WO2011074897A2 - 식물배양세포주를 이용한 표준물질의 제조방법 - Google Patents

식물배양세포주를 이용한 표준물질의 제조방법 Download PDF

Info

Publication number
WO2011074897A2
WO2011074897A2 PCT/KR2010/009027 KR2010009027W WO2011074897A2 WO 2011074897 A2 WO2011074897 A2 WO 2011074897A2 KR 2010009027 W KR2010009027 W KR 2010009027W WO 2011074897 A2 WO2011074897 A2 WO 2011074897A2
Authority
WO
WIPO (PCT)
Prior art keywords
genetically modified
standard
sample
analysis
tissue culture
Prior art date
Application number
PCT/KR2010/009027
Other languages
English (en)
French (fr)
Other versions
WO2011074897A3 (ko
Inventor
김형하
김우정
서정근
Original Assignee
한국표준과학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국표준과학연구원 filed Critical 한국표준과학연구원
Priority to EP10837893.6A priority Critical patent/EP2514816B1/en
Priority to US13/513,096 priority patent/US9512492B2/en
Priority to JP2012541033A priority patent/JP5784034B2/ja
Publication of WO2011074897A2 publication Critical patent/WO2011074897A2/ko
Publication of WO2011074897A3 publication Critical patent/WO2011074897A3/ko
Priority to US15/336,499 priority patent/US20170044629A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/04—Plant cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5097—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Definitions

  • the present invention provides a method for preparing a standard material for analysis of the incorporation or incorporation rate of a genetically modified product from a tissue culture cell line obtained by tissue culture of a tissue of a genetically modified or non-genetically modified product and a genetically modified product using the standard material.
  • the present invention relates to a method for analyzing the incorporation or incorporation rate in a sample.
  • GMO Genetically Modified Organism
  • Quantitative analysis of genetically modified organisms is largely divided into protein analysis and DNA analysis.
  • the ELISA method for the protein expressed from the gene introduced into the genetic modification has a lower detection intensity than the PCR method and there is a limit because the protein can be denatured by heat treatment.
  • a technique for quantifying genes introduced into genetically modified products using real-time PCR is currently used.
  • a standard material capable of comparing the copy number of introduced genes introduced into the genetically modified product is required.
  • the present invention seeks to improve the reliability of standard materials in terms of securing or verifying the purity of these starting samples.
  • the present invention is to provide a method for preparing a reference material for the analysis of the incorporation rate of the genetic modification of the sample as well as to confirm the purity of the starting sample 100% homogeneity and a method for analyzing the content of the genetic modification in the sample using the same.
  • the present invention comprises the steps of tissue culture, respectively, genetically modified or non-genetically modified product: and standard for analysis of the incorporation or incorporation rate analysis of the genetically modified product comprising the step of separating each tissue culture cell line Provided are methods for preparing the material.
  • the present invention also provides a method for preparing a standard for incorporation or incorporation rate analysis in a genetically modified sample comprising extracting genomic DNA from each tissue culture cell line obtained by tissue culture of a genetically modified or non-genetically modified product. Provide a method.
  • the present invention also incorporates a genetically modified product comprising performing PCR of analytical samples by preparing a primer specific for the base sequence of the transgene using a template of genomic DNA extracted from a tissue culture cell line obtained by tissue culture of the genetically modified product. Provides an analysis method.
  • the present invention also relates to a gene comprising comparing genomic DNA extracted from a tissue culture cell line obtained by tissue culture of a genetically modified or non-genetically modified organism, to a PCR product obtained from a sample using as a standard for analyzing the incorporation rate of the genetically modified product.
  • a method for analyzing the incorporation rate of a modified plant in a sample is provided.
  • the reference material for analysis of incorporation rate is numerous. Increasing the incubation volume in large quantities can provide a large amount of standards of uniform quality that eliminate heterogeneity between batches. In addition, unlike the standard material manufactured using conventional grain powder, the purity of the cultured cell line is proven, so that a standard material with 100% purity or non-GM can be obtained. There is an advantage. This ensures a consistent and stable supply of standard materials of constant composition at all times.
  • FIG. 1 shows the cotyledon of soybean produced 5 days after germination
  • FIG. 2 shows cell micrographs (right) of callus (left) derived from leaf tissue of soybean and liquid suspension culture cell lines derived from callus of soybean.
  • Figure 3 shows the PCR results of the transgene using 35S3F and NOS3R PCR primers.
  • M molecular weight marker DNA
  • G GM soybean DNA
  • N non-GM soybean
  • Figure 4 shows the results of electrophoresis of genomic DNA of soybeans.
  • M molecular weight marker DNA
  • G GM soybean DNA
  • N non-GM soybean
  • FIG. 6 is a view showing the results of real-time quantitative PCR using a commercially available plasmid DNA reference.
  • FIG. 7 is a diagram showing a standard curve obtained from the results of real-time quantitative PCR using a commercially available plasmid DNA reference.
  • FIG. 8 is a view showing the results of real-time quantitative PCR using a plasmid DNA reference prepared in-house.
  • FIG. 9 is a diagram showing a standard curve obtained from the results of real-time quantitative PCR using a plasmid DNA reference prepared in-house.
  • FIG. 10 is a diagram showing the results of real-time quantitative PCR using genomic DNA reference material of GM suspension culture cell line.
  • FIG. 11 is a diagram showing a standard curve obtained from the results of real-time quantitative PCR using genomic DNA reference material of GM suspension culture cell line.
  • the 'incorporation rate in a sample of a genetically modified product' refers to the ratio of the amount of the genetically modified product to the total amount of the unknown sample or the ratio of the endogenous genes and artificially introduced modified genes of a specific crop as a percentage (%). It means the value shown in conversion.
  • the incorporation rate in a sample of genetic modification can be calculated using the transgene or protein expressed therein, wherein the amount or copy number of the transgene with respect to the endogenous gene or protein expressed therefrom, or therefrom The percentage of expressed protein can be measured to determine relative to what percentage of the genetic variants are present.
  • An endogenous gene refers to a gene inherently possessed by each crop, and an introduced gene refers to a foreign gene introduced into a genetic modification.
  • the present invention uses the tissue culture cell line obtained by tissue culture of the genetically modified or non-genetically modified product, or genomic DNA extracted from it, as a standard material for analysis of the incorporation or incorporation rate of the genetically modified product into an initial sample.
  • the purpose of this study was to demonstrate the purity of starting samples used to prepare standards as a method of ensuring and ensuring the homogeneity of. Tissue culture techniques can be used to obtain a large number of individuals with the same genotype, thus eliminating heterogeneity between batches in the preparation of standards and ensuring homogeneity and purity of the initial sample.
  • the present invention comprises the steps of tissue culture each genetically modified or non-genetically modified; And it provides a method for producing a standard for incorporation rate analysis in a sample of genetic modification comprising the step of separating each tissue culture cell line.
  • 'Standard substance' used in the present invention is a sample which is a standard for measuring the incorporation or the rate of incorporation of genetically modified products, and is composed of 100% genetically modified (100% GMO) or 100% genetically unmodified ( 100% non-GMO) may mean each of the samples, or the amount of the genetic modification may mean a sample that is already formulated at a predetermined rate.
  • the standard substance for incorporation or incorporation rate analysis in a sample of genetically modified product is a pure genetically modified or non-genetically modified product obtained by tissue culture of specific tissue of genetically modified or non-genetically modified product, respectively.
  • Tissue cultured cell lines themselves can be used as 100% GMO or 100% non-GMO standards.
  • the tissue culture cell lines of each of the genetically modified or non-genetically modified product may be stored or distributed after pretreatment such as, for example, lyophilization.
  • Tissue cultured cell lines of the genetically modified or non-genetically modified tissues obtained by tissue culture of specific tissues of the genetically modified or non-genetically modified organisms may also be used in pure form, but they may be mixed in a predetermined ratio so that they are known. It may also be made of a standard material having an incorporation rate. By preparing a standard material that knows the mixing rate and real-time PCR amplification, the standard curve is calculated, and the real-time PCR amplification result of the analytical sample can be compared with the standard curve, so that the genetic modification content of the analyte can be easily analyzed. In the case of such standards, but not limited thereto, for example, the incorporation rate of the genetic modification may be prepared to be 0%, 0.1%, 0.5%, 1%, 2%, 3%, or 5%, respectively.
  • the method for preparing a standard for incorporation rate analysis in a sample of genetic modification further comprises mixing a tissue culture cell line of the isolated genetic modification or non-genetic modification at a predetermined ratio.
  • a tissue culture cell line of genetically modified or non-genetically modified product is obtained by tissue culture of a specific tissue of genetically modified or non-genetically modified product, respectively, and the tissue culture cell line of the genetically modified product or genetically unmodified product. May be mixed in a predetermined ratio and used as a standard material having a known GMO incorporation rate.
  • genomic DNA can be used for incorporation or analysis of the incorporation rate of the genetically modified product.
  • the present invention provides a method for preparing a standard material for analysis of the incorporation rate of a genetically modified product comprising the step of extracting genomic DNA from each tissue culture cell line obtained by tissue culture of the genetically modified or non-genetically modified product. do.
  • the standard substance for incorporation or incorporation rate analysis in a sample of genetically modified product is a tissue of genetically modified or non-genetically modified product obtained by tissue culture of specific tissue of genetically modified or non-genetically modified product, respectively.
  • Each genomic DNA can be extracted from the cell line and 100% GMO or 100% non-GMO genomic DNA can be used as a standard.
  • Each genomic DNA extracted from the tissue culture cell line of the genetically modified or unmodified genetically modified cells may be used in pure form, but these may be quantified and mixed at a predetermined ratio to prepare a standard material having a known GMO incorporation rate. have.
  • a standard material that knows the mixing rate and real-time PCR amplification
  • the standard curve is calculated, and the real-time PCR amplification result of the analytical sample can be compared with the standard curve, so that the genetic modification content of the analyte can be easily analyzed.
  • the incorporation rate of the genetic modification may be prepared to be 0%, 0.1%, 0.5%, 1%, 2%, 3%, or 5%, respectively.
  • the method for preparing a standard for incorporation rate analysis in a sample of genetic modification may further include mixing each genomic DNA at a predetermined ratio.
  • each genomic DNA extracted from a tissue-modified cell line of a genetically modified or a non-genetically modified tissue obtained by tissue culture of a specific tissue of a genetically modified or non-genetically modified product can be used as a reference material. Can be.
  • the standard material mainly used is a standard plasmid made by inserting an amplicon of a genetic sample and a non-genetically modified product in a certain amount or a mixture of endogenous and transgenes thereof.
  • the PCR plasmids of the intrinsic gene and the transgene are inserted into the same plasmid in the standard plasmid, so that the standard plasmid in a constant state can be infinitely supplied as a standard material by propagating the standard plasmid in E. coli.
  • the tissue culture according to the present invention is a cultured cell line (callus) by culturing a part of a specific tissue of genetically modified or non-genetically modified in a liquid medium containing appropriate nutrition and plant growth regulators , callus) can be produced and passaged to the cultured cell line.
  • the tissue culture may preferably be carried out in a sterile state.
  • a method of extracting DNA from the cultured cell line may be used by any method known in the art, but is not limited thereto.
  • Method development in relation to regulatory requirements for the detection of GMOs in the disclosed in the food chain (Anklam et al. 2002, Journal of AOAC International. 85 (3), 753) or Validation studies and proficiency testing (Anklam et al. 2002, Journal of AOAC International. 85 (3), 809-815) It can extract by a method.
  • the present invention is a genomic DNA extracted from the tissue culture cell line obtained by tissue culture of the genetic modification as a template to prepare a primer specific for the base sequence of the transgene to incorporate a genetic modification comprising the PCR of the assay sample
  • the PCR product of the analytical sample may be qualitatively analyzed for incorporation of the genetic modification by comparing the PCR product with the genetic product or the non-genetic modification template.
  • the present invention includes comparing the genomic DNA extracted from the tissue culture cell line obtained by tissue culture of the genetically modified or non-genetically modified, respectively, with the PCR product obtained from the analytical sample using as a standard for analysis of the incorporation rate of the genetically modified product.
  • comparing the PCR product obtained from the standard and the assay sample is not limited thereto, but may use real-time polymerase chain reaction (hereinafter, Real-Time PCR).
  • the amount of intrinsic and transgene is measured by measuring the amount of fluorescence generated during PCR amplification by using a bidirectional primer and a detection probe that specifically bind to the DNA of the endogenous and transgene. Can be calculated. It is a method of analyzing the percentage of genetically modified organisms by the relative ratio of the foreign transgenes to the endogenous genes of the plant.
  • the detection probe refers to a probe in which a fluorescent material is introduced into a nucleotide sequence for quantitative analysis when Real-Time PCR is performed.
  • the type of detection probe may be appropriately selected by those skilled in the art according to the type of the endogenous gene and the introduced gene.
  • a standard curve representing the number of PCR cycles for gene copy number is obtained by measuring fluorescence by real-time PCR with a standard for detecting a probe, a primer for detecting a transgene and a primer for detecting an endogenous gene.
  • the incorporation rate of the genetically modified sample can be analyzed by calculating and comparing it with the real-time PCR product obtained from the analytical sample.
  • the standard curve is a real-time PCR for a plurality of standard samples having different gene copies by diluting genomic DNA extracted from a tissue culture cell line obtained by tissue culture with a predetermined ratio. And it may be calculated by applying the PCR cycle number for the gene copy number obtained therefrom.
  • the standard curve is Real for a plurality of standard samples having different gene copy numbers by mixing each genomic DNA extracted from a tissue culture cell line of a genetically modified or non-genetically modified cell at a predetermined ratio. It may be calculated by performing a -Time PCR and applying the PCR cycle number for the number of gene copies obtained therefrom.
  • the standard curve is prepared by converting the gene copy number of the standard material in the Ct value into a log value with the X axis and the PCR cycle number for the gene copy number as the Y axis.
  • Application of the fluorescence intensity of the analyte to the standard curve reveals the number of gene copies of the analyte.
  • the analysis of the incorporation rate in the sample of the genetic modification 100% of the DNA of the genetic modification is measured by PCR with a detection probe, a transgene detection primer and an endogenous gene detection primer
  • the incorporation rate in the sample of the genetic modification can be measured more accurately using the correction coefficient calculated by the following equation.
  • 100% genetic variants do not originally have the same number of copies of the endogenous gene and the transgene, the relative quantification using the ratio of the endogenous gene and the transgene is not possible.
  • the conversion factor (Cf) is used to correct the ratio of the copy number of the endogenous gene and the transgene and factors that may affect the PCR amplification efficiency during DNA extraction.
  • the correction factor refers to the ratio of the DNA copy number between the transgene and the endogenous gene in one genetic modification.
  • the correction factor may be influenced by which varieties are used.
  • the incorporation rate of the genetically modified sample is substituted for the amount of fluorescence measured by PCR with an analytical sample using a detection probe, a primer for detecting a transgene, and a primer for detecting an endogenous gene into a standard curve. It can be measured by, and more specifically can be measured by the following mixing ratio calculation formula.
  • the quantitative measurement method of the fluorescence amount by real-time PCR is not limited thereto.
  • SYBR Green I method SYBR Green I method
  • Taqman probe method Taqman probe method
  • Molecular beacon probe method Molecular beacon probe method
  • Hybridization probe method may be used.
  • SYBR Green I method is a method of measuring the amount of fluorescence generated by using SYBR Green I, a reagent that emits fluorescence by binding to a minor groove of a double helix of DNA, a PCR product produced by a PCR reaction. Since the amount of fluorescence detected is proportional to the amount of DNA amplified, it may be a quantitative measuring means.
  • Taqman probe method is a method of attaching a reporter fluorescence to the 5 'end of the probe and a quencher at the 3' end to quantify the intrinsic fluorescence generated by dropping of the reporter fluorescence at the 5 'end as PCR proceeds.
  • the probe sequence is attached to a specific product as a unique nucleotide sequence of the target, and when there is no PCR reaction, fluorescence is suppressed by the quencher at the 3 'end. Since the amount of fluorescence also increases in proportion to the PCR reaction, it can be a quantitative measurement means.
  • Molecular beacon probe method is a unique hair-pin stem and stem-and-loop structure, with the center loop part consisting of base sequences complementary to the target, and both ends are complementary of 4 to 7 base pairs, respectively. It forms a stem structure as a base sequence.
  • the reporter fluorescence is attached to the 5 'end and the DABSYL is attached to the 3' end as a quencher.If these hairpin structures are not attached to the target, the reporter does not fluoresce structurally. This is a method of quantifying by measuring the fluorescence emitted by the reporter outside the range of influence of the quencher as the loop portion is attached to the specific product that increases and the hairpin structure is released.
  • Hybridization probe method is to use two adjacent probes in the target sequence.
  • donor fluorescence is attached to the 3 'end of one probe and acceptor fluorescence is attached to the 5' end of the other probe, so that these probes must be adjacent to each other so that a fluorescence coplanar energy transfer (FRET) occurs and the emission of the donor is emitted.
  • FRET fluorescence coplanar energy transfer
  • Emission light can act as an excitation light for the receptor. That is, the receptor fluorescence fluoresces by the energy delivered from the adjacent donor fluorescence, and the amount of the fluorescence increases in proportion to the amount of the probe attached to the PCR product, which may be an indirect quantitative measuring means.
  • GM soybeans were randomly selected and germinated and grown, and GM soybeans were determined by genetic analysis for each individual and tissue.
  • GM-resistant gene for the herbicide glyphosate the modified gene sequence of the GM soybean was determined by PCR amplifying a DNA fragment containing the (EPSPS 5- e nol p yruvyl s hikimate-3- p hosphate s ynthase). It was confirmed that GM soybean sample was amplified with the same size band as GM DNA, and that non-GM soybean sample was non-GM soybean sample.
  • This method secured GM soybean or non-GM soybean suspension cell line. And cultured and maintained in isolated cell lines. Since each cell line is derived from one leaf and then cultured and maintained in a separate container, there is no possibility of other cells being incorporated or contaminated. Through this, GM soybean suspension culture cell line consisting of 100% GM cells and non-GM soybean suspension cell line consisting only of 100% non-GM cells were obtained.
  • the leaves derived from the 100% GM soybean and 100% non-GM soybean were surface sterilized with bleach and 70% ethanol, respectively, to induce callus in the following LS (Linsmaier & Skoog) medium (except BAP). Cultured in the following LS solid medium or suspended in liquid medium except phytagel.
  • LS medium composition was as follows: LS salt 4.4 g / L, sucrose 3% (30 g / L), BAP (6-benzylaminopurine) 3 mg / mL, 2,4-D (2,4-dichlorophenoxy-Acetic Acid ) 0.1 mg / mL, Phytagel 0.3% (3 g / L).
  • FIG. 1 shows the cotyledon of soybean produced 5 days after germination
  • FIG. 2 shows cell micrographs (right) of callus (left) derived from leaf tissue of soybean and liquid suspension culture cell lines derived from callus of soybean.
  • Figure 3 shows that the sample amplified band of the same size according to the arrow labeled GM DNA is GM soybean having the introduced gene, the sample of the same size band is not amplified non-GM soybean without the introduced gene.
  • Extraction of genomic DNA can be performed by using a variety of commercially available plant DNA extraction kits intact or slightly modified by the manufacturer (Qiagen, Promega, etc.) or by the FDA.
  • the CTAB method described in 'Testing genetically modified foods' method was used in a modified method.
  • the extracted genomic DNA showed the form as shown in FIG.
  • the DNA was used after measuring the absorbance in the ultraviolet light to confirm the purity (see KFDA notice).
  • GM of the sample through gene amplification was performed according to the method announced by KFDA or under the following conditions.
  • the amplification product is about 2 kb in size, and the positive control is used to identify the intrinsic gene lectin.
  • 2 ⁇ L of the forward primer 35S 3F (AAGATGCCTCTGCCGACA, 10 ⁇ M)
  • 2 ⁇ L of the reverse primer NOS 3R (ATGTATAATTGCGGGACTCTAATCA, 10 ⁇ M)
  • 2 ⁇ L of dNTP 10 mM
  • 10 ⁇ buffer 2 ⁇ L 10 ⁇ L
  • MgCl 2 25 mM
  • 0.2 ⁇ L of Taq polymerase 5U / ⁇ L
  • PCR reactions were carried out in a denaturation step, 94 ° C., 3 min; 35 cycles of amplification step, (94 ° C., 20 sec; 60 ° C., 30 sec; 72 ° C., 2 min); The final elongation step was carried out using a gradient cycler PTC-0225 (MJ Research, Waltham, MA) under conditions of 72 ° C. and 10 min.
  • lectin gene specific to soybean was used. All conditions were the same but only primers were used as follows. Lec 3F (GACTAGAGTGCTACAAATGCTTATC) was used as a forward primer and Lec 1R (GGCATAGAAGGTGAAGTTGAAGGA) was used as a reverse primer.
  • Figure 3 shows the results of PCR of the transgene. Samples with amplified bands of the same size as GM DNA are GM soybeans with modified genes, and samples without amplified bands with the same size as GM DNA are non-GM soybeans without modified genes.
  • Figure 5 shows the results of PCR of the endogenous gene. In the case of an endogenous gene, a positive PCR result is always obtained regardless of whether GMO or non-GMO.
  • real-time quantitative PCR was performed to quantitatively analyze the incorporation rate of the genetically modified product.
  • the relative ratio of the transgene to the endogenous gene should be obtained as described above. Therefore, real-time PCR was used to observe the degree of amplification of the gene in real time.
  • all experiments were performed using ABI 7900HT, and the basic design of the experiment and experimental components such as primers and probes were used by taking the contents of the KFDA standard.
  • Figure 6 shows the results of amplifying the endogenous gene by concentration based on the commercialized plasmid DNA that already knows the copy number.
  • DNA reference material was added between 250000 and 20 copies to obtain repeatable results with a constant interval between concentrations. The same trend was seen in the results of the GM gene.
  • FIG. 7 shows the results of three repeated experiments as an experimental result showing the standard curve derived from the DNA concentration of FIG. 6 and the amount of the endogenous gene calculated therein (indicated by red x).
  • the regression line was found to be greater than 0.99, and the GM incorporation rate was about 108% ⁇ 2.6% (relative standard deviation), confirming that the results were fairly accurate.
  • the inventors prepared a self-made and used a reference material to draw a calibration curve of a plasmid DNA which already knows the copy number, and the tissue of 100% GM soybean according to Examples 1 and 2 was used. Using genomic DNA extracted from the cell line as an assay sample, real-time quantitative PCR was performed as before.
  • Figure 8 shows the results of the same experiment was repeated by the inventors prepared by themselves using plasmid DNA which already knows the copy number as a reference material.
  • the DNA reference material was added between 1000000 and 1000 copies to obtain repeatable results with constant intervals between concentrations. The same trend can be seen in the results of endogenous genes.
  • FIG. 9 shows the results of three repeated experiments as an experimental result showing the standard curve derived from the DNA concentration of FIG. 8 and the amount of the GM gene (marked in red x). The regression line was found to be greater than 0.99 and the GM incorporation rate was about 105% ⁇ 5.5% (relative standard deviation), confirming that the results were fairly accurate.
  • Real-time quantitative PCR was performed to quantitatively analyze the incorporation rate of the genetic modification using genomic DNA extracted from the tissue culture cell line according to the present invention as a standard material.
  • Experimental method was the same as Experimental Example 2, except that genomic DNA extracted from tissue culture cell lines verified to be close to 100% GM ratio in Experimental Example 2 was used as a reference material, and the sample already known GM incorporation rate (5% GM soybean) ERM, IRMM-410S-5) was used as analytical sample.
  • Figure 10 shows the result of amplifying the endogenous gene by concentration using the genomic DNA extracted from the tissue culture cell line of 100% GM soybean according to the present invention as a reference material. Repeatability was obtained by adding DNA at a DNA concentration between 10 ng / ⁇ L and 0.08 ng / ⁇ L.
  • FIG. 11 is an experimental result showing the standard curve derived from the genomic DNA concentration of FIG. 10 and the amount of the GM gene (marked by red x) calculated as a result of three repeated experiments, and the correlation between the regression line was about 0.99. Although it differs slightly from the ERM's certification value of 4.76% ⁇ 0.47% (relative standard deviation), the GM incorporation rate (%) is relatively close to 4%. Experiments with different concentrations are expected to yield a rate of incorporation closer to the authentication value.
  • GM genetic variants have various copy number transgenes, they need to be corrected for each GM genetic variant in relation to endogenous genes.
  • the correction factor for determining the incorporation rate of the genetically modified product was calculated by real-time PCR.
  • Manufactured with commercially available plasmid DNA (NipponGene, Japan), which already knows the copy number, using plasmid DNA, which already knows the copy number, as a reference material for drawing a standard curve, and 100% GM soybean according to Examples 1 and 2
  • Genomic DNA extracted from Suspension cultured cell line was used as analytical sample and real-time quantitative PCR was performed using primers for detecting the introduced gene and primers for detecting the endogenous gene.
  • the endogenous gene used to calculate the correction coefficient is a lectin gene specific to soybean, and Le1n02-5 '(GCCCTCTACTCCACCCCCA) was used as a forward primer for detecting the endogenous gene, and Le1n02-3' (GCCCATCTGCAAGCCTTTTT) was used as a reverse primer. Le1-Taq (FAM-AGCTTCGCCGCTTCCTTCAACTTCAC-TAMRA) was used as a detection probe.
  • the transgene is the RRS gene, RRS01-5 '(CCTTTAGGATTTCAGCATCAGTGG) as the forward primer for detecting the transgene, RRS01-3' (GACTTGTCGCCGGGAATG) as the reverse primer, and RRS-Taq (FAM-CGCAACCGCCCGCAAATCC- as the detection probe) TAMRA) was used.
  • the correction factor was calculated according to the following equation after obtaining the copy number of the introduced gene and the endogenous gene of the analyte from the standard curve of the reference material.
  • Table 1 shows the result of the correction coefficient calculated using the commercialized plasmid DNA (Nippon Gene, Japan), which already knows the copy number, as a reference material, and the correction coefficient is 1.08.
  • Table 2 shows the results of the correction coefficients calculated using the plasmid DNA, which already knows the copy number, prepared by itself as a reference material, and the correction coefficient is 1.05.
  • Table 3 shows the results of determining the GM incorporation rate by applying the correction factor 1.08 calculated in Experiment 4 using commercially available plasmid DNA (NipponGene, Japan), which already knows the copy number, as a reference material.
  • the GM incorporation rate was about 100.03%, which is a result of the relative relative GM value of 100%.
  • Table 4 shows the results of determining the GM incorporation rate by applying a correction coefficient of 1.05 calculated in Experimental Example 4 using plasmid DNA that already knows its own copy number as a reference material.
  • the GM incorporation rate was about 99.8%, confirming that the relative relative GM value was very close to 100%.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Environmental Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)

Abstract

본 발명은 유전자변형식물 또는 유전자비변형식물의 조직을 조직배양하여 얻은 조직배양세포주로부터 유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질을 제조하는 방법 및 상기 표준물질을 이용하여 유전자변형식물의 시료내 혼입여부 또는 혼입률을 분석하는 방법에 관한 것이다. 본 발명에 따른 유전자변형식물 또는 유전자비변형식물을 각각 조직배양하여 얻은 조직배양세포주를 이용한 유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질은 조직배양을 통해 유전형질이 동일한 개체를 무수히 많이 얻을 수 있기 때문에 대량으로 배양용량을 증가시키면 batch 간의 불균질성을 배제한 균일한 질의 표준물질을 대량으로 확보할 수 있다. 또한 기존의 곡물분말을 사용하여 제조하는 표준물질과는 달리, 배양세포주의 순도가 입증됨으로써 순도가 100%인 유전자변형(GM) 또는 유전자비변형(non-GM)인 표준물질을 확보할 수 있다는 장점이 있다. 그리하여 일정한 조성의 표준물질을 항상 균일하고 안정적으로 공급할 수 있다.

Description

식물배양세포주를 이용한 표준물질의 제조방법
본 발명은 유전자변형식물 또는 유전자비변형식물의 조직을 조직배양하여 얻은 조직배양세포주로부터 유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질을 제조하는 방법 및 상기 표준물질을 이용하여 유전자변형식물의 시료내 혼입여부 또는 혼입률을 분석하는 방법에 관한 것이다.
유전자변형식물(GMO: Genetically Modified Organism)이란 기존의 작물육종에 의한 품종 개발과는 달리, 동식물 또는 미생물의 유용한 유전자를 인공적으로 분리, 결합시켜 생산성이나 기능성이 증가되도록 한 생물체를 총칭하는 것이다. 일반적으로 유전자변형식물의 생산성을 향상시키고 품질을 강화하기 위하여 제초제 저항성, 내충성, 내병성, 내한성, 영양 증대 등에 관련된 유전자를 식물에 도입하고 있다.
현재 세계적으로 가장 많이 상업화되어 있는 유전자변형식물로는 옥수수, 콩이 있으며 그 밖에 면화, 카놀라, 감자, 토마토 등 다른 작물에도 넓게 적용되고 있다. 그러나 유전자변형식물에 대한 안전성이 과학적으로 검증되지 않아, 우리나라의 경우 유전자변형식물이 3% 이상 혼입된 경우 유전자변형식물이라고 표기하도록 하는 표시제를 시행하고 있고, 다른 나라들도 혼입허용치(threshold)의 차이는 있으나 비슷한 실정이다.
따라서 유전자변형식물의 혼입 여부를 측정하는 정성적인 분석법 이외에도, 혼입률을 정량적으로 측정하는 분석기술을 요구하게 되었다.
유전자변형식물의 정량 분석법은 크게 단백질 분석법과 DNA 분석법 두 가지로 분류된다. 일반적으로 유전자변형식물에 도입된 유전자로부터 발현되는 단백질을 대상으로 하는 ELISA법은 검출강도가 PCR 법에 비해 떨어지며 열처리 등으로 단백질의 변성이 생길 수 있어 한계가 있다. 이에 실시간 PCR(Real-Time PCR)법을 이용하여 유전자변형식물에 도입된 유전자를 정량하는 기술이 현재 주로 이용되고 있다. 유전자변형식물의 시료내 혼입률을 실시간 PCR법으로 정량하기 위해서는 유전자변형식물에 도입된 도입 유전자의 카피수를 비교할 수 있는 표준물질이 필요하다.
GMO 표시제의 시행에 따라 유전자변형식물의 혼입허용치에 대한 분석의 정확도, 정밀성 등이 매우 중요해졌으며, 혼입허용치에 대한 정확하고 정밀한 분석을 위해서는 무엇보다 분석에 사용한 표준물질이 매우 중요하다. 표준물질은 장기간 보존 가능성과 그 자체의 안정성(stability) 및 균질성(homogeneity)도 보장되어야 한다.
현재 표준물질로는 재래적인 방식에 의거하여 각 작물별 유전자변형식물(GMO) 및 유전자비변형식물(non-GMO)의 종자 분쇄물을 일정량씩 중량에 따라 혼합하여 만든 표준물질 또는 유전자변형식물 및 유전자비변형식물이 일정량 혼합된 시료로부터 추출한 내재유전자 및 도입유전자의 앰플리콘(amplicon)을 삽입하여 만든 표준플라스미드가 사용되고 있다. 그러나 이들 표준물질에 대한 신뢰도에 대해서는 아직 많은 부분이 개선되어야 하며, 특히 표준물질 제조시 시작시료의 순도에 대한 정보가 부재하고 이를 입증할 기술적인 방법이 없다는 것이 큰 걸림돌이 되어 왔다. 따라서 보다 안정적으로 균질하게 이용 가능한 표준물질의 개발이 필요하다.
본 발명은 이러한 시작시료의 순도 확보 또는 입증의 차원에서 표준물질의 신뢰도를 개선하고자 한다. 본 발명은 시작시료의 순도가 100%로 입증되었을 뿐만 아니라 균질성까지 확보된 유전자변형식물의 시료내 혼입률 분석용 표준물질의 제조방법 및 이를 이용한 유전자변형식물의 시료내 혼입률 분석방법을 제공하고자 한다.
상기 과제의 해결을 위해 본 발명은 유전자변형식물 또는 유전자비변형식물을 각각 조직배양하는 단계: 및 각각의 조직배양세포주를 분리하는 단계를 포함하는 유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질의 제조방법을 제공한다.
본 발명은 또한 유전자변형식물 또는 비유전자변형식물을 각각 조직배양하여 얻은 각각의 조직배양세포주로부터 genomic DNA를 추출하는 단계를 포함하는 유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질을 제조하는 방법을 제공한다.
본 발명은 또한 유전자변형식물을 조직배양하여 얻은 조직배양세포주로부터 추출한 genomic DNA를 템플레이트로 하여 도입유전자의 염기서열에 특이적인 프라이머를 제작하여 분석시료의 PCR을 수행하는 것을 포함하는 유전자변형식물의 혼입여부 분석방법을 제공한다.
본 발명은 또한 유전자변형식물 또는 비유전자변형식물을 각각 조직배양하여 얻은 조직배양세포주로부터 추출한 genomic DNA를 유전자변형식물의 혼입률 분석용 표준물질로 이용하여 시료로부터 얻은 PCR 산물과 비교하는 것을 포함하는 유전자변형식물의 시료내 혼입률 분석방법을 제공한다.
본 발명에 따른 유전자변형식물 또는 유전자비변형식물을 각각 조직배양하여 얻은 조직배양세포주를 이용한 유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질은 조직배양을 통해 유전형질이 동일한 개체를 무수히 많이 얻을 수 있기 때문에 대량으로 배양용량을 증가시키면 batch 간의 불균질성을 배제한 균일한 질의 표준물질을 대량으로 확보할 수 있다. 또한 기존의 곡물분말을 사용하여 제조하는 표준물질과는 달리, 배양세포주의 순도가 입증됨으로써 순도가 100%인 유전자변형(GM) 또는 유전자비변형(non-GM)인 표준물질을 확보할 수 있다는 장점이 있다. 그리하여 일정한 조성의 표준물질을 항상 균일하고 안정적으로 공급할 수 있다.
도 1 의 (a)는 발아 5일 후 생성되는 대두의 자엽, (b)는 발아 7일 후 생성되는 일차엽이 있는 대두 식물체를 보여준다.
도 2 는 대두의 잎조직으로부터 유래된 캘러스(좌)와 대두의 캘러스로부터 유래된 액체현탁 배양세포주의 세포 현미경 사진(우)을 보여준다.
도 3 은 35S3F와 NOS3R PCR 프라이머를 사용한 도입유전자의 PCR 결과를 보여준다. (M: 분자량 마커 DNA; G: GM 대두 DNA; N: non-GM 대두)
도 4 는 대두의 genomic DNA의 전기영동 결과를 보여준다. (M: 분자량 마커 DNA; G: GM 대두 DNA; N: non-GM 대두)
도 5 는 Lec 3F 와 Lec 1R 프라이머를 사용한 내재유전자의 PCR 결과를 보여준다. (M: 분자량 마커 DNA; G: GM 대두 DNA; N: non-GM 대두)
도 6 은 상용화된 플라스미드 DNA 기준물질을 사용하여 실시간 정량 PCR을 수행한 결과를 보여주는 도면이다.
도 7 은 상용화된 플라스미드 DNA 기준물질을 사용하여 실시간 정량 PCR을 수행한 결과로부터 얻은 표준곡선을 보여주는 도면이다.
도 8 은 자체 제조한 플라스미드 DNA 기준물질을 사용하여 실시간 정량 PCR을 수행한 결과를 보여주는 도면이다.
도 9 는 자체 제조한 플라스미드 DNA 기준물질을 사용하여 실시간 정량 PCR을 수행한 결과로부터 얻은 표준곡선을 보여주는 도면이다.
도 10 은 GM 현탁배양세포주의 genomic DNA 기준물질을 사용하여 실시간 정량 PCR을 수행한 결과를 보여주는 도면이다.
도 11 은 GM 현탁배양세포주의 genomic DNA 기준물질을 사용하여 실시간 정량 PCR을 수행한 결과로부터 얻은 표준곡선을 보여주는 도면이다.
본 발명에서 사용된 '유전자변형식물의 시료내 혼입률'이란 미지 시료의 전체 양 대비 유전자변형식물이 차지하는 양의 비율 또는 특정 작물의 내재유전자와 인위적으로 도입된 변형유전자의 비율을 백분율(%)로 환산하여 나타낸 값을 의미한다. 유전자변형식물의 시료내 혼입률은 유전자변형식물에 도입된 도입유전자 또는 이로부터 발현된 단백질을 이용하여 계산할 수 있는데, 내재유전자 또는 이로부터 발현된 단백질에 대한 도입유전자의 양 또는 카피수, 또는 이로부터 발현된 단백질의 비율을 측정하여 유전자변형식물이 몇 % 존재하는지 상대적으로 측정할 수 있다. 내재유전자란 각 작물들이 본래부터 고유하게 보유하고 있는 유전자를 의미하고, 도입유전자란 유전자변형식물에 도입된 외래유전자를 의미한다.
이러한 방법을 통해 혼입률을 계산하게 되므로 표준물질을 제조하는데 사용하는 시작시료의 순도가 모든 정량 결과에 영향을 미치고 bias를 제공하게 된다. 그러므로 표준물질 제조시에 사용되는 시작 시료의 순도가 매우 중요한 불확도 요인으로 작용하게 되는 것은 자명하다. 본 발명의 이전에는 종자 등의 분말을 사용하여 표준물질을 제조하였기 때문에 순도가 보장되지 않는다는 단점이 있음에도 불구하고 순도에 대한 문제를 해결할 수 있는 현실적인 방법이 없었다. 이는 종자의 유전적 전수조사 이외에는 순도를 확인할 수 있는 특별한 방법이 없고 전수조사는 현실적으로 불가능 하기에 순도를 입증할 수 없었기 때문이다.
이에 본 발명은 유전자변형식물 또는 유전자비변형식물을 각각 조직배양하여 얻은 각각의 조직배양세포주 또는 이로부터 추출한 genomic DNA를 유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질로 이용함으로써, 초기 시료의 균질성을 입증하여 보장하는 방법으로 표준물질 제조에 사용되는 시작시료의 순도를 입증코자 하였다. 조직배양기법을 이용하면 유전형질이 동일한 개체를 무수히 많이 얻을 수 있기 때문에 표준물질 제조시에 batch 간의 불균질성을 배제하고 초기 시료의 균질성과 순도를 보장할 수 있다.
본 발명은 유전자변형식물 또는 유전자비변형식물을 각각 조직배양하는 단계; 및 각각의 조직배양세포주를 분리하는 단계를 포함하는 유전자변형식물의 시료내 혼입률 분석용 표준물질을 제조하는 방법을 제공한다.
본 발명에서 사용된 '표준물질'이란 유전자변형식물의 혼입여부 또는 혼입률을 측정하기 위한 기준이 되는 시료로서, 100% 유전자변형식물(100% GMO)로 조성된 시료나 100% 유전자비변형식물(100% non-GMO)로 조성된 시료 각각을 의미할 수도 있고, 유전자변형식물의 혼입률이 이미 소정 비율로 조성된 시료를 의미할 수도 있다.
본 발명의 한 구체예에 따르면 유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질은 유전자변형식물 또는 유전자비변형식물의 특정 조직을 각각 조직배양하여 얻은 순수한 유전자변형식물 또는 유전자비변형식물의 조직배양세포주 자체를 100% GMO 또는 100% non-GMO 표준물질로 사용할 수 있다. 이 경우 상기 유전자변형식물 또는 유전자비변형식물 각각의 조직배양세포주들은 이에 한정되는 것은 아니지만 예를 들면 동결건조와 같은 전저리 후에 보관 또는 유통이 가능하다.
상기 유전자변형식물 또는 유전자비변형식물의 특정 조직을 각각 조직배양하여 얻은 순수한 유전자변형식물 또는 유전자비변형식물의 조직배양세포주 자체를 순수한 형태로 사용할 수도 있지만, 이들을 소정 비율로 혼합하여 이를 기지의 GMO 혼입률을 갖는 표준물질로 제조할 수도 있다. 혼입률을 알고 있는 표준물질을 제조하여 이를 실시간 PCR 증폭시켜 표준곡선을 산출하고 분석시료의 실시간 PCR 증폭결과를 표준곡선과 대비함으로써 분석시료의 유전자변형식물 혼입률을 용이하게 분석할 수 있다. 이러한 표준물질의 경우 이에 한정되는 것은 아니지만, 예를 들어 유전자변형식물의 혼입률이 각각 0%, 0.1%, 0.5%, 1%, 2%, 3% 또는 5%가 되도록 제조할 수 있다.
본 발명의 다른 구체예에 따르면 유전자변형식물의 시료내 혼입률 분석용 표준물질을 제조하는 방법은 상기 분리된 유전자변형식물 또는 비유전자변형식물의 조직배양세포주를 소정 비율로 혼합하는 단계를 추가로 포함할 수 있다. 예를 들면, 유전자변형식물 또는 유전자비변형식물의 특정 조직을 각각 조직배양하여 유전자변형식물 또는 유전자비변형식물의 조직배양세포주를 얻고, 상기 분리된 유전자변형식물과 유전자비변형식물의 조직배양세포주를 소정 비율로 혼합하여 이를 기지의 GMO 혼입률을 갖는 표준물질로서 사용할 수 있다. 또한 후술하는 바와 같이 상기 조직배양세포주로부터 genomic DNA를 추출함으로써, genomic DNA를 유전자변형식물의 시료내 혼입여부 또는 혼입률 분석에 이용할 수 있다.
또한 본 발명은 유전자변형식물 또는 비유전자변형식물을 각각 조직배양하여 얻은 각각의 조직배양세포주로부터 genomic DNA를 추출하는 단계를 포함하는 유전자변형식물의 시료내 혼입률 분석용 표준물질을 제조하는 방법을 제공한다.
본 발명의 한 구체예에 따르면 유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질은 유전자변형식물 또는 유전자비변형식물의 특정 조직을 각각 조직배양하여 얻은 유전자변형식물 또는 유전자비변형식물의 조직배양세포주로부터 각각의 genomic DNA를 추출하여 100% GMO 또는 100% non-GMO 의 genomic DNA를 표준물질로 사용할 수 있다.
상기 유전자변형식물 또는 유전자비변형식물의 조직배양세포주로부터 추출한 각각의 genomic DNA 자체를 순수한 형태로 사용할 수도 있지만, 이들을 정량한 후 소정 비율로 혼합하여 이를 기지의 GMO 혼입률을 갖는 표준물질로 제조할 수도 있다. 혼입률을 알고 있는 표준물질을 제조하여 이를 실시간 PCR 증폭시켜 표준곡선을 산출하고 분석시료의 실시간 PCR 증폭결과를 표준곡선과 대비함으로써 분석시료의 유전자변형식물 혼입률을 용이하게 분석할 수 있다. 이러한 표준물질의 경우 이에 한정되는 것은 아니지만, 예를 들어 유전자변형식물의 혼입률이 각각 0%, 0.1%, 0.5%, 1%, 2%, 3% 또는 5%가 되도록 제조할 수 있다.
본 발명의 다른 구체예에 따르면 유전자변형식물의 시료내 혼입률 분석용 표준물질을 제조하는 방법은 상기 각각의 genomic DNA를 일정 비율로 혼합하는 단계를 추가로 포함할 수 있다. 예를 들면, 유전자변형식물 또는 유전자비변형식물의 특정 조직을 각각 조직배양하여 얻은 유전자변형식물 또는 유전자비변형식물의 조직배양세포주로부터 추출한 각각의 genomic DNA를 소정 비율로 혼합하여 이를 표준물질로 사용할 수 있다.
현재 주로 사용되고 있는 표준물질은 유전자변형식물과 유전자비변형식물이 일정량 혼합된 분말 시료나 이들의 내재유전자 및 도입유전자의 앰플리콘(amplicon)을 삽입하여 만든 표준플라스미드이다. 특히 표준플라스미드에는 내재유전자와 도입유전자의 PCR 앰플리콘들이 동일한 플라스미드 내에 삽입되어 있어서 상기 표준플라스미드를 대장균 내에서 증식시킴으로써 일정한 상태의 표준플라스미드를 표준물질로서 무한 공급 가능하다. 그러나 분말 표준물질을 사용하는 경우의 순도에 관한 문제점은 이미 상술한 바와 같으며, 플라스미드를 대장균에서 증식시키는 경우에는 표준물질의 제조에 관한 ISO국제 규격의 '표준물질'의 엄밀한 정의에 일치하지 않는다고 볼 수 있어 문제가 된다. 이는 소위 'matrix effect'라고 하는 매질효과에 대한 직접비교가 불가능한 이질적인 두 가지 시료 (식물 DNA와 대장균 DNA)를 비교하게 되기 때문이다. 이러한 매질효과가 분석결과에 어떠한 영향을 미칠지는 예측하기 어려운데 그렇기에 될 수 있으면 비슷한 매질의 표준물질을 사용하도록 권장하고 있다. 이러한 점에서 플라스미드 DNA보다는 본 발명에 따른 식물로부터 유래한 genomic DNA 표준물질이 매질효과에 따른 이상 결과를 방지하는데 유리하다고 할 수 있다.
더욱이 본 발명에 따라 유전자변형식물 또는 유전자비변형식물을 각각 조직배양하여 얻은 조직배양세포주 자체 또는 이들로부터 genomic DNA를 추출하여 표준물질을 제조하는 경우, 직접 해당 식물의 세포로부터 추출한 동일한 유전형질을 갖는 수많은 배양세포로부터 균질한 품질의 표준물질을 대량으로 제작할 수 있다. 따라서 일정하고 균일한 표준물질의 공급이 가능하며 이로 인해 순도가 불확실한 표준물질을 사용한 경우보다 정확한 유전자변형식물의 시료내 혼입률 분석이 가능하다.
본 발명의 일실시예에 따르면, 본 발명에 따른 조직배양은 유전자변형식물 또는 유전자비변형식물의 특정 조직의 일부를 적절한 영양과 식물생장조절물질이 함유된 액체배지에서 액체배양하여 배양세포주(캘러스, callus)를 생산하고, 상기 배양세포주를 계대배양함으로써 이루어질 수 있다. 상기 조직배양은 바람직하게는 무균상태에서 이루어질 수 있다.
본 발명에서 상기 배양세포주로부터 DNA를 추출하는 방법은 당업계에 공지된 어떠한 방법을 사용하여도 무방하며, 이에 한정되는 것은 아니지만, 예를 들어 Method development in relation to regulatory requirements for the detection of GMOs in the food chain (Anklam et al. 2002, Journal of AOAC International. 85(3), 753) 또는 Validation studies and proficiency testing (Anklam et al. 2002, Journal of AOAC International. 85(3), 809-815)에 개시된 방법에 의해 추출할 수 있다.
또한 본 발명은 유전자변형식물을 조직배양하여 얻은 조직배양세포주로부터 추출한 genomic DNA를 템플레이트로 하여 도입유전자의 염기서열에 특이적인 프라이머를 제작하여 분석시료의 PCR을 수행하는 것을 포함하는 유전자변형식물의 혼입여부 분석방법을 제공한다. 분석시료로부터 도입유전자에 해당하는 PCR 산물의 증폭 여부를 확인함으로써 도입유전자를 포함하는 유전자변형식물이 혼입되어 있는지 여부를 정성적으로 분석할 수 있다. 또는 상기 분석시료의 PCR 산물을 유전자변형식물 또는 비유전자변형식물을 템플레이트로 하여 수행한 PCR 산물과 비교 분석함으로써 유전자변형식물의 혼입여부를 정성적으로 분석할 수도 있다.
또한 본 발명은 유전자변형식물 또는 유전자비변형식물을 각각 조직배양하여 얻은 조직배양세포주로부터 추출한 genomic DNA를 유전자변형식물의 혼입률 분석용 표준물질로 이용하여 분석시료로부터 얻은 PCR 산물과 비교하는 것을 포함하는 유전자변형식물의 시료내 혼입률 분석방법을 제공한다.
본 발명의 한 구체예에서, 상기 표준물질과 분석시료로부터 얻은 PCR 산물을 비교하는 것은, 이에 한정되는 것은 아니지만, 실시간 중합효소연쇄반응 (이하, Real-Time PCR)을 이용하는 것일 수 있다.
Real-Time PCR을 이용할 경우, 내재유전자 및 도입유전자의 DNA에 특이적으로 결합하는 양 방향 프라이머와 검출용 프로브를 이용하여 PCR 증폭과정에서 발색되는 형광의 양을 측정함으로써 내재 및 도입유전자의 양을 산출할 수 있다. 해당 계통의 식물이 반드시 가지고 있는 내재유전자에 대한 외래 도입유전자의 상대적인 비율을 통하여 유전자변형식물이 몇 % 함유되어 있는지를 분석해내는 방법이다.
이때 상기 검출용 프로브는 Real-Time PCR 수행시 정량분석을 위해 형광물질이 염기서열에 도입되어 있는 프로브를 의미한다. 검출용 프로브의 종류는 내재유전자 및 도입유전자의 종류에 따라 당업자에 의해 적절히 선택될 수 있다.
본 발명의 일실시예에 따르면, 표준물질을 검출용 프로브와 도입유전자 검출용 프라이머 및 내재유전자 검출용 프라이머로 Real-Time PCR하여 형광을 측정함으로써 유전자 카피수에 대한 PCR 사이클수를 나타내는 표준곡선을 산출하고 이를 분석시료로부터 얻은 Real-Time PCR 산물과 비교함으로써 유전자변형식물의 시료내 혼입률을 분석할 수 있다.
본 발명의 한 구체예에서 상기 표준곡선은 유전자변형식물을 조직배양하여 얻은 조직배양세포주로부터 추출한 genomic DNA를 소정의 비율로 희석하여 서로 다른 유전자 카피수를 갖는 복수개의 표준시료에 대해 Real-Time PCR을 수행하고 이로부터 얻은 유전자 카피수에 대한 PCR 사이클수를 적용하여 산출되는 것일 수 있다.
본 발명의 다른 구체예에서 상기 표준곡선은 유전자변형식물 또는 유전자비변형식물의 조직배양세포주로부터 추출한 각각의 genomic DNA를 소정의 비율로 혼합하여 서로 다른 유전자 카피수를 갖는 복수개의 표준시료에 대해 Real-Time PCR을 수행하고 이로부터 얻은 유전자 카피수에 대한 PCR 사이클수를 적용하여 산출되는 것일 수 있다.
즉, 유전자변형식물의 시료내 혼입률을 알고 있는 여러 개의 표준물질을 한가지 표준물질의 DNA를 적절히 희석하여 카피수를 일정한 간격으로 만들거나 유전자변형식물과 유전자비변형식물의 DNA를 소정비율로 혼합하여 일정한 혼입률을 갖도록 제조한 수개의 시료에 대해 Real-Time PCR을 수행하면, PCR 사이클 수에 따른 형광의 정도를 측정할 수 있다. 이 때 형광 시그널이 증가하기 시작하는 지점의 사이클 수를 Ct(threshold cycle)라고 하는데, 이 값은 시료의 초기농도(유전자 카피수)와 가장 재현성 있는 상관관계를 나타내는 시점으로서 Real-Time PCR을 이용한 정량적인 분석에 있어서 가장 중요한 수치이다. Real-Time PCR에서 표준곡선은 Ct 값에서의 표준물질의 유전자 카피수를 로그(log)값으로 환산한 값을 X축, 상기 유전자 카피수에 대한 PCR 사이클수를 Y축으로 하여 작성한다. 분석시료의 형광량을 이 표준곡선에 적용하면 분석시료의 유전자 카피수를 알 수 있다.
더욱 구체적으로 본 발명의 일실시예에 따르면, 유전자변형식물의 시료내 혼입률의 분석은, 100% 유전자변형식물의 DNA를 검출용 프로브, 도입유전자 검출용 프라이머 및 내재유전자 검출용 프라이머로 PCR하여 측정한 형광량을 상기 표준곡선에 대입하여 유전자 카피수를 측정함으로써 하기 식에 의하여 산출한 보정계수를 이용하여 더욱 정확하게 유전자변형식물의 시료내 혼입률을 측정할 수 있다. 일반적으로 100% 유전자변형식물 내에는 원래부터 내재유전자와 도입유전자의 카피수가 동일하게 존재하는 것이 아니므로, 내재유전자와 도입유전자의 비율을 이용하여 상대적인 정량을 하고자 할 때는 100% 유전자변형식물에서의 내재유전자와 도입유전자의 카피수의 비율과 DNA 추출과정에서 PCR 증폭효율에 영향을 미칠 수 있는 요소 등을 보정하기 위하여 보정계수(conversion factor, Cf)를 사용한다. 보정계수란 하나의 유전자변형식물에 있어서의 도입 유전자와 내재유전자 사이의 DNA 카피수의 비율을 의미한다.
Figure PCTKR2010009027-appb-I000001
그러나 하나의 유전자변형식물 계통 내에도 다수의 품종이 있고, 유전자비변형식물에도 다수의 품종이 있기 때문에, 보정계수도 어떤 품종을 이용했느냐에 따라 영향을 받을 수 있다.
더욱 구체적으로 본 발명의 일실시예에 따르면, 유전자변형식물의 시료내 혼입률은 분석시료를 검출용 프로브, 도입유전자 검출용 프라이머 및 내재유전자 검출용 프라이머로 PCR하여 측정한 형광량을 표준곡선에 대입함으로써 측정될 수 있으며, 더욱더 구체적으로는 하기 혼입률 계산식에 의해 측정될 수 있다.
Figure PCTKR2010009027-appb-I000002
Real-Time PCR을 통한 형광량의 정량적인 측정방법은, 이에 한정되는 것은 아니지만, 예를 들어 SYBR Green I 법, Taqman probe법, Molecular beacon probe법 또는 Hybridization probe법을 사용할 수 있다.
SYBR Green I 법은 PCR 반응에 의해 생성된 PCR 산물인 DNA 의 이중나선의 minor groove에 결합하여 형광을 방출하는 시약인 SYBR Green I을 사용하여, 이로 인해 발생하는 형광량을 측정하는 방법이다. 검출되는 형광량은 증폭된 DNA의 양에 비례하므로 정량측정 수단이 될 수 있다.
Taqman probe법은 프로브의 5' 말단에 리포터형광을 붙이고 3' 말단에는 퀀처(quencher)를 붙여, PCR이 진행될 때 5' 말단의 리포터형광이 떨어지면서 내는 고유의 형광을 정량하는 방식이다. 이 프로브 서열은 타겟의 고유한 염기서열로서 특정 산물에만 붙으며, PCR 반응이 없으면 3' 말단의 퀀처에 의해 형광이 억제된다. PCR 반응에 비례하여 형광의 양도 누적 증가하므로 정량측정 수단이 될 수 있다.
Molecular beacon probe법은 특이한 헤어핀(hair-pin)의 스템과 루프(stem-and-loop) 구조로, 가운데 루프 부분은 타겟에 상보적인 염기서열로 구성되고 양 말단은 각각 4 내지 7 염기쌍의 상보적인 염기서열로서 스템 구조를 형성한다. 5' 말단에는 리포터형광이 붙어있고 3' 말단에는 퀀처로 DABSYL이 붙어 있어, 이들 헤어핀 구조가 타겟에 붙어있지 않은 경우에는 구조적으로 리포터가 형광을 내지 못하는 반면, 타겟에 결합하게 되면 PCR의 진행에 따라 증가하는 특정산물에 루프 부위가 붙게 되고, 헤어핀 구조가 풀어지면서 퀀처의 영향권에서 벗어난 리포터가 발산하는 형광을 측정하여 정량하는 방법이다.
Hybridization probe법은 타겟 서열 내의 서로 인접한 2개의 프로브를 사용하는 것이다. 이 경우, 한 프로브의 3' 말단에는 공여체형광이 붙어 있고 다른 프로브의 5' 말단에는 수용체형광이 붙어 있어 이들 프로브가 서로 인접해야만 형광공면에너지전이(Fluorescence Resonance Energy Transfer; FRET)가 일어나서 공여체의 방사광(emission light)이 수용체의 여기광(excitation light)으로 작용할 수 있다. 즉, 근접한 공여체형광에서 전달된 에너지에 의해 수용체 형광이 형광을 발하게 되며, 그 형광의 양은 PCR 산물에 붙은 프로브의 양에 비례 증대하여 간접적 정량측정 수단이 될 수 있다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
<실시예 1> 조직배양세포주의 제조
GM 대두(Glycine max)가 혼합된 미국산 대두를 무작위로 선별하여 발아시켜서 재배한 후 개체별, 조직별로 유전자 분석을 통한 GM 대두 여부를 결정하였다.
암소에서 대두를 발아시키고 토양에 심은 후, 배양실(명/암: 16/8시간; 22/18 ℃, 습도 80 %)에서 1 주 정도 성장시키면 일차엽(primary leaf)이 형성되며 이 식물체의 잎(leaf)을 수확하여 질량을 측정하고 액체질소로 급냉 시킨 후 genomic DNA를 추출하여 GM 여부를 유전자 증폭을 통해 결정하였다.
GM 여부는 GM 대두의 변형 유전자인 glyphosate 계열의 제초제에 대한 저항성 유전자(EPSPS: 5-enolpyruvyl shikimate-3-phosphate synthase)를 포함하는 DNA 절편을 PCR 증폭하여 결정하였다. GM DNA와 같은 크기의 밴드가 증폭된 시료는 GM 대두, 같은 크기의 밴드가 증폭되지 않은 시료는 non-GM 대두 시료임을 확인하였고, 이러한 방법을 통해 GM 대두 또는 non-GM 대두 현탁배양세포주를 확보하고 분리된 세포주로 배양, 유지하였다. 각 세포주는 하나의 잎으로부터 유래한 후 개별적인 용기 내에서 배양하고 유지하였으므로 다른 세포가 혼입되거나 오염될 가능성이 전무하다. 이를 통해 100 % GM 세포로만 구성된GM 대두 현탁배양세포주와 100 % non-GM 세포로만 구성된 non-GM 대두 현탁배양세포주를 확보하였다.
상기 100% GM 대두와 100% non-GM 대두로부터 유래한 잎을 각각 bleach와 70% 에탄올로 표면살균하여 다음의 LS (Linsmaier & Skoog) 배지(BAP를 제외)에서 캘러스를 유도하였고 유도된 캘러스는 다음의 LS 고체배지에서 배양하거나 phytagel을 제외한 액체배지에서 현탁배양을 하였다.
LS 배지조성은 다음과 같다: LS 염 4.4 g/L, 수크로스 3 % (30 g/L), BAP (6-benzylaminopurine) 3 mg/mL, 2,4-D (2,4 dichlorophenoxy-Acetic Acid) 0.1 mg/ mL, Phytagel 0.3 % (3 g/L).
고체배지의 캘러스는 3-4주에 한번 새로운 배지로 옮겨주고, 현탁배양세포주는 10일에 한번씩 새로운 배지로 옮겨주었다. 이들의 배양조건은 25℃, 암조건이며 현탁배양 세포주는 200 rpm으로 진탕배양 하였다.
도 1 의 (a)는 발아 5일 후 생성되는 대두의 자엽, (b)는 발아 7일 후 생성되는 일차엽이 있는 대두 식물체를 보여준다.
도 2 는 대두의 잎조직으로부터 유래된 캘러스(좌)와 대두의 캘러스로부터 유래된 액체현탁 배양세포주의 세포 현미경 사진(우)을 보여준다.
도 3 은 GM DNA라고 표시한 화살표를 따라서 같은 크기의 밴드가 증폭된 시료는 도입 유전자를 갖는 GM 대두이고, 같은 크기의 밴드가 증폭되지 않은 시료는 도입 유전자가 없는 non-GM 대두임을 보여준다.
<실시예 2> 조직배양세포주로부터 genomic DNA 추출
Genomic DNA의 추출은 여러 상용화된 식물 DNA 추출 키트를 제조사 (Qiagen, Promega 등)가 제안하는 방법을 그대로 또는 약간 변형시켜 사용하거나 식약청에서 고시한 '식품의 기준 및 규격' 중 '제 10. 일반시험법 중 유전자재조합식품의 시험법'에 기술된 CTAB 방법을 용량을 줄인 방법으로 변형하여 사용하였다.
추출한 genomic DNA는 도 4 와 같은 형태를 보였다. 상기 DNA는 자외선에서의 흡광도를 측정하여 순도를 확인한 후 사용하였다 (식약청 고시 참조).
<실험예 1> 유전자변형식물의 혼입여부 정성분석
정성분석은 GM 대두의 변형 유전자인 glyphosate 계열의 제초제에 대한 저항성 유전자(EPSPS: 5-enolpyruvyl shikimate-3-phosphate synthase)를 포함하는 DNA 절편을 PCR 증폭함으로써 수행하였다.
유전자증폭을 통한 시료의 GM 여부의 판별은 식약청에서 고시된 방법을 따르거나 다음과 같은 조건으로 수행하였다. 다음 조건으로 수행하는 경우에는 증폭산물은 약 2 kb 정도의 크기를 보이며 그 외에 양성대조구로는 내재유전자인 lectin을 확인하는 방법을 사용한다.
도입유전자를 확인코자 하는 경우에는PCR 튜브에 정방향 프라이머 35S 3F (AAGATGCCTCTGCCGACA, 10 μM) 2 μL, 역방향 프라이머 NOS 3R (ATGTATAATTGCGGGACTCTAATCA, 10 μM) 2 μL, dNTP (10 mM) 2 μL, 10x buffer 2 μL, MgCl2 (25 mM) 2 μL, Taq polymerase (5U/μL) 0.2 μL를 넣고 템플레이트 DNA로 genomic DNA는 약 50 ng이 되도록 첨가하고 나머지는 증류수로 채워서 총 20 μL를 사용하였다. PCR 반응은 denaturation step, 94 ℃, 3 min;　35 사이클의 amplification step, (94 ℃, 20 sec; 60 ℃, 30 sec; 72 ℃, 2 min); final elongation step, 72 ℃, 10 min의 조건으로 gradient cycler PTC-0225(MJ Research, Waltham, MA)를 사용하여 수행하였다.
내재유전자를 확인하는 경우에는 대두에 특이적인 lectin 유전자를 사용하였는데 모든 조건은 동일하되 프라이머만 다음과 같이 사용하였다. 정방향 프라이머로는 Lec 3F (GACTAGAGTGCTACAAATGCTTATC)를, 역방향 프라이머로는 Lec 1R (GGCATAGAAGGTGAAGTTGAAGGA)를 사용하였다.
도 3 은 도입유전자의 PCR 수행 결과를 보여준다. GM DNA와 같은 크기의 밴드가 증폭된 시료는 변형 유전자를 갖는 GM 대두이고, GM DNA 와 같은 크기의 밴드가 증폭되지 않은 시료는 변형 유전자가 없는 non-GM 대두이다.
도5는 내재유전자의 PCR 수행 결과를 보여준다. 내재유전자의 경우 GMO, non-GMO 여부와 무관하게 항상 양성의 PCR 결과가 나오게 된다.
<실험예 2> 조직배양세포주로부터 추출한 genomic DNA의 순도 검증
본 발명에 따른 GM 대두의 조직배양세포주로부터 추출한 genomic DNA의 순도를 검증하기 위하여 유전자변형식물의 혼입률을 정량분석하기 위한 실시간 정량 PCR(real-time PCR)을 수행하였다. 분석시료의 GM 혼입률을 결정하기 위해서는 앞서 기술한 대로 내재유전자에 대한 도입유전자의 상대적인 비율을 구해야 하기 때문에 실시간으로 유전자의 증폭 정도를 관찰하는 real-time PCR을 사용하였다. 본 실험예에서는 ABI 7900HT를 사용하여 모든 실험을 수행하였으며 실험의 기본적인 디자인 및 프라이머, 프로브 등의 실험 구성요소는 식약청의 규격에 나온 내용을 취하여 사용하였다.
먼저 이미 카피수를 아는 상용화된 플라스미드 DNA(Nippon Gene, Japan) 를 표준곡선을 그리기 위한 기준물질을 사용하고, 실시예 1 및 실시예 2에 따라 100% GM 대두의 조직배양세포주로부터 추출한 genomic DNA를 분석시료로 사용하여, 실시간 정량 PCR을 수행하였다.
도 6 은 이미 카피수를 아는 상용화된 플라스미드 DNA를 기준물질로 삼아 농도별로 내재유전자를 증폭을 한 결과를 보여준다. 250000부터 20 카피 사이로 DNA 기준물질을 첨가하여 농도간 간격이 일정하면서 반복성이 있는 결과를 얻었다. 이는 GM 유전자의 결과에서도 동일한 경향을 볼 수 있었다.
이에 대해 100 % GM 대두의 조직배양세포주로부터 추출한 genomic DNA를 분석시료로 사용하여 표준곡선으로부터 유래된 GM 상대정량치가 100 %에 근접하게 결과를 얻게 되는지를 확인하였다.
도 7 은 도 6 의 DNA 농도로부터 유래된 표준곡선과 그에 의해서 계산된 내재유전자의 양 (적색 x로 표시)을 나타내는 실험 결과로서 3회 반복 실험을 한 결과를 보여준다. 회귀선의 연관성은 0.99 이상으로 나타났으며 GM 혼입률은 약 108 % ± 2.6 % (상대표준편차)인 것으로 나타나서 상당히 정확한 결과임을 확인하였다.
다음으로 상용화된 플라스미드 기준물질 대신에 본 발명자들이 자체적으로 제조하여 이미 카피수를 아는 플라스미드 DNA 를 보정곡선을 그리기 위한 기준물질을 사용하고, 실시예 1 및 실시예 2에 따라 100% GM 대두의 조직배양세포주로부터 추출한 genomic DNA를 분석시료로 사용하여, 앞서와 마찬가지로 실시간 정량 PCR을 수행하였다.
도 8 은 본 발명자들이 자체적으로 제조하여 카피수를 이미 아는 플라스미드 DNA를 기준물질로 사용하여 동일한 실험을 반복한 결과를 보여준다. 1000000부터 1000 카피 사이로 DNA 기준물질을 첨가하여 농도간 간격이 일정하면서 반복성이 있는 결과를 얻었다. 내재유전자의 결과에서도 동일한 경향을 볼 수 있었다.
이에 대해 100 % GM 대두의 조직배양세포주로부터 추출한 genomic DNA를 분석시료로 사용하여 표준곡선으로부터 유래된 GM상대정량치가 100 %에 근접하게 결과를 얻게 되는지를 확인하였다.
도 9 는 도 8의 DNA 농도로부터 유래된 표준곡선과 그에 의해서 계산된 GM 유전자의 양 (적색 x로 표시)을 나타내는 실험 결과로서 3회 반복 실험을 한 결과를 보여준다. 회귀선의 연관성은 0.99 이상으로 나타났으며 GM 혼입률은 약 105 % ± 5.5 % (상대표준편차)인 것으로 나타나서 상당히 정확한 결과임을 확인하였다.
<실험예 3> 조직배양세포주로부터 추출한 genomic DNA를 표준물질로 사용한 분석시료내 유전자변형식물의 혼입률 정량분석
본 발명에 따른 조직배양세포주로부터 추출한 genomic DNA를 표준물질로 사용하여 유전자변형식물의 혼입률을 정량분석하기 위한 실시간 정량 PCR(real-time PCR)을 수행하였다. 실험방법은 실험예 2와 동일하며, 다만 실험예 2를 통하여 100 % GM 비율에 근접한 것으로 검증된 조직배양세포주로부터 추출한 genomic DNA를 표준물질로 사용하였고, 이미 GM 혼입률을 아는 시료(5 % GM 대두ERM, IRMM-410S-5)를 분석시료로 사용하였다.
도 10 은 본 발명에 따른 100% GM 대두의 조직배양세포주로부터 추출한 genomic DNA를 표준물질로 삼아 농도별로 내재유전자를 증폭을 한 결과를 보여준다. DNA 농도 10 ng/μL부터 0.08 ng/μL 사이로 DNA를 첨가하여 반복성이 있는 결과를 얻었다.
도 11 은 도 10의 genomic DNA 농도로부터 유래된 표준곡선과 그에 의해서 계산된 GM 유전자의 양 (적색 x로 표시)을 나타내는 실험 결과로서 3회 반복 실험을 한 결과 회귀선의 연관성은 약 0.99로 나타났다. 해당 ERM의 인증값인 4.76 % ± 0.47 % (상대표준편차)와 약간의 차이가 나기는 하나 GM 혼입률(%)이 비교적 근접한 값인 약 4 %로 나타났다. 여러 농도를 사용하는 실험을 진행하면 인증값에 더욱 근접한 혼입률을 얻을 것으로 예상된다.
<실험예 4> 보정계수 산출
GM 유전자변형식물은 각기 다양한 카피수의 도입유전자를 갖고 있기 때문에 내재유전자와의 관계에 있어 각 GM 유전자변형식물별로 보정이 필요하다. 유전자변형식물의 혼입률을 결정하기 위한 보정계수는 실시간 정량 PCR(real-time PCR)을 실시하여 산출하였다. 이미 카피수를 아는 상용화된 플라스미드 DNA (NipponGene, Japan)와 자체적으로 제조하여 카피수를 이미 아는 플라스미드 DNA를 표준곡선을 그리기 위한 기준물질로 사용하고 실시예 1 및 실시에 2에 따라 100 % GM 대두의 현탁배양세포주에서 추출한 genomic DNA를 분석시료로 사용하였으며 도입유전자 검출용 프라이머 및 내재유전자 검출용 프라이머를 사용하여 실시간 정량 PCR을 실시하였다. 보정계수 산출에 사용된 내재유전자는 대두에 특이적인 lectin 유전자이며, 내재유전자 검출용 정방향 프라이머로는 Le1n02-5' (GCCCTCTACTCCACCCCCA)을, 역방향 프라이머로는 Le1n02-3' (GCCCATCTGCAAGCCTTTTT)을 사용하였다. 검출용 프로브로는 Le1-Taq (FAM-AGCTTCGCCGCTTCCTTCAACTTCAC-TAMRA)을 사용하였다. 도입유전자는 RRS 유전자이며, 도입유전자 검출용 정방향 프라이머로는 RRS01-5' (CCTTTAGGATTTCAGCATCAGTGG)을, 역방향 프라이머로는 RRS01-3' (GACTTGTCGCCGGGAATG)을, 검출용 프로브로는 RRS-Taq (FAM-CGCAACCGCCCGCAAATCC-TAMRA)을 사용하였다.
보정계수는 기준물질의 표준곡선으로부터 분석시료의 도입유전자와 내재유전자의 카피수를 구한 후 다음 식에 따라 산출하였다.
Figure PCTKR2010009027-appb-I000003
표 1은 이미 카피수를 아는 상용화된 플라스미드 DNA (Nippon Gene, Japan)를 기준물질로 사용하여 산출한 보정계수 결과를 보여주며 보정계수는 1.08로 나왔다.
표 1
평균값 표준편차 상대표준편차
GM 대두 1.08 0.03 2.63
표 2는 자체적으로 제조한 이미 카피수를 아는 플라스미드 DNA 를 기준물질로 사용하여 산출한 보정계수 결과를 보여주며 보정계수는 1.05로 나왔다.
표 2
평균값 표준편차 상대표준편차
GM 대두 1.05 0.06 5.52
<실험예 5> 보정계수 적용에 따른 분석시료의 GM 혼입률 결정
유전자변형식물의 혼입률을 정량분석하기 위해 이미 카피수를 아는 상용화된 플라스미드 DNA(NipponGene, Japan)와 자체적으로 제조하여 카피수를 이미 아는 플라스미드 DNA를 표준곡선을 그리기 위한 기준물질로 사용하고, 100 % GM 대두의 현탁배양세포주에서 추출한 genomic DNA를 분석시료로 실시간 정량 PCR(real-time PCR)을 수행하였다. 상기 두 개의 기준물질의 표준곡선으로부터 분석시료의 도입유전자와 내재유전자의 카피수를 구한 후 실험예 4에서 산출한 보정계수를 적용하여 GM 혼입률을 결정하고, 100 %에 근접하게 결과를 얻게 되었는지 확인하였다. 보정계수를 적용하여 GM 혼입률을 결정하는 계산식은 다음과 같다.
Figure PCTKR2010009027-appb-I000004
표 3은 이미 카피수를 아는 상용화된 플라스미드 DNA(NipponGene, Japan)를 기준물질로 사용하여 실험예 4에서 산출한 보정계수 1.08을 적용하여 GM 혼입률을 결정한 결과이다. GM 혼입률은 약 100.03 %로, GM 상대정량치가 100 %에 상당히 근접하게 나온 결과임을 확인하였다.
표 3
Figure PCTKR2010009027-appb-T000001
표 4는 자체적으로 제조한 이미 카피수를 아는 플라스미드 DNA를 기준물질로 사용하여 실험예 4에서 산출한 보정계수 1.05를 적용하여 GM 혼입률을 결정한 결과이다. GM 혼입률은 약 99.8 %로, GM 상대정량치가 100 %에 상당히 근접하게 나온 결과임을 확인하였다.
표 4
Figure PCTKR2010009027-appb-T000002

Claims (13)

  1. 유전자변형식물 또는 유전자비변형식물을 각각 조직배양하는 단계; 및
    각각의 조직배양세포주를 분리하는 단계를 포함하는
    유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질을 제조하는 방법.
  2. 제1항에 있어서,
    상기 분리된 유전자변형식물 또는 유전자비변형식물의 조직배양세포주를 소정 비율로 혼합하는 단계를 추가로 포함하는
    유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질을 제조하는 방법.
  3. 유전자변형식물 또는 유전자비변형식물을 각각 조직배양하여 얻은 각각의 조직배양세포주로부터 genomic DNA를 추출하는 단계를 포함하는
    유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질을 제조하는 방법.
  4. 제3항에 있어서,
    상기 각각의 genomic DNA를 소정 비율로 혼합하는 단계를 추가로 포함하는
    유전자변형식물의 시료내 혼입여부 또는 혼입률 분석용 표준물질을 제조하는 방법.
  5. 유전자변형식물을 조직배양하여 얻은 조직배양세포주로부터 추출한 genomic DNA를 템플레이트로 하여 도입유전자의 염기서열에 특이적인 프라이머를 제작하여 분석시료의 PCR을 수행하는 것을 포함하는
    유전자변형식물의 혼입여부 분석방법.
  6. 유전자변형식물 또는 유전자비변형식물을 각각 조직배양하여 얻은 조직배양세포주로부터 추출한 genomic DNA를 유전자변형식물의 혼입률 분석용 표준물질로 이용하여 분석시료로부터 얻은 PCR 산물과 비교하는 것을 포함하는
    유전자변형식물의 시료내 혼입률 분석방법.
  7. 제6항에 있어서,
    상기 표준물질과 분석시료로부터 얻은 PCR 산물을 비교하는 것은 실시간 중합효소연쇄반응 (Real-Time PCR)을 이용하는 것인
    유전자변형식물의 시료내 혼입률 분석방법.
  8. 제7항에 있어서,
    상기 표준물질과 시료로부터 얻은 Real-Time PCR 산물의 비교는 표준물질을 검출용 프로브, 도입유전자 검출용 프라이머 및 내재유전자 검출용 프라이머로 Real-Time PCR하여 형광을 측정함으로써 산출된 유전자 카피수에 대한 PCR 사이클수를 나타내는 표준곡선을 이용함으로써 수행되는 것인
    유전자변형식물의 시료내 혼입률 분석방법.
  9. 제8항에 있어서,
    상기 표준곡선은 유전자변형식물을 조직배양하여 얻은 조직배양세포주로부터 추출한 genomic DNA를 소정의 비율로 희석하여 서로 다른 유전자 카피수를 갖는 복수개의 표준시료에 대해 PCR을 수행하고 이로부터 얻은 유전자 카피수에 대한 PCR 사이클수를 적용하여 산출되는 것인
    유전자변형식물의 시료내 혼입률 분석방법.
  10. 제8항에 있어서,
    상기 표준곡선은 유전자변형식물 또는 유전자비변형식물의 조직배양세포주로부터 추출한 각각의 genomic DNA를 소정의 비율로 혼합하여 서로 다른 유전자 카피수를 갖는 복수개의 표준시료에 대해 PCR을 수행하고 이로부터 얻은 유전자 카피수에 대한 PCR 사이클수를 적용하여 산출되는 것인
    유전자변형식물의 시료내 혼입률 분석방법.
  11. 제8항에 있어서,
    상기 표준물질과 시료로부터 얻은 PCR 산물의 비교는 100% 유전자변형식물의 DNA를 검출용 프로브, 도입유전자 검출용 프라이머 및 내재유전자 검출용 프라이머로 PCR하여 측정한 형광량을 상기 표준곡선에 대입하여 유전자 카피수를 측정함으로써, 하기 식에 의하여 보정계수를 산출하는 것을 포함하는
    유전자변형식물의 시료내 혼입률 분석방법:
    Figure PCTKR2010009027-appb-I000005
  12. 제8항 또는 제11항에 있어서,
    상기 유전자변형식물의 시료내 혼입률은 분석시료를 검출용 프로브, 도입유전자 검출용 프라이머 및 내재유전자 검출용 프라이머로 PCR하여 측정한 형광량을 표준곡선에 대입하여 산출한 유전자 카피수를 이용하여 측정되는 것인
    유전자변형식물의 시료내 혼입률 분석방법.
  13. 제12항에 있어서,
    상기 유전자변형식물의 시료내 혼입률은 하기 혼입률 계산식에 의해 측정되는 것인
    유전자변형식물의 시료내 혼입률 분석방법:
    Figure PCTKR2010009027-appb-I000006
PCT/KR2010/009027 2009-12-17 2010-12-16 식물배양세포주를 이용한 표준물질의 제조방법 WO2011074897A2 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP10837893.6A EP2514816B1 (en) 2009-12-17 2010-12-16 Method of manufacturing reference material using plant cultured cell lines
US13/513,096 US9512492B2 (en) 2009-12-17 2010-12-16 Method of manufacturing reference material using plant cultured cell lines
JP2012541033A JP5784034B2 (ja) 2009-12-17 2010-12-16 植物培養細胞株を利用した標準物質の製造方法
US15/336,499 US20170044629A1 (en) 2009-12-17 2016-10-27 Method of Manufacturing Reference Material Using Plant Cultured Cell Lines

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2009-0126139 2009-12-17
KR20090126139 2009-12-17
KR1020100128970A KR101288738B1 (ko) 2009-12-17 2010-12-16 식물배양세포주를 이용한 표준물질의 제조방법
KR10-2010-0128970 2010-12-16

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/513,096 A-371-Of-International US9512492B2 (en) 2009-12-17 2010-12-16 Method of manufacturing reference material using plant cultured cell lines
US15/336,499 Division US20170044629A1 (en) 2009-12-17 2016-10-27 Method of Manufacturing Reference Material Using Plant Cultured Cell Lines

Publications (2)

Publication Number Publication Date
WO2011074897A2 true WO2011074897A2 (ko) 2011-06-23
WO2011074897A3 WO2011074897A3 (ko) 2011-11-10

Family

ID=44401480

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/009027 WO2011074897A2 (ko) 2009-12-17 2010-12-16 식물배양세포주를 이용한 표준물질의 제조방법

Country Status (5)

Country Link
US (2) US9512492B2 (ko)
EP (1) EP2514816B1 (ko)
JP (1) JP5784034B2 (ko)
KR (1) KR101288738B1 (ko)
WO (1) WO2011074897A2 (ko)

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5550318A (en) * 1990-04-17 1996-08-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5658772A (en) * 1989-12-22 1997-08-19 E. I. Du Pont De Nemours And Company Site-specific recombination of DNA in plant cells
DE19906169A1 (de) * 1999-02-08 2000-08-10 Bioinside Ges Fuer Biodiagnost Testkit und Verfahren zum quantitativen Nachweis von gentechnisch veränderter DNS in Lebensmitteln mittels fluoreszenzgekoppelter PCR
KR100439168B1 (ko) 2001-07-02 2004-07-05 (주)넥스젠 유전자 변형 식물체의 정량적 검출용 ｄｎａ 증폭 키트 및이를 이용한 유전자 변형 식물체의 정량적 검출방법
KR100482649B1 (ko) 2002-04-25 2005-04-13 한국화학연구원 기재에 광촉매를 직접 고정시키는 방법
KR20030084184A (ko) * 2002-04-25 2003-11-01 주식회사 지디바이오텍 유전자 조작 농산물과 이의 가공품의 정성 검정용프라이머와 정량 검정용 프라이머, 프로브 및 검정키트
US20040172682A1 (en) * 2003-02-12 2004-09-02 Kinney Anthony J. Production of very long chain polyunsaturated fatty acids in oilseed plants
KR100687765B1 (ko) 2005-01-27 2007-03-02 한국생명공학연구원 ＳＹＢＲ Ｇｒｅｅｎ Ｉ를 이용하는 실시간-ＰＣＲ을 통한유전자변형 콩의 혼입률 정량분석 방법
KR100707830B1 (ko) * 2005-12-14 2007-04-13 한국생명공학연구원 유전자변형 벼에서 도입유전자를 검출하는 방법
CA2673748C (en) * 2007-01-29 2016-08-16 Scientific Institute Of Public Health (Iph) Transgenic plant event detection

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ANKLAM ET AL., JOURNAL OF AOAC INTERNATIONAL., vol. 85, no. 3, 2002, pages 753
ANKLAM ET AL., JOURNAL OF AOAC INTERNATIONAL., vol. 85, no. 3, 2002, pages 809 - 815
See also references of EP2514816A4

Also Published As

Publication number Publication date
US9512492B2 (en) 2016-12-06
JP5784034B2 (ja) 2015-09-24
EP2514816A9 (en) 2013-04-17
EP2514816A4 (en) 2013-06-05
JP2013511980A (ja) 2013-04-11
KR20110069726A (ko) 2011-06-23
EP2514816A2 (en) 2012-10-24
EP2514816B1 (en) 2019-06-26
US20170044629A1 (en) 2017-02-16
US20120282620A1 (en) 2012-11-08
WO2011074897A3 (ko) 2011-11-10
KR101288738B1 (ko) 2013-07-23

Similar Documents

Publication Publication Date Title
US9562267B2 (en) Standard plasmid for assaying genetically modified organism, and analysis method and assay kit using same
CN107058493B (zh) 一种检测水稻粒宽等位基因的特异性pcr分子标记和方法
KR102332689B1 (ko) 인삼 &#39;금진&#39; 및 &#39;선향&#39; 품종을 구별하기 위한 미토콘드리아 게놈 서열 기반 분자마커 및 이의 용도
WO2011074897A2 (ko) 식물배양세포주를 이용한 표준물질의 제조방법
KR102332688B1 (ko) 인삼 &#39;선향&#39; 품종을 구별하기 위한 핵 게놈 서열 기반 분자마커 및 이의 용도
KR101014238B1 (ko) 수박 ｆ1 종자 순도 검정 방법
KR102429219B1 (ko) 콩 역병균에 대한 저항성 또는 감수성을 가지는 콩 품종 판별용 마커 조성물 및 이의 용도
WO2019035480A1 (ja) ブラシカ・オレラセア植物の異型検出法
WO2012002598A1 (ko) 결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법
KR101612044B1 (ko) 유전자 변형체의 검정을 위한 표준 플라스미드, 이를 이용한 분석 방법 및 검정용 키트
KR101820048B1 (ko) 유전자 변형체의 검정을 위한 표준 플라스미드, 이를 이용한 분석 방법 및 검정용 키트
CN106967830B (zh) Zfp基因作为内参基因在定量检测螟黄赤眼蜂基因表达量中的应用
SK41797A3 (en) Method of genetic varietal differentiation of hop
KR101794701B1 (ko) 평안옥 품종 판별용 프라이머 세트 및 판별방법
KR101712464B1 (ko) 감염성 질환 치료제 대사효소 관련 유전자 snp 지노타이핑 시약, 이를 포함하는 키트 및 유전자형 분석방법
KR102054696B1 (ko) 포도의 위단위결과 무핵 또는 유핵 특성 판별방법
RU2787519C2 (ru) Способ детекции нетипичного растения brassica oleracea
Kulukovska et al. Real time PCR method for PPV diagnostic on plums and apricot in the Republic of North Macedonia
CN108060258B (zh) 用于棉花mon15985转化体纯杂合鉴定的引物组、试剂盒及方法
KR20040012260A (ko) 유전자변형농산물에 대한 유전자변형농산물 혼입률(%)의정량분석방법
KR101760066B1 (ko) 광평옥 품종 판별용 프라이머 세트 및 판별방법
KR101760056B1 (ko) 평강옥 품종 판별용 프라이머 세트 및 판별방법
KR20240003001A (ko) 마이코플라스마 시노비애의 야외주와 백신주를 동시에 구별하여 검출하기 위한 조성물 및 이를 이용한 검출방법
CN116254361A (zh) 一种海南黄灯笼辣椒果实发育早期深绿性状的dCAPS标记及应用
KR101615300B1 (ko) 끝동매미충 저항성 Ｇｒｈ３ 유전자를 가진 벼 품종 선별용 프라이머 세트 및 이를 이용한 끝동매미충 저항성 벼 품종 선별 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10837893

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2012541033

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2010837893

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13513096

Country of ref document: US