand's disease, Factor XI deficiency (PTA deficiency), Factor XII deficiency, as well as deficiencies or structural abnormalities in fibrinogen, prothrombin, Factor V, Factor VII, Factor X, or Factor XIII.
  • the hemostatic disorder is an inherited, disorder.
  • the subject has hemophilia A, and the chimeric protein comprises Factor VII or Factor Villa.
  • the subject has hemophilia A and the chimeric clotting factor comprises Factor VII or Factor Vila.
  • the subject has hemophilia B and the chimeric clotting factor comprises Factor IX or Factor IXa.
  • the subject has hemophilia B and the chimeric protein comprises Factor VII or Factor Vila.
  • the subject has inhibitory antibodies to Factor VII or Factor Villa and the chimeric clotting factor comprises Factor VII or Factor Vila.
  • the subject has inhibitory antibodies against Factor IX or Factor IXa and the chimeric protein comprises Factor VII or Factor Vila.
  • the chimeric clotting factor of the invention can be used to prophyiacticaliy treat a subject with a hemostatic disorder.
  • the chimeric clotting factor of the invention can be used to treat an acute bleeding episode in a subject with a hemostatic disorder.
  • the hemostatic disorder is the result of a deficiency in a clotting factor, e.g., Factor IX, Factor VIII.
  • a clotting factor e.g., Factor IX, Factor VIII.
  • the hemostatic disorder can be the result of a defective clotting factor.
  • the hemostatic disorder can be an acquired disorder.
  • the acquired disorder can result from an underlying secondary disease or condition.
  • the unrelated condition can be, as an example, but not as a limitation, cancer, an autoimmune disease, or pregnancy.
  • the acquired disorder can result from old age or from medication to treat an underlying secondary disorder (e.g. cancer chemotherapy).
  • the invention also relates to methods of treating a subject that does not have a hemostatic disorder or a secondary disease or condition resulting in acquisition of a hemostatic disorder.
  • the invention thus relates to a method of treating a subject in need of a general hemostatic agent comprising administering a therapeutically effective amount of at least one chimeric clotting factor of the invention.
  • the subject in need of a general hemostatic agent is undergoing, or is about to undergo, surgery.
  • the chimeric clotting factor of the invention can be administered prior to or after surgery as a prophylactic.
  • the chimeric clotting factor of the invention can be administered during or after surgery to control an acute bleeding episode.
  • the surgery can include, but is not limited to, liver transplantation, liver resection, or stem cell transplantation.
  • the chimeric clotting factor of the invention can be used to treat a subject having an acute bleeding episode who does not have a hemostatic disorder.
  • the acute bleeding episode can result from severe trauma, e.g., surgery, an automobile accident, wound, laceration gun shot, or any other traumatic event resulting in uncontrolled, bleeding.
  • Example L Heterodimeric Constructs comprising FVII-Fc and MB9-Fc at the amino terminus of the second Fc chain
  • the FV11-027 construct comprises cscFc for cleavage when processed during manufacture in a cell.
  • the construct comprises a targeting moiety, a scFv moiety that binds to GPIIbllia, MB 9.
  • Plasmid (pSYN-FVH-027) was generated for the expression FVIl-Fc and MB9-Fc heterodimer, where MB9 is a scFv previously shown to bind to receptor GPIIb/IIIa on activated platelets.
  • Protein from p8Y -FVII ⁇ 027 is expressed in the cell as a single polypeptide where the C-terminus of the FVII-Fc subunit is Jinked to the N -terminus of the MB9-Fc subunit by a (GGGGS)e x polypeptide linker.
  • R RRS and RKRRKR sequences were inserted at the 5' and 3' end of the polypeptide linker, respectively, for intracellular cleavage by proprotein convertases following the last Arg at each sequence. Consequently, ceils will express a 2 chain FVII-Fc/MB9-Fe heterodimer where the FVII-Fc chain has a RRRRS sequence at the C-terminus, but the remainder of the linker and the RKRRKR sequence have otherwise been removed.
  • a 50 ul PGR reaction was carried out with 25 pmol of Hindlll-Sall-BpEI-Fc-F and BamHI-linker-Fc-R and template pSY -Fc-001 using the following cycle: 95° C 2 minutes; 30 cycles of (95° C 30 seconds. 54° C 30 seconds, 72° C 1 minute).
  • the expected sized band (-700 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia, Calif.) and cloned into the Hindlll and BamHI restriction sites of pBUDCE4 (Invitrogen, Carlsbad, Calif.) to generate intermediate pSYN-FVU-007.
  • Hindlll-Sail-BpEI-Fc-F and BamHI-linker-Fc-R amplify the Fc region starting at amino acid 221 (EU numbering) and add a Hindi! and a Sail restriction enzyme site immediately upstream of site Fc region, as well as a DNA fragment encoding a (GGGGS) 4x linker followed by a BamHI site immediately downstream of the Fc coding region.
  • GGGGS GGS
  • the expected sized band (-700 bp) was gel purified as above, cut with restriction enzymes BamHI and EcoRI, and cloned in the BcU EcoRI restriction sites of pSYN-FVU-007 to generate the intermediate plasmid pSYN-FVTI-008.
  • the primer pair Bell-Fe-F and scFc-EcoRI-R amplifies the Fc region while adding a Bell and EcoRI restriction sites immediately upstream and downstream of the Fc coding region, respectively.
  • a 50 ul PGR reaction was carried out with 25 prnol of Hindm-Kozak-FVII-F and FVII-HC-BspEI-R and template pSYN-FVII-001 using the following cycle: 95° C 2 minutes; 30 cycles of (95° C 30 seconds, 55° C 30 seconds, 72° C 90 seconds).
  • the primer pair amplifies the FVII coding region while adding a DNA fragment at the 3' end of the molecule encoding a (GGGGS)e polypeptide linker followed by a fragment of the Fc region ending at amino acid 221 (EU numbering).
  • Primer HindIII-Kozak-FVII-F generates a Hindi!!
  • the FVII-HC-BspEI-R primer introduces DNA encoding the polypeptide linker as well as the Fc portion.
  • the expected sized band ( ⁇ 1 00 bp) was gel purified as above and cloned into the HindXXX/BspEI sites of pSYN-FVII-008 to generate pSYN-FVII-01 1.
  • Genescript-FVII-027- consists of a DNA fragment encoding a portion of the Fc region (starting at nucleotide 1306, EU numbering) followed by the sequence RRRRS-(GGGGS) 6x -RKRRKR followed by a portion of the MB 9 scF v (residues 1-142).
  • An EcoRI site was introduced in the coding sequence of MB9 using the degeneracy of the genetic code to preserve the proper amino acid sequence and overlaps the last 6 bases of Geneseript-FVIi-027-1.
  • Genscript-FVII-026-2 consists of a DN A fragment encoding a portion of the MB9 (residues 143-273) followed by a (GGGGS)ex polypeptide linker followed by the Fc region and an EcoRI site.
  • EcoRI site was introduced in the coding sequence of MB9 using the degerseracy of the genetic code to preserve the proper amino acid sequence and overlaps the first 6 bases of Genescript-FVII-026-2.
  • Genescript-FVII -027-1 was cloned into the Sapl and EcoRI sites of pSYN-FVTT-011 to generate pSY -FW-036.
  • Genscript-F lI-026-2 was cloned into the EcoRI site of pSYN-FVn-036 to generate pSYN-F ⁇ 11-027. Correct orientation of the last cloning step was confirmed by restriction enzyme analysis and DNA sequencing.
  • the FVII-037 construct is made using an scFc scaffold which is not cleaved during processing.
  • the targeting moiety again the MB 9 scFv which binds to GPIIbllla is attached to the c- terminus of the second Fc moiety.
  • Genscript This fragment comprises a portion of the Fc region (residues 434 to 447, EU numbering) followed by a (GGGGS)4x polypeptide linker and the MB9 scFv.
  • a SapI/EcoRI fragment of Genscript-FVEI-037 was subcloned into the SapI EcoRI of pSYN-FVTT-Q 11 (refer to P0830) to generate and intermediate construct
  • a Sapl fragment from pSYN-F VII-O! 1 was subcloned into the Sapl sites of the intermediate construct to generate pSYNFVII-037.
  • the FVTI-041 construct was first made as an intermediate. Synthesis of DNA molecule Genscript-FVII-041 was outsourced (Genscript). This fragment was digested with Sapl and cloned into Sapl sites of pSYN-F VH-011 to generate pSYN-FVTI-041. This process introduces a unique Sail site (residues 412-413 EU numbering. GTG GAC to GTC GAC) in the second Fc. Cloning of pSYN-FVII-044-, -045 and -046.
  • the FVII-041 construct was used as the starting material to generate several constructs that comprise targeting moieties which are peptides that bind to GPIb.
  • the PS4 peptide is used in the -044 construct, the OS1 peptide in the -045 construct, ad the OS2 peptide in the -046 construct.
  • an scFc scaffold is used and the peptides are attached via a linker to the C -terminus of the second Fc moiety.
  • the FVII-043 construct was first made as an intermediate. Synthesis of DNA fragment Genscript-FVH-043 was outsourced (Genscript). This fragment comprises a DNA molecule encoding a portion of the Fc region (residues 232 to 447, EU numbering) followed by a (GGGGS)4x polypeptide linker and another portion of the Fc region (residues 221 to 238, EU numbering). This DNA fragment was digested with BspEI and Rsrll and subcloned. into the BspEI/RsrII sites of SYN-FVII-042 to generate pSYN-FVII-050.
  • Genscript-FVH-043 was outsourced (Genscript). This fragment comprises a DNA molecule encoding a portion of the Fc region (residues 232 to 447, EU numbering) followed by a (GGGGS)4x polypeptide linker and another portion of the Fc region (resi
  • the FVII-043 construct was used, as the starting material to generate several constructs that comprise targeting moieties which are peptides that bind to GPIb.
  • the PS4 peptide is used in the -047 construct, the 081 peptide in the -048 construct, and the OS2 peptide in the -049 construct.
  • an scFc scaffold is used and the peptides are interposed between the scFc linker and a linker which is attached to to the N-terminus of the second. Fc moiety.
  • Genscript-FVII-047, -048 and. -049 was outsourced (Genscript), A Sal/RsrII fragment from Genscript-FVII-047, -048 and - 049 was subcloned into Sail/RsrII sites of pSYN-FVTI-043 to generate pSYN-FVH- 047, -048 and 049, respectively.
  • Example 5 Heterodimeric Constructs comprising a Gia-deleted FVII-Fc and a targeting molecule
  • FV11-028 construct was first made as an intermediate. Synthesis of DNA fragment Genscript-FVTT-028 was outsourced (Genscript). This fragment was cut with Hindlll/Xbal and subcloned into pSYN- FVn-011 to generate pSYN-FVH-028.
  • the FVII-028 construct was used as the starting material to generate a construct that comprises a targeting moiety and employs a clotting factor that lacks a Gla domain.
  • amino acids 1-35 were removed from FV1I and an RKRRKR insertion was added after residue R152 (WT FVII numbering ⁇ to facilitate intracellular activation.
  • the MB 9 scFv served as the targeting moiety.
  • Example 6 Heterodimeric Co structs comprising a Factor Vli heavy and light chains as two separate polypeptides
  • the FVII-024 construct is one in which the heavy and light chains of factor FVII are not contiguous in a single chain molecule.
  • the construct employs cscFc such that the cscFc linker is cleaved, by proteases in the trans-Golgi network This cleavage results in linker removal as well as activation of FVII, resulting in the expression of activated FVIIaFc.
  • FVII The coding sequence of FVII was obtained by reverse transcription coupled to polymerase chain reaction from a human liver mRNA library (Ambion, Austin, Texas) using the following primers:
  • the cycle used was 50° C for 30 minutes for the reverse transcription followed by denaturing at 94° C for 2 minutes and 30 cycles of (94° C 30 seconds, 53° C 30 seconds, 72° C 90 seconds) followed by 10 minutes at 72° C
  • the expected sized band (-1400 bp) was gel-purified with a Gel Extraction kit (Qiagen, Valencia, Calif.) and cloned in pCR2.1 TOPO using the TOPO TA Cloning kit (Invitrogen, Carlsbad, Calif.) to produce the intermediate plasmid pSYN-FVII-001.
  • the FVII coding sequence was PCR-amplified using the following primers:
  • the forward primer Hindlll-Kozak-FVII-F adds a Hind!II restriction site followed by a Kozak sequence immediately upstream of the FVII coding region.
  • the reverse primer Bspel-Fc-FVXX-K adds a fragment of the constant region of IgGl (the Fc region) comprising amino acids 221-233 (EU numbering).
  • This process also incorporates a BspEI restriction site at amino acids 231 -233 using the degeneracy of the genetic code to preserve the correct amino acid sequence (EU numbering),
  • a 50 ul reaction was earned out with 15 pmol of each primer and template pSYN-FVXX-001 using Platinum Pfx DNA Polymerase system according to manufacturer's protocol in a MJ Thermocycler using the following cycles: 95° C 2 minutes; 30 cycles of (95° C 15 seconds, 49° C 30 seconds, 68° C 90 seconds): 68° C 10 minutes, Plasmid pSYN- FIX-027 (pBUD FIXFe/Fc) was digested with Hindlll and BspEI and the expected sized band for the vector (approximately 5800 bp) was purified away from the FIX insert (expected size band approximately 1480 bp) with a Gel Extraction kit (Qiagen, Valencia, Calif.), Next, the PCR-
  • Fc-linker-F GACAAAACTCACACATGCCCACC
  • FVTI-linker-F and FVIT-Linker-R (reaction 1) or Fc-linker-F and Fc-linker-R (reaction 2) using Expand High Fidelity System (Boehringer Mannheim. Indianapolis. Ind.) according to manufacturer's standard protocol in a MJ Thermocycler.
  • the first and second reactions were carried out with i ug of pSYN-FVII-002 as template using the following cycle: 94 °C. 2 minutes: 14 cycles of (94 G C. 30 seconds, 55 G C. 30 seconds, 72°C. 2 minutes); 72°C. 10 minutes.
  • the expected sized bands (532 bp for reaction 1 and 670 bp for reaction 2) were gel purified with a Gel Extraction kit (Qiagen,
  • the expected sized band (1200 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia. Calif.) and digested with restriction enzymes Kpnl and EcoRI.
  • the expected sized band (920 bp) was gel purified as before and cloned into the Kpnl/EcoRi sites of pSYN-FVU-002 to generate pSYN-FVH-003 (pBUD FVIIFc/6x(GGGGS)/Fc).
  • Plasmid (pSY -FVII-024) was generated for the expression of a two- chain heterodimer where one chain consists of the FVII light chain (residues 1-152) followed by a (GGGGS)fj X linker followed, by the Fc region, while the other chain contains a FVII heavy chain (residues 153 to 406) followed by a (GGGGS)ex linker followed by the Fc region.
  • the plasmid is designed to express the heterodimer as a single polypeptide where the C-temiinus of the FVII heavy chain-linker-Fc chain is connected to the N-terminus of the heavy chain-linker-Fc chain by the follo wing polypeptide sequence: RRRRS-(GGGGS) 6x -RKRRKR, where the RRRRS and
  • RKRRKR sequences are proprotein convertase cleavage sites. Intracellular cleavage by proprotein convertases following the last Arg at each cleavage site can result in removal of the polypeptide linker. Consequently , cells will express a 2 chain heterodimer where the FVII light chain-linker-Fc chain has a RRRRS seque ce at the C-terminus, but the remainder of the linker and the RKRRKR sequence have otherwise been removed. Construction of the pSYN-FVH-024 and several intermediate plasrnids required the use of the following primers:
  • Hino.III -Sail -BpEI-Fc-F AGTCAAGCTTGTCGACTCCGGAACTCCTGGGCGGACC
  • the correct sized band (approximately 730 bp) was gel purified as above and cloned into the Hindlll/BamHI sites of pBUDCE4 vector (Invitrogen, Carlsbad, Calif), generating pSYN-FVTi-014.
  • PGR amplification with primers HindIII-SalI- BpEI-Fc-F and BaniHI-linker(PACE 1 )-Fc-R generated a D A fragment encoding a portion of the Fc region (Amino A X-Y) followed by an RRRRS sequence and
  • (GGGGS) 2x polypeptide linker 2x polypeptide linker.
  • Primer HindIII-SalI-BpEI-Fc-F introduces a Ilindlll and Sail restriction site at the 5' end of the molecule, while primer BamHI- linker(PACEl )-Fe-R introduces a BamHI at the 3' end that overlaps the codons encoding the last 2 residues of the GGGGS linker (residues GS with codons GGA TCC) .
  • Primers Hindlll-Kozak-FVII-F and BspEI-Fc-linker-FVIILC-R amplified a DNA fragment encoding the FVII light chain followed by a (GGGGS)f JX polypeptide linker and a portion of the Fc region up to amino acid 232 (EU numbering).
  • Primer Hindlll-Kozak-FVII-F introduces a Hindi!! restriction site at the 5' end of the molecule followed by a Kozak sequence while primer BspEI-Fc-iinker- F VULC-R adds a Bspel site at the 3 ' end of the molecule.
  • This PGR reaction generated a DNA molecule encoding a (GGGGS) 3 ⁇ 4. polypeptide linker followed by a RKRRKR sequence followed by the FVII heavy chain.
  • Primers Bamffl-2xlink-pace-HC-F and Fc-EeoRI-R introduce a BamHI site and an EcoRI site at the 5' and 3 'end of the molecule, respectively.
  • the expected sized band (approximately 1600 bp) was cloned into the BamHI and EcoRI sites ofpSY -FVn-023 to generate pSYN-FVII-024.
  • a triple point mutation (V158D, E296V and M298Q: mature FVII sequence numbering) was introduced into the FVII coding region of pSYN -FVII-090 by PGR- based site-directed mutagenesis to generate pSYN-FVTI-l 15
  • a DNA fragment comprising the 170 loop of trypsin was generated, by PGR using pSYN-FVIUOO as template. This PGR reaction generated BsiWI and BspEI restriction sites at the 5' and 3', respectively. The DNA fragment was subcloned into the BsiWI/BspEI sites of pSYN-FVII-1 1 8 to generate pSYN-FVTI-l 27.
  • a BspEI-EcoRI fragment from pSYN-FIX-048 was subcloned into BspEI-EcoRI sites of pSYN-FIX-053 to generate pS YN-FIX-089
  • the SCE5 sequence is set forth below:
  • a DNA fragment comprising a sequence encoding a 6x(GGGGS) linker followed, by the SCE5 coding sequence was synthesized (outsourced) and. cloned into the
  • a DNA fragment was PGR amplified from pSYN-FVTi-088, comprising the AP3 region and part of the linker. This PGR reaction generated BamHI and EcoRI sites at the 5 ' and 3' of the DNA fragment, respectively. This DNA fragment was subcloned into the BamHI/EcoRI sites of pSYN-FVII-0! 1 to generate pSY -FVII-125
  • the coding sequence of human recombinant B-domain deleted FVIII was obtained by reverse transcription-polymerase chain reaction (RT-PCR) from human liver poly A RNA (Clontech) using FVffl-specific primers.
  • the FVITI sequence includes the native signal sequence for FVIII,
  • the B-domain deletion starts after serine 743 (S743; 2287 bp) and ends before glutamine 1638 (Q1638; 4969 bp) for a total deletion of 2682 bp (SQ version).
  • the coding sequence for human recombinant Fc was obtained by RT-PCR from a human leukocyte cDN A library (Clontech) using Fc specific primers. Primers were designed such that the B-domain deleted FVIII sequence was fused directly to the N- terminus of the Fc sequence with no intervening linker.
  • the FVIIIFc DNA sequence was cloned into the mammalian dual expression vector pB UDCE4.1 (Invitrogen) under control of the CMV promoter.
  • a second identical Fc sequence including the mouse Igk signal sequence was obtained by RT-PCR and cloned downstream of the second promoter, FT ' I a, in the expression vector pBUDCE4.1. This final construct was designated pSYN-FVIII- 013.
  • a second plasmid was created from similar constructs using PGR and standard molecular biology techniques, in order to express rFVIIIBDD-Fc-Fc in which the rFVIIIBDDFc coding sequence was fused, to the second Fc sequence with a
  • the FVII-G10 construct is one in which the heavy chain of factor VII was expressed in the context of an scFc scaffold and the light chain was expressed separately.
  • the FVII-013 construct is one in which the light chain was expressed in the context of an scFc scaffold and the heavy chain was expressed separately.
  • the heavy chain of FVII was epressed as an Fc fusion protein and the light chain of FVII was separately expressed as a separate Fc fusion protein.
  • the 039 construct was made in the context of an scFc scaffold.
  • the construct included the FVII light chain, the FXIa cleavage site, and the FVII heavy chain with a I153V mutation in linear sequence attached to the N -terminus of the first
  • the 040 construct was also made in the context of an scFc scaffold.
  • the construct included the FVII light chain with an R152 deletion, the FXIa cleavage site, and the FVn heavy chain with an II 53V mutation in linear sequence attached to the N- temiinus of the first Fc moiety.
  • the DFTR cleavage sequence is a natural FXIa sequence found in FIX. In FIX, the DFTR sequence is followed by a valine, so an II 52V mutation was introduced in pSYN-FVTi-039, -040 to increase FXIa cleavage efficiency
  • HEK-293-F cells were grown in suspension in Freestyle media (Invitrogen) supplemented with vitamin K3 (For FVII and FIX transfections only) (Sigma Aldrich, St. Louis, MO) to 2 ⁇ ig liter (growth media) as suspension cells at 37° C/10% C0 2 . Cells we subcultured every three to four days by seeding at cell density of 5x10 3 cells/ml.
  • transfection media Twenty-four hours prior to transfection cells were seeded at a density of 7xl0 5 cells/ml in growth media supplemented with LONGTMR3IGF- 1 (Sigma Aldrich, St. Louis, MO) to 20 ⁇ g/liter (transfection media). On the day of transfection, a transfection solution was made with a volume equal to 5% of the total volume of the cell culture to be transfected. In the transfection solution DNA was added (final concentration 20 mg/L) to a freshly made solution of PEI (60 mg/L) in transfection media. The solution was swirled for 30 seconds and incubated for five minutes at room temperature before adding directly to the cell culture. Four hours later a volume equal to the cell culture volume of OptiCHO (Invitrogen)
  • FVIIFc molecules were purified from conditioned media using the following columns: 1 ) Anion exchange chromatography with pseudo-affinity elution (e.g. Q sepharose 4FF (GE Healthcare) followed by elution with varying levels of CaC1 2 to selectively elute the most active species), followed by 2) shFcRn (soluble human FeRn) affinity (NHS- coupled shFcRn with sepharose 4FF beads)
  • pseudo-affinity elution e.g. Q sepharose 4FF (GE Healthcare) followed by elution with varying levels of CaC1 2 to selectively elute the most active species
  • shFcRn soluble human FeRn affinity
  • FVII-028 and -053 were purified from conditioned media using the following columns: 1) Hydrophobic interaction chromatography (e.g. Phenyl FF (high sub) (GE Healthcare)), followed by 2) Anion/cation exchange chromatography with salt elution. These purification steps utilized standard methods known to those in the art to generate purified proteins of >95% purity by SEC analysis and SDS-PAGE. Example 12. Purification of FIX-090
  • FIX-090 was purified through a 2-step chromatography process, first using an immunoaffmit ⁇ ' chromatography step with an anti-GLA domain antibody, followed by anion exchange chromatography using pseudoaffinity elution similar to FIXFc proteins described above. These purification steps utilized standard methods known to those in the art to generate purified proteins of >95% purity by SEC analysis and SDS-PAGE. .
  • F VIIIFc proteins were purified from clarified and chemically defined harvest media using a two or three column purification process, including a FVTII- specific affinity purification step (McCue 2009) followed by a combination of anion exchange with standard NaCl elution and/or shFcRn (soluble human FcRn) affinity (NHS- coupled shFcRn with sepharose 4FF beads) chromatography, binding Fc- containing proteins at low pH (e.g. pH 6.2) and eluting at neutral pH (e.g. pH 8.0).
  • FVTII- specific affinity purification step McCue 2009
  • shFcRn soluble human FcRn affinity
  • NHS- coupled shFcRn with sepharose 4FF beads binding Fc- containing proteins at low pH (e.g. pH 6.2) and eluting at neutral pH (e.g. pH 8.0).
  • These purification steps utilized standard methods known to those in the art to generate purified proteins of >95% purity by SEC
  • FVIIaFc variants Specific activity of the FVIIaFc variants was determined by the soluble tissue factor method. Unlike lipidated full length tissue factor, soluble tissue factor (extracellular portion of tissue factor) can't activate FVII into FVIIa, but it acts as an activator of the conversion of factor X into factor Xa by FVIIa.
  • a STACLOT ⁇ FVII-rTF kit (Diagnostica Stago, Asnieres, France) was used following manufacturer's recommendations. Table 1 summarizes the data and. shows comparable specific activity for all variants.
  • ADP Sigma Aldrich, cat# A2754, stock 1 mM, working concentration 10 uM SFLLRN peptide: in-house synthesis, stock concentration 5 mg/ml (6.7 mM), working coiicentration 50 ug/ml (67 uM)
  • FVU antibody-FITC- labeled Affinity Biologicals SAFVII-APFTC
  • Platelet buffer 15 mM HEPES, 138 mM NaCl, 2.7 mM KC1, 1 mM MgC12, 5 mM
  • Prothrombin HTI, cat#HCP-0010, lot# Z0128, 4.8 mg/ml
  • Thrombin Calibrator Thrombinoscope, cat# TS20.00
  • Platelet buffer 15 mM Hepes pH 7.4, 138 mM NaCl, 2.7 mM C1, 1 mM MgC32, 5.5 niM Dextrose, supplemented with 1 mg/ml BSA before using
  • ADP Sigma Aldrieh, cat# A2754, stock 1 mM, working concentration 10 uM SFLLR peptide: in-house synthesis, stock concentration 5 mg/ml (6.7 mM), working concentration 50 ug/ml (67 uM)
  • conditioned media from transfections of pSY -FVTI-010, 011, -013, -018, -003, -019 -020 and -024 were subjected to protein A immunoprecipitation. Briefly, cell culture supernatant was mixed with approximately 50 ul of protein A-Sepharose 50% slurry and incubated at 4°C with rocking for 1 hour, then centrifuged to pellet the protein A beads. Beads were washed twice by resuspending in 1 ml of PBS, spinning and aspirating.
  • the beads were resuspended with sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing or nonreducing conditions, heated for 5 minutes at 10Q°C, spun down and loaded on SDS-PAGE gels and run according to standard protocols. Gels were transferred to nitrocellulose membranes and Western blots were performed to detect the Fc region or the FVII light chain.
  • the antibody used was a goat a ti -human IgG (Fc specific)-horseradish peroxidase conjugate (Pierce ImmunoPure antibody, catalog #31413).
  • FVII light chain detection an anti light chain monoclonal antibody was used (Green Mountain, clone 6MA-219).
  • the antibodies were diluted 1 : 15,000 (for Fc detection) or 1 :200 (for light chain detection) in PBST (PBS with 0, 1 % Tween-20) with 5% nonfat dry milk and incubated with the membrane for I hour at room temperature.
  • the membrane was then washed in PBST 3 times for 10 minutes and signal was detected by a chemiluminescent method for Fc detection.
  • the membrane was further incubated for one hour in a solution containing HRP-labeled goat anti-mouse antibody (Southern Biotech, # 1010-05) diluted 1 :5000 in PBST.
  • the membrane was also washed in PBST 3 times for 10 minutes and the signal was detected by a chemiluminescent method, Chemiluminescent detection was performed using ECL Plus Western Blotting Detection System (Amersham Biosciences catalog #RPN2132) according to manufacturer's protocol Signal was visualized in a Storm 840 P osphorimager (Molecular Devices).
  • FXIa Failure of FXIa to cleave FVII-039 and FVII-040 may have been caused by inaccessibility of the protease to the cleavage site by steric hindrance.
  • the sites will be placed upstream of the heavy chain in a structure where the heavy chain is not preceded by the light chain (Light chain-1 mker-Fc-scFcfinker-FXIa/thrombin cleavage site-heavy chain-lmker- Fc).
  • the heavy chain will comprise the II 52V mutation.
  • a cscFc will be introduced so that the cell secretes a heterodimeric protein with the following structure: light chain-linker-Fc which is disulfide bonded to a second chain: FXIa/thrombin cleavage site-heavy chain-linker Fc.
  • Example 21 A Factor VII Activatable Construct
  • FVII-090 To 125 iiM of FVII-090, FVTI- 089, FVII-062, or plasma-derived FVII (FVII) increasing concentrations of thrombin were added, and incubated for 10 minutes at 37°C. The mixture was run on SDS- PAGE gel to determine cleavage by thrombin ( Figure 33). Generation of FVII light chain-Fc and FVII heavy chain-Fc was observed for FVII-089 and FVII-090 after incubation with thrombin. The fact that there was no cleavage of plasma-derived FVII or the FVII-062 negative control by thrombin shows specificity.
  • Thrombin generation assays were used to measure activity of activatable variant FVII-090.
  • a thrombin generation assays in FVIII-deficient platelet-rich plasma was performed as previously described, but replacing clotting factors and platelets with FVIII-deficient platelet-rich plasma.
  • the results depicted in Figure 34 are from an assay in which thrombin generation was activated with 50 nM of FVIIaFc. As shown in Figure 34, thrombin is generated by 50 nM of FVIIaFc.
  • FVII-090 (not F VIX-062, the negative control) to 50 nM of FVIIaFc results in a significant increase in thrombin generation, suggesting that FVI-- 090 becomes activated by thrombin generated by FVIIaFc.
  • FVII- 1 An additional high specific activity version of Factor VII, FVII- 1 15, was constructed.
  • the 170 loop is wild type, but there are three point mutations in the heavy chain of FVII, V158D, E296V and M298Q.
  • FVII- 100 and FVII-115 are illustrated in Figure 41
  • FVII-01 l(wild type FVIIaFc) is 10,000 IU/mg.
  • FVII-090 has a specific activity of 0.32 lU/rag,
  • FVII- 100 has a specific activity of 0.25 IU/mg, and
  • FVII-115 has a specific activity of 14 IU/mg.
  • each of the activatable forms is essentially inactive in this assay.
  • Thrombin generation assays were used to measure activity of acdvatable variant FVII-090 and high specific activity variant FVII- 100. As set forth previously herein, thrombin generation was tested in a reconstituted system with human platelets, Factor X, Factor V, prothrombin, antithrombin and tissue-factor pathway inhibitor. Activity was measured with or without 5 iiM thrombin activation.
  • chromogenic assays were used to measure FVII activity.
  • One of the assays used measures the amidolytic activity of FVIIaFc by measuring the cleavage of a chromogenic substrate by FVIIa.
  • Another of these measures the FX activation activity by measuring the ability of F VIIa to activate FX, as determined by measuring levels of a chromogenic substrate that is cleaved by activated FX (FXa).
  • amidolytic activity of the activatable variants can be measured following thrombin activation and there is increased amidolytic activity for the high specific activity variants as compared to FVH-090.
  • hirudin is added to inhibit thrombin cleavage of the chromogenic substrate. In this manner, the thrombin does not interfere with the ability to detect FVIIa activity.
  • FVIIa The activation of FX by FVIIa is also enhanced in the high specific activity FVII activatable variants.
  • substrate S2765 was used to measure activation of FX by FVIIa. This chromogenic substrate is also recognized by FX.
  • 10 uM of FX was incubated with FVIIaFc for 15 minutes and the reaction was quenched with EDTA.
  • Figure 39 shows the results of the control experiment which demonstrates that FX activation by FVIIaFc can be detected.
  • Example 24 Monomeric Fc molecules easi also be synthesized in activatable form
  • FVII-1 18 had an activity of 4.5 lU/mg and FVII- 127 had an activity of 1.8 lU/mg, demonstrating that these molecules had essentially no activity in their activatable form.
  • Thrombin cleavage reactions of FVII- 118, F VII- 119 and FVII--09G followed by SDS PAGE analysis were performed as previously described.
  • the cleavage site in an activatable construct can be cleaved in the context of both the monomer and. heterodimer Fc molecules.
  • the decrease in the intensity of the nonactivated FVIIFc band with increasing thrombin concentration is similar for the FVII- 1 18, FVII- 1 19, and FVII-090 constructs.
  • FVII- 127 Another activatable monomelic construet,FVTI- 127, was made and tested.
  • FVII- 127 has the backbone of FVII- 118, but the same 170 loop substitution used in FVII- 100 to confer high specific activity.
  • the activity of FVII- 127 is significantly increased as compared to FVII-118 lacking the high specific activity amino acid substitution.
  • High activity with longer initiation time for F VII- 127 in the absence of thrombin suggests that residual levels of tissue factor, thrombin or contact pathway activation can generate enough thrombin to activate FVII- 127 without exogenous addition of thrombin.
  • FVII- 127 activity is accelerated by thrombin.
  • the SCE5 targeting moiety was placed at the N-terminus (FVII-066) or C terminus (FVII- 067) of the second Fc moiety of FVIIaFc, In addition, the SCE5 was placed at the C- terminus of FVIIa (FVII-094).
  • FVIIaFc (FVII-011) and Novoseven were used, as controls. As shown in Figure 44B, these proteins were tested, by thrombin generation assays in FVIII-deficient human plasma as previously described. These experiments revealed, increased rates of thrombin generation for all the proteins containing the SCE5 targeting moiety relative to the controls.
  • FVII-G66 was tested in thrombin generation assays using mouse F VHI-deficient platelet rich pasma, as well as in a reconstituted system using human purified components and platelets, as previously described ( Figure 29). We observed increased rates of thrombin generation for FVH- ⁇ relative to the controls in both systems.
  • construct FVII-027 illustrated in Figure 12 A was cloned, expressed (with PCS cotransfection to fully process the cscFc linker, described in the protein sequence, connecting the first Fc moiety to the platelet targeting moiety), purified and activated as previously described.
  • This construct employs the targeting moiety MB9, a scFv that has been shown to bind to the active conformation of GPIIbllla.
  • FACS assays were performed as previously described to assess binding to activated platelets, and FV11-027 was shown to bind to activated platelets with higher affinity than the FVII-01 1 control ( Figure 12B).
  • Thrombin generation assays were performed with reconstituted purified human proteins and platelets as previously decribed ( Figures 13 A, 13B and 13C).
  • FVII-027 showed increased rates of thrombin generation relative to the controls.
  • Figure 13D illustrates that FVII-027 has four times more activity than FVII-01 1 or Novoseven, based on thrombin generation assays.
  • Figure 14 illustrates that the enhanced platelet binding and thrombin generation activity of FVII-027 were abrogated by PACI, an antibody that competes with MB9 for binding to the activated form of GPIIbllla, demonstrating the effects are mediated by the interaction of MB 9 with the activated form of GPIIbllla,
  • the MB9 targeting moiety was also placed at the C-terminus of the second Fc moiety of FVIIaFc to generate FVTI-037 illustrated in Figure 15.
  • Thombin generation assays in a FVIII- deficient reconstituted sy stem with platelets revealaed increased rates of thrombin generation for FVII-037 relative to the Novoseven control ( Figure 16)
  • Example 27 Factor VII constructs targeted to both activated and nonactivated platelets
  • the constructs illustrated in Figure 45 A were cloned, expressed, purified and activated as previously described.
  • FVII-088 was cotransfected with PC5 to fully process the cscFc linker, described in the protein sequence, connecting the first Fc moiety to the platelet targeting moiety.
  • FVII-088 and FVII-125 employed the AP3 targeting moiety, a scFv that binds to both active and nonactive conformations of human GPIIbllla.
  • Rotation Thromboelastometry (ROTEM®. Pentapharm GmbH, Munich, Germany) is another method to evaluate platelet- targeted FVIIa constructs, since it allows for the characterization of several coagulation parameters in whole blood (in the presence of platelets).
  • the ability of FVII-088 and wild type recombinant FVIlaFc (rFVIIaFc) to form firm and stable clots was evaluated by ROTEM with Calcium Chloride as activator (NATEM) following manufacturer's recommendations.
  • Hemophilia A blood from a human donor was spiked with FVIIFc to a final concentration of 100, 30 or 10 iiM.
  • the NATEM reaction was initiated by the addition of CaC3 ⁇ 4.
  • Coagulation parameters including Clotting Time (relates to coagulation initiation time), Clot Formation Time (relates to rates of coagulation) and Alpha Angle (relates to rates of coagulation) were assessed as shown in Figure 30, FVII-088 showed a significant reduction in the Clotting Time and Clot Forming Time and an increase in the alpha angle relative to wild type rFVIIaFc, consistent with enhanced coagulation kinetics for FVII-088.
  • Example 28 Use of peptides for targeting FVIIa to platelets
  • the FV11-044 construct employed the PS4 peptide attached to the C terminus of the second Fc moiety of the construct;
  • FVII-045 employed the OSI peptide attached to the C terminus of the second Fc moiety of the construct;
  • the FVii-046 construct employed the OS2 molecule attached to the C terminus of the second Fc moiety of the constract.
  • the F VH-047 constract employed the PS4 peptide attached to the N terminus of the second Fc moiety of the construct
  • the FVII-048 molecule employed the OSI peptide attached to the N- terminus of the second Fc moiety of the construct
  • the F VII- 049 molecule employed the OS2 peptide attached to the >] -terminus of the second Fc moiety of the construct.
  • Thrombin generation assays were performed using FVIII-deficient platelet rich plasma as previously described.
  • Figure 47B shows that the FVII-045 constract may be marginally better than the F VII-048 construct in this assay, but that again both the N and C terminal fusions are better than the Novoseven control.
  • Figure 48 shows the published GPIb-alpha affinity for each peptide (Figure 48) and the increase in the activity associated with that peptide when recombinantly fused to FVIIaFc.
  • Figure 48 shows the binding of FVII-049, FVII-048 and wild type FVIIaFc (FVII-01 i control) to activated platelets as determined by FACS as well as the affinity for the targeting peptides reported in Bernard et al. Biochemistry 2008. 47:4674-4682.
  • FACS data revealed increased affinity of FVII-045 and FVII-048 for platelets relative to the FVII-01 i control
  • Example 29 An FVIIIFc variant targeted to the active form of GPIifoilia
  • FVIII-041 is wild type FVIIIFc
  • FVIII-108 has a SCE5 platelet targeting moiety at the N-terminus of the second Fc moiety.
  • FVIII- 108 was cotransfected with PCS to fully process the cscFc linker, described in the protein sequence, connecting the first Fc moiety to the platelet targeting moiety.
  • These proteins were tested in thrombin generation assays using FVJll deficient platelet rich plasma as previously described, but in addition the thrombin generation assay was also activated with tissue factor As shown in Figure 49B, no significant improvement w r as seen using the targeted version of FVlIIFc. It is noteworthy that the thrombin generation assays described herein measure thrombin generation on the surface of platelets and, therefore, are an accurate measure of activity.
  • Example 30 Making and testing a version of FVil targeted to platelets that lacks a Gla domain
  • FVIIaFc illustrated in Figure 21 was generated.
  • This protein has the MB9 scFv at the - terminus and a deletion that removes the Gla domain.
  • FVII-053 contains an RKRRKR sequence inserted between the light and heavy chain for intracellular activation.
  • FVII-053 was transiently expressed (cotrasnfected. with PCS for processing of the RKRRKR. sequence which results in activation of the protein) and purified as previously described.
  • Thrombin generation assays with purified components and platelets reveal that FVII-053 has some activity (Figure 22), even though this activity is compromised relative to the F VII- 01 1 control ( Figure 22D).
  • FIX-068 was cotransfected with PCS to fully process the cscFc linker, described in the protein sequence, connecting the first Fc moiety to the platelet targeting moiety.
  • FIX-068 has the SCE5 platelet targeting moiety at the -terminus of the second Fc moiety, while FIX-088 has SCE5 at the C-terminus of the second Fc moiety.
  • FIX-090 is a FIX construct without an Fc domain and has the SCE5 moiety attached at the C-terminus of the FIX protein.
  • FIX-042 is a FIXFc as a single chain Fc without a targeting moiety and was made as a control BeneFIX (Pfizer) was also used as a control.
  • BeneFIX Pfizer
  • the BeneFIX sample was treated with the irreversible active site inhibitor glutamyl-glyeyl-arginyl- chloromethylketone (Hematologic Technologies). BeneFIX was incubated with an excess amount of the inhibitor for 180 minutes at room temperature. The sample was then dialyzed to remove unbound mhibitor. The treated. BeneFIX is hereafter referred to as BeneFIX.
  • FIX-090 (which lacks an Fc) also shows increased activity relative to BeneFIX, suggesting that targeting FIX to platelets in the absence of Fc also increases activity.
  • Figure 52B shows that the activity of FIX-090 is at least 4 times that of BeneFIX. Since both FIX-090 and BeneFIX have similar specific activities, the 4-fold increase in activity in thrombin generations assays must be caused by the platelet targeting effect Example 32.
  • the FIX-089 construct illustrated in Figure 53A was cloned, transiently expressed and. purified as previously described.
  • the molecule comprises the OS1 peptide, which binds to GPTb-alpha receptor, attached to the N- terminus of the second Fc moiety of the construct.
  • the specific activity of the FIX- 089 construct was 2.4 IU/nmol as compared to 6 IU/nmol for the control FIX-042 molecule,
  • the FIX-089 molecule is more active than the FIX-042 control in thrombin generation assays with FIX-platelet rich plasma; this is particularly evident at limiting concentrations of FIX.
  • Figure 53C demonstrates that FIX-089 is roughly 4-times stronger than FIX-042 as measured by thrombin generation, while having a lower specific activity. This further suggests that targeting to GPIb increases the activity of FIXFc.
  • FVII-027 amino acid sequence Signal sequence is shown in dotted underline, propeptide is double underlined, linker region connecting FVTI orMB9 to Fc region is underlined, and linker with proprotein convextase processing sites is shown in bold
  • gggagagcaa gggcagccg gagaacaact acaagaccac gcctcccgtg ttggactccg acggctcctt cttcctcT;ac agcaagctca ccgtggacaa gagcaggtgg cagcagggga acgtcttctc atgctccgtg atgcatgagg ctctgcacaa ccactacacg cagaagagcc tccctgtc tcgggtaa gagaattc
  • FVll-037 amino acid sequence Signal sequence is shown in dotted, underline, propeptide is double underlined, linker region connecting FVII or MB 9 to Fc region is underlined, and linker connecting both Fes sites is shown in bold.
  • FVII-053 amino acid sequence Signal sequence is shown in dotted underline, linker region connecting FVII to Fc region is underlined, linker connecting both Fes sites is shown in bold, and MB 9 is italicized
  • FVII-044 amino acid sequence Signal sequence is shown in dotted underline, propeptide is double underlined, linker region connecting FVII or PS4 to Fc region is underlined, linker connecting both Fes sites is shown in bold, and PS4 peptide is italicized
  • FVII-045 amino acid sequence Signal sequence is shown in dotted underline, propeptide is double underlined, linker region connecting FVII or OS! to Fc region is underlined, linker connecting both Fes sites is shown in bold, and OS1 peptide is italicized
  • FVII-G46 amino acid sequence Signal sequence is shown in dotted underline, propeptide is double underlined, linker region connecting FVII or OS2 to Fc region is underlined, linker connecting both Fes sites is shown in bold, and OS2 peptide is italicized
  • FViI-047 amino acid sequence Signal sequence is shown in doited underline, propeptide is double underlined, linker region connecting FVII or PS4 to Fc regions is underlined, and PS4 peptide is italicized
  • FVII-049 amino acid sequence Signal sequence is shown in dotted underline, propeptide is double underlined, linker region connecting FVll or OS2 to Fc regions is underlined, and OS2 peptide is italicized
  • FVn-011 amino acid sequence Signal sequence is shown in dotted underline, propeptide is double underlmed, Gla domam is italicized, linker region connecting FVll to Fc region is underlined, and linker connecting both Fes sites is shown in bol
  • YISWLQKLMR SEPRPGVLLR APFPGGGGSG GGGSGGGG3G GGGSGGGGSG GGGSD THTC.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Diabetes (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)
  • Materials For Medical Uses (AREA)
PCT/US2011/043597 2010-07-09 2011-07-11 Chimeric clotting factors Ceased WO2012006633A1 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
AU2011274423A AU2011274423B2 (en) 2010-07-09 2011-07-11 Chimeric clotting factors
EA201291482A EA201291482A1 (ru) 2010-07-09 2011-07-11 Химерные факторы коагуляции
US13/809,289 US20130216513A1 (en) 2010-07-09 2011-07-11 Chimeric Clotting Factors
NZ605400A NZ605400A (en) 2010-07-09 2011-07-11 Chimeric clotting factors
SG2012096608A SG186875A1 (en) 2010-07-09 2011-07-11 Chimeric clotting factors
JP2013518877A JP2013534427A (ja) 2010-07-09 2011-07-11 キメラの凝固因子
KR1020137003461A KR20140002601A (ko) 2010-07-09 2011-07-11 키메라 응고 인자
CA2804280A CA2804280A1 (en) 2010-07-09 2011-07-11 Chimeric clotting factors
DK11738538.5T DK2591099T3 (da) 2010-07-09 2011-07-11 Kimære koagulationsfaktorer
MX2013000301A MX2013000301A (es) 2010-07-09 2011-07-11 Factores quimericos de coagulacion.
CN2011800424499A CN103180439A (zh) 2010-07-09 2011-07-11 嵌合凝血因子
BR112013000652A BR112013000652A2 (pt) 2010-07-09 2011-07-11 fatores de coagulação quiméricos.
EP11738538.5A EP2591099B1 (en) 2010-07-09 2011-07-11 Chimeric clotting factors
US15/221,420 US10968442B2 (en) 2010-07-09 2016-07-27 Chimeric clotting factors
US17/222,636 US20210355473A1 (en) 2010-07-09 2021-04-05 Chimeric clotting factors

Applications Claiming Priority (14)

Application Number Priority Date Filing Date Title
US36318610P 2010-07-09 2010-07-09
US36318310P 2010-07-09 2010-07-09
US61/363,186 2010-07-09
US61/363,183 2010-07-09
US201161442055P 2011-02-11 2011-02-11
US201161442029P 2011-02-11 2011-02-11
US201161442150P 2011-02-11 2011-02-11
US61/442,029 2011-02-11
US61/442,150 2011-02-11
US61/442,055 2011-02-11
US201161467880P 2011-03-25 2011-03-25
US61/467,880 2011-03-25
US201161491762P 2011-05-31 2011-05-31
US61/491,762 2011-05-31

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/809,289 A-371-Of-International US20130216513A1 (en) 2010-07-09 2011-07-11 Chimeric Clotting Factors
US15/221,420 Continuation US10968442B2 (en) 2010-07-09 2016-07-27 Chimeric clotting factors

Publications (1)

Publication Number Publication Date
WO2012006633A1 true WO2012006633A1 (en) 2012-01-12

Family

ID=44629302

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2011/043597 Ceased WO2012006633A1 (en) 2010-07-09 2011-07-11 Chimeric clotting factors
PCT/US2011/043599 Ceased WO2012006635A1 (en) 2010-07-09 2011-07-11 Processable single chain molecules and polypeptides made using same

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2011/043599 Ceased WO2012006635A1 (en) 2010-07-09 2011-07-11 Processable single chain molecules and polypeptides made using same

Country Status (22)

Country Link
US (6) US9856468B2 (cg-RX-API-DMAC7.html)
EP (3) EP3560962A1 (cg-RX-API-DMAC7.html)
JP (1) JP2013534427A (cg-RX-API-DMAC7.html)
KR (1) KR20140002601A (cg-RX-API-DMAC7.html)
CN (1) CN103180439A (cg-RX-API-DMAC7.html)
AU (1) AU2011274423B2 (cg-RX-API-DMAC7.html)
CA (1) CA2804280A1 (cg-RX-API-DMAC7.html)
CY (1) CY1122044T1 (cg-RX-API-DMAC7.html)
DK (2) DK2591006T3 (cg-RX-API-DMAC7.html)
EA (1) EA201291482A1 (cg-RX-API-DMAC7.html)
ES (1) ES2739503T3 (cg-RX-API-DMAC7.html)
HR (1) HRP20191305T1 (cg-RX-API-DMAC7.html)
HU (1) HUE044419T2 (cg-RX-API-DMAC7.html)
LT (1) LT2591006T (cg-RX-API-DMAC7.html)
MX (1) MX2013000301A (cg-RX-API-DMAC7.html)
NZ (1) NZ605400A (cg-RX-API-DMAC7.html)
PL (1) PL2591006T3 (cg-RX-API-DMAC7.html)
PT (1) PT2591006T (cg-RX-API-DMAC7.html)
SG (2) SG186875A1 (cg-RX-API-DMAC7.html)
SI (1) SI2591006T1 (cg-RX-API-DMAC7.html)
TW (2) TW201217527A (cg-RX-API-DMAC7.html)
WO (2) WO2012006633A1 (cg-RX-API-DMAC7.html)

Cited By (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013096932A1 (en) * 2011-12-23 2013-06-27 Vasculogics, Inc. Compositions and methods for treatment of thrombosis and prolonging survival of stored platelets
WO2013185114A2 (en) 2012-06-08 2013-12-12 Biogen Idec Ma Inc. Chimeric clotting factors
WO2014063108A1 (en) 2012-10-18 2014-04-24 Biogen Idec Ma Inc. Methods of using a fixed dose of a clotting factor
US8716448B2 (en) 2009-02-03 2014-05-06 Amunix Operating Inc. Coagulation factor VII compositions and methods of making and using same
EP2727940A1 (en) * 2012-10-31 2014-05-07 Samsung Electronics Co., Ltd Bispecific antigen binding protein complex and preparation methods of bispecific antibodies
WO2014138449A1 (en) * 2013-03-06 2014-09-12 Merrimack Pharmaceuticals, Inc. Anti-c-met tandem fc bispecific antibodies
WO2015023894A1 (en) 2013-08-14 2015-02-19 Biogen Idec Ma Inc. Recombinant factor viii proteins
WO2014194282A3 (en) * 2013-05-31 2015-03-12 Biogen Idec Ma Inc. Chimeric fvii-xten molecules and uses thereof
JP2015508077A (ja) * 2012-02-10 2015-03-16 ジェネンテック, インコーポレイテッド 単鎖抗体及び他のヘテロ多量体
WO2015095809A1 (en) 2013-12-20 2015-06-25 Biogen Idec Ma Inc. Use of perfusion seed cultures to improve biopharmaceutical fed-batch production capacity and product quality
WO2016061286A2 (en) 2014-10-14 2016-04-21 Halozyme, Inc. Compositions of adenosine deaminase-2 (ada2), variants thereof and methods of using same
WO2016065301A1 (en) 2014-10-23 2016-04-28 Biogen Ma Inc. Anti-gpiib/iiia antibodies and uses thereof
WO2016070050A1 (en) 2014-10-31 2016-05-06 Biogen Ma Inc. ANTI-GLYCOPROTEIN IIb/IIIa ANTIBODIES
US9371369B2 (en) 2009-02-03 2016-06-21 Amunix Operating Inc. Extended recombinant polypeptides and compositions comprising same
EP2858659A4 (en) * 2012-06-08 2016-09-28 Biogen Ma Inc PROKOAGULATIONSVERBINDUNGEN
US9486507B2 (en) 2011-06-10 2016-11-08 Biogen Ma Inc. Pro-coagulant compounds and methods of use thereof
EP3003368A4 (en) * 2013-05-24 2017-05-03 Biogen MA Inc. Anti-gpiib/iiia antibodies or uses thereof
WO2017079768A1 (en) * 2015-11-08 2017-05-11 Genentech, Inc. Methods of screening for multispecific antibodies
US9856468B2 (en) 2010-07-09 2018-01-02 Bioverativ Therapeutics Inc. Processable single chain molecules and polypeptides made using same
US9938331B2 (en) 2005-09-27 2018-04-10 Amunix Operating Inc. Biologically active proteins having increased in vivo and/or in vitro stability
US9994646B2 (en) 2009-09-16 2018-06-12 Genentech, Inc. Coiled coil and/or tether containing protein complexes and uses thereof
WO2018144623A1 (en) 2017-01-31 2018-08-09 Bioverativ Therapeutics Inc. Factor ix fusion proteins and methods of making and using same
US10106600B2 (en) 2010-03-26 2018-10-23 Roche Glycart Ag Bispecific antibodies
US10106612B2 (en) 2012-06-27 2018-10-23 Hoffmann-La Roche Inc. Method for selection and production of tailor-made highly selective and multi-specific targeting entities containing at least two different binding entities and uses thereof
US10138291B2 (en) 2012-07-11 2018-11-27 Bioverativ Therapeutics Inc. Factor VIII complex with XTEN and von Willebrand Factor protein, and uses thereof
EP3307304A4 (en) * 2015-06-12 2018-12-26 UBI Pharma Inc. Immunoglobulin fusion proteins and uses thereof
US10370430B2 (en) 2012-02-15 2019-08-06 Bioverativ Therapeutics Inc. Recombinant factor VIII proteins
US10421798B2 (en) 2012-02-15 2019-09-24 Bioverativ Therapeutics Inc. Factor VIII compositions and methods of making and using same
WO2019241847A1 (en) * 2018-06-22 2019-12-26 Baker Heart and Diabetes Institute A therapeutic gpiib/iiia binding-protein drug conjugate and use thereof
US10548953B2 (en) 2013-08-14 2020-02-04 Bioverativ Therapeutics Inc. Factor VIII-XTEN fusions and uses thereof
US10584147B2 (en) 2013-11-08 2020-03-10 Biovertiv Therapeutics Inc. Procoagulant fusion compound
US20200085922A1 (en) * 2017-03-14 2020-03-19 Ohio State Innovation Foundation Methods and compositions related to a tissue factor-targeting igg3 immunoconjugates
US10633457B2 (en) 2014-12-03 2020-04-28 Hoffmann-La Roche Inc. Multispecific antibodies
WO2020086408A1 (en) 2018-10-26 2020-04-30 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services A high-yield perfusion-based transient gene expression bioprocess
WO2020118069A2 (en) 2018-12-06 2020-06-11 Bioverativ Therapeutics Inc. Use of lentiviral vectors expressing factor ix
US10717965B2 (en) 2013-01-10 2020-07-21 Gloriana Therapeutics, Inc. Mammalian cell culture-produced neublastin antibodies
US10745680B2 (en) 2015-08-03 2020-08-18 Bioverativ Therapeutics Inc. Factor IX fusion proteins and methods of making and using same
US20210309985A1 (en) * 2018-08-20 2021-10-07 Ucl Business Ltd Factor ix encoding nucleotides
EP3903599A1 (en) 2013-09-25 2021-11-03 Bioverativ Therapeutics Inc. On-column viral inactivation methods
US11168125B2 (en) 2003-05-06 2021-11-09 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US11192936B2 (en) 2014-01-10 2021-12-07 Bioverativ Therapeutics Inc. Factor VIII chimeric proteins and uses thereof
US11325983B2 (en) 2019-04-17 2022-05-10 Novo Nordisk A/S Bispecific antibodies
US11370827B2 (en) 2012-01-12 2022-06-28 Bioverativ Therapeutics Inc. Chimeric factor VIII polypeptides and uses thereof
US11421022B2 (en) 2012-06-27 2022-08-23 Hoffmann-La Roche Inc. Method for making antibody Fc-region conjugates comprising at least one binding entity that specifically binds to a target and uses thereof
US20220323590A1 (en) * 2019-07-02 2022-10-13 Jiangsu Gensciences Inc. Improved fix fusion protein and conjugate and use thereof
CN116261592A (zh) * 2020-08-18 2023-06-13 昂希莱斯制药公司 经修饰的丝氨酸蛋白酶前蛋白
WO2023133469A3 (en) * 2022-01-07 2023-08-24 Codexis, Inc. Recombinant factor viii variants
US11753461B2 (en) 2016-02-01 2023-09-12 Bioverativ Therapeutics Inc. Optimized factor VIII genes
US11787851B2 (en) 2013-02-15 2023-10-17 Bioverativ Therapeutics Inc. Optimized factor VIII gene
EP4368194A2 (en) 2013-06-28 2024-05-15 Bioverativ Therapeutics Inc. Thrombin cleavable linker with xten and its uses thereof
US12030925B2 (en) 2018-05-18 2024-07-09 Bioverativ Therapeutics Inc. Methods of treating hemophilia A
US12161696B2 (en) 2016-12-02 2024-12-10 Bioverativ Therapeutics Inc. Methods of treating hemophilic arthropathy using chimeric clotting factors
US12173307B2 (en) 2020-06-24 2024-12-24 Bioverativ Therapeutics Inc. Methods for the purification of viral vectors
US12275970B2 (en) 2014-06-30 2025-04-15 Bioverativ Therapeutics Inc. Optimized factor IX gene
US12403164B2 (en) 2019-09-30 2025-09-02 Bioverativ Therapeutics Inc. Lentiviral vector formulations
US12516307B2 (en) 2020-08-18 2026-01-06 Onchilles Pharma, Inc. Modified porcine pancreatic elastase proteins
US12617839B2 (en) 2021-11-05 2026-05-05 Bioverativ Therapeutics Inc. Factor VIII chimeric proteins and uses thereof

Families Citing this family (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2758994T3 (es) 2010-11-05 2020-05-07 Zymeworks Inc Diseño anticuerpo heterodimérico estable con mutaciones en el dominio Fc
AU2012222833B2 (en) 2011-03-03 2017-03-16 Zymeworks Inc. Multivalent heteromultimer scaffold design and constructs
PT3513804T (pt) * 2011-07-08 2022-06-02 Bioverativ Therapeutics Inc Polipéptidos fator viii híbridos e quiméricos, e métodos de utilização dos mesmos
BR112014010580B1 (pt) 2011-11-04 2021-01-12 Zymeworks, Inc. constructo de fc heteromultimérico isolado, composição, uso de um constructo de fc heteromultimérico isolado, composição de ácido nucléico e método para expressar o constructo de fc heteromultimérico isolado
KR101963230B1 (ko) * 2011-12-26 2019-03-29 삼성전자주식회사 복수개의 단일 항체를 포함하는 단백질 복합체
KR20150008171A (ko) * 2012-05-10 2015-01-21 자임워크스 인코포레이티드 단일군 일가 항체 구조물 및 그의 용도
US9499634B2 (en) 2012-06-25 2016-11-22 Zymeworks Inc. Process and methods for efficient manufacturing of highly pure asymmetric antibodies in mammalian cells
WO2014012082A2 (en) 2012-07-13 2014-01-16 Zymeworks Inc. Multivalent heteromultimer scaffold design an constructs
KR101974583B1 (ko) * 2012-08-29 2019-05-02 삼성전자주식회사 링커 폴리펩티드 및 이를 이용한 표적 물질 분석 방법
US9914785B2 (en) 2012-11-28 2018-03-13 Zymeworks Inc. Engineered immunoglobulin heavy chain-light chain pairs and uses thereof
WO2014121176A2 (en) 2013-02-04 2014-08-07 Emory University Specific binding agents of glycoprotein ib alpha as selective ectodomain shedding inhibitors
WO2014144549A1 (en) 2013-03-15 2014-09-18 Biogen Idec Ma Inc. Factor ix polypeptide formulations
CN104211799B (zh) * 2013-05-29 2017-12-26 成都渊源生物科技有限公司 人源egf结构域蛋白及其应用
WO2015021423A2 (en) 2013-08-08 2015-02-12 Biogen Idec Ma Inc. Purification of chimeric fviii molecules
CN103397009B (zh) * 2013-08-16 2015-06-03 安源生物科技(上海)有限公司 改良型人凝血因子FVII-Fc融合蛋白及其制备方法与用途
CN103599527A (zh) * 2013-08-16 2014-02-26 安源生物科技(上海)有限公司 包含改良型人凝血因子FVII-Fc融合蛋白的药物组合物
EP3049434A1 (en) * 2013-09-24 2016-08-03 Pfizer Inc. Compositions comprising heterogeneous populations of recombinant human clotting factor xa proteins
AU2014357292B2 (en) 2013-11-27 2020-06-25 Zymeworks Bc Inc. Bispecific antigen-binding constructs targeting HER2
EP4299595A3 (en) 2014-05-02 2024-03-13 Momenta Pharmaceuticals, Inc. Compositions and methods related to engineered fc constructs
CA3244731A1 (en) 2014-05-28 2025-11-29 Zymeworks Bc Inc. Modified antigen binding polypeptide constructs and uses thereof
CN105294857B (zh) * 2014-06-18 2019-02-19 上海交通大学 基于fix的抗原表位及其应用
US10266549B2 (en) 2014-08-25 2019-04-23 Salk Institute For Biological Studies ULK1 inhibitors and methods using same
TWI700300B (zh) * 2014-09-26 2020-08-01 日商中外製藥股份有限公司 中和具有第viii凝血因子(fviii)機能替代活性的物質之抗體
WO2016118577A1 (en) * 2015-01-22 2016-07-28 Medimmune, Llc Thymosin-beta-four fusion proteins
EP3359576B1 (en) 2015-10-08 2024-12-25 Zymeworks BC Inc. Antigen-binding polypeptide constructs comprising kappa and lambda light chains and uses thereof
EA202190827A1 (ru) 2015-11-13 2021-11-30 Баксалта Инкорпорейтед Вирусные векторы, кодирующие рекомбинантные варианты fviii с повышенной экспрессией для генной терапии гемофилии a
EP3423572B1 (en) 2016-03-02 2023-11-29 Momenta Pharmaceuticals, Inc. Methods related to engineered fc constructs
DK3484514T3 (da) 2016-05-23 2024-01-29 Momenta Pharmaceuticals Inc Compositions and methods related to engineered fc constructs
CN109843327B (zh) 2016-07-07 2022-05-13 小利兰·斯坦福大学托管委员会 抗体佐剂缀合物
KR20190077306A (ko) 2016-08-05 2019-07-03 메디뮨 엘엘씨 항-o2 항체 및 이의 용도
CN106317226B (zh) 2016-08-19 2017-09-05 安源医药科技(上海)有限公司 用于构建融合蛋白的连接肽
CN106279437B (zh) * 2016-08-19 2017-10-31 安源医药科技(上海)有限公司 高糖基化人凝血因子viii融合蛋白及其制备方法与用途
US20190248920A1 (en) * 2016-09-23 2019-08-15 Csl Limited Coagulation factor binding proteins and uses thereof
SG11201903063UA (en) 2016-10-19 2019-05-30 Medimmune Llc Anti-o1 antibodies and uses thereof
MA46862A (fr) 2016-11-17 2019-09-25 Bluebird Bio Inc Convertisseur de signaux tgf béta
JP7146771B2 (ja) 2017-01-06 2022-10-04 モメンタ ファーマシューティカルズ インコーポレイテッド 操作されたFcコンストラクトに関する組成物及び方法
US20190388522A1 (en) * 2017-01-25 2019-12-26 Iconic Therapeutics, Inc. Methods for treating disorders associated with angiogenesis and neovascularization
NZ762100A (en) 2017-08-09 2025-12-19 Bioverativ Therapeutics Inc Nucleic acid molecules and uses thereof
WO2019067249A1 (en) * 2017-09-27 2019-04-04 Ohio State Innovation Foundation CAR-NK CELL THERAPY AND TISSUE FACTOR TARGETING T-CARD
KR101952102B1 (ko) * 2017-12-07 2019-02-26 주식회사 지앤피바이오사이언스 단백질 발현량이 증대된 인자 ⅷ 변이체 발현벡터
AU2019215063B2 (en) 2018-02-01 2025-10-16 Bioverativ Therapeutics, Inc. Use of lentiviral vectors expressing Factor VIII
TW202003555A (zh) 2018-03-07 2020-01-16 英商葛蘭素史克智慧財產發展有限公司 用於純化重組多肽之方法
EP3802610A1 (en) 2018-06-05 2021-04-14 Amgen Inc. Modulating antibody dependent cellular phagocytosis
US12091675B2 (en) 2018-07-16 2024-09-17 Takeda Pharmaceutical Company Limited Gene therapy of hemophilia a using viral vectors encoding recombinant FVIII variants with increased expression
EP3833766A1 (en) 2018-08-09 2021-06-16 Bioverativ Therapeutics Inc. Nucleic acid molecules and uses thereof for non-viral gene therapy
CA3109999A1 (en) * 2018-08-21 2020-02-27 Abl Bio Inc. Anti-pd-l1/anti-lag3 bispecific antibodies and uses thereof
CA3110530A1 (en) 2018-09-11 2020-03-19 Amgen Inc. Methods of modulating antibody-dependent cell-mediated cytotoxicity
TWI851647B (zh) 2019-01-16 2024-08-11 日商武田藥品工業股份有限公司 用於a型血友病基因治療之編碼表現增加之重組fviii變異體的病毒載體
US11471497B1 (en) 2019-03-13 2022-10-18 David Gordon Bermudes Copper chelation therapeutics
WO2020190725A1 (en) 2019-03-15 2020-09-24 Bolt Biotherapeutics, Inc. Immunoconjugates targeting her2
CA3139011A1 (en) 2019-05-08 2020-11-12 Medigene Immunotherapies Gmbh Engineered t cells
CN114364796B (zh) * 2019-09-02 2023-07-11 甘李药业股份有限公司 嵌合蛋白
CN113005176A (zh) * 2019-12-20 2021-06-22 深圳市帝迈生物技术有限公司 稳定剂、凝血酶原时间检测试剂及其制备方法、试剂盒
KR20220153582A (ko) 2020-02-14 2022-11-18 솔크 인스티튜트 포 바이올로지칼 스터디즈 마크로시클릭 ulk1/2 억제제
US20230035308A1 (en) * 2021-07-02 2023-02-02 Aetio Biotherapy, Inc. Activatable monomeric cytokine-single chain (sc) fc fusion proteins and uses thereof
CN119176867A (zh) * 2024-10-17 2024-12-24 北京田园奥瑞生物科技有限公司 一种猪伪狂犬病毒抗体检测试剂盒及其应用

Citations (112)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0068763A2 (en) 1981-07-01 1983-01-05 Board Of Regents, The University Of Texas System Recombinant monoclonal antibodies
US4444878A (en) 1981-12-21 1984-04-24 Boston Biomedical Research Institute, Inc. Bispecific antibody determinants
EP0120694A2 (en) 1983-03-25 1984-10-03 Celltech Limited Processes for the production of multichain polypeptides or proteins
EP0125023A1 (en) 1983-04-08 1984-11-14 Genentech, Inc. Recombinant immunoglobulin preparations, methods for their preparation, DNA sequences, expression vectors and recombinant host cells therefor
WO1987004187A1 (en) 1986-01-03 1987-07-16 Genetics Institute, Inc. METHOD FOR PRODUCING FACTOR VIII:c-TYPE PROTEINS
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4694778A (en) 1984-05-04 1987-09-22 Anicon, Inc. Chemical vapor deposition wafer boat
US4704362A (en) 1977-11-08 1987-11-03 Genentech, Inc. Recombinant cloning vehicle microbial polypeptide expression
EP0255694A1 (en) 1986-07-30 1988-02-10 Teijin Limited Mouse-human chimera antibody and its components and gene therefor
WO1988000831A1 (en) 1986-08-01 1988-02-11 Biogen N.V. Dna sequences coding for modified factor viii:c and modified factor viii:c-like polypeptides and processes for producing these polypeptides in high yields
EP0256654A2 (en) 1986-07-07 1988-02-24 Centocor, Inc. Chimeric murine/human immunoglobulin specific for tumour-associated 17-1A Antigen
EP0266663A1 (en) 1986-10-27 1988-05-11 Bristol-Myers Squibb Company Chimeric antibody with specificity to human tumor antigen
US4745055A (en) 1985-05-07 1988-05-17 California Biotechnology Inc. Fused protein for enzyme immunoassay system
WO1988003559A1 (en) 1986-11-12 1988-05-19 The General Hospital Corporation Recombinant hybrid immunoglobulin molecules and method of use
WO1988003565A1 (en) 1986-11-05 1988-05-19 National Research Development Corporation Antibodies
WO1988007089A1 (en) 1987-03-18 1988-09-22 Medical Research Council Altered antibodies
EP0295597A2 (de) 1987-06-19 1988-12-21 BEHRINGWERKE Aktiengesellschaft Faktor VIII:C-ähnliches Molekül mit Koagulationsaktivität
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4868112A (en) 1985-04-12 1989-09-19 Genetics Institute, Inc. Novel procoagulant proteins
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
WO1991009122A1 (en) 1989-12-15 1991-06-27 Kabivitrum Ab A recombinant human factor viii derivative
US5112950A (en) 1987-08-11 1992-05-12 Transgene S.A. Factor viii analog, preparation process, and pharmaceutical composition containing it
US5171844A (en) 1987-06-12 1992-12-15 Gist-Brocades N.W. Proteins with factor viii activity: process for their preparation using genetically-engineered cells and pharmaceutical compositions containing them
US5304489A (en) 1987-02-17 1994-04-19 Genpharm International, Inc. DNA sequences to target proteins to the mammary gland for efficient secretion
US5460950A (en) 1990-11-26 1995-10-24 Genetics Institute, Inc. Expression of PACE in host cells and methods of use thereof
WO1996014339A1 (en) 1994-11-05 1996-05-17 The Wellcome Foundation Limited Antibodies
US5543502A (en) 1986-06-24 1996-08-06 Novo Nordisk A/S Process for producing a coagulation active complex of factor VIII fragments
US5589369A (en) 1992-02-11 1996-12-31 Cell Genesys Inc. Cells homozygous for disrupted target loci
US5591669A (en) 1988-12-05 1997-01-07 Genpharm International, Inc. Transgenic mice depleted in a mature lymphocytic cell-type
US5595886A (en) 1986-01-27 1997-01-21 Chiron Corporation Protein complexes having Factor VIII:C activity and production thereof
US5658570A (en) 1991-07-25 1997-08-19 Idec Pharmaceuticals Corporation Recombinant antibodies for human therapy
WO1998005787A1 (en) 1996-08-02 1998-02-12 Bristol-Myers Squibb Company A method for inhibiting immunoglobulin-induced toxicity resulting from the use of immunoglobulins in therapy and in vivo diagnosis
US5736137A (en) 1992-11-13 1998-04-07 Idec Pharmaceuticals Corporation Therapeutic application of chimeric and radiolabeled antibodies to human B lymphocyte restricted differentiation antigen for treatment of B cell lymphoma
US5739277A (en) 1995-04-14 1998-04-14 Genentech Inc. Altered polypeptides with increased half-life
US5741957A (en) 1989-12-01 1998-04-21 Pharming B.V. Transgenic bovine
WO1998023289A1 (en) 1996-11-27 1998-06-04 The General Hospital Corporation MODULATION OF IgG BINDING TO FcRn
US5811524A (en) 1995-06-07 1998-09-22 Idec Pharmaceuticals Corporation Neutralizing high affinity human monoclonal antibodies specific to RSV F-protein and methods for their manufacture and therapeutic use thereof
US5834250A (en) 1988-10-28 1998-11-10 Genentech, Inc. Method for identifying active domains and amino acid residues in polypeptides and hormone variants
US5840529A (en) 1995-08-02 1998-11-24 Clinical Research Institute Of Montreal Mammalian pro-hormone convertase
US5849992A (en) 1993-12-20 1998-12-15 Genzyme Transgenics Corporation Transgenic production of antibodies in milk
US5869046A (en) 1995-04-14 1999-02-09 Genentech, Inc. Altered polypeptides with increased half-life
US5892019A (en) 1987-07-15 1999-04-06 The United States Of America, As Represented By The Department Of Health And Human Services Production of a single-gene-encoded immunoglobulin
US5935815A (en) 1989-10-25 1999-08-10 Katholieke Universiteit Leuven Process for micro biological production of proteins
US5939598A (en) 1990-01-12 1999-08-17 Abgenix, Inc. Method of making transgenic mice lacking endogenous heavy chains
WO1999051642A1 (en) 1998-04-02 1999-10-14 Genentech, Inc. Antibody variants and fragments thereof
US5972885A (en) 1993-07-05 1999-10-26 Pharmacia & Upjohn Aktiebolag Method for treatment of hemophilia by extravascular administration of factor VIII deletion derivatives
WO1999058572A1 (en) 1998-05-08 1999-11-18 Cambridge University Technical Services Limited Binding molecules derived from immunoglobulins which do not trigger complement mediated lysis
US6005079A (en) 1992-08-21 1999-12-21 Vrije Universiteit Brussels Immunoglobulins devoid of light chains
WO2000009560A2 (en) 1998-08-17 2000-02-24 Abgenix, Inc. Generation of modified molecules with increased serum half-lives
US6030613A (en) 1995-01-17 2000-02-29 The Brigham And Women's Hospital, Inc. Receptor specific transepithelial transport of therapeutics
US6048720A (en) 1995-09-29 2000-04-11 Pharmacia & Upjohn Ab Conjugates of a polypeptide and a biocompatible polymer
US6060447A (en) 1987-05-19 2000-05-09 Chiron Corporation Protein complexes having Factor VIII:C activity and production thereof
WO2000032767A1 (en) 1998-12-03 2000-06-08 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RECOMBINANT SOLUBLE Fc RECEPTORS
US6075181A (en) 1990-01-12 2000-06-13 Abgenix, Inc. Human antibodies derived from immunized xenomice
US6086875A (en) 1995-01-17 2000-07-11 The Brigham And Women's Hospital, Inc. Receptor specific transepithelial transport of immunogens
WO2000042072A2 (en) 1999-01-15 2000-07-20 Genentech, Inc. Polypeptide variants with altered effector function
US6096871A (en) 1995-04-14 2000-08-01 Genentech, Inc. Polypeptides altered to contain an epitope from the Fc region of an IgG molecule for increased half-life
US6121022A (en) 1995-04-14 2000-09-19 Genentech, Inc. Altered polypeptides with increased half-life
US6159730A (en) 1992-11-13 2000-12-12 Idec Pharmaceutical Corporation Impaired dominant selectable marker sequence and intronic insertion strategies for enhancement of expression of gene product and expression vector systems comprising same
US6194551B1 (en) 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
US6193980B1 (en) 1995-12-06 2001-02-27 Cambridge University Technical Services, Limited Replication defective herpes simplex virus comprising heterologous inserts
US6242195B1 (en) 1998-04-02 2001-06-05 Genentech, Inc. Methods for determining binding of an analyte to a receptor
US6277375B1 (en) 1997-03-03 2001-08-21 Board Of Regents, The University Of Texas System Immunoglobulin-like domains with increased half-lives
WO2002002781A1 (en) 2000-06-30 2002-01-10 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Heterodimeric fusion proteins
US6346513B1 (en) 1987-06-12 2002-02-12 Baxter Trading Gmbh Proteins with factor VIII activity: process for their preparation using genetically-engineered cells and pharmaceutical compositions containing them
US6380171B1 (en) 1996-07-26 2002-04-30 Clinical Research Institute Of Montreal Pro-protein converting enzyme
WO2002044215A2 (en) 2000-12-01 2002-06-06 Cockbain, Julian Hybrid antibodies
US6413777B1 (en) 1997-03-14 2002-07-02 Idec Pharmaceuticals Corp. Method for integrating genes at specific sites in mammalian cells via homologous recombination and vectors for accomplishing the same
WO2002060919A2 (en) 2000-12-12 2002-08-08 Medimmune, Inc. Molecules with extended half-lives, compositions and uses thereof
WO2002060955A2 (en) 2001-01-29 2002-08-08 Idec Pharmaceuticals Corporation Modified antibodies and methods of use
US6458563B1 (en) 1996-06-26 2002-10-01 Emory University Modified factor VIII
US6485726B1 (en) 1995-01-17 2002-11-26 The Brigham And Women's Hospital, Inc. Receptor specific transepithelial transport of therapeutics
WO2002096948A2 (en) 2001-01-29 2002-12-05 Idec Pharmaceuticals Corporation Engineered tetravalent antibodies and methods of use
US6528624B1 (en) 1998-04-02 2003-03-04 Genentech, Inc. Polypeptide variants
WO2003074569A2 (en) 2002-03-01 2003-09-12 Immunomedics, Inc. Bispecific antibody point mutations for enhancing rate of clearance
WO2003077834A2 (en) 2002-03-15 2003-09-25 The Brigham And Women's Hospital, Inc. Central airway administration for systemic delivery of therapeutics
US6686179B2 (en) 1992-01-31 2004-02-03 Aventis Behring L.L.C. Fusion polypeptides of human serum albumin and a therapeutically active polypeptide
WO2004016750A2 (en) 2002-08-14 2004-02-26 Macrogenics, Inc. FcϜRIIB-SPECIFIC ANTIBODIES AND METHODS OF USE THEREOF
WO2004029207A2 (en) 2002-09-27 2004-04-08 Xencor Inc. Optimized fc variants and methods for their generation
WO2004035752A2 (en) 2002-10-15 2004-04-29 Protein Design Labs, Inc. ALTERATION OF FcRn BINDING AFFINITIES OR SERUM HALF-LIVES OF ANTIBODIES BY MUTAGENESIS
US6737056B1 (en) 1999-01-15 2004-05-18 Genentech, Inc. Polypeptide variants with altered effector function
WO2004044859A1 (en) 2002-11-14 2004-05-27 Gary Michael Wilson Warning unit
US20040132028A1 (en) 2000-09-08 2004-07-08 Stumpp Michael Tobias Collection of repeat proteins comprising repeat modules
US6765087B1 (en) 1992-08-21 2004-07-20 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
WO2004063351A2 (en) 2003-01-09 2004-07-29 Macrogenics, Inc. IDENTIFICATION AND ENGINEERING OF ANTIBODIES WITH VARIANT Fc REGIONS AND METHODS OF USING SAME
WO2004074455A2 (en) 2003-02-20 2004-09-02 Applied Molecular Evolution Fc REGION VARIANTS
WO2004099249A2 (en) 2003-05-02 2004-11-18 Xencor, Inc. Optimized fc variants and methods for their generation
WO2005040217A2 (en) 2003-10-17 2005-05-06 Cambridge University Technical Services Limited Antibodies having a mutated amino acid residue at position 268 (ch2 region) in constant regions
WO2005047327A2 (en) 2003-11-12 2005-05-26 Biogen Idec Ma Inc. NEONATAL Fc RECEPTOR (FcRn)-BINDING POLYPEPTIDE VARIANTS, DIMERIC Fc BINDING PROTEINS AND METHODS RELATED THERETO
WO2005070963A1 (en) 2004-01-12 2005-08-04 Applied Molecular Evolution, Inc Fc region variants
WO2005077981A2 (en) 2003-12-22 2005-08-25 Xencor, Inc. Fc POLYPEPTIDES WITH NOVEL Fc LIGAND BINDING SITES
WO2005092925A2 (en) 2004-03-24 2005-10-06 Xencor, Inc. Immunoglobulin variants outside the fc region
WO2005123780A2 (en) 2004-04-09 2005-12-29 Protein Design Labs, Inc. Alteration of fcrn binding affinities or serum half-lives of antibodies by mutagenesis
WO2006019447A1 (en) 2004-07-15 2006-02-23 Xencor, Inc. Optimized fc variants
WO2006047350A2 (en) 2004-10-21 2006-05-04 Xencor, Inc. IgG IMMUNOGLOBULIN VARIANTS WITH OPTIMIZED EFFECTOR FUNCTION
US7041635B2 (en) 2003-01-28 2006-05-09 In2Gen Co., Ltd. Factor VIII polypeptide
WO2006085967A2 (en) 2004-07-09 2006-08-17 Xencor, Inc. OPTIMIZED ANTI-CD20 MONOCONAL ANTIBODIES HAVING Fc VARIANTS
US20070218067A1 (en) 2001-10-05 2007-09-20 Buttner Et Al Claudia Antibody of human origin for inhibiting thrombocytes aggregation
US20070231329A1 (en) 2003-03-03 2007-10-04 Xencor, Inc. Fc Variants Having Increased Affinity for FcyRIIb
US7317091B2 (en) 2002-03-01 2008-01-08 Xencor, Inc. Optimized Fc variants
WO2008012543A1 (en) 2006-07-25 2008-01-31 Ucb Pharma S.A. Single chain fc polypeptides
US20080057056A1 (en) 2003-03-03 2008-03-06 Xencor, Inc. Fc Variants with Increased Affinity for FcyRIIC
US7348004B2 (en) 2003-05-06 2008-03-25 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US7381408B2 (en) 2003-05-06 2008-06-03 Syntonix Pharmaceuticals, Inc. Methods for chemically synthesizing immunoglobulin chimeric proteins
US20080260738A1 (en) 2007-04-18 2008-10-23 Moore Margaret D Single chain fc, methods of making and methods of treatment
WO2008143954A2 (en) 2007-05-14 2008-11-27 Biogen Idec Ma Inc. Single-chain fc (scfc) regions, binding polypeptides comprising same, and methods related thereto
US7566565B2 (en) 2006-03-24 2009-07-28 Syntonix Pharmaceuticals, Inc. PC5 as a factor IX propeptide processing enzyme
US7592010B2 (en) 2001-12-21 2009-09-22 Human Genome Sciences, Inc. Albumin fusion proteins
WO2009140598A1 (en) * 2008-05-16 2009-11-19 Bayer Healthcare Llc Targeted coagulation factors and method of using the same
WO2010115866A1 (en) 2009-04-06 2010-10-14 Novo Nordisk A/S Targeted delivery of factor viii proteins to platelets
US20100330059A1 (en) * 2009-06-25 2010-12-30 The University Of North Carolina At Chapel Hill Chimeric factor vii molecules

Family Cites Families (90)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US659684A (en) 1899-10-14 1900-10-16 John A W Lundborg Dental rubber-dam holder.
AU561343B2 (en) 1981-10-19 1987-05-07 Genentech Inc. Human immune interferon by recombinant dna
US4766073A (en) 1985-02-25 1988-08-23 Zymogenetics Inc. Expression of biologically active PDGF analogs in eucaryotic cells
US4889919A (en) 1986-08-13 1989-12-26 Zymogenetics, Inc. Biologically active PDGF derived A-chain homodimers
US5157021A (en) 1985-03-15 1992-10-20 Novo Nordisk A/S Insulin derivatives and pharmaceutical preparations containing these derivatives
IL78444A (en) 1986-04-08 1992-05-25 Yeda Res & Dev Human gamma interferon-specific receptor protein,antibody against said protein,and compositions containing said protein and antibody
AU643427B2 (en) 1988-10-31 1993-11-18 Immunex Corporation Interleukin-4 receptors
EP0368684B2 (en) 1988-11-11 2004-09-29 Medical Research Council Cloning immunoglobulin variable domain sequences.
WO1990014425A1 (en) 1989-05-22 1990-11-29 Zymogenetics, Inc. PDGF α-RECEPTOR
US5061786A (en) 1989-05-25 1991-10-29 Genentech, Inc. Biologically active polypeptides based on transforming growth factor-β
US5194596A (en) 1989-07-27 1993-03-16 California Biotechnology Inc. Production of vascular endothelial cell growth factor
US5395760A (en) 1989-09-05 1995-03-07 Immunex Corporation DNA encoding tumor necrosis factor-α and -β receptors
JPH0396383A (ja) 1989-09-08 1991-04-22 Riso Kagaku Corp 画像形成装置
EP0939121B2 (de) 1989-09-12 2007-12-26 AHP Manufacturing B.V. TFN-bindende Proteine
US5648273A (en) 1989-12-27 1997-07-15 The United States Of America, As Represented By The Department Of Health And Human Services Hepatic growth factor receptor is the MET proto-oncogene
CA2040099A1 (en) 1990-05-01 1991-11-02 Mariano Barbacid Tyrosine kinase negative trkb
GB9015198D0 (en) 1990-07-10 1990-08-29 Brien Caroline J O Binding substance
US5453491A (en) 1990-09-11 1995-09-26 Kiyoshi Takatsu Murine interleukin-5 receptor
CA2095633C (en) 1990-12-03 2003-02-04 Lisa J. Garrard Enrichment method for variant proteins with altered binding properties
WO1992018628A1 (en) 1991-04-19 1992-10-29 Schering Corporation Subunit of the human interleukin-3 receptor
US5227158A (en) 1991-06-10 1993-07-13 Genentech, Inc. Method of stimulating hepatocyte proliferation by administration of hepatocyte growth factor and gamma-interferon
US5346991A (en) 1991-06-13 1994-09-13 Genentech, Inc. Tissue factor mutants useful for the treatment of myocardial infarction and coagulopathic disorders
US5348856A (en) 1991-07-08 1994-09-20 E. R. Squibb & Sons, Inc. DNA encoding TRKC protein
JP2559093Y2 (ja) 1992-05-08 1998-01-14 ワイケイケイ株式会社 面ファスナー
AU7050994A (en) 1993-06-01 1994-12-20 Scripps Research Institute, The Human mutant tissue factor compositions useful as tissue factor antagonists
US6740734B1 (en) 1994-01-14 2004-05-25 Biovitrum Ab Bacterial receptor structures
US5877016A (en) 1994-03-18 1999-03-02 Genentech, Inc. Human trk receptors and neurotrophic factor inhibitors
DE69519929T2 (de) 1994-07-11 2001-05-23 Board Of Regents, The University Of Texas System Verfahren und zusammensetzungen für die spezifische koagulation von tumorgefässen
US5686292A (en) 1995-06-02 1997-11-11 Genentech, Inc. Hepatocyte growth factor receptor antagonist antibodies and uses thereof
ES2202469T5 (es) 1995-09-08 2011-06-06 Genentech, Inc. Proteína relacionada con el vegf.
US5723125A (en) * 1995-12-28 1998-03-03 Tanox Biosystems, Inc. Hybrid with interferon-alpha and an immunoglobulin Fc linked through a non-immunogenic peptide
JP2000515735A (ja) 1996-07-03 2000-11-28 ジェネンテック インコーポレーテッド 肝細胞成長因子レセプターアゴニスト
US6159462A (en) 1996-08-16 2000-12-12 Genentech, Inc. Uses of Wnt polypeptides
US5994104A (en) * 1996-11-08 1999-11-30 Royal Free Hospital School Of Medicine Interleukin-12 fusion protein
US6271349B1 (en) 1996-12-23 2001-08-07 Immunex Corporation Receptor activator of NF-κB
DE69740107D1 (de) 1996-12-23 2011-03-10 Immunex Corp Rezeptor aktivator von nf-kappa b, rezeptor is mitglied der tnf rezeptor superfamilie
EP1958962A3 (en) 1997-06-12 2013-05-01 Novartis International Pharmaceutical Ltd. Artificial antibody polypeptides
DE19742706B4 (de) 1997-09-26 2013-07-25 Pieris Proteolab Ag Lipocalinmuteine
EP1047781B1 (en) * 1998-01-23 2004-07-28 Immunex Corporation Il-18 receptors
AUPP221098A0 (en) 1998-03-06 1998-04-02 Diatech Pty Ltd V-like domain binding molecules
US6281331B1 (en) 1998-03-23 2001-08-28 Trimeris, Inc. Methods and compositions for peptide synthesis
US6355782B1 (en) 1998-07-09 2002-03-12 Baylor College Of Medicine Hypohidrotic ectodermal dyplasia genes and proteins
JP2002520053A (ja) 1998-07-15 2002-07-09 ジェネンテック・インコーポレーテッド 凝固因子fvii/fviiaに対する向上した親和性を持つ組織因子タンパク質変異体
US6927044B2 (en) 1998-09-25 2005-08-09 Regeneron Pharmaceuticals, Inc. IL-1 receptor based cytokine traps
US6818418B1 (en) 1998-12-10 2004-11-16 Compound Therapeutics, Inc. Protein scaffolds for antibody mimics and other binding proteins
JP2002535967A (ja) 1999-01-06 2002-10-29 ジェネンテック・インコーポレーテッド インシュリン様成長因子(igf)i変異体
AU762351B2 (en) 1999-01-06 2003-06-26 Genentech Inc. Insulin-like growth factor (IGF) I mutant variants
US20020102208A1 (en) 1999-03-01 2002-08-01 Paul Chinn Radiolabeling kit and binding assay
US6602977B1 (en) 1999-04-19 2003-08-05 Biovitrum Ab Receptor structures
SE9901379D0 (sv) 1999-04-19 1999-04-19 Pharmacia & Upjohn Ab Receptor structures
DK1198479T3 (da) * 1999-07-01 2008-10-13 Univ Yale Neovaskulamålrettet immunkonjugat
IL147270A0 (en) * 1999-07-02 2002-08-14 Genentech Inc Fusion peptides comprising a peptide ligand domain and a multimerization domain
US6469136B1 (en) 1999-07-07 2002-10-22 Trimeris, Inc. Methods and composition for peptide synthesis
AU2001249389A1 (en) 2000-03-22 2001-10-03 The Children's Hospital Of Philadelphia Modified blood clotting factors and methods of use
US7208151B2 (en) 2001-09-12 2007-04-24 Biogen Idec Ma Inc. Tweak receptor agonists as anti-angiogenic agents
AU2002245204A1 (en) 2000-10-25 2002-07-24 Genzyme Corporation Methods for treating blood coagulation disorders
US7235638B2 (en) * 2001-03-22 2007-06-26 Novo Nordisk Healthcare A/G Coagulation factor VII derivatives
US20030157561A1 (en) 2001-11-19 2003-08-21 Kolkman Joost A. Combinatorial libraries of monomer domains
US20030082630A1 (en) 2001-04-26 2003-05-01 Maxygen, Inc. Combinatorial libraries of monomer domains
FR2831170B1 (fr) 2001-10-19 2004-03-19 Inst Nat Sante Rech Med Proteines c modifiees activables directement par la thrombine
US20040102440A1 (en) 2002-07-01 2004-05-27 Wong Erik Ho Fong Method of promoting smoking cessation
US7211558B2 (en) * 2002-05-22 2007-05-01 The Children's Hospital Of Philadelphia Compositions and methods for the treatment of hemophilia A
PL2298347T3 (pl) * 2003-05-06 2016-03-31 Bioverativ Therapeutics Inc Białka chimeryczne czynnika krzepnięcia do leczenia zaburzenia hemostazy
ATE385806T1 (de) * 2003-06-12 2008-03-15 Lilly Co Eli Fusionsproteine
CA2532918C (en) 2003-07-25 2012-07-10 Basf Aktiengesellschaft Aqueous dispersions of hydrosoluble polymerisates of ethylenically unsaturated anionic monomers, method for the production and use thereof
AU2003264100A1 (en) 2003-08-25 2005-03-10 Pieris Proteolab Ag Muteins of a bilin-binding protein with affinity for a given target
US9296820B2 (en) 2003-11-05 2016-03-29 Roche Glycart Ag Polynucleotides encoding anti-CD20 antigen binding molecules with increased Fc receptor binding affinity and effector function
JP2007511604A (ja) * 2003-11-18 2007-05-10 アイコニック セラピューティクス インコーポレイティッド キメラタンパク質の均質製剤
ES2305886T3 (es) * 2003-12-30 2008-11-01 Merck Patent Gmbh Proteinas de fusion de il-7 con porciones de anticuerpo, su preparacion y su empleo.
DK1773872T3 (en) 2004-05-21 2017-05-08 Uab Res Found VARIABLE Lymphocyte Receptors, Associated Polypeptides and Nucleic Acids, and Uses thereof
US20060234299A1 (en) 2004-11-16 2006-10-19 Avidia Research Institute Protein scaffolds and uses thereof
ES2971647T3 (es) 2005-04-15 2024-06-06 Macrogenics Inc Diacuerpos covalentes y usos de los mismos
US7427787B2 (en) 2005-07-08 2008-09-23 Texas Instruments Incorporated Guardringed SCR ESD protection
US7666622B2 (en) * 2005-10-19 2010-02-23 Regeneron Pharmaceuticals, Inc. Monomeric self-associating fusion polypeptides and therapeutic uses thereof
EP1816201A1 (en) * 2006-02-06 2007-08-08 CSL Behring GmbH Modified coagulation factor VIIa with extended half-life
EP1820508A1 (en) 2006-02-21 2007-08-22 CSL Behring GmbH Coagulation factor X polypeptides with modified activation properties
CA2646508A1 (en) 2006-03-17 2007-09-27 Biogen Idec Ma Inc. Stabilized polypeptide compositions
US7939632B2 (en) * 2006-06-14 2011-05-10 Csl Behring Gmbh Proteolytically cleavable fusion proteins with high molar specific activity
EP2032607B2 (en) * 2006-06-14 2017-02-22 CSL Behring GmbH Proteolytically cleavable fusion protein comprising a blood coagulation factor
US8460364B2 (en) 2006-07-20 2013-06-11 Orbusneich Medical, Inc. Bioabsorbable polymeric medical device
EP1952822A1 (en) 2007-01-26 2008-08-06 Novo Nordisk A/S Factor VII polypeptides with increased affinity to platelets
EP2203180B1 (en) 2007-10-22 2012-11-21 Merck Serono S.A. Single ifn-beta fused to a mutated igg fc fragment
TWI465247B (zh) 2008-04-11 2014-12-21 Catalyst Biosciences Inc 經修飾的因子vii多肽和其用途
US8800831B2 (en) 2009-08-19 2014-08-12 Larry A. Gray Multi-purpose rack and method thereof
ES2898683T3 (es) 2009-08-27 2022-03-08 Novo Nordisk As Direccionamiento del factor tisular a las plaquetas activadas
SI2506868T1 (en) 2009-12-06 2018-04-30 Bioverativ Therapeutics Inc. HYPER AND HYBRID POLYPETTIDES FACTOR VIII-FC AND METHODS FOR THEIR USE
WO2011130845A1 (en) 2010-04-21 2011-10-27 Optosecurity Inc. Method and system for use in performing security screening
TW201217527A (en) 2010-07-09 2012-05-01 Biogen Idec Hemophilia Inc Processable single chain molecules and polypeptides made using same
PL3552619T3 (pl) 2010-07-09 2025-12-01 Bioverativ Therapeutics Inc. Polipeptydy czynnika ix i sposoby ich zastosowania
WO2012117091A1 (en) 2011-03-02 2012-09-07 Novo Nordisk A/S Coagulation factor-targeting to tlt-1 on activated platelets

Patent Citations (132)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4704362A (en) 1977-11-08 1987-11-03 Genentech, Inc. Recombinant cloning vehicle microbial polypeptide expression
EP0068763A2 (en) 1981-07-01 1983-01-05 Board Of Regents, The University Of Texas System Recombinant monoclonal antibodies
US4444878A (en) 1981-12-21 1984-04-24 Boston Biomedical Research Institute, Inc. Bispecific antibody determinants
EP0120694A2 (en) 1983-03-25 1984-10-03 Celltech Limited Processes for the production of multichain polypeptides or proteins
EP0125023A1 (en) 1983-04-08 1984-11-14 Genentech, Inc. Recombinant immunoglobulin preparations, methods for their preparation, DNA sequences, expression vectors and recombinant host cells therefor
US4694778A (en) 1984-05-04 1987-09-22 Anicon, Inc. Chemical vapor deposition wafer boat
US4683202B1 (cg-RX-API-DMAC7.html) 1985-03-28 1990-11-27 Cetus Corp
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4868112A (en) 1985-04-12 1989-09-19 Genetics Institute, Inc. Novel procoagulant proteins
US4745055A (en) 1985-05-07 1988-05-17 California Biotechnology Inc. Fused protein for enzyme immunoassay system
WO1987004187A1 (en) 1986-01-03 1987-07-16 Genetics Institute, Inc. METHOD FOR PRODUCING FACTOR VIII:c-TYPE PROTEINS
US5595886A (en) 1986-01-27 1997-01-21 Chiron Corporation Protein complexes having Factor VIII:C activity and production thereof
US5789203A (en) 1986-01-27 1998-08-04 Chiron Corporation Protein complexes having factor VIII:C activity and production thereof
US6228620B1 (en) 1986-01-27 2001-05-08 Chiron Corporation Protein complexes having factor VIII:C activity and production thereof
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (cg-RX-API-DMAC7.html) 1986-01-30 1990-11-27 Cetus Corp
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US5543502A (en) 1986-06-24 1996-08-06 Novo Nordisk A/S Process for producing a coagulation active complex of factor VIII fragments
US5610278A (en) 1986-06-24 1997-03-11 Novo Nordisk A/S Process for producing a coagulation active complex of factor VIII fragments
EP0256654A2 (en) 1986-07-07 1988-02-24 Centocor, Inc. Chimeric murine/human immunoglobulin specific for tumour-associated 17-1A Antigen
EP0255694A1 (en) 1986-07-30 1988-02-10 Teijin Limited Mouse-human chimera antibody and its components and gene therefor
WO1988000831A1 (en) 1986-08-01 1988-02-11 Biogen N.V. Dna sequences coding for modified factor viii:c and modified factor viii:c-like polypeptides and processes for producing these polypeptides in high yields
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
EP0266663A1 (en) 1986-10-27 1988-05-11 Bristol-Myers Squibb Company Chimeric antibody with specificity to human tumor antigen
WO1988003565A1 (en) 1986-11-05 1988-05-19 National Research Development Corporation Antibodies
WO1988003559A1 (en) 1986-11-12 1988-05-19 The General Hospital Corporation Recombinant hybrid immunoglobulin molecules and method of use
US5304489A (en) 1987-02-17 1994-04-19 Genpharm International, Inc. DNA sequences to target proteins to the mammary gland for efficient secretion
WO1988007089A1 (en) 1987-03-18 1988-09-22 Medical Research Council Altered antibodies
US5648260A (en) 1987-03-18 1997-07-15 Scotgen Biopharmaceuticals Incorporated DNA encoding antibodies with altered effector functions
US6060447A (en) 1987-05-19 2000-05-09 Chiron Corporation Protein complexes having Factor VIII:C activity and production thereof
US6346513B1 (en) 1987-06-12 2002-02-12 Baxter Trading Gmbh Proteins with factor VIII activity: process for their preparation using genetically-engineered cells and pharmaceutical compositions containing them
US5171844A (en) 1987-06-12 1992-12-15 Gist-Brocades N.W. Proteins with factor viii activity: process for their preparation using genetically-engineered cells and pharmaceutical compositions containing them
US6316226B1 (en) 1987-06-12 2001-11-13 Baxter Trading Gmbh Proteins with Factor VIII activity: process for their preparation using genetically-engineered cells and pharmaceutical compositions containing them
EP0295597A2 (de) 1987-06-19 1988-12-21 BEHRINGWERKE Aktiengesellschaft Faktor VIII:C-ähnliches Molekül mit Koagulationsaktivität
US5892019A (en) 1987-07-15 1999-04-06 The United States Of America, As Represented By The Department Of Health And Human Services Production of a single-gene-encoded immunoglobulin
US5112950A (en) 1987-08-11 1992-05-12 Transgene S.A. Factor viii analog, preparation process, and pharmaceutical composition containing it
US5834250A (en) 1988-10-28 1998-11-10 Genentech, Inc. Method for identifying active domains and amino acid residues in polypeptides and hormone variants
US5591669A (en) 1988-12-05 1997-01-07 Genpharm International, Inc. Transgenic mice depleted in a mature lymphocytic cell-type
US5935815A (en) 1989-10-25 1999-08-10 Katholieke Universiteit Leuven Process for micro biological production of proteins
US5741957A (en) 1989-12-01 1998-04-21 Pharming B.V. Transgenic bovine
WO1991009122A1 (en) 1989-12-15 1991-06-27 Kabivitrum Ab A recombinant human factor viii derivative
US5939598A (en) 1990-01-12 1999-08-17 Abgenix, Inc. Method of making transgenic mice lacking endogenous heavy chains
US6075181A (en) 1990-01-12 2000-06-13 Abgenix, Inc. Human antibodies derived from immunized xenomice
US5460950A (en) 1990-11-26 1995-10-24 Genetics Institute, Inc. Expression of PACE in host cells and methods of use thereof
US5658570A (en) 1991-07-25 1997-08-19 Idec Pharmaceuticals Corporation Recombinant antibodies for human therapy
US6686179B2 (en) 1992-01-31 2004-02-03 Aventis Behring L.L.C. Fusion polypeptides of human serum albumin and a therapeutically active polypeptide
US5589369A (en) 1992-02-11 1996-12-31 Cell Genesys Inc. Cells homozygous for disrupted target loci
US6765087B1 (en) 1992-08-21 2004-07-20 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US6005079A (en) 1992-08-21 1999-12-21 Vrije Universiteit Brussels Immunoglobulins devoid of light chains
US5736137A (en) 1992-11-13 1998-04-07 Idec Pharmaceuticals Corporation Therapeutic application of chimeric and radiolabeled antibodies to human B lymphocyte restricted differentiation antigen for treatment of B cell lymphoma
US6159730A (en) 1992-11-13 2000-12-12 Idec Pharmaceutical Corporation Impaired dominant selectable marker sequence and intronic insertion strategies for enhancement of expression of gene product and expression vector systems comprising same
US5972885A (en) 1993-07-05 1999-10-26 Pharmacia & Upjohn Aktiebolag Method for treatment of hemophilia by extravascular administration of factor VIII deletion derivatives
US5849992A (en) 1993-12-20 1998-12-15 Genzyme Transgenics Corporation Transgenic production of antibodies in milk
WO1996014339A1 (en) 1994-11-05 1996-05-17 The Wellcome Foundation Limited Antibodies
US6030613A (en) 1995-01-17 2000-02-29 The Brigham And Women's Hospital, Inc. Receptor specific transepithelial transport of therapeutics
US6485726B1 (en) 1995-01-17 2002-11-26 The Brigham And Women's Hospital, Inc. Receptor specific transepithelial transport of therapeutics
US6086875A (en) 1995-01-17 2000-07-11 The Brigham And Women's Hospital, Inc. Receptor specific transepithelial transport of immunogens
US5869046A (en) 1995-04-14 1999-02-09 Genentech, Inc. Altered polypeptides with increased half-life
US5739277A (en) 1995-04-14 1998-04-14 Genentech Inc. Altered polypeptides with increased half-life
US6096871A (en) 1995-04-14 2000-08-01 Genentech, Inc. Polypeptides altered to contain an epitope from the Fc region of an IgG molecule for increased half-life
US6121022A (en) 1995-04-14 2000-09-19 Genentech, Inc. Altered polypeptides with increased half-life
US6998253B1 (en) 1995-04-14 2006-02-14 Genentech, Inc. Altered polypeptides with increased half-life
US5811524A (en) 1995-06-07 1998-09-22 Idec Pharmaceuticals Corporation Neutralizing high affinity human monoclonal antibodies specific to RSV F-protein and methods for their manufacture and therapeutic use thereof
US5840529A (en) 1995-08-02 1998-11-24 Clinical Research Institute Of Montreal Mammalian pro-hormone convertase
US6048720A (en) 1995-09-29 2000-04-11 Pharmacia & Upjohn Ab Conjugates of a polypeptide and a biocompatible polymer
US6193980B1 (en) 1995-12-06 2001-02-27 Cambridge University Technical Services, Limited Replication defective herpes simplex virus comprising heterologous inserts
US6458563B1 (en) 1996-06-26 2002-10-01 Emory University Modified factor VIII
US6380171B1 (en) 1996-07-26 2002-04-30 Clinical Research Institute Of Montreal Pro-protein converting enzyme
WO1998005787A1 (en) 1996-08-02 1998-02-12 Bristol-Myers Squibb Company A method for inhibiting immunoglobulin-induced toxicity resulting from the use of immunoglobulins in therapy and in vivo diagnosis
WO1998023289A1 (en) 1996-11-27 1998-06-04 The General Hospital Corporation MODULATION OF IgG BINDING TO FcRn
US6821505B2 (en) 1997-03-03 2004-11-23 Board Of Regents, The University Of Texas System Immunoglobin-like domains with increased half lives
US6277375B1 (en) 1997-03-03 2001-08-21 Board Of Regents, The University Of Texas System Immunoglobulin-like domains with increased half-lives
US6413777B1 (en) 1997-03-14 2002-07-02 Idec Pharmaceuticals Corp. Method for integrating genes at specific sites in mammalian cells via homologous recombination and vectors for accomplishing the same
WO1999051642A1 (en) 1998-04-02 1999-10-14 Genentech, Inc. Antibody variants and fragments thereof
US6194551B1 (en) 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
US6538124B1 (en) 1998-04-02 2003-03-25 Genentech, Inc. Polypeptide variants
US6528624B1 (en) 1998-04-02 2003-03-04 Genentech, Inc. Polypeptide variants
US6242195B1 (en) 1998-04-02 2001-06-05 Genentech, Inc. Methods for determining binding of an analyte to a receptor
WO1999058572A1 (en) 1998-05-08 1999-11-18 Cambridge University Technical Services Limited Binding molecules derived from immunoglobulins which do not trigger complement mediated lysis
WO2000009560A2 (en) 1998-08-17 2000-02-24 Abgenix, Inc. Generation of modified molecules with increased serum half-lives
WO2000032767A1 (en) 1998-12-03 2000-06-08 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RECOMBINANT SOLUBLE Fc RECEPTORS
WO2000042072A2 (en) 1999-01-15 2000-07-20 Genentech, Inc. Polypeptide variants with altered effector function
US6737056B1 (en) 1999-01-15 2004-05-18 Genentech, Inc. Polypeptide variants with altered effector function
WO2002002781A1 (en) 2000-06-30 2002-01-10 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Heterodimeric fusion proteins
US20040132028A1 (en) 2000-09-08 2004-07-08 Stumpp Michael Tobias Collection of repeat proteins comprising repeat modules
WO2002044215A2 (en) 2000-12-01 2002-06-06 Cockbain, Julian Hybrid antibodies
US7083784B2 (en) 2000-12-12 2006-08-01 Medimmune, Inc. Molecules with extended half-lives, compositions and uses thereof
WO2002060919A2 (en) 2000-12-12 2002-08-08 Medimmune, Inc. Molecules with extended half-lives, compositions and uses thereof
WO2002096948A2 (en) 2001-01-29 2002-12-05 Idec Pharmaceuticals Corporation Engineered tetravalent antibodies and methods of use
WO2002060955A2 (en) 2001-01-29 2002-08-08 Idec Pharmaceuticals Corporation Modified antibodies and methods of use
US20070218067A1 (en) 2001-10-05 2007-09-20 Buttner Et Al Claudia Antibody of human origin for inhibiting thrombocytes aggregation
US7592010B2 (en) 2001-12-21 2009-09-22 Human Genome Sciences, Inc. Albumin fusion proteins
WO2003074569A2 (en) 2002-03-01 2003-09-12 Immunomedics, Inc. Bispecific antibody point mutations for enhancing rate of clearance
US7317091B2 (en) 2002-03-01 2008-01-08 Xencor, Inc. Optimized Fc variants
US20030235536A1 (en) 2002-03-15 2003-12-25 The Brigham And Women's Hospital, Inc. Central airway administration for systemic delivery of therapeutics
WO2003077834A2 (en) 2002-03-15 2003-09-25 The Brigham And Women's Hospital, Inc. Central airway administration for systemic delivery of therapeutics
WO2004016750A2 (en) 2002-08-14 2004-02-26 Macrogenics, Inc. FcϜRIIB-SPECIFIC ANTIBODIES AND METHODS OF USE THEREOF
WO2004029207A2 (en) 2002-09-27 2004-04-08 Xencor Inc. Optimized fc variants and methods for their generation
WO2004035752A2 (en) 2002-10-15 2004-04-29 Protein Design Labs, Inc. ALTERATION OF FcRn BINDING AFFINITIES OR SERUM HALF-LIVES OF ANTIBODIES BY MUTAGENESIS
WO2004044859A1 (en) 2002-11-14 2004-05-27 Gary Michael Wilson Warning unit
WO2004063351A2 (en) 2003-01-09 2004-07-29 Macrogenics, Inc. IDENTIFICATION AND ENGINEERING OF ANTIBODIES WITH VARIANT Fc REGIONS AND METHODS OF USING SAME
US7041635B2 (en) 2003-01-28 2006-05-09 In2Gen Co., Ltd. Factor VIII polypeptide
WO2004074455A2 (en) 2003-02-20 2004-09-02 Applied Molecular Evolution Fc REGION VARIANTS
US20070237766A1 (en) 2003-03-03 2007-10-11 Xencor, Inc. Fc Variants Having Increased Affinity for FcyRllla
US20070248603A1 (en) 2003-03-03 2007-10-25 Xencor, Inc. Fc Variants with Increased Affinity for FcyRlla
US20080057056A1 (en) 2003-03-03 2008-03-06 Xencor, Inc. Fc Variants with Increased Affinity for FcyRIIC
US20070231329A1 (en) 2003-03-03 2007-10-04 Xencor, Inc. Fc Variants Having Increased Affinity for FcyRIIb
US20070237767A1 (en) 2003-03-03 2007-10-11 Xencor, Inc. Fc Variants Having Decreased Affinity for FcyRllla
US20070237765A1 (en) 2003-03-03 2007-10-11 Xencor, Inc. Fc Variants Having Increased Affinity for FcyRl
US20070286859A1 (en) 2003-03-03 2007-12-13 Xencor, Inc. Fc Variants Having Decreased Affinity for FcyRl
US20070243188A1 (en) 2003-03-03 2007-10-18 Xencor, Inc. Fc Variants Having Decreased Affinity for FcyRlla
WO2004099249A2 (en) 2003-05-02 2004-11-18 Xencor, Inc. Optimized fc variants and methods for their generation
US7862820B2 (en) 2003-05-06 2011-01-04 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US7404956B2 (en) 2003-05-06 2008-07-29 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US7381408B2 (en) 2003-05-06 2008-06-03 Syntonix Pharmaceuticals, Inc. Methods for chemically synthesizing immunoglobulin chimeric proteins
US7348004B2 (en) 2003-05-06 2008-03-25 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
WO2005040217A2 (en) 2003-10-17 2005-05-06 Cambridge University Technical Services Limited Antibodies having a mutated amino acid residue at position 268 (ch2 region) in constant regions
WO2005047327A2 (en) 2003-11-12 2005-05-26 Biogen Idec Ma Inc. NEONATAL Fc RECEPTOR (FcRn)-BINDING POLYPEPTIDE VARIANTS, DIMERIC Fc BINDING PROTEINS AND METHODS RELATED THERETO
WO2005077981A2 (en) 2003-12-22 2005-08-25 Xencor, Inc. Fc POLYPEPTIDES WITH NOVEL Fc LIGAND BINDING SITES
WO2005070963A1 (en) 2004-01-12 2005-08-04 Applied Molecular Evolution, Inc Fc region variants
WO2005092925A2 (en) 2004-03-24 2005-10-06 Xencor, Inc. Immunoglobulin variants outside the fc region
WO2005123780A2 (en) 2004-04-09 2005-12-29 Protein Design Labs, Inc. Alteration of fcrn binding affinities or serum half-lives of antibodies by mutagenesis
WO2006085967A2 (en) 2004-07-09 2006-08-17 Xencor, Inc. OPTIMIZED ANTI-CD20 MONOCONAL ANTIBODIES HAVING Fc VARIANTS
WO2006019447A1 (en) 2004-07-15 2006-02-23 Xencor, Inc. Optimized fc variants
WO2006047350A2 (en) 2004-10-21 2006-05-04 Xencor, Inc. IgG IMMUNOGLOBULIN VARIANTS WITH OPTIMIZED EFFECTOR FUNCTION
US7566565B2 (en) 2006-03-24 2009-07-28 Syntonix Pharmaceuticals, Inc. PC5 as a factor IX propeptide processing enzyme
WO2008012543A1 (en) 2006-07-25 2008-01-31 Ucb Pharma S.A. Single chain fc polypeptides
US20080260738A1 (en) 2007-04-18 2008-10-23 Moore Margaret D Single chain fc, methods of making and methods of treatment
WO2008143954A2 (en) 2007-05-14 2008-11-27 Biogen Idec Ma Inc. Single-chain fc (scfc) regions, binding polypeptides comprising same, and methods related thereto
WO2009140598A1 (en) * 2008-05-16 2009-11-19 Bayer Healthcare Llc Targeted coagulation factors and method of using the same
WO2010115866A1 (en) 2009-04-06 2010-10-14 Novo Nordisk A/S Targeted delivery of factor viii proteins to platelets
US20100330059A1 (en) * 2009-06-25 2010-12-30 The University Of North Carolina At Chapel Hill Chimeric factor vii molecules

Non-Patent Citations (116)

* Cited by examiner, † Cited by third party
Title
"Antibody Engineering: A Practical Approach", 1996, IRL PR, article "Practical Approach Series", pages: 169
"Current Protocols in Molecular Biology", 1992, JOHN WILEY & SONS
"PCR Protocols: A Guide to Methods and Applications", 1990, ACADEMIC PRESS
A. VYSOTCHIN ET AL., J. BIOL. CHEM., vol. 268, 1993, pages 8436
ARMOUR ET AL., EUR. J. IMMUNOL., vol. 29, 1999, pages 2613
BALDASSARRE ET AL., THERIOGENOLOGY, vol. 59, 2003, pages 831
BENARD ET AL., BIOCHEMISTRY, vol. 47, 2008, pages 4674
BENARD ET AL., BIOCHEMISTRY, vol. 47, 2008, pages 4674 - 4682
BENHAR, PASTAN, PROTEIN ENGINEERING, vol. 7, 1994, pages 1509
BERNARD ET AL., BIOCHEMISTRY, vol. 47, 2008, pages 4674 - 4682
BERNARD, BIOCHEMISTRY, vol. 47, 2008, pages 4674 - 4682
BETTER ET AL., SCIENCE, vol. 240, 1988, pages 1041
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 337, 2005, pages 1276
BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423
BIRD, SCIENCE, vol. 242, 1988, pages 42,3 - 442
BRINSTER ET AL., NATURE, vol. 306, 1983, pages 332
BRINSTER ET AL., PROC. NATL. ACAD.SCI. USA, vol. 82, 1985, pages 4438
BRUCE A CHABNER ET AL.: "GOODMAN & GILMAN'S THE PHARMACOLOGICAL BASIS OF THERAPEUTICS", 1996, article "Antineoplastic Agents", pages: 1233 - 1287
BURMEISTER, NATURE, vol. 372, 1994, pages 379
CHANG ET AL., JBC, vol. 273, 1988, pages 12089
CRIPE, L. D. ET AL., BIOCHEMISTRY, vol. 31, 1992, pages 3777 - 3785
DUMOULIN ET AL., PROTEIN SCIENCE, vol. 11, 2002, pages 500 - 515
EATON ET AL., BIOCHEMISTRY, vol. 25, 1986, pages 8343 - 8347
EATON, D. ET AL., BIOCHEMISTRY, vol. 25, 1986, pages 505
ELLMAN ET AL., METH. ENZYM., vol. 202, 1991, pages 301 - 336
FAULKNER ET AL., NATURE, vol. 298, 1982, pages 286
FAY, P. J. ET AL., J. BIOL. CHEM., vol. 266, 1991, pages 8957
FRIEND ET AL., TRANSPLANTATION, vol. 68, 1999, pages 1632
GITSCHIER, J. ET AL., NATURE, vol. 312, 1984, pages 326 - 330
GODING: "Monoclonal Antibodies: Principles and Practice", 1986, ACADEMIC PRESS, pages: 59 - 103
H. BRANDSTETTER ET AL., PROC. NATL. ACAD SCI. USA, vol. 92, 1995, pages 9796
HAMERS-CASTERMAN ET AL., NATURE, vol. 363, 1993, pages 446 - 448
HARLOW ET AL.: "Antibodies: A Laboratory Manual", 1999, CS.H.L. PRESS, PUB.
HO ET AL., GENE, vol. 77, 1989, pages 51
HOEBEN R.C. ET AL., J. BIOL CHEM., vol. 265, no. 13, 1990, pages 7318 - 7323
HORTON, METHODS ENZYMOL., vol. 217, 1993, pages 270
HUSTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883
ISRAEL ET AL., IMMUNOLOGY, vol. 92, 1997, pages 69
JENDREYKO ET AL., J. BIOL. CHEM., vol. 278, 2003, pages 47813
JENNY, R.. J. ET AL., PNAS (USA, vol. 84, 1987, pages 4846 - 4850
JONES, GENETICS, vol. 85, 1977, pages 12
KABAT ET AL.: "Sequences of Proteins of lmmiunological Interest", 1991, U.S. DEPARTMENT OF PUBLIC HEALTH
KANE, W. H. ET AL., PNAS (USA, vol. 83, 1986, pages 6800 - 6804
KINGSMAN ET AL., GENE, vol. 7, 1979, pages 141
KOBAYASHI ET AL., AM. J. PHYSIOL. RENAL PHYSIOL., vol. 282, 2002, pages F358
KOHLER ET AL., NATURE, vol. 256, 1975, pages 495
KOHLER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 77, 1980, pages 2197
LAGNER, BEHRING INST. MITT., 1988, pages 16 - 25
LARRICK ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 160, 1989, pages 1250
LEI, NATURE, vol. 331, 1988, pages 543
LIN ET AL., JOURNAL OF THROMBOSIS AND HAEMOSTASIS, vol. 8, 2010, pages 1773
LOLLAR, P. ET AL., J. BIOL. CHEM., vol. 266, 1991, pages 12481
LUSSON J ET AL., PROC NATL ACAD SCI USA, vol. 90, 1993, pages 6691 - 5
MALASSAGNE ET AL., XENOTRANSPLANTATION, vol. 10, no. 3, 2003, pages 267
MCKNIGHT ET AL., CELL, vol. 34, 1983, pages 335
MEULIEN P. ET AL., PROTEIN ENG., vol. 2, no. 4, 1988, pages 301 - 6
MILENIC ET AL., CANCER RESEARCH, vol. 51, 1991, pages 6363
MORRISON ET AL., ANN. REV. IMMUNOL., vol. 2, 1984, pages 239
MORRISON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6851
MORRISON, J. IMMUN., vol. 123, 1979, pages 793
MORRISON, SCIENCE, vol. 229, 1985, pages 1202
MULLINAX ET AL., PNAS, vol. 87, 1990, pages 8095
NAKAGAWA T ET AL., J BIOCHEM, vol. 113, 1993, pages 132 - 5
NAKAYAMA K, BIOCHEM J., vol. 327, 1997, pages 625 - 35
NEUMANN ET AL., EMBO, J. J, 1982, pages 841
NOREN ET AL., SCIENCE, vol. 244, 1989, pages 182
NUCLEIC ACIDS RES., vol. 18, 1990, pages 1332
PANTOLIANO ET AL., BIOCHEMISTRY, vol. 30, 1991, pages 10117
PAUL, S.: "Antibody Engineering Protocols", 1996, HUMANA PR, article "Methods in Molecular Biology", pages: 510
PERSSON ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 29195
PERSSON ET AL., PNAS, vol. 98, 2001, pages 13583
PETERSON ET AL., HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY, vol. 101, 2003, pages 937
PETROVAN, RUF, J. BIOL. CHEM., vol. 276, 2001, pages 6616
PIERRI ET AL., HUMAN GENE THERAPY, vol. 20, 2009, pages 479
RASO ET AL., CANCER RES., vol. 41, 1981, pages 2073
REHEMTULLA A ET AL., BIOCHEMISTRY, vol. 32, 1993, pages 11586 - 90
RIDGWAY, A. A. G.: "Mammalian Expression Vectors", 1988, BUTTERWORTHS, pages: 470 - 472
RITCHIE ET AL., NATURE, vol. 312, 1984, pages 517
ROBL ET AL., THERIOGENOLOGY, vol. 59, 2003, pages 107
ROUTLEDGE ET AL., TRANSPLANTATION, vol. 60, 1995, pages 847
RUBERTI, F. ET AL., J. IMMUNOL. METHODS, vol. 173, 1994, pages 33
RUTHER ET AL., EMBO J., vol. 2, 1983, pages 1791
S. BAJAJ ET AL., BIOCHEMISTRY, vol. 22, 1983, pages 4047
S. SPITZER ET AL., BIOCHEMICAL JOURNAL, vol. 265, 1990, pages 219
SAMBROOK, FRITSCH, MANIATIS: "Molecular Cloning", 1989, COLD SPRING HARBOR LABORATORY PRESS
SARVER ET AL., DNA, vol. 6, 1987, pages 553 - 5G4
SCHULTE, THROMBOSIS RES., vol. 124, no. 2, 2009, pages S6 - S8
SCHWARZ ET AL., CIRCULATION RESEARCH, vol. 99, 2006, pages 25 - 33
SCHWARZ ET AL., FASEB JOURNAL EXPRESS ARTICLE 10. 1096/FJ.04-1513FJE, 2004
SCHWARZ ET AL., FASEB JOURNAL EXPRESS ARTICLE, 2004
SCOPES: "Protein Purification", 1982, SPRINGER-VERLAG
SHIELDS ET AL., J. BIOL. CHEM., vol. 276, 1995, pages 6591
SHIELDS ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 6591
SICHLER, J. BIOL. CHEM., vol. 278, 2003, pages 4121
SIMIONI ET AL., N.E. JOURNAL OF MEDICINE, vol. 361, 2009, pages 1671
SKERRA ET AL., SCIENCE, vol. 242, 1988, pages 1038 - 1041
SOEJIMA ET AL., J. BIOL. CHEM., vol. 247, 2002, pages 49027
SOEJIMA ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 17229
STINCHCOMB ET AL., NATURE, vol. 282, 1979, pages 39
STORY ET AL., J. EXP. MED., vol. 180, 1994, pages 2377
STUBBS, J. D. ET AL., PNAS (USA, vol. 87, 1990, pages 8417 - 8421
STURZEBECHER ET AL., FEBS LETT, vol. 412, 1997, pages 295
TAKAHASHI, N. ET AL., PNAS (USA, vol. 81, 1984, pages 390 - 394
TAKKINEN ET AL., PROTEIN ENGINEERING, vol. 4, 1991, pages 837
TOOLE ET AL., PROC. NATI. ACAD. SCI. U.S.A., vol. 83, 1986, pages 5939 - 5942
TOOLE, J. J. ET AL., NATURE, vol. 312, 1984, pages 342 - 347
TSCHEMPER ET AL., GENE, vol. 10, 1980, pages 157
VAN DEN OUWELAND A M ET AL., NUCLEIC ACIDS RES., vol. 18, 1990, pages 664
WAGNER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 78, 1981, pages 6376
WARD ET AL., NATURE, vol. 334, 1989, pages 544 - 554
WARD, GHETIE, THERAPEUTIC IMMUNOLOGY, vol. 2, 1995, pages 77
WASLEY L C ET AL., J BIOL CHEM., vol. 268, 1993, pages 8458 - 65
WEHAR, G. A. ET AL., NATURE, vol. 312, 1984, pages 337 - 342
WIGLER ET AL., CELL, vol. 14, 1978, pages 725
YANG X ET AL: "An ordered sequential mechanism for Factor IX and Factor IXa binding to platelet receptors in the assembly of the Factor X-activating complex", BIOCHEMICAL JOURNAL, THE BIOCHEMICAL SOCIETY, LONDON, GB, vol. 390, no. 1, 15 August 2005 (2005-08-15), pages 157 - 167, XP009118579, ISSN: 0264-6021, [retrieved on 20050309], DOI: 10.1042/BJ20050029 *
ZOGG, BRANDSTETTER, STRUCTURE, vol. 17, 2009, pages 1669

Cited By (102)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11168125B2 (en) 2003-05-06 2021-11-09 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US11401322B2 (en) 2003-05-06 2022-08-02 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US9938331B2 (en) 2005-09-27 2018-04-10 Amunix Operating Inc. Biologically active proteins having increased in vivo and/or in vitro stability
US8716448B2 (en) 2009-02-03 2014-05-06 Amunix Operating Inc. Coagulation factor VII compositions and methods of making and using same
US10961287B2 (en) 2009-02-03 2021-03-30 Amunix Pharmaceuticals, Inc Extended recombinant polypeptides and compositions comprising same
US12071456B2 (en) 2009-02-03 2024-08-27 Amunix Pharmaceuticals, Inc. Extended recombinant polypeptides and compositions comprising same
US9371369B2 (en) 2009-02-03 2016-06-21 Amunix Operating Inc. Extended recombinant polypeptides and compositions comprising same
US9926351B2 (en) 2009-02-03 2018-03-27 Amunix Operating Inc. Extended recombinant polypeptides and compositions comprising same
US9758776B2 (en) 2009-08-24 2017-09-12 Amunix Operating Inc. Coagulation factor IX compositions and methods of making and using same
US9376672B2 (en) 2009-08-24 2016-06-28 Amunix Operating Inc. Coagulation factor IX compositions and methods of making and using same
US9062299B2 (en) 2009-08-24 2015-06-23 Amunix Operating Inc. Coagulation factor IX compositions and methods of making and using same
US9994646B2 (en) 2009-09-16 2018-06-12 Genentech, Inc. Coiled coil and/or tether containing protein complexes and uses thereof
US10106600B2 (en) 2010-03-26 2018-10-23 Roche Glycart Ag Bispecific antibodies
US10968442B2 (en) 2010-07-09 2021-04-06 Bioverativ Therapeutics Inc. Chimeric clotting factors
US9856468B2 (en) 2010-07-09 2018-01-02 Bioverativ Therapeutics Inc. Processable single chain molecules and polypeptides made using same
US10927362B2 (en) 2010-07-09 2021-02-23 Bioverativ Therapeutics Inc. Processable single chain molecules and polypeptides made using same
EP3527218A1 (en) 2011-06-10 2019-08-21 Bioverativ Therapeutics Inc. Pro-coagulant compounds and methods of use thereof
US9486507B2 (en) 2011-06-10 2016-11-08 Biogen Ma Inc. Pro-coagulant compounds and methods of use thereof
WO2013096932A1 (en) * 2011-12-23 2013-06-27 Vasculogics, Inc. Compositions and methods for treatment of thrombosis and prolonging survival of stored platelets
US11370827B2 (en) 2012-01-12 2022-06-28 Bioverativ Therapeutics Inc. Chimeric factor VIII polypeptides and uses thereof
JP2015508077A (ja) * 2012-02-10 2015-03-16 ジェネンテック, インコーポレイテッド 単鎖抗体及び他のヘテロ多量体
US9688758B2 (en) 2012-02-10 2017-06-27 Genentech, Inc. Single-chain antibodies and other heteromultimers
EP3564260A1 (en) 2012-02-15 2019-11-06 Bioverativ Therapeutics Inc. Factor viii compositions and methods of making and using same
EP3549953A1 (en) 2012-02-15 2019-10-09 Bioverativ Therapeutics Inc. Recombinant factor viii proteins
US10421798B2 (en) 2012-02-15 2019-09-24 Bioverativ Therapeutics Inc. Factor VIII compositions and methods of making and using same
EP4194465A1 (en) 2012-02-15 2023-06-14 Bioverativ Therapeutics Inc. Factor viii compositions and methods of making and using same
US11685771B2 (en) 2012-02-15 2023-06-27 Bioverativ Therapeutics Inc. Recombinant factor VIII proteins
US10370430B2 (en) 2012-02-15 2019-08-06 Bioverativ Therapeutics Inc. Recombinant factor VIII proteins
EP2858659A4 (en) * 2012-06-08 2016-09-28 Biogen Ma Inc PROKOAGULATIONSVERBINDUNGEN
US10287564B2 (en) 2012-06-08 2019-05-14 Bioverativ Therapeutics Inc. Procoagulant compounds
EP3693000A1 (en) 2012-06-08 2020-08-12 Bioverativ Therapeutics Inc. Procoagulant compounds
EP2863940A4 (en) * 2012-06-08 2016-08-10 Biogen Ma Inc Chimeric clotting factors
US11168316B2 (en) 2012-06-08 2021-11-09 Bioverativ Therapeutics, Inc. Chimeric clotting factors
US11261437B2 (en) 2012-06-08 2022-03-01 Bioverativ Therapeutics Inc. Procoagulant compounds
US20150353911A1 (en) * 2012-06-08 2015-12-10 Biogen Idec Ma Inc. Chimeric clotting factors
CN104427995A (zh) * 2012-06-08 2015-03-18 比奥根艾迪克Ma公司 嵌合凝血因子
EP4079316A1 (en) 2012-06-08 2022-10-26 Bioverativ Therapeutics Inc. Procoagulant compounds
WO2013185114A3 (en) * 2012-06-08 2014-01-30 Biogen Idec Ma Inc. Chimeric clotting factors
WO2013185114A2 (en) 2012-06-08 2013-12-12 Biogen Idec Ma Inc. Chimeric clotting factors
US10202595B2 (en) 2012-06-08 2019-02-12 Bioverativ Therapeutics Inc. Chimeric clotting factors
US11421022B2 (en) 2012-06-27 2022-08-23 Hoffmann-La Roche Inc. Method for making antibody Fc-region conjugates comprising at least one binding entity that specifically binds to a target and uses thereof
US11407836B2 (en) 2012-06-27 2022-08-09 Hoffmann-La Roche Inc. Method for selection and production of tailor-made highly selective and multi-specific targeting entities containing at least two different binding entities and uses thereof
US10106612B2 (en) 2012-06-27 2018-10-23 Hoffmann-La Roche Inc. Method for selection and production of tailor-made highly selective and multi-specific targeting entities containing at least two different binding entities and uses thereof
US10138291B2 (en) 2012-07-11 2018-11-27 Bioverativ Therapeutics Inc. Factor VIII complex with XTEN and von Willebrand Factor protein, and uses thereof
US11091534B2 (en) 2012-07-11 2021-08-17 Bioverativ Therapeutics Inc. Factor VIII complex with XTEN and von Willebrand Factor protein, and uses thereof
US10391152B2 (en) 2012-10-18 2019-08-27 Bioverativ Therapeutics Inc. Methods of using a fixed dose of a clotting factor
WO2014063108A1 (en) 2012-10-18 2014-04-24 Biogen Idec Ma Inc. Methods of using a fixed dose of a clotting factor
EP2727940A1 (en) * 2012-10-31 2014-05-07 Samsung Electronics Co., Ltd Bispecific antigen binding protein complex and preparation methods of bispecific antibodies
US9932412B2 (en) 2012-10-31 2018-04-03 Samsung Electronics Co., Ltd. Bispecific antigen binding protein complex and preparation methods of bispecific antibodies
US10717965B2 (en) 2013-01-10 2020-07-21 Gloriana Therapeutics, Inc. Mammalian cell culture-produced neublastin antibodies
US11787851B2 (en) 2013-02-15 2023-10-17 Bioverativ Therapeutics Inc. Optimized factor VIII gene
US9458245B2 (en) 2013-03-06 2016-10-04 Merrimack Pharmaceuticals, Inc. ANTI-C-MET tandem Fc bispecific antibodies
WO2014138449A1 (en) * 2013-03-06 2014-09-12 Merrimack Pharmaceuticals, Inc. Anti-c-met tandem fc bispecific antibodies
US10364288B2 (en) 2013-05-24 2019-07-30 Biogen Ma Inc. Anti-GPIIB/IIIA antibodies or uses thereof
EP3003368A4 (en) * 2013-05-24 2017-05-03 Biogen MA Inc. Anti-gpiib/iiia antibodies or uses thereof
WO2014194282A3 (en) * 2013-05-31 2015-03-12 Biogen Idec Ma Inc. Chimeric fvii-xten molecules and uses thereof
EP4368194A2 (en) 2013-06-28 2024-05-15 Bioverativ Therapeutics Inc. Thrombin cleavable linker with xten and its uses thereof
WO2015023894A1 (en) 2013-08-14 2015-02-19 Biogen Idec Ma Inc. Recombinant factor viii proteins
EP4108254A1 (en) 2013-08-14 2022-12-28 Bioverativ Therapeutics Inc. Recombinant factor viii proteins
US10548953B2 (en) 2013-08-14 2020-02-04 Bioverativ Therapeutics Inc. Factor VIII-XTEN fusions and uses thereof
US11578098B2 (en) 2013-09-25 2023-02-14 Bioverativ Therapeutics Inc. On-column viral inactivation methods
US12134632B2 (en) 2013-09-25 2024-11-05 Bioverativ Therapeutics Inc. On-column viral inactivation methods
EP3903599A1 (en) 2013-09-25 2021-11-03 Bioverativ Therapeutics Inc. On-column viral inactivation methods
US10584147B2 (en) 2013-11-08 2020-03-10 Biovertiv Therapeutics Inc. Procoagulant fusion compound
WO2015095809A1 (en) 2013-12-20 2015-06-25 Biogen Idec Ma Inc. Use of perfusion seed cultures to improve biopharmaceutical fed-batch production capacity and product quality
US11192936B2 (en) 2014-01-10 2021-12-07 Bioverativ Therapeutics Inc. Factor VIII chimeric proteins and uses thereof
US12275970B2 (en) 2014-06-30 2025-04-15 Bioverativ Therapeutics Inc. Optimized factor IX gene
US11584923B2 (en) 2014-10-14 2023-02-21 Halozyme, Inc. Compositions of adenosine deaminase-2 (ADA2), variants thereof and methods of using same
US9969998B2 (en) 2014-10-14 2018-05-15 Halozyme, Inc. Compositions of adenosine deaminase-2 (ADA2), variants thereof and methods of using same
WO2016061286A2 (en) 2014-10-14 2016-04-21 Halozyme, Inc. Compositions of adenosine deaminase-2 (ada2), variants thereof and methods of using same
WO2016065301A1 (en) 2014-10-23 2016-04-28 Biogen Ma Inc. Anti-gpiib/iiia antibodies and uses thereof
US10875924B2 (en) 2014-10-23 2020-12-29 Biogen Ma Inc. Anti-GPIIB/IIIA antibodies and uses thereof
WO2016070050A1 (en) 2014-10-31 2016-05-06 Biogen Ma Inc. ANTI-GLYCOPROTEIN IIb/IIIa ANTIBODIES
US20170342152A1 (en) * 2014-10-31 2017-11-30 Biogen Ma Inc. ANTI-GLYCOPROTEIN IIb/IIIa ANTIBODIES
US11999801B2 (en) 2014-12-03 2024-06-04 Hoffman-La Roche Inc. Multispecific antibodies
US10633457B2 (en) 2014-12-03 2020-04-28 Hoffmann-La Roche Inc. Multispecific antibodies
AU2016274890B2 (en) * 2015-06-12 2022-02-10 Ubi Pharma Inc Immunoglobulin fusion proteins and uses thereof
EP3307304A4 (en) * 2015-06-12 2018-12-26 UBI Pharma Inc. Immunoglobulin fusion proteins and uses thereof
US10745680B2 (en) 2015-08-03 2020-08-18 Bioverativ Therapeutics Inc. Factor IX fusion proteins and methods of making and using same
WO2017079768A1 (en) * 2015-11-08 2017-05-11 Genentech, Inc. Methods of screening for multispecific antibodies
US11753461B2 (en) 2016-02-01 2023-09-12 Bioverativ Therapeutics Inc. Optimized factor VIII genes
US12161696B2 (en) 2016-12-02 2024-12-10 Bioverativ Therapeutics Inc. Methods of treating hemophilic arthropathy using chimeric clotting factors
WO2018144623A1 (en) 2017-01-31 2018-08-09 Bioverativ Therapeutics Inc. Factor ix fusion proteins and methods of making and using same
EP3595707A4 (en) * 2017-03-14 2021-01-13 Ohio State Innovation Foundation METHODS AND COMPOSITIONS RELATING TO IGG3 IMMUNOCONJUGATES TARGETING TISSUE FACTOR
US11872194B2 (en) 2017-03-14 2024-01-16 Ohio State Innovation Foundation Methods and compositions related to a tissue factor-targeting IGG3 immunoconjugates
US20200085922A1 (en) * 2017-03-14 2020-03-19 Ohio State Innovation Foundation Methods and compositions related to a tissue factor-targeting igg3 immunoconjugates
US12030925B2 (en) 2018-05-18 2024-07-09 Bioverativ Therapeutics Inc. Methods of treating hemophilia A
WO2019241847A1 (en) * 2018-06-22 2019-12-26 Baker Heart and Diabetes Institute A therapeutic gpiib/iiia binding-protein drug conjugate and use thereof
US12209262B2 (en) * 2018-08-20 2025-01-28 Ucl Business Ltd Factor IX encoding nucleotides
US20210309985A1 (en) * 2018-08-20 2021-10-07 Ucl Business Ltd Factor ix encoding nucleotides
WO2020086408A1 (en) 2018-10-26 2020-04-30 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services A high-yield perfusion-based transient gene expression bioprocess
WO2020118069A2 (en) 2018-12-06 2020-06-11 Bioverativ Therapeutics Inc. Use of lentiviral vectors expressing factor ix
US12122847B2 (en) 2019-04-17 2024-10-22 Novo Nordisk A/S Factor VII (FVII(a))/TREM-like transcript 1 (TLT-1) bispecific antibodies
US11325983B2 (en) 2019-04-17 2022-05-10 Novo Nordisk A/S Bispecific antibodies
US20220323590A1 (en) * 2019-07-02 2022-10-13 Jiangsu Gensciences Inc. Improved fix fusion protein and conjugate and use thereof
US12403164B2 (en) 2019-09-30 2025-09-02 Bioverativ Therapeutics Inc. Lentiviral vector formulations
US12173307B2 (en) 2020-06-24 2024-12-24 Bioverativ Therapeutics Inc. Methods for the purification of viral vectors
EP4199948A4 (en) * 2020-08-18 2024-10-16 Onchilles Pharma, Inc. Modified serine protease proproteins
CN116261592A (zh) * 2020-08-18 2023-06-13 昂希莱斯制药公司 经修饰的丝氨酸蛋白酶前蛋白
US12516307B2 (en) 2020-08-18 2026-01-06 Onchilles Pharma, Inc. Modified porcine pancreatic elastase proteins
US12617839B2 (en) 2021-11-05 2026-05-05 Bioverativ Therapeutics Inc. Factor VIII chimeric proteins and uses thereof
WO2023133469A3 (en) * 2022-01-07 2023-08-24 Codexis, Inc. Recombinant factor viii variants

Also Published As

Publication number Publication date
EP3560962A1 (en) 2019-10-30
CA2804280A1 (en) 2012-01-12
US10927362B2 (en) 2021-02-23
HRP20191305T1 (hr) 2019-10-18
US20180320159A1 (en) 2018-11-08
AU2011274423B2 (en) 2016-02-11
CN103180439A (zh) 2013-06-26
AU2011274423A1 (en) 2013-01-24
ES2739503T3 (es) 2020-01-31
US20130202596A1 (en) 2013-08-08
MX2013000301A (es) 2013-05-09
WO2012006635A1 (en) 2012-01-12
HUE044419T2 (hu) 2019-10-28
DK2591006T3 (da) 2019-07-29
SG186875A1 (en) 2013-02-28
EP2591099B1 (en) 2020-11-18
US20210292729A1 (en) 2021-09-23
TW201217527A (en) 2012-05-01
CY1122044T1 (el) 2020-10-14
SI2591006T1 (sl) 2019-10-30
SG10201505217WA (en) 2015-08-28
EP2591006A1 (en) 2013-05-15
PL2591006T3 (pl) 2019-10-31
EP2591006B1 (en) 2019-04-24
PT2591006T (pt) 2019-07-29
US20210355473A1 (en) 2021-11-18
LT2591006T (lt) 2019-08-26
NZ605400A (en) 2015-05-29
KR20140002601A (ko) 2014-01-08
EP2591099A1 (en) 2013-05-15
US20130216513A1 (en) 2013-08-22
DK2591099T3 (da) 2021-02-15
US9856468B2 (en) 2018-01-02
US20170044512A1 (en) 2017-02-16
TW201217526A (en) 2012-05-01
US10968442B2 (en) 2021-04-06
JP2013534427A (ja) 2013-09-05
EA201291482A1 (ru) 2013-10-30

Similar Documents

Publication Publication Date Title
US20210355473A1 (en) Chimeric clotting factors
US12134632B2 (en) On-column viral inactivation methods
DK2361932T3 (en) CHEMICAL IMMUNOGLOBULIN MONOMER DIMER HYBRIDS
AU2021277601B2 (en) Factor VIII polypeptide formulations
KR102110736B1 (ko) Viii 인자 키메라 및 하이브리드 폴리펩타이드, 그리고 이들의 사용 방법
CN106456718B (zh) 因子viii嵌合蛋白及其用途
CN108465106B (zh) 降低经受因子viii疗法的个体中针对因子viii的免疫原性的方法
ES2987558T3 (es) PC5 como enzima de procesamiento de propéptido de factor IX
KR20140115347A (ko) 키메라 인자 viii 폴리펩티드들과 이의 용도
KR20210020030A (ko) A형 혈우병의 치료 방법
AU2016244273B2 (en) Immunoglobulin Chimeric Monomer-Dimer Hybrids

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11738538

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 201291482

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 223991

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2804280

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2013518877

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2013/000301

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2011274423

Country of ref document: AU

Date of ref document: 20110711

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2011738538

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20137003461

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13809289

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013000652

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112013000652

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20130109