WO2012002598A1 - 결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법 - Google Patents

결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법 Download PDF

Info

Publication number
WO2012002598A1
WO2012002598A1 PCT/KR2010/004333 KR2010004333W WO2012002598A1 WO 2012002598 A1 WO2012002598 A1 WO 2012002598A1 KR 2010004333 W KR2010004333 W KR 2010004333W WO 2012002598 A1 WO2012002598 A1 WO 2012002598A1
Authority
WO
WIPO (PCT)
Prior art keywords
tuberculosis
seq
probe
primer
real
Prior art date
Application number
PCT/KR2010/004333
Other languages
English (en)
French (fr)
Inventor
박소현
김성열
박해준
박한오
변상진
Original Assignee
(주)바이오니아
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)바이오니아 filed Critical (주)바이오니아
Priority to KR1020127032154A priority Critical patent/KR101498705B1/ko
Priority to PCT/KR2010/004333 priority patent/WO2012002598A1/ko
Publication of WO2012002598A1 publication Critical patent/WO2012002598A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to a primer for diagnosing tuberculosis, a probe, a kit including the same, and a method for diagnosing tuberculosis using the kit. More specifically, the present invention relates to a primer, a probe, and a probe for detecting a gene of Mycobacterium tuberculosis in a biological sample and an environmental sample. The present invention relates to a method for detecting Mycobacterium tuberculosis by polymerase chain reaction.
  • Tuberculosis is a highly contagious disease with approximately one third of the world's population already infected. Despite the introduction of anti-tuberculosis chemotherapy and worldwide management, the absolute number of TB patients is increasing every year, and mortality among infectious diseases 1 Occupy the stomach Tuberculosis mainly affects the lungs. In most cases, pathogen infection in the lungs is controlled by the immune system and causes no symptoms, but when the immune system is weakened, lung disease is activated. Symptoms of pulmonary tuberculosis include fever, fatigue, appetite and weight loss, chills, and persistent coughing. Pleurisy causes water to accumulate in the chest cavity, resulting in the loss of part of the lungs.
  • the present inventors have designed a novel primer and probe specific for Mycobacterium tuberculosis, and by performing the real-time polymerase chain reaction using the primer, the kit and the kit containing the same, faster and more precisely compared to the conventional methods
  • the performance of the solution and the performance of the mixture in the solution state are kept equal, the storage period is improved, and the mixing process is simplified to minimize the occurrence of errors, thereby obtaining high reproducible results.
  • the present invention has been completed by confirming that it can.
  • the present invention has been made in view of the above necessity, an object of the present invention to provide a primer and probe for diagnosing tuberculosis used in real time polymerase chain reaction.
  • Another object of the present invention is a Mycobacterium tuberculosis detection kit comprising the primer and the probe, and all the reagents required for the polymerase chain reaction are mixed, dispensed, and dried in accordance with one test dose, so that the skill of the inspector is not required for use.
  • a diagnostic kit for TB To provide a diagnostic kit for TB.
  • Another object of the present invention is to provide a rapid and accurate quantitative diagnosis method of Mycobacterium tuberculosis.
  • the present invention provides primers and probes required for detecting Mycobacterium tuberculosis DNA through real-time polymerase chain reaction or general polymerase chain reaction.
  • the real-time polymerase chain reaction of the present invention monitors the reaction results in real time by using oligonucleotide probes in which the primer and the fluorescent substance are chemically bound.
  • the probe binds to the complementary sequence in the nucleic acid of the sample, like the two primers, and is located slightly away from the primer.
  • the probe of the present invention may have a structure in which both ends of a reporter and a quencher are attached to both ends. In this case, when the reporter and the quencher are in close proximity, the probes cancel each other and thus the fluorescence of the reporter is not detected.
  • the reporter falls from the quencher, the reporter's fluorescence is detected.
  • the intensity of fluorescence increases gradually as the amplification cycle increases.
  • the primers and probes of the present invention include a part of the Mycobacterium tuberculosis IS6110 gene, such as Mycobacterium tuberculosis IS6110 gene (GenBank Accession No. AJ242908) or a part of its complementary nucleotide sequence, and preferably 1300 to 2100 bases of the nucleotide sequence.
  • a forward primer comprising 5 to 40, preferably 19 to 25, nucleotide sequences, more preferably a nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, and a base described in SEQ ID NO: 3 or SEQ ID NO: 4
  • a reverse primer that is a sequence is a sequence.
  • the probe is preferably a nucleotide sequence set forth in SEQ ID NO: 5 or SEQ ID NO: 6, all of which are forward probes.
  • Primers and probes of the present invention were prepared based on the IS6110 gene sequence, which is a specific gene of Mycobacterium tuberculosis, using BLAST of the National Center for Biotechnology Information (NCBI) (see FIG. 1). Therefore, the DNA of Mycobacterium tuberculosis can be easily detected by using the primer and probe of the present invention.
  • the present invention also provides a kit for detecting Mycobacterium tuberculosis comprising the primer or probe.
  • the kit may further include amplification buffers, dNTPs, controls, detection reagents, and the like, in addition to the primers or probes of the present invention, and may be provided in a liquid or dry type, and may not be affected by the reaction. It may contain additional ingredients.
  • the kit which is provided in a dry state, has improved storage stability and can be used for a long time, and has a significant result with the culture method, so that accurate results can be obtained in a shorter time.
  • the kit may further comprise primers and probes for internal control.
  • internal positive control hereinafter, also referred to as 'IPC'
  • the primer includes, for example, a part of the Tobacco mosaic virus isolate Taigu movement protein (MP) gene (GenBank. Accession No. FJ873800) or a part of its complementary sequence, and preferably the 15th to 800th base of the base sequence.
  • MP Tobacco mosaic virus isolate Taigu movement protein
  • It is a forward primer which contains 5 to 40 nucleotide sequences within, and more preferably a base primer described in SEQ ID NO: 7 to SEQ ID NO: 9 and a base sequence described in SEQ ID NO: 10 to SEQ ID NO: 12.
  • the probe is preferably a nucleotide sequence described in SEQ ID NO: 13 to SEQ ID NO: 15, all are forward probes.
  • the internal control primers and probes are positive controls in the test, and when the (real-time) polymerase chain reaction is performed using the present invention, a negative judgment is obtained, that is, when no TB bacteria are present in the sample, the result is experimental. It is necessary to verify that it is a mistake or that no actual tuberculosis bacteria are present and should not interfere with tuberculosis detection when amplified with the tuberculosis primer set of the present invention. If the internal control is positive, the polymerase chain reaction itself indicates no problem.
  • the primers and probes for detecting Mycobacterium tuberculosis or the internal control may be any combination as long as it consists of two primers (one forward and one reverse), but preferably, the forward primer, SEQ ID NO: Reverse primers described as 3 and forward probes as shown in SEQ ID NO: 5 can be used.
  • the primers and probes for the internal control may also be any combination as long as it consists of two primers (one forward and one reverse), but is preferably a forward primer as set forth in SEQ ID NO. 7, SEQ ID NO. Reverse primers and forward probes set forth in SEQ ID NO: 13 may be used.
  • the primer of the present invention can be used not only for real-time polymerase chain reaction but also for general polymerase chain reaction.
  • FAM (6-carboxyfluorescein) as a reporter for tuberculosis probes and BHQ1 (2,5-di-tert-butylhydroquinone-1) as a quencher
  • BHQ1 (2,5-di-tert-butylhydroquinone-1)
  • TAMRA Carboxy-tetramethyl-hod
  • quencher is preferred to use BHQ1, but is not limited thereto.
  • the tuberculosis bacteria can be detected even if a very small amount of the tuberculosis bacteria is present in the sample, especially in real time polymerase chain reaction.
  • detection time can be reduced.
  • the present polymerase chain reaction or real time polymerase chain reaction it is preferable to further use IPC, but is not limited thereto.
  • the polymerase chain reaction it is easy to check whether the PCR was performed well by preparing the IPC template and the primers corresponding thereto.
  • the sample may be obtained from a clinical sample or an environmental sample, but is not limited thereto.
  • the primers, probes and detection methods of the present invention it is possible to detect genes of Mycobacterium tuberculosis faster and more easily than conventional detection methods, and precisely detect genes of very low concentrations of Mycobacterium tuberculosis in the sample with high sensitivity. can do.
  • the development of the tuberculosis bacterium diagnostic kit of the present invention is expected to enable accurate diagnosis at the initial stage of infection, and is expected to greatly contribute to confirming the drug resistance and treatment effect of Mycobacterium tuberculosis through monitoring the drug treatment.
  • Figure 1 shows that the IS6110 gene sequence of Mycobacterium tuberculosis was found using BLAST of the National Center for Biotechnology Information (NCBI), and the primers and probes of the present invention were prepared in the sequence.
  • NCBI National Center for Biotechnology Information
  • 2 and 3 are all combinations of the tuberculosis primer and probe of the present invention described in SEQ ID NO: 1 to SEQ ID NO: 6 using the Exicycler TM Real-Time PCR System (Bioneer, South Korea) instrument for real-time polymerase chain reaction After performing, one set having good PCR efficiency is selected and the graph shows the result of real-time polymerase chain reaction.
  • Figure 2 Graphs amplified with primers and probes of SEQ ID NOs: 1, 3, 5
  • 4 to 6 is a combination of primers and probes of the DNA for the internal control of the present invention described in SEQ ID NO: 7 to SEQ ID NO: 15 using a Exicycler TM Real-Time PCR System (manufactured by Bioeer, Korea) instrument A graph showing the results of the chain reaction.
  • Figure 4 Graphs amplified with primers and probes of SEQ ID NOs: 7, 10, 13
  • Figure 7 is a tuberculosis standard template using a real-time polymerase chain reaction device Exicycler TM 96 Real-Time Quantitative Thermal block with a combination of the primers and probes of the present invention set forth in SEQ ID NO: 1, 3, 5 and SEQ ID NO: 7, 10, 13 This graph shows the results of real-time polymerase chain reaction.
  • Green curve Amplification curve of tuberculosis template DNA at 10 to 10 7 copy concentrations, respectively
  • FIG. 8 is a tuberculosis standard template real-time polymerase chain by concentration using Exicycler TM 96 Real-Time Quantitative Thermal block in combination with the primers and probes of the present invention as set forth in SEQ ID NOs: 1, 3, 5 and SEQ ID NOs: 7, 10, 13.
  • the standard curve of the reaction graph is shown (slope: -0.2961, R 2 : 0.9995).
  • Figure 9 is a real-time tuberculosis standard template using a real-time polymerase chain reaction machine 7500 Fast Real-Time PCR System with a combination of the primers and probes of the present invention described in SEQ ID NO: 1, 3, 5 and SEQ ID NO: 7, 10, 13 The graph of the polymerase chain reaction is shown.
  • Figure 10 shows the standard curve of the tuberculosis standard template real-time polymerase chain reaction graph by concentration using the 7500 Fast Real-Time PCR System (Slope: -3.266328, R 2 : 0.999409).
  • Figure 11 is a tuberculosis standard template using a real time polymerase chain reaction device iQ TM 5 Real-Time PCR Detection System with a combination of the primers and probes of the present invention set forth in SEQ ID NOs: 1, 3, 5 and SEQ ID NOs: 7, 10, 13 The graph of the real-time polymerase chain reaction of is shown.
  • Figure 12 shows the standard curve of the tuberculosis standard template real-time polymerase chain reaction graph by concentration using the iQ TM 5 Real-Time PCR Detection System (slope: -3.536, R 2 : 0.996).
  • FIG. 13 shows a graph of real-time polymerase chain reaction of a tuberculosis standard template using a dry PCR composition comprising the primers and probes of the invention set forth in SEQ ID NOs: 1, 3, 5 and SEQ ID NOs: 7, 10, 13 Real-time polymerase chain reaction device Exicycler TM 96 Real-Time Quantitative Thermal Block.
  • Exicycler TM 96 Real-Time Quantitative Thermal block is used to show the standard curve of the real-time polymerase chain reaction graph of the tuberculosis standard template at different concentrations in a dry PCR mixture (slope: -0.2932, R 2 : 0.9999).
  • FIG. 15 is a graph showing real-time polymerase chain reaction of TB standard template using a dry PCR mixture. Exicycler TM 96 Real-Time Quantitative Thermal Block.
  • Black curve Amplification curve of TB standard template by 10 to 10 10 copy concentrations
  • FIG. 16 is a graph illustrating a real-time polymerase chain reaction using a control, which is a liquid PCR mixture, for a storage stability test of a dry PCR mixture.
  • Real time polymerase chain reaction device Exicycler TM 96 Real-Time Quantitative Thermal Block was used, 10 3 To 10 6 Tests were performed on tuberculosis standard template at copy concentration.
  • the formula at the top of the graph shows the standard curve of the real-time polymerase chain reaction graph applying the TB standard template by concentration. Slope: -0.3045, R 2 : 0.9998 value is shown.
  • 17 to 22 are graphs of real-time polymerase chain reactions of dry PCR mixtures stored at 40 ° C. for a storage stability test of dry PCR mixtures for a total storage period of 6 days at daily intervals.
  • Real time polymerase chain reaction device Exicycler TM 96 Real-Time Quantitative Thermal Block was used, 10 3 To 10 6 Tests were performed on tuberculosis standard template at copy concentration.
  • the formula at the bottom of the graph shows the standard curve of the real-time polymerase chain reaction graph applying the tuberculosis standard template for each concentration.
  • Slope -2.78 to -3.05, R 2 Values are listed for each storage day in the range of 0.9989 to 0.9999. Marked from 1 to 6 days represents total stored days at 40 ° C.
  • FIG. 23 is a graph illustrating DNA extraction from M. tuberculosis positive specimens and real-time polymerase chain reaction using a dried PCR mixture. Results are obtained using an Exicycler TM 96 Real-Time Quantitative Thermal block.
  • FIG. 24 is a graph illustrating DNA extraction from a tuberculosis negative sample and real-time polymerase chain reaction using a dried PCR mixture, which is obtained using an Exicycler TM 96 Real-Time Quantitative Thermal block. Negative specimens do not show amplification curves of tuberculosis, similar to NTC results.
  • FIG. 25 is a graph illustrating DNA extraction from atypical mycobacterium (NTM: M. intracellulre ) positive specimens and real-time polymerase chain reaction using a dried PCR mixture, showing an Exicycler TM 96 Real-Time Quantitative Thermal block.
  • NTM atypical mycobacterium
  • FIG. This is the result obtained using For NTM-positive specimens, the amplification curve of tuberculosis does not appear, similar to NTC results.
  • CT-positive specimens do not show amplification curves of tuberculosis, similar to NTC results.
  • FIG. 27 is a table showing the results of calculating DNA values from DNA samples extracted from 238 samples and real-time reverse transcriptase polymerase chain reaction using a dried PCR mixture. Specificity is specificity, PPV is positive prediction rate, NPV is negative prediction rate, and efficiency is the efficiency of PCR mixture.
  • template DNA was prepared first.
  • the high homology was confirmed by aligning the IS6110 gene sequence of Mycobacterium tuberculosis (FIG. 1).
  • 405 bp which is the 1558 th to 1962 th sequence including the primer and probe sequences, was synthesized by NBiochem. Biophys. Res. Commun. 1998, 248, 200-203. It was synthesized and cloned into pGEM-T-Easy Vector (Cat: A1360, manufactured by Promega, USA).
  • Plasmid DNA was measured by UV spectrometer (manufactured by Shimazu Co., Japan) and the purity was confirmed to be between 1.8 and 2.0. Based on the concentration measurement results, the DNA copy number was calculated by the following formula. It was.
  • the copy number of the template DNA was calculated and stored in -70 ° C until use in 10-degree dilution with 1X TE + BSA buffer (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA, 0.6% acetylated BSA).
  • Internal control DNA was prepared in the same manner as the template DNA preparation. Internal control DNA is needed to confirm that when a negative result is obtained, the negative result is not due to an amplification error.
  • Tobacco mosaic virus isolate in the Taigu movement protein (MP) gene (GenBank. Accession No. FJ873800) was used to prepare DNA for internal control by synthesizing the 763 bp site, which is the 37th to 799th sequence including the primer and probe sequences. Based on the concentration measurement results of the extracted plasmid DNA, the DNA copy number was calculated by the following formula.
  • the number of copies of the DNA for the internal control was calculated and then diluted 10 ⁇ with 1 ⁇ TE + BSA buffer (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA, 0.6% acetylated BSA) and stored at ⁇ 70 ° C. until use.
  • nucleotide sequences 1558 and 1962 of the tuberculosis IS6110 gene (GenBank Accession No. NC_002944), 19 to 25 bp in length and 55 to 65 ° C in Tm value were arbitrarily selected and used as forward and reverse primers.
  • the base sequence of the internal control Tobacco mosaic virus isolate Taigu movement protein (MP) gene (GenBank. Accession No. FJ873800) between 37 and 799 has a length of 17-23 bp and a Tm of 55-62 ° C. was chosen to be a forward and reverse primer.
  • the length was between 19 and 30 bp, and the Tm value was selected between 67 and 72 ° C. at random, and the Tm value was checked using the Primer3Plus program (Table 2). .
  • test set 1 having good PCR efficiency was selected (Table 1). That is, it was found that the highest PCR amplification efficiency among the primers and probes was the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 3, and the forward probe of SEQ ID NO: 5 (FIGS. 2 to 3).
  • Test 2 SEQ ID NO: Forward direction One 2 Reverse 3 4 Probe 5 6
  • the negative control group a blank sample without Mycobacterium tuberculosis DNA template
  • tuberculosis template DNA was detected by copying the number of copies according to the method of Example 1 (Fig. 7, 9, 11), and when a standard graph of the standard template real-time polymerase chain reaction was prepared, The slope was -2.96 to -3.53 R 2 value was 0.996 to 0.9995 (Fig. 8, 10, 12).
  • R 2 is a correlation coefficient indicating the linearity of the graph when the standard graph of the real-time polymerase chain reaction is drawn, which means that the closer to 1 (the closer to the straight line), the PCR proceeded properly.
  • 10 5 copies of the internal control DNA was reacted together, it was confirmed that the internal control amplification was independently performed without affecting the amplification of the tuberculosis DNA template.
  • PCR mixture premix dried product
  • a PCR mixture of the same composition as in Example 2 was prepared, dried, and then subjected to real-time polymerase chain reaction using an Exicycler TM Quantitative Thermal Block (Bionia, Korea). It was.
  • the tuberculosis DNA prepared in Example 1 and the internal control DNA were added to the dry PCR mixture as a template, and the mixture was dispensed with distilled water to have a total volume of 50 ⁇ l and thoroughly mixed to loosen the dry matter. 45 cycles of real-time polymerase chains under the same conditions and components as in Example 2 except that the Exicycler TM Real-Time Quantitative Thermal Block (manufactured by Bioneer, Korea) and the negative control (co-sample without tuberculosis DNA template) were reacted together. The reaction was carried out.
  • tuberculosis template DNA could be detected by a minimum of 10 copies by counting the copy number according to the method of Example 1 (FIG. 13).
  • the slope was -2.932.
  • R 2 value was 0.9999 (FIG. 14).
  • R 2 is a correlation coefficient indicating the linearity of the graph when the standard graph of the real-time polymerase chain reaction is drawn. The closer to 1 (the closer to the straight line), the better the PCR was performed. From the above results, it can be seen that the same performance is maintained in two methods using a PCR mixture in a solution state and a real time polymerase chain reaction using a dry mixture.
  • Exicycler TM Real-Time Quantitative Thermal Block (manufactured by Bioneer, Korea) for final dynamic range (concentration range of tuberculosis DNA that can be detected in one reaction) using a dry PCR mixture in the same manner as above. 45 cycles of real-time polymerase chain reaction were carried out under the same conditions as in Example 2.
  • Example 1 method as was the tuberculosis template DNA calculate the copy number at best 10 10 copy diluted 10-fold in at least 10 copies concentration range, it was confirmed that tuberculosis DNA detection yirueojim normally from 10 log range ( Figure 15) .
  • PCR in a dry state comprising the TB primers and probes described in SEQ ID NOs: 1, 3, and 5 and the primers and probes for internal control described in SEQ ID NOs: 7, 10, and 13, using the same composition and method as in Example 4.
  • the mixture was placed at a constant temperature for 6 days at 40 ° C. for 6 days, and the dry type PCR composition for each storage period was prepared using the Exicycler TM Real-Time Quantitative Thermal Block (Bionia, Korea). Real time polymerase chain reaction was performed under the same conditions. This is a method that can be predicted in a short time through accelerated experiments to maintain the performance of the dry PCR composition at -20 °C, which is the recommended storage temperature, which is considered to be stored at about -20 °C for about 64 days (Table 5).
  • the dry-type PCR composition was prepared in 7 batches at once in the same batch, and then a portion of the mixture immediately after drying was used for 45 cycles of real-time polymerase chain reaction under the same conditions as in Example 2 to obtain a control result. Got it. All other dry type PCR compositions were placed in a 40 ° C. incubator at the same time, and were taken out at daily intervals as necessary for the reaction, and then subjected to real-time polymerase chain reaction. At this time, the tuberculosis template DNA was counted in the number of copies according to the method of Example 1, the reaction was carried out using four concentrations from the highest 10 6 to the lowest 10 3 copies.
  • Dry mixture immediately after preparation by comparing the slope value and R 2 value of the real-time polymerase chain reaction result of the dry mixture for each storage days obtained using the Exicycler TM Real-Time Quantitative Thermal Block (manufactured by Bioneer, Korea) And the dry mixture's performance according to the storage days and 40 °C days.
  • N.Temp Normal temperature means normal temperature.
  • Tuberculosis specimens using a dry type PCR composition comprising the primers and probes described in SEQ ID NOs: 1, 3, and 5 prepared in Example 4 and the primers and probes for internal control described in SEQ ID NOs: 7, 10, and 13
  • the detection test was carried out for.
  • DNA extracted from specimens determined to be tuberculosis positive or negative in culture using sputum and Chlamydia trachomatis ( CT ) positive in culture using patient urine was tested using Exicycler TM Real-Time Quantitative Thermal Block. Real time polymerase chain reaction was performed under the same conditions as in Example 2.
  • bead method was used to extract DNA from 1 ml of tuberculosis-positive sputum specimens (TB tuberculosis), and the extraction process was carried out according to the recommended experimental method and stored frozen at -70 ° C until use.
  • tuberculosis genes were amplified for the tuberculosis positive sample, and DNA was extracted from the tuberculosis negative sample and CT positive sample to determine the cross-reaction. It was confirmed.
  • the primer and probe of the present invention were able to detect four tuberculosis genes at the same time, and confirmed that no cross-reaction with unrelated pathogens occurred (FIGS. 23 to 26).
  • the detection test was performed on the tuberculosis specimen using the dry type PCR mixture prepared in Example 4.
  • the specimens were 238 specimens which were determined to be positive or negative by a culture method using patient sputum, and include DNA extracted from 43 tuberculosis positive specimens and 195 tuberculosis negative specimens.
  • the tuberculosis specimens were extracted from 1ml of sputum using the bead beating method (TB) and used for testing after freezing storage at -20 °C.
  • the dry type PCR composition comprising the tuberculosis primer and probe described in SEQ ID NO: 1, 3 and 5 prepared in Example 4 and the primers and probe for the internal control described in SEQ ID NO: 7, 10 and 13
  • the tuberculosis DNA prepared in Example 1 and the DNA for the internal control were added as a template, and the mixture was dispensed with distilled water to have a total volume of 50 ⁇ l and thoroughly mixed so as to loosen the dry composition.
  • the DNA extracted from each sample was added to the same components as the above for the specimen test. 45 cycles of real-time polymerase chain reaction were carried out using the Exicycler TM Real-Time Quantitative Thermal Block (manufactured by Bioneer, Korea) under the same conditions as in Example 2.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 결핵균 검출용 프라이머, 프로브 및 이를 이용한 검출 방법에 관한 것으로, 보다 상세하게는 생물학적 시료 및 환경 시료에 존재하는 결핵균의 유전자를 검출하기 위한 프라이머, 프로브 및 이를 이용한 중합효소 연쇄반응으로 결핵균의 유전자를 검출하는 방법에 관한 것이다. 본 발명에 따르면, 종래의 결핵균 검출 방법에 비해 신속하고 정확하게 실시간으로 검출가능하며, 또한 상기 프라이머 및 프로브를 포함하는 중합효소 연쇄반응 혼합물의 건조물은 용액 상태와 동등한 성능으로 보관 기간이 향상되므로 검출 키트에 이용될 수 있다.

Description

결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법
본 발명은 결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법에 관한 것으로서, 보다 상세하게는 생물학적 시료 및 환경 시료에 존재하는 결핵균의 유전자를 검출하기 위한 프라이머, 프로브 및 이를 이용하여 중합효소 연쇄반응으로 결핵균을 검출하는 방법에 관한 것이다.
결핵은 현재 전 세계 인구의 약 1/3이 이미 감염되어 있는 전염성이 강한 질환으로 항결핵 화학요법의 도입과 범세계적인 관리에도 불구하고 결핵 환자의 절대 수는 매년 증가하고 있으며, 감염성 질환 중 사망률 1위를 차지한다. 결핵은 주로 폐에 주된 영향을 미치는데, 대부분의 경우 폐에 병원균이 감염되면 면역 시스템에 의해 조절되어 증상이 나타나지 않지만, 면역 시스템이 약해지면 폐질환이 활성화된다. 폐결핵(Pulmonary Tuberculosis)의 증상은 발열, 피로, 식욕 및 체중 감소, 오한, 끊이지 않는 기침 등이 있으며, 늑막염으로 인해 흉강에 물이 고여 결국에는 폐의 일부가 소실되기도 한다.
결핵 진단의 방법에는 여러 가지가 있으며, 가장 유용한 방법은 결핵균의 배양법이다. 그러나, 배양법은 6∼8주가 걸려 중요한 치료시기를 놓칠 수도 있다. 따라서, 빨리 결과가 나오는 실시간 중합효소연쇄반응(polymerase chain reaction, 이하 'PCR'이라 하기도 함) 방법이 근래의 진단법으로 널리 사용되고 있다.
이에, 본 발명자들은 결핵균에 대해 특이적인 신규한 프라이머 및 프로브를 디자인하였으며, 상기 프라이머, 프로브 및 이를 포함하는 키트를 이용하여 실시간 중합효소연쇄반응을 실시함으로써 종래의 방법들에 비해 결핵균을 신속하고 정확하게 검출할 수 있고, 또한 반응에 필요한 중합효소연쇄반응 혼합액을 건조함으로써, 용액 상태의 혼합액과 성능은 동등하게 유지하면서 보관기간이 향상됨은 물론 혼합과정의 간소화로 오차발생을 최대한 줄여 재현성 높은 결과를 얻을 수 있음을 확인함으로써 본 발명을 완성하였다.
본 발명은 상기의 필요성에 의하여 안출된 것으로서, 본 발명의 목적은 실시간 중합효소연쇄반응에 사용되는 결핵 진단용 프라이머와 프로브를 제공하는 것이다.
본 발명의 다른 목적은 상기 프라이머 및 프로브를 포함하는 결핵균 검출 키트로서, 중합효소연쇄반응 반응에 필요한 모든 시약이 1회 테스트 용량에 맞춰 혼합, 분주, 건조되어 있어 사용을 위해 검사자의 숙련도가 요구되지 않는 결핵 진단용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 신속하고 정확한 결핵균의 정량적 진단 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 실시간 중합효소연쇄반응 또는 일반적인 중합효소연쇄반응을 통해 결핵균 DNA를 검출하는데 필요한 프라이머 및 프로브를 제공한다.
본 발명의 실시간 중합효소 연쇄반응은 프라이머와 형광물질이 화학적으로 결합하여 있는 올리고뉴클레오타이드 프로브를 사용함으로써 반응 결과를 실시간으로 모니터한다. 이 프로브는 중합효소 연쇄반응 과정에서 두 개의 프라이머와 같이 검체의 핵산에 있는 상보서열에 결합하게 되는데 위치는 프라이머에서 약간 떨어진 부분이다. 본 발명의 프로브는 양끝에 리포터(reporter)와 소광제(quencher)라는 형광물질이 붙어 있는 구조일 수 있으며, 이 경우 리포터와 소광제가 근접하여 존재하면 형광을 서로 상쇄하여 리포터의 형광이 감지되지 않으나, 증폭이 진행됨에 따라 리포터가 소광제로부터 떨어지면 리포터의 형광이 감지되는 것이다. 따라서 형광의 강도는 증폭 사이클이 증가함에 따라 점점 증가하게 된다.
본 발명의 프라이머 및 프로브는 결핵균 IS6110 유전자, 예컨대 Mycobacterium tuberculosis IS6110 유전자(GenBank Accession No. AJ242908)의 일부 또는 그 상보적 염기서열의 일부를 포함하는 것으로서, 바람직하게는 상기 염기서열의 1300 부터 2100 번째 염기 내의 5 내지 40 개, 바람직하게는 19 내지 25개의 염기서열을 포함하고, 보다 바람직하게는 서열번호 1 또는 서열번호 2로 기재되는 염기서열인 정방향 프라이머 및 서열번호 3 또는 서열번호 4로 기재되는 염기서열인 역방향 프라이머이다. 또한, 프로브는 서열번호 5 또는 서열번호 6으로 기재되는 염기서열이 바람직하며, 모두 정방향 프로브이다. 본 발명의 프라이머 및 프로브는 NCBI(National Center for Biotechnology Information)의 BLAST를 이용하여 결핵균(Mycobacterium tuberculosis)의 특이적 유전자인 IS6110 유전자 서열을 바탕으로 제작하였다(도 1 참조). 따라서 본 발명의 프라이머 및 프로브를 이용하면 결핵균의 DNA를 용이하게 검출할 수 있다.
또한, 본 발명은 상기 프라이머 또는 프로브를 포함하는 결핵균 검출용 키트를 제공한다.
상기 키트는 본 발명의 프라이머 또는 프로브 외에 증폭용 완충용액, dNTP, 대조군, 검출 시약 등을 추가적으로 포함할 수 있으며, 액상 또는 건조 타입으로 제공될 수 있고, 반응에 영향이 없는 경우에 한하여 목적에 따라 추가적인 성분을 포함할 수 있다. 건조 상태로 제공되는 키트는 보관 안정성이 향상되어 오랜 기간 사용이 가능하며, 배양법과 유의성 있는 결과를 가짐으로써, 보다 빠른 시간 내에 정확한 결과를 얻을 수 있다.
상기 키트는 추가로 내부 대조군용 프라이머 및 프로브를 포함할 수 있다. 중합효소연쇄반응시 내부 양성 대조군(internal positive control, 이하 'IPC'라 하기도 함) 주형 및 이에 맞는 프라이머를 제작하여 함께 넣어줌으로써 PCR이 잘 수행되었는지를 여부를 용이하게 확인할 수 있다. 상기 프라이머는 예컨대 Tobacco mosaic virus isolate Taigu movement protein (MP) 유전자(GenBank. Accession No. FJ873800)의 일부 또는 그 상보적 염기서열의 일부를 포함하는 것으로서, 바람직하게는 상기 염기서열의 15 부터 800 번째 염기 내의 5 내지 40 개의 염기서열을 포함하고, 보다 바람직하게는 서열번호 7 내지 서열번호 9로 기재되는 염기서열인 정방향 프라이머 및 서열번호 10 내지 서열번호 12로 기재되는 염기서열인 역방향 프라이머이다. 또한, 프로브는 서열번호 13 내지 서열번호 15로 기재되는 염기서열이 바람직하며, 모두 정방향 프로브이다.
내부 대조군용 프라이머 및 프로브는 테스트시 양성 대조군으로서, 본 발명을 이용하여 (실시간) 중합효소 연쇄반응을 수행시 음성 판정이 나왔을 때, 즉 시료에 결핵균이 존재하지 않는 것으로 나왔을 때 그 결과가 실험상의 실수인지 또는 실제 결핵균이 존재하지 않는 것인지 검증하기 위해 필요한 것으로서, 본 발명의 결핵 프라이머 세트와 함께 증폭할 때 결핵 검출을 방해하지 않아야 한다. 상기 내부 대조군이 양성으로 나타날 경우 중합효소 연쇄반응 자체는 문제가 없음을 나타낸다.
상기 결핵균 검출용 또는 내부 대조군용 프라이머 및 프로브들은 프라이머 2개(정방향 1개, 역방향 1개) 프로브 1개의 구성이면 임의의 조합이 가능하나, 바람직하게는 서열번호 1로 기재되는 정방향 프라이머, 서열번호 3으로 기재되는 역방향 프라이머 및 서열번호 5로 기재되는 정방향 프로브를 사용할 수 있다. 상기 내부 대조군용 프라이머 및 프로브들 또한 프라이머 2개(정방향 1개, 역방향 1개) 프로브 1개의 구성이면 임의의 조합이 가능하나, 바람직하게는 서열번호 7로 기재되는 정방향 프라이머, 서열번호 10으로 기재되는 역방향 프라이머 및 서열번호 13으로 기재되는 정방향 프로브를 사용할 수 있다. 본 발명의 프라이머는 실시간 중합효소 연쇄반응 뿐 아니라 일반적인 중합효소 연쇄반응에도 사용될 수 있다. 결핵 프로브의 리포터는 FAM(6-carboxyfluorescein), 소광제는 BHQ1(2,5-di-tert- butylhydroquinone-1)을 사용하는 것이 바람직하고, 내부 대조군용 프로브의 리포터는 TAMRA(Carboxy-tetramethyl-hod-amine), 소광제는 BHQ1을 사용하는 것이 바람직하나 이에 한정되는 것은 아니다.
아울러, 본 발명은
1) 검체를 주형으로 상기 결핵 검출용 프라이머와 상기 결핵 검출용 프로브를 사용하여 중합효소 연쇄반응 또는 실시간 중합효소 연쇄반응을 수행하는 단계; 및
2) 상기 1) 단계의 증폭 유무 또는 증폭 산물에 대한 형광값을 조사하는 단계를 포함하는 결핵 검출 방법을 제공한다.
본 발명의 검출 방법에 의하면, 민감도가 높아 매우 적은 양의 결핵균의 핵산이 시료 내에 존재하더라도 결핵균을 검출할 수 있으며, 특히 실시간 중합효소 연쇄반응의 경우 증폭이 진행되는 동안 곧바로 증폭여부를 관찰할 수 있고, 별도의 증폭산물 확인 단계가 필요하지 않아 검출 시간을 줄일 수 있다. 본 중합효소연쇄반응 또는 실시간 중합효소연쇄반응에서는 IPC를 추가로 사용하는 것이 바람직하지만, 이에 한정되는 것은 아니다. 중합효소연쇄반응시 상기 IPC 주형 및 이에 맞는 프라이머를 제작하여 함께 넣어줌으로써 PCR이 잘 수행되었는지를 여부를 용이하게 확인할 수 있다. 또한, 상기 검체는 임상 시료 또는 환경시료로부터 습득될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 프라이머, 프로브 및 검출 방법을 사용하면 기존에 사용되던 검출 방법들에 비해 결핵균의 유전자를 신속하고 간편하게 검출할 수 있으며, 민감도가 높아 시료 내에 존재하는 매우 낮은 농도의 결핵균의 유전자까지도 정확하게 검출할 수 있다. 또한, 본 발명의 결핵균 진단용 키트의 개발을 통해 감염 초기의 정확한 진단이 가능할 것으로 기대되며, 약물 치료의 모니터링을 통한 결핵균의 약물 내성 확인 및 치료 효과 확인에도 크게 기여할 것으로 기대된다.
도 1은 NCBI(National Center for Biotechnology Information)의 BLAST를 이용하여 결핵균(Mycobacterium tuberculosis)의 IS6110 유전자 서열을 찾은 것을 나타낸 것으로서, 그 서열 내에서 본 발명의 프라이머 및 프로브를 제작하였다.
도 2 및 도 3은 서열번호 1 내지 서열번호 6으로 기재되는 본 발명의 결핵 프라이머 및 프로브의 모든 조합으로 ExicyclerTM Real-Time PCR System(Bioneer사제, 한국) 기기를 사용하여 실시간 중합효소 연쇄반응을 실시한 후, PCR 효율이 좋은 세트 1개를 선별하여 다시 실시간 중합효소 연쇄반응을 실시한 결과를 나타낸 그래프이다.
도 2: 서열번호 1, 3, 5의 프라이머 및 프로브로 증폭한 그래프
도 3: 서열번호 2, 4, 6의 프라이머 및 프로브로 증폭한 그래프
도 4 내지 도 6은 서열번호 7 내지 서열번호 15로 기재되는 본 발명의 내부 대조군용 DNA의 프라이머 및 프로브의 조합으로 ExicyclerTM Real-Time PCR System(Bioneer사제, 한국) 기기를 사용하여 실시간 중합효소 연쇄반응을 실시한 결과를 나타낸 그래프이다.
도 4: 서열번호 7, 10, 13의 프라이머 및 프로브로 증폭한 그래프
도 5: 서열번호 8, 11, 14의 프라이머 및 프로브로 증폭한 그래프
도 6: 서열번호 9, 12, 15의 프라이머 및 프로브로 증폭한 그래프
도 7은 서열번호 1, 3, 5 및 서열번호 7, 10, 13으로 기재되는 본 발명의 프라이머 및 프로브의 조합으로 실시간 중합효소 연쇄반응기기 ExicyclerTM 96 Real-Time Quantitative Thermal block을 사용한 결핵 표준 주형의 실시간 중합효소 연쇄반응 결과를 보여주는 그래프이다.
녹색 곡선: 각각 10∼107 카피 농도별 결핵 주형 DNA의 증폭 곡선
파란색 곡선: 자체 제작한 내부 대조군용 DNA에 의한 증폭 곡선
도 8은 서열번호 1, 3, 5 및 서열번호 7, 10, 13으로 기재되는 본 발명의 프라이머 및 프로브의 조합으로 ExicyclerTM 96 Real-Time Quantitative Thermal block을 사용한 농도별 결핵 표준 주형 실시간 중합효소 연쇄반응 그래프의 표준 곡선을 나타낸다(기울기: -0.2961, R2: 0.9995).
도 9는 서열번호 1, 3, 5 및 서열번호 7, 10, 13으로 기재되는 본 발명의 프라이머 및 프로브의 조합으로 실시간 중합효소 연쇄반응기기 7500 Fast Real-Time PCR System를 사용한 결핵 표준 주형의 실시간 중합효소 연쇄반응의 그래프를 나타낸다.
검은색 곡선: 10∼107 카피 농도별 결핵 주형 DNA의 증폭 곡선
보라색 곡선: 자체 제작한 내부 대조군용 DNA에 의한 증폭 곡선
도 10은 7500 Fast Real-Time PCR System을 사용한 농도별 결핵 표준 주형 실시간 중합효소 연쇄반응 그래프의 표준 곡선을 나타낸다(기울기: -3.266328, R2: 0.999409).
도 11은 서열번호 1, 3, 5 및 서열번호 7, 10, 13으로 기재되는 본 발명의 프라이머 및 프로브의 조합으로 실시간 중합효소 연쇄반응기기 iQ™5 Real-Time PCR Detection System를 사용한 결핵 표준 주형의 실시간 중합효소 연쇄반응의 그래프를 나타낸다.
녹색 곡선: 10∼107 카피 농도별 결핵 주형 DNA의 증폭 곡선
파란색 곡선: 자체 제작한 내부 대조군용 DNA에 의한 증폭 곡선
도 12는 iQ™5 Real-Time PCR Detection System을 사용한 농도별 결핵 표준 주형 실시간 중합효소 연쇄반응 그래프의 표준 곡선을 나타낸다(기울기: -3.536, R2: 0.996).
도 13은 서열번호 1, 3, 5 및 서열번호 7, 10, 13으로 기재되는 본 발명의 프라이머 및 프로브를 포함하는 건조 상태의 PCR 조성물을 이용한 결핵 표준 주형의 실시간 중합효소 연쇄반응의 그래프를 나타낸 것으로, 실시간 중합효소 연쇄반응기기 Exicycler TM 96 Real-Time Quantitative Thermal block을 사용한 것이다.
검은색 곡선: 10∼107 카피 농도별 결핵 주형 DNA의 증폭 곡선
파란색 곡선: 자체 제작한 내부 대조군용 DNA에 의한 증폭 곡선
도 14는 Exicycler TM 96 Real-Time Quantitative Thermal block을 사용하여 건조 상태의 PCR 혼합물에 농도별 결핵 표준 주형을 적용한 실시간 중합효소 연쇄반응 그래프의 표준 곡선을 나타낸다(기울기: -0.2932, R2: 0.9999).
도 15는 건조 상태의 PCR 혼합물을 이용한 결핵 표준 주형의 실시간 중합효소 연쇄반응의 그래프를 나타낸 것으로 실시간 중합효소 연쇄반응기기 Exicycler TM 96 Real-Time Quantitative Thermal block을 사용한 것이다.
검은색 곡선: 10∼1010 카피 농도별 결핵 표준 주형의 증폭 곡선
NTC: 음성 대조군으로서 공시료
도 16은 건조 상태의 PCR 혼합물의 보관안정성 시험을 위하여 액체 상태의 PCR 혼합물인 대조군을 사용하여 실시간 중합효소 연쇄반응을 수행한 그래프이다. 실시간 중합효소 연쇄반응기기 Exicycler TM 96 Real-Time Quantitative Thermal block을 사용하였으며, 103∼106 카피 농도의 결핵 표준 주형에 대하여 시험을 진행한 것이다. 그래프 상단의 수식은 농도별 결핵 표준 주형을 적용한 실시간 중합효소 연쇄반응 그래프의 표준 곡선을 나타내는 것으로 기울기: -0.3045, R2: 0.9998 값을 나타낸다.
검은색 곡선: 농도별 결핵 주형 DNA의 증폭 곡선
파란색 곡선: 자체 제작한 내부 대조군용 DNA의 증폭 곡선
NTC: 음성대조군으로서 공시료
도 17 내지 도 22는 건조 상태의 PCR 혼합물의 보관안정성 시험을 위하여 건조한 PCR 혼합물을 40℃에 보관한 뒤, 하루 간격으로 총 6일간의 보관 기간에 대하여 실시간 중합효소 연쇄반응을 수행한 그래프이다. 실시간 중합효소 연쇄반응기기 Exicycler TM 96 Real-Time Quantitative Thermal block을 사용하였으며, 103∼106 카피 농도의 결핵 표준 주형에 대하여 시험을 진행한 것이다. 그래프 하단의 수식은 농도별 결핵 표준 주형을 적용한 실시간 중합효소 연쇄반응 그래프의 표준 곡선을 나타내는 것으로 기울기 -2.78∼-3.05, R2 값은 0.9989∼0.9999 의 범위에서 각 보관 일수별로 값이 표기되어 있다. 1일∼6일로 표기된 것은 40℃에서 총 보관된 일수를 나타낸다.
검은색 곡선: 농도별 결핵 주형 DNA의 증폭 곡선
파란색 곡선: 자체 제작한 내부 대조군용 DNA의 증폭 곡선
도 23은 결핵균(M.tuberculosis) 양성 검체로부터 DNA를 추출하고, 건조된 PCR 혼합물을 사용하여 실시간 중합효소 연쇄반응을 수행한 그래프이며 ExicyclerTM 96 Real-Time Quantitative Thermal block을 사용하여 얻은 결과이다.
녹색: 결핵 증폭 곡선
파란색: 내부 대조군용 DNA의 증폭 곡선
도 24는 결핵 음성 검체로부터 DNA를 추출하고, 건조된 PCR 혼합물을 사용하여 실시간 중합효소 연쇄반응을 수행한 그래프이며 ExicyclerTM 96 Real-Time Quantitative Thermal block을 사용하여 얻은 결과이다. 음성 검체의 경우 NTC(공시료) 결과와 유사하게 결핵의 증폭 곡선이 나타나지 않는다.
검은색: 결핵 증폭 곡선
파란색: 내부 대조군용 DNA의 증폭 곡선
도 25는 비정형 마이코박테리움(NTM: M. intracellulre) 양성 검체로부터 DNA를 추출하고, 건조된 PCR 혼합물을 사용하여 실시간 중합효소 연쇄반응을 수행한 그래프로서, ExicyclerTM 96 Real-Time Quantitative Thermal block을 사용하여 얻은 결과이다. NTM 양성 검체의 경우 NTC(공시료) 결과와 유사하게 결핵의 증폭 곡선이 나타나지 않는다.
검은색: 결핵 증폭 곡선
파란색: 내부 대조군용 DNA의 증폭 곡선
도 26은 CT(Chlamydia trachomatis) 양성 검체로부터 DNA를 추출하고, 건조된 PCR 혼합물을 사용하여 실시간 중합효소 연쇄반응을 수행한 그래프로서, Exicycler TM 96 Real-Time Quantitative Thermal block을 사용하여 얻은 결과이다. CT 양성 검체의 경우 NTC(공시료) 결과와 유사하게 결핵의 증폭 곡선이 나타나지 않는다.
검은색: 결핵 증폭 곡선
파란색: 내부 대조군용 DNA의 증폭 곡선
도 27은 238개의 검체에서 DNA를 추출하고, 건조된 PCR 혼합물을 사용하여 실시간 역전사 중합효소 연쇄반응을 수행한 후 배양 결과와 비교하여 각각의 수치를 계산한 결과를 보여주는 표로서, Sensitivity는 민감도, specificity는 특이도, PPV는 양성 예측율, NPV는 음성 예측율이고 efficiency는 PCR 혼합물의 효율을 나타낸다.
이하, 본 발명을 실시예에 의해 설명한다. 다만, 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 내용을 한정하지는 않는다.
실시예 1. 주형 DNA 및 내부 대조군용 DNA 제조
이후에 실시간 중합효소 연쇄반응을 실시하기 위해, 먼저 주형 DNA를 제조하였다. 결핵균(Mycobacterium tuberculosis)의 IS6110 유전자 서열을 정렬(alignment)하여 상동성이 높은 부분을 확인하였다(도 1). 그 후에 IS6110 유전자(GenBank Accession No. AJ242908)에서 프라이머 및 프로브 서열을 포함하는 1558번째 내지 1962번째 서열인 405 bp를 유전자 합성방법(NBiochem. Biophys. Res. Commun. 1998, 248, 200-203)으로 합성하고 이를 pGEM-T-Easy Vector(Cat: A1360, Promega사제, 미국)에 클로닝하였다.
구체적으로 2X rapid ligation buffer(Promega사제, 미국) 5 ㎕, T-Easy Vector(Promega사제, 미국) 1 ㎕, T4 DNA ligase 1 ㎕(Promega사제, 미국), 유전자 합성물질 3 ㎕(8 ng)를 동일한 튜브에 넣어 혼합한 다음 37℃에서 1시간 정온 배치하였다. 그 후, E. coli 만능세포(competent cell) 50 ㎕에 상기의 정온 배치한 반응액 5 ㎕을 넣고 얼음 상에 30분간 놓아둔 뒤 42℃에서 90초 배양하고 다시 얼음 상에 2분 놓아두었다. 앰피실린, IPTG, X-Gal이 포함된 LB 플레이트에 상기 반응액을 접종한 후 37℃에서 16시간 배양하였다.
색이 흰 콜로니를 취하여 LB 액체 배지에서 16시간 정도 배양한 후 원심 분리하여 상층액은 버리고 Accuprep　plasmid DNA prep kit(Bioneer사제, 한국)를 사용하여 펠렛으로부터 플라스미드 DNA를 추출하였다. 플라스미드 DNA는 UV 분광계(Shimazu사제, 일본)로 농도와 순도를 측정한 다음 순도가 1.8∼2.0 사이인 것을 확인하였고, 농도 측정 결과를 바탕으로 DNA 카피 수(copy number)를 아래의 공식에 의하여 계산하였다.
6.02×1023×농도(UV 분광계로 측정된 농도 g/㎖)/(3015+405)×660 [3015 bp: T-easy vector의 크기, 405bp: 결핵 주형 DNA의 크기]
주형 DNA의 카피 수를 계산한 다음 1X TE+BSA buffer(10mM Tris-HCl pH 8.0, 0.1mM EDTA, 0.6% acetylated BSA)로 10진 희석하여 사용시까지 -70℃에 보관하였다.
상기 주형 DNA 제조와 같은 방법으로 내부 대조군용 DNA를 제조하였다. 내부 대조군용 DNA는 음성 결과가 나왔을 때, 그 음성 결과가 증폭 오류에 의한 것이 아님을 확인하기 위해 필요하다.
Tobacco mosaic virus isolate Taigu movement protein (MP) 유전자(GenBank. Accession No. FJ873800)에서 프라이머 및 프로브 서열을 포함하는 37번째 내지 799번째 서열인 763 bp 부위를 유전자 합성하여 내부 대조군용 DNA 제조에 이용하였고, 추출한 플라스미드 DNA의 농도 측정 결과를 바탕으로 DNA 카피 수를 아래의 공식에 의하여 계산하였다.
6.02×1023×농도(UV 분광계로 측정된 농도 g/㎖)/(3015+763)×660[3015 bp: T-easy vector의 크기, 763bp: 내부 대조군용 DNA의 크기]
내부 대조군용 DNA의 카피 수를 계산한 다음 1X TE+BSA buffer(10mM Tris-HCl pH 8.0, 0.1mM EDTA, 0.6% acetylated BSA)로 10진 희석하여 사용시까지 -70℃에 보관하였다.
실시예 2. 프라이머 및 프로브 디자인
결핵 IS6110 gene(GenBank Accession No. NC_002944)의 염기서열 1558 부터 1962 사이에서 길이는 19∼25 bp, Tm 값은 55℃ 내지 65℃가 되도록 임의로 염기서열을 선택하여 정방향 및 역방향 프라이머로 하였다. 또한, 염기서열 1558 부터 1962 사이에서 길이는 20∼30 bp 사이, Tm 값은 67∼77℃ 사이에서 임의로 염기서열을 선택하여 프로브로 하였고, Tm 값은 Primer3Plus 프로그램을 사용하여 체크하였다(표 1).
내부 대조군용 Tobacco mosaic virus isolate Taigu movement protein (MP) 유전자(GenBank. Accession No. FJ873800)의 염기서열 37 부터 799 사이에서 길이는 17∼23 bp, Tm 값은 55℃ 내지 62℃가 되도록 임의로 염기서열을 선택하여 정방향 및 역방향 프라이머로 하였다. 또한, 염기서열 942 부터 1708 사이에서 길이는 19∼30 bp 사이, Tm 값은 67∼72℃ 사이에서 임의로 염기서열을 선택하여 프로브로 하였고, Tm 값은 Primer3Plus 프로그램을 사용하여 체크하였다(표 2).
우선, 결핵균의 모든 프라이머와 프로브를 세트로 조합한 후 ExicyclerTM Real-Time Quantitative system (Bioneer사제, 미국)을 이용하여 실시간 중합효소 연쇄반응을 진행하였다(표 3 및 표 4). 구체적으로 10X Buffer 5㎕, wTfi polymerase, dNTP 20mM 2.5㎕, Thermostable Pyrophosphatase, PPi, 안정화제 등을 한 튜브에 넣고 상기 실시예 1에서 합성한 결핵 주형 DNA, 결핵 검출용 프라이머와 프로브 및 증류수를 넣어 총 용량이 50㎕이 되도록 혼합한 후 96-웰 플레이트에 분주하였다. 이 때, 총 용량 50㎕ 혼합액에 포함된 정방향 프라이머, 역방향 프라이머 및 프로브의 농도는 각각 15pmole을 사용하였다. 이를 95℃에서 10분간 변성시킨 후, 95℃에서 20초, 55℃에서 30초씩 45 사이클을 반응시켰다. 증폭된 형광값은 각 PCR 사이클이 진행됨에 따라 55℃ 30초 반응 후에 1회씩 지속적으로 측정되었다. 반응결과 PCR 효율이 좋은 테스트 세트 1을 선택하였다(표 1). 즉, 상기 프라이머 및 프로브 중 PCR 증폭효율이 가장 높은 것은 서열번호 1의 정방향 프라이머, 서열번호 3의 역방향 프라이머, 서열번호 5의 정방향 프로브인 것을 알 수 있었다(도 2 내지 도 3).
또한, 상기 실시예 1에서 합성한 내부 대조군용 DNA 및 내부 대조군용 모든 프라이머와 프로브를 세트로 조합한 후 상기와 같은 방법으로 실시간 중합효소 연쇄반응을 진행하였다.
반응 조건은 95℃에서 10분간 변성 후, 95℃에서 20초, 55℃에서 30초씩 45 사이클을 반응시켰다. 그 결과, PCR 증폭이 효율적으로 확인되는 내부 대조군용의 프라이머 및 프로브를 선택하였고(표 2), 상기 프라이머 및 프로브 중 PCR 증폭효율이 가장 높은 것은 서열번호 7의 정방향 프라이머, 서열번호 10의 역방향 프라이머, 서열번호 13의 정방향 프로브인 것을 알 수 있었다(도 4 내지 도 6).
이 후 실험에서는 결핵 프라이머 및 프로브 중 PCR 증폭효율이 가장 높은 것(서열번호 1의 정방향 프라이머, 서열번호 3의 역방향 프라이머, 서열번호 5의 정방향 프로브)과 내부 대조군용 프라이머 및 프로브 중 결과가 가장 좋은 것(서열번호 7의 정방향 프라이머, 서열번호 10의 역방향 프라이머, 서열번호 13의 정방향 프로브)을 사용하였다.
표 1
번호 Forward primer(정방향) 번호 Reverse Primer(역방향) 번호 TaqMan Probe(정방향)
1 CAGGGTTAGCCACACTTTGC 3 GCGAACTCAAGGAGCACATC 5 TAGTTGGCGGCGTGGACGCG
2 AGTTTGGTCATCAGCCGTTC 4 GCCAACTACGGTGTTTACGG 6 CAGGGTTAGCCACACTTTGC
표 2
번호 Forward primer(정방향) 번호 Reverse Primer(역방향) 번호 TaqMan Probe(정방향)
7 AGATTTCAGTTCAAGGTCGTTC 10 GAAACCCGCTGACATCTT 13 ACGCGATGAAAAACGTCTGGCAAGT
8 TCAGTTCAAGGTCGTTCC 11 GAGAAAGCGGACAGAAACC 14 ACGCGATGAAAAACGTCTGGCAAGT
9 ACAATTGCAGAGGAGGTG 12 TGGGAACGACCTTGAACT 15 CTGGTGGACAAAAGGATGGAAAGAGC
표 3
테스트 1 테스트 2
서열번호 정방향 1 2
역방향 3 4
프로브 5 6
표 4
테스트 3 테스트 4 테스트 5
서열번호 정방향 7 8 9
역방향 10 11 12
프로브 13 14 15
실시예 3. 표준 주형 실시간 중합효소 연쇄반응
상기 실시예 1에서 제작한 결핵 DNA 및 내부 대조군용 DNA를 주형으로 하고, 상기 실시예 2에서 선택된 서열번호 1, 3 및 5로 기재되는 결핵 프라이머 및 프로브, 및 서열번호 7, 10 및 13으로 기재되는 내부 대조군용 프라이머 및 프로브를 적용하여 Exicycler TM Real-Time Quantitative Thermal Block(바이오니아사제, 한국), 7500 Fast Real-Time PCR System(Applied Biosystems사제, 미국) 및 iQ™5 Real-Time PCR Detection System (BioRad사제, 미국)을 이용하여 실시간 중합효소 연쇄반응을 실행하여 성능을 비교하였다. 음성 대조군(결핵균 DNA 주형이 없는 공시료)을 함께 반응시켰다는 점 이외에는 실시예 2와 동일한 조건 및 성분으로 45 사이클의 실시간 중합효소 연쇄반응을 실시하였다.
그 결과, 실시예 1의 방법대로 카피 수를 계산하여 결핵 주형 DNA는 최저 10 카피까지 검출이 가능하였고(도 7, 9, 11), 표준 주형 실시간 중합효소 연쇄반응의 표준 그래프를 작성했을 때, 기울기는 -2.96∼-3.53 R2 값은 0.996∼0.9995이었다(도 8, 10, 12). 여기서, R2 는 실시간 중합효소연쇄반응의 표준 그래프를 그렸을 때 그래프의 직선성을 나타내는 상관계수로 1에 가까울수록(직선에 가까울수록), PCR이 제대로 진행되었음을 의미한다. 또한, 105 카피의 내부 대조군용 DNA를 함께 반응시켰음에도 결핵 DNA 주형의 증폭에 아무런 영향을 주지 않고 내부 대조군 증폭이 독립적으로 이루어짐을 확인하였다.
실시예 4. 건조 타입 PCR 조성물을 사용한 표준 주형 실시간 중합효소 연쇄반응
PCR 혼합액(프리믹스) 건조물에 대한 열안정성 검토를 위하여 상기 실시예 2와 같은 조성의 PCR 혼합액을 제조, 건조한 후 이를 사용하여 ExicyclerTM Quantitative Thermal Block(바이오니아사제, 한국)로 실시간 중합효소 연쇄반응을 실행하였다.
구체적으로, 10X Buffer 5㎕, wTfi polymerase 10U, dNTP 20mM 2.5㎕, Thermostable Pyrophosphatase, PPi, 안정화제 등을 한 튜브에 넣고 증류수를 넣어 총 용량이 25㎕이 되도록 혼합한 후 96-웰 플레이트에 분주하고, SuperCentra2(바이오니아사제, 한국)를 이용하여 50∼60분간 건조하였다. 이 후 상기 실시예 2에서 선택된 서열번호 1, 3 및 5로 기재되는 결핵 프라이머 및 프로브, 또한 서열번호 7, 10 및 13으로 기재되는 내부 대조군용 프라이머 및 프로브를 총 용량 5㎕이 되도록 혼합한 후 1차 건조물에 추가 분주하여 25∼30분 건조하였다.
건조한 PCR 혼합물에 상기 실시예 1에서 제작한 결핵 DNA 및 내부 대조군용 DNA를 주형으로 첨가하고, 증류수로 총 용량이 50㎕가 되도록 분주하여 건조물이 잘 풀리도록 완전 혼합하였다. Exicycler TM Real-Time Quantitative Thermal Block(바이오니아사제, 한국)을 이용하고 음성 대조군(결핵 DNA 주형이 없는 공시료)을 함께 반응시켰다는 점 이외에는 실시예 2와 동일한 조건 및 성분으로 45 사이클의 실시간 중합효소 연쇄반응을 실시하였다.
그 결과, 실시예 1의 방법대로 카피 수를 계산하여 결핵 주형 DNA는 최저 10 카피까지 검출이 가능하였고(도 13), 표준 주형 실시간 중합효소 연쇄반응의 표준 그래프를 작성했을 때, 기울기는 -2.932, R2 값은 0.9999이었다(도 14). 여기서, R2 는 실시간 중합효소 연쇄반응의 표준 그래프를 그렸을 때 그래프의 직선성을 나타내는 상관계수로 1에 가까울수록(직선에 가까울수록), PCR이 제대로 진행되었음을 의미한다. 상기 결과에 의해 용액 상태의 PCR 혼합액을 사용한 것과 건조한 혼합물을 사용하여 실시간 중합효소 연쇄반응을 수행한 두 가지 방법에서 동등한 성능이 유지됨을 알 수 있다.
상기 방법과 동일하게 건조한 PCR 혼합물을 사용하여 최종적으로 다이내믹 레인지(Dynamic Range, 한번의 반응에서 검출할 수 있는 결핵 DNA의 농도 범위) 확인을 위해 ExicyclerTM Real-Time Quantitative Thermal Block(바이오니아사제, 한국)을 이용하여 실시예 2와 동일한 조건으로 45 사이클의 실시간 중합효소 연쇄반응을 실시하였다. 실시예 1의 방법대로 카피 수를 계산한 결핵 주형 DNA를 최고 1010 카피에서 최저 10 카피 농도 범위에서 10배씩 희석하여 사용하였으며, 10 log 범위에서 결핵 DNA 검출이 정상적으로 이루어짐을 확인하였다(도 15).
실시예 5. 건조 타입 PCR 조성물의 보관 기간에 따른 안정성 시험
상기 실시예 4와 동일한 조성과 방법을 이용하여 서열번호 1, 3 및 5로 기재되는 결핵 프라이머 및 프로브와 서열번호 7, 10 및 13으로 기재되는 내부 대조군용 프라이머 및 프로브를 포함하는 건조 상태의 PCR 혼합물을 제조한 뒤, 40℃에서 1일 간격으로 6일 동안 정온 배치하고, 각 보관 기간별 건조 타입 PCR 조성물을 Exicycler TM Real-Time Quantitative Thermal Block(바이오니아사제, 한국)을 이용하여 상기 실시예 2와 동일한 조건으로 실시간 중합효소 연쇄반응을 실시하였다. 이는 실제 보관 권장 온도인 -20℃에서 건조 PCR 조성물의 성능 유지 기간을 가속화 실험을 통해 단기간에 예측할 수 있는 방법으로, 40℃에서 1일 보관한 경우 -20℃에서 약64일 보관한 것으로 간주한다(표 5).
구체적으로, 건조 타입 PCR 조성물은 동일 배치(batch)로 7일 분량을 한번에 제조한 후, 건조 직후의 혼합물 일부를 실시예 2와 동일한 조건으로 45 사이클의 실시간 중합효소 연쇄반응에 사용하여 대조군 결과를 얻었다. 그 외의 건조 타입 PCR 조성물은 모두 40℃ 항온기에 동시에 넣어두었으며, 반응에 필요한 수량만큼 하루 간격으로 꺼내어 각각 실시간 중합효소 연쇄반응을 실시하였다. 이 때, 결핵 주형 DNA는 실시예 1의 방법대로 카피 수를 계산하였고, 최고 106부터 최저 103 카피까지 4가지 농도를 사용하여 반응을 진행하였다. Exicycler TM Real-Time Quantitative Thermal Block(바이오니아사제, 한국)을 이용하여 얻은 각 보관 일수별 건조 혼합물의 실시간 중합효소 연쇄반응 결과 중 기울기 값과 R2 값을 대조군 결과와 비교하여, 제조 직후의 건조 혼합물과 40℃ 보관 일수에 따른 건조 혼합물의 성능을 비교하였다.
40℃에서 1일 간격으로 6일 동안 정온배치하여 실험한 결과, 액체 상태의 PCR 혼합물인 대조군에서 기울기는 -3.04, R2 값은 0.9998(도 16)이었으며, 40℃에서 보관한 건조 타입 PCR 조성물은 기울기 -2.94∼-3.13, R2 값은 0.9999∼1.0으로 확인되었다(도 17 내지 도 22). 이는 40℃ 정온배치 6일 후에도 건조 직후의 결과와 동등 수준의 결과값을 얻은 것으로, -20℃ 보관일수로 환산하면 약 384일 동안 건조 직후와 거의 유사한 결과를 안정되게 얻을 수 있음을 의미한다.
표 5
Figure PCTKR2010004333-appb-T000001
N.Temp : Normal temperature 로 정상온도를 의미한다.
실시예 6. 건조 타입 PCR 조성물을 이용한 결핵 검체의 검출시험
상기 실시예 4에서 제작한 서열번호 1, 3 및 5로 기재되는 결핵 프라이머 및 프로브와 서열번호 7, 10 및 13으로 기재되는 내부 대조군용 프라이머 및 프로브를 포함하는 건조 타입 PCR 조성물을 이용하여 결핵 검체에 대해 검출시험을 하였다. 객담을 이용하여 배양으로 결핵 양성 또는 음성으로 판정된 검체와, 환자 소변을 이용하여 배양에 의해 CT(Chlamydia trachomatis) 양성으로 판정된 검체로부터 추출된 DNA를 Exicycler TM Real-Time Quantitative Thermal Block을 이용하여 실시예 2와 같은 조건으로 실시간 중합효소 연쇄반응을 진행하였다.
구체적으로 1㎖의 결핵 양성 객담(Sputum) 검체로부터 DNA를 추출하기 위해 Bead beating법(결핵연구원)을 이용하였고, 권장 실험방법에 따라 추출과정을 진행하여 사용시까지 -70℃에 냉동 보관하였다.
또한 결핵양성 검체 뿐 아니라 음성검체, 결핵과 유사한 비정형 마이코박테리움(NTM : M.intracellulre) 양성으로 판정된 검체 및 CT(Chlamydia trachomatis) 양성으로 판정된 검체로부터 추출된 DNA를 Exicycler TM Real-Time Quantitative Thermal Block을 이용하여 실시예 2와 같은 조건으로 실시간 중합효소 연쇄반응을 진행하였다. 이는 본 발명의 프라이머 및 프로브를 상기 실시예 3의 표준 주형 뿐 아니라 실제 결핵 양성 검체에 적용하였을 때에도 동일한 결과가 나오는지 확인하기 위함이며, 결핵 음성 검체 및 결핵 유사 균 내지 무관한 병원균(Non-Related pathogen)에 대해서 교차반응 유무를 확인하기 위함이다.
그 결과, 상기의 결핵 양성검체에 대해 결핵 유전자가 모두 증폭되었고, 교차반응 유무를 판단하기 위하여 결핵 음성 검체 및 CT 양성 검체로부터 DNA를 추출하여 실시간 중합효소 연쇄반응을 진행한 경우에는 증폭이 되지 않음을 확인하였다. 이로써 본 발명의 프라이머 및 프로브는 4종의 결핵 유전자를 동시에 검출할 수 있고, 무관한 병원균과 교차반응이 일어나지 않음을 확인하였다(도 23 내지 도 26).
실시예 7. 건조 타입 PCR 조성물을 이용한 결핵 검체의 검출 특이도(민감도) 시험
상기 실시예 4에서 제작한 건조 타입 PCR 혼합물을 이용하여 결핵 검체에 대해 검출시험을 수행하였다. 상기 검체는 환자 객담을 이용하여 배양법으로 양성 또는 음성으로 판정된 238개의 검체로써, 43개의 결핵 양성 검체와 195개의 결핵 음성 검체로부터 추출된 DNA를 포함한다. 상기 결핵 검체는 Bead beating법(결핵연구원)을 이용하여 1ml의 객담으로부터 DNA를 추출하였고 -20℃에 냉동 보관 후 시험에 사용하였다.
구체적으로는, 실시예 4에서 제작한 서열번호 1, 3 및 5로 기재되는 결핵 프라이머 및 프로브와 서열번호 7, 10 및 13으로 기재되는 내부 대조군용 프라이머 및 프로브를 포함하는 건조 타입 PCR 조성물에 상기 실시예 1에서 제작한 결핵 DNA 및 내부 대조군용 DNA를 주형으로 첨가하고, 증류수로 총 용량이 50㎕가 되도록 분주하여 건조 조성물이 잘 풀리도록 완전 혼합하였다. 이때, 검체 시험을 위해서 상기와 동일한 성분에 주형 DNA를 제외하고 각각의 검체로부터 추출한 DNA를 대체 첨가하였다. Exicycler TM Real-Time Quantitative Thermal Block(바이오니아사제, 한국)을 이용하여 상기 실시예 2와 동일한 조건으로 45 사이클의 실시간 중합효소 연쇄반응을 실시하였다.
그 결과, 43개의 모든 결핵 검체에서 현미경 관찰시험 결과와 100% 일치하는 양성의 결과를 얻었고 추가로 10개의 검체에서 양성으로 판정되었다. 추가 양성 검체에 대하여 환자 추적조사를 해본 결과 이미 결핵으로 진단받고 치료중이거나 완치된 환자로 확인되었다(표 6). 이로써 배양 결과를 기준으로 하여, 본 발명에서 제공되는 건조 타입의 PCR 조성물의 민감도와 특이도는 각각 95.5% 와 95.3%이고, 양성 예측율은 79.2%로 확인되었다(도 27).
표 6
양성 샘플 음성 샘플
배양법 43 195
본 발명의 건조 타입의PCR 조성물 53 185

Claims (16)

  1. 결핵균(Mycobacterium tuberculosis) IS6110 유전자(GenBank Accession No. AJ242908)의 1300 내지 2100 번째 염기 내의 5 내지 40개의 염기서열을 포함하는 결핵균 검출용 프라이머.
  2. 서열번호 1 내지 서열번호 4로 기재되는 염기서열들로 이루어진 군으로부터 선택되는 프라이머.
  3. 결핵균(Mycobacterium tuberculosis) IS6110 유전자(GenBank Accession No. AJ242908)의 1300 내지 2100 번째 염기 내의 5 내지 40개의 염기서열을 포함하는 결핵균 검출용 프로브.
  4. 서열번호 5 또는 서열번호 6의 염기서열을 갖는 프로브.
  5. 청구항 3 또는 청구항 4에 있어서,
    리포터와 소광제가 붙어 있는 구조인 프로브.
  6. 청구항 5에 있어서,
    상기 리포터는 FAM인 프로브.
  7. 청구항 5에 있어서,
    상기 소광제는 BHQ1인 프로브.
  8. 청구항 1 또는 청구항 2의 결핵균 검출용 프라이머 및 청구항 3 또는 청구항 4의 결핵균 검출용 프로브를 포함하는 결핵균 검출용 키트.
  9. 청구항 8에 있어서,
    상기 결핵균 검출용 키트는 내부 대조군용 유전자, 프라이머 및 프로브를 더 포함하는 결핵균 검출용 키트.
  10. 청구항 8에 있어서,
    상기 결핵 검출용 키트는 건조 타입인 결핵균 검출용 키트.
  11. 청구항 9에 있어서,
    상기 내부 대조군용 유전자, 프라이머 및 프로브는 Tobacco mosaic virus isolate Taigu movement protein (MP) 유전자(GenBank. Accession No. FJ873800)의 염기서열로부터 유래된 것인 결핵균 검출용 키트.
  12. 청구항 11에 있어서,
    상기 프라이머는 서열번호 7 내지 서열번호 12로 기재되는 염기서열들로 이루어진 군으로부터 선택되고, 상기 프로브는 서열번호 13 내지 서열번호 15로 기재되는 염기서열들로 이루어진 군으로부터 선택되는 결핵균 검출용 키트.
  13. 1) 검체를 주형으로 청구항 1의 결핵균 검출용 프라이머와 청구항 3의 결핵균 검출용 프로브를 사용하여 중합효소 연쇄반응 또는 실시간 중합효소 연쇄반응을 수행하는 단계; 및
    2) 상기 1) 단계의 증폭 유무 또는 증폭 산물에 대한 형광값을 조사하는 단계를 포함하는 결핵 검출 방법.
  14. 청구항 13에 있어서,
    상기 연쇄반응을 수행하는 단계는 내부 대조군용 유전자, 프라이머, 프로브를 추가로 사용하여 수행하는 결핵균 검출 방법.
  15. 청구항 13에 있어서,
    상기 내부 대조군용 유전자, 프라이머 및 프로브는 Tobacco mosaic virus isolate Taigu movement protein (MP) 유전자(GenBank. Accession No. FJ873800)의 염기서열로부터 유래된 것인 결핵균 검출 방법.
  16. 청구항 15에 있어서,
    상기 프라이머는 서열번호 7 내지 서열번호 12로 기재되는 염기서열들로 이루어진 군으로부터 선택되고, 상기 프로브는 서열번호 13 내지 서열번호 15로 기재되는 염기서열들로 이루어진 군으로부터 선택되는 결핵 검출 방법.
PCT/KR2010/004333 2010-07-02 2010-07-02 결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법 WO2012002598A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020127032154A KR101498705B1 (ko) 2010-07-02 2010-07-02 결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법
PCT/KR2010/004333 WO2012002598A1 (ko) 2010-07-02 2010-07-02 결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2010/004333 WO2012002598A1 (ko) 2010-07-02 2010-07-02 결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법

Publications (1)

Publication Number Publication Date
WO2012002598A1 true WO2012002598A1 (ko) 2012-01-05

Family

ID=45402289

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/004333 WO2012002598A1 (ko) 2010-07-02 2010-07-02 결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법

Country Status (2)

Country Link
KR (1) KR101498705B1 (ko)
WO (1) WO2012002598A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2977465A4 (en) * 2013-03-21 2016-11-16 Hyunil Bio Co SELECTIVE PROCEDURE FOR TUBERCULOUS SLIME-BACTERIA AND NON-UGLY MOLECULAR BACTERIA AND KIT THEREWITH
CN110819726A (zh) * 2018-08-08 2020-02-21 台达电子工业股份有限公司 检测分枝杆菌的方法及其套组
RU2770803C1 (ru) * 2021-08-05 2022-04-21 Федеральное государственное бюджетное учреждение науки Институт химической биологии и фундаментальной медицины Сибирского отделения Российской академии наук (ИХБФМ СО РАН) Способ выявления ДНК бактерии Mycobacterium tuberculosis для диагностики туберкулеза

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060127897A1 (en) * 2002-02-25 2006-06-15 Stewart Cole Delete sequence in m, tuberculosis, method for detecting mycobacteria using these sequences and vaccines
US20080206776A1 (en) * 2005-09-05 2008-08-28 Bio-Rad Pasteur Use of Both Rd9 and Is6110 as Nucleic Acid Targets for the Diagnosis of Tuberculosis, and Provision of Multiplex-Compliant Is6110 and Rd9 Targets
US20080241826A1 (en) * 2004-04-26 2008-10-02 Wako Pure Chemical Probe And Primer For Tubercle Bacillus Detection, And Method Of Detecting Human Tubercle Bacillus Therewith

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060127897A1 (en) * 2002-02-25 2006-06-15 Stewart Cole Delete sequence in m, tuberculosis, method for detecting mycobacteria using these sequences and vaccines
US20080241826A1 (en) * 2004-04-26 2008-10-02 Wako Pure Chemical Probe And Primer For Tubercle Bacillus Detection, And Method Of Detecting Human Tubercle Bacillus Therewith
US20080206776A1 (en) * 2005-09-05 2008-08-28 Bio-Rad Pasteur Use of Both Rd9 and Is6110 as Nucleic Acid Targets for the Diagnosis of Tuberculosis, and Provision of Multiplex-Compliant Is6110 and Rd9 Targets

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK 23 October 2008 (2008-10-23), "Mycobacterium tuberculosis IS6110 genes and partial plcD and Rv1758 genes", Database accession no. AJ242908 *
DORIS HILLEMANN ET AL.: "Rapid Detection of Mycobacterium tuberculosis Beijing Genotype Strains by Real-Time PCR.", JOURNAL OF CLINICAL MICROBIOLOGY., vol. 44, no. 2, 2006, pages 302 - 306 *
PAUL H.M. SAVELKOUL ET AL.: "Detection of Mycobacterium tuberculosis complex with Real Time PCR: Comparison of different primer-probe sets based on the IS6110 element.", JOURNAL OF MICROBIOLOGICAL METHODS., vol. 66, no. ISS.1, 2006, pages 177 - 180 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2977465A4 (en) * 2013-03-21 2016-11-16 Hyunil Bio Co SELECTIVE PROCEDURE FOR TUBERCULOUS SLIME-BACTERIA AND NON-UGLY MOLECULAR BACTERIA AND KIT THEREWITH
US10301686B2 (en) 2013-03-21 2019-05-28 Hyunil-Bio Co. Selective detection method for Mycobacterium tuberculosis and nontuberculous mycobacteria and kit using same
CN110819726A (zh) * 2018-08-08 2020-02-21 台达电子工业股份有限公司 检测分枝杆菌的方法及其套组
CN110819726B (zh) * 2018-08-08 2023-12-05 台达电子工业股份有限公司 检测分枝杆菌的方法及其套组
RU2770803C1 (ru) * 2021-08-05 2022-04-21 Федеральное государственное бюджетное учреждение науки Институт химической биологии и фундаментальной медицины Сибирского отделения Российской академии наук (ИХБФМ СО РАН) Способ выявления ДНК бактерии Mycobacterium tuberculosis для диагностики туберкулеза

Also Published As

Publication number Publication date
KR101498705B1 (ko) 2015-03-06
KR20130045863A (ko) 2013-05-06

Similar Documents

Publication Publication Date Title
CN110982943B (zh) 一种新型冠状病毒rt-pcr检测方法及试剂盒
CN111118228B (zh) 一种用于新型冠状病毒covid-19核酸检测试剂盒及其使用方法
WO2010147372A9 (ko) 말라리아 원충 검출용 프라이머, 탐침 및 이를 이용한 검출방법
CN112063756B (zh) 多重检测呼吸道病毒核酸的方法及试剂盒
WO2011025262A2 (ko) 결핵균군 및 마이코박테리아 속 구분 검출용 조성물 및 이를 이용한 실시간 다중 중합효소 연쇄반응에 의한 결핵균 및 마이코박테리아 속의 동시 분석 방법
WO2012002598A1 (ko) 결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법
WO2012002597A1 (ko) Β형 간염 바이러스 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 β형 간염 바이러스 진단 방법
WO2020101194A1 (ko) 카바페넴아제 생성 장내세균 진단을 위한 루프 매개 등온증폭 반응용 프라이머 세트 및 이의 용도
KR20210113932A (ko) 신종 코로나바이러스 검출용 고감도 다중 루프매개등온증폭 프라이머 세트
WO2022145658A1 (ko) 쯔쯔가무시병 진단용 조성물 및 이를 포함하는 키트
WO2012002594A1 (ko) Ｃ형 간염 바이러스 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 ｃ형 간염 바이러스 진단 방법
WO2021141179A1 (ko) 뎅기 바이러스의 4종류 혈청형 동시 검출용 올리고뉴클레오티드 및 플라스미드와 이를 이용한 뎅기 바이러스 혈청형 분석 방법
US9096908B2 (en) Selective detection of Bordetella species
WO2021154042A2 (ko) 결핵균 및 비결핵항산균을 동시에 감별하여 검출할 수 있는 고감도 다중 등온증폭반응용 프라이머 세트
WO2020171596A1 (ko) 가노더마 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
WO2021215556A1 (ko) 코로나 바이러스 진단 키트를 제조하는 방법, 이로부터 제조된 코로나 바이러스 진단 키트 및 이를 사용하여 코로나 바이러스를 진단하는 방법
WO2010137873A9 (ko) 신종 인플루엔자 a형 바이러스 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 진단 방법
KR20210073220A (ko) 중증열성혈소판감소증후군 및 쯔쯔가무시증 동시 검출용 프라이머 및 프로브 세트
WO2021201462A1 (ko) 돼지 내인성 레트로 바이러스 검출용 올리고뉴클레오티드 및 플라스미드와 이를 이용한 돼지 내인성 레트로 바이러스 유전자 검출 방법
WO2021040245A1 (ko) 중증열성혈소판감소증후군 바이러스 유전자 검출용 조성물 및 이를 이용한 중증열성혈소판감소증후군의 진단방법
WO2010032991A2 (ko) 엔테로바이러스 검출용 프라이머, 탐침 및 이를 이용한 엔테로바이러스 검출방법
CN114262758B (zh) 检测新型冠状病毒突变株的试剂盒及检测方法
WO2020171604A1 (ko) Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
WO2020171595A1 (ko) 가노더마 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
WO2020171598A1 (ko) Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10854144

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 20127032154

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10854144

Country of ref document: EP

Kind code of ref document: A1