WO2008132743A2 - Production of high mannose proteins in plant culture - Google Patents
Production of high mannose proteins in plant culture Download PDFInfo
- Publication number
- WO2008132743A2 WO2008132743A2 PCT/IL2008/000576 IL2008000576W WO2008132743A2 WO 2008132743 A2 WO2008132743 A2 WO 2008132743A2 IL 2008000576 W IL2008000576 W IL 2008000576W WO 2008132743 A2 WO2008132743 A2 WO 2008132743A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- lysosomal protein
- human
- cell
- protein
- human lysosomal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/47—Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/23—Apiaceae or Umbelliferae (Carrot family), e.g. dill, chervil, coriander or cumin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/10—Cells modified by introduction of foreign genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2465—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on alpha-galactose-glycoside bonds, e.g. alpha-galactosidase (3.2.1.22)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/005—Glycopeptides, glycoproteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01022—Alpha-galactosidase (3.2.1.22)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01045—Glucosylceramidase (3.2.1.45), i.e. beta-glucocerebrosidase
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/04—Fusion polypeptide containing a localisation/targetting motif containing an ER retention signal such as a C-terminal HDEL motif
Definitions
- the present invention relates to transformed host cells for the production of high mannose proteins and a method and system for producing these proteins, particularly in plant culture.
- Gaucher' s disease is the most prevalent lysosomal storage disorder. It is caused by a recessive genetic disorder (chromosome 1 q21-q31) resulting in deficiency of glucocerebrosidase, also known as glucosylceramidase, which is a membrane-bound lysosomal enzyme that catalyzes the hydrolysis of the glycosphingolipid glucocerebroside (glucosylceramide, GlcCer) to glucose and ceramide.
- GlcCer glycosphingolipid glucocerebroside
- the gene encoding human GCD was first sequenced in 1985 (6)
- the protein consists of 497 amino acids derived from a 536-mer pro-peptide.
- the mature hGCD contains five N-glycosylation amino acid consensus sequences (Asn-X-Ser/Thr). Four of these sites are normally glycosylated. Glycosylation of the first site is essential for the production of active protein. Both high-mannose and complex oligosaccharide chains have been identified (7).
- hGCD from placenta contains 7% carbohydrate, 20% of which is of the high-mannose type (8).
- Biochemical and site-directed mutagenesis studies have provided an initial map of regions and residues important to folding, activator interaction, and active site location (9).
- placental hGCD Treatment of placental hGCD with neuraminidase (yielding an asialo enzyme) results in increased clearance and uptake rates by rat liver cells with a concomitant increase in hepatic enzymatic activity (Furbish et al., 1981, Biochim. Biophys. Acta 673:425-434).
- This glycan-modified placental hGC is currently used as a therapeutic agent in the treatment of Gaucher's disease.
- Biochemical and site-directed mutagenesis studies have provided an initial map of regions and residues important to folding, activator interaction, and active site location [Grace et al., J. Biol. Chem. 269:2283- 2291 (1994)].
- Gaucher cells There are three different types of Gaucher disease, each determined by the level of hGC activity.
- the major cells affected by the disease are the macrophages, which are highly enlarged due to GlcCer accumulation, and are thus referred to as "Gaucher cells”.
- Fabry disease is an X-linked lysosomal storage disease that is caused by deficient activity of lysosomal enzyme ⁇ -galactosidase A ( ⁇ -Gal A).
- ⁇ -Gal A ⁇ -galactosidase A
- Patients with classic Fabry disease typically have ⁇ -Gal A activity of less than 1% and often demonstrate the full spectrum of symptoms, including severe pain in the extremities (acroparesthesias), hypohidrosis, corneal and lenticular changes, skin lesions (angiokeratoma), renal failure, cardiovascular disease, pulmonary failure, neurological symptoms and stroke.
- This protein does not target the phagocytic cells in the body and is therefore of limited therapeutic value.
- the terminal sugars on the carbohydrate chains of glucocerebrosidase are sequentially removed by treatment with three different glycosidases.
- This glycosidase treatment results in a glycoprotein whose terminal sugars consist of mannose residues. Since phagocytes have mannose receptors that recognize glycoproteins and glycopeptides with oligosaccharide chains that terminate in mannose residues, the carbohydrate remodeling of glucocerebrosidase has improved the targeting of the enzyme to these cells [Furbish et al., Biochem. Biophys. Acta 673:425, (1981)].
- glycosylation plays a crucial role in hGCD activity, therefore deglycosylation of hGCD expressed in cell lines using either tunicamycin (S ⁇ > cells) or point mutations abolishing all glycosylation sites (both SJ9 and COS-I cells), results in complete loss of enzymatic activity.
- hGCD expressed in E. coli was found to be inactive. Further research indicated the significance of the various glycosylation sites for protein activity.
- the commercially produced enzyme contains glycan sequence modifications that facilitate specific drug delivery. The glycosylated proteins are remodeled following extraction to include only mannose containing glycan sequences.
- the human GCD enzyme contains 4 glycosylation sites and 22 lysines.
- the recombinantly produced enzyme (Cerezyme Tm ) differs from the placental enzyme (CeredaseTM) in position 495 where an arginine has been substituted with a histidine.
- the oligosaccharide composition differs between the recombinant and the placental GCD as the former has more fucose and N-acetyl-glucosamine residues while the latter retains one high mannose chain.
- GCDs are treated with three different glycosidases (neuraminidase, galactosidase, and P-N acetyl- glucosaminidase) to expose terminal mannoses, which enables targeting of phagocytic cells.
- glycosidases neuroaminidase, galactosidase, and P-N acetyl- glucosaminidase
- a pharmaceutical preparation comprising the recombinantly produced enzyme is described in US 5,549,892. It should be noted that all references mentioned are hereby incorporated by reference as if fully set forth herein.
- Recombinant ⁇ -Galactosidase A for enzyme replacement therapy has been produced in insect (sf9) cells (see US 7,011,831) in human fibroblasts (see US 6,395,884) and in plant cells (see US 6,846,968).
- Clinical trials with recombinant a-Gal A (agalsidase beta [Fabrazyme]: Genzyme Corporation, Cambridge, Mass; agalsidase alfa [Replagal]: TKT Corporation, Cambridge, Mass) have been performed, and both drugs have been approved for clinical use.
- Another major drawback of the existing GCD recombinant enzymes is their expense, which can place a heavy economic burden on health care systems.
- the high cost of these recombinant enzymes results from a complex purification protocol, and the relatively large amounts of the therapeutic required for existing treatments. There is therefore, an urgent need to reduce the cost of GCD so that this life saving therapy can be provided to all who require it more affordably.
- Proteins for pharmaceutical use have been traditionally produced in mammalian or bacterial expression systems.
- This methodology utilizes Agrobacterium, a bacteria capable of inserting single stranded DNA molecules (T-DNA) into the plant genome. Due to the relative simplicity of introducing genes for mass production of proteins and peptides, this methodology is becoming increasingly popular as an alternative protein expression system (1). While post translational modifications do not exist in bacterial expression systems, plant derived expression systems do facilitate these modifications known to be crucial for protein expression and activity.
- One of the major differences between mammalian and plant protein expression system is the variation of protein sugar side chains, caused by the differences in biosynthetic pathways.
- Protein glycosylation is divided into two categories: N-linked and O-linked modifications (2).
- the two types differ in amino acid to which the glycan moiety is attached to - N-linked are attached to Asn residues, while O-linked are attached to Ser or Thr residues.
- the glycan sequences of each type bears unique distinguishing features.
- N-linked glycosylation is the more abundant, and its effect on protein function has been extensively studied.
- O-linked glycans on the other hand are relatively scarce, and less information is available regarding their affect on proteins.
- the background art does not teach or suggest a device, system or method for selectively producing glycosylated proteins in plant culture.
- the background art also does not teach or suggest such a device, system or method for producing high mannose proteins in plant culture.
- the background art also does not teach or suggest a device, system or method for producing proteins in plant culture through the endoplasmic reticulum (ER).
- the background art also does not teach or suggest such a device, system or method for producing proteins in plant culture through the endoplasmic reticulum (ER) while by-passing the Golgi body.
- the background art also does not teach or suggest such a device, system or method for producing proteins in plant culture by using an ER signal to by-pass the Golgi body.
- the present invention overcomes these disadvantages of the background art by providing a device, system and method for producing glycosylated proteins in plant culture, particularly proteins having a high mannose glycosylation, while optionally and preferably targeting (and/or otherwise manipulating processing of) such proteins with an ER signal.
- a device, system and method for producing glycosylated proteins in plant culture particularly proteins having a high mannose glycosylation
- targeting and/or otherwise manipulating processing of
- ER signal e.g., it is believed that such targeting causes the proteins to by-pass the Golgi body and thereby to retain the desired glycosylation, particularly high mannose glycosylation.
- plant culture includes any type of transgenic and/or otherwise genetically engineered plant cell that is grown in culture. The genetic engineering may optionally be permanent or transient.
- the culture features cells that are not assembled to form a complete plant, such that at least one biological structure of a plant is not present.
- the culture may feature a plurality of different types of plant cells, but preferably the culture features a particular type of plant cell.
- plant cultures featuring a particular type of plant cell may be originally derived from a plurality of different types of such plant cells.
- the plant cells may be grown according to any type of suitable culturing method, including but not limited to, culture on a solid surface (such as a plastic culturing vessel or plate for example) or in suspension.
- the invention further relates to vectors and methods for expression and production of enzymatically active high mannose lysosomal enzymes using transgenic plant root, particularly carrot cells. More particularly, the invention relates to host cells, particularly transgenic suspended carrot cells, vectors and methods for high yield expression and production of biologically active high mannose Glucocerebrosidase
- the invention further provides for compositions and methods for the treatment of lysosomal storage diseases.
- the present invention is also of a device, system and method for providing sufficient quantities of biologically active lysosomal enzymes, and particularly, human
- the present invention is also of host cells comprising new vector compositions that allow for efficient production of genes encoding lysosomal enzymes, such as GCD and ⁇ -galactosidase A.
- the present invention therefore solves a long-felt need for an economically viable technology to produce proteins having particular glycosylation requirements, such as the high mannose glycosylation of lysosomal enzymes such as GCD and ⁇ - galactosidase A for example.
- the present invention is able to solve this long felt need by using plant cell culture.
- Biosynthesis begins in the Endoplasmic Reticulum (ER) with the transfer of the glycan precursor from a dolichol lipid carrier to a specific Asn residue on the protein by the oligosaccharyl transferase.
- the precursor is subsequently modified in the ER by glycosidases I and II and a hypothetical mannosidase to yield the high mannose structures, similar to the process occurring in mammals.
- modifications of the glycan sequence to complex and hybrid structures occur in the Golgi. Such modifications include removal of one of the four mannose residues by ⁇ -mannosidase I, addition of an N-acetylglucosamine residue, removal of the two additional mannose residues by ⁇ -mannosidase II, addition of N- acetylglucosamine and optionally, at this stage, xylose and fucose residues may be added to yield plant specific N-linked glycans. After the transfer of xylose and fucose to the core, complex type N-glycans can be further processed via the addition of terminal fucose and galactose. Further modifications may take place during the glycoprotein transport.
- the present invention overcomes these deficiencies of the background art approaches by using an ER signal and/or by blocking secretion from the ER to the Golgi body.
- ER signal and/or by blocking secretion from the ER to the Golgi body.
- secretion can be blocked and the protein can be maintained in the ER, naturally occurring high mannose structures are obtained without the need for remodeling.
- proteins transported via the endomembrane system first pass into the endoplasmic reticulum.
- the necessary transport signal for this step is represented by a signal sequence at the N-terminal end of the molecule, the so-called signal peptide.
- this signal peptide As soon as this signal peptide has fulfilled its function, which is to insert the precursor protein attached to it into the endoplasmic reticulum, it is split off proteolytically from the precursor protein.
- this type of signal peptide sequence has been conserved to a high degree during evolution in all living cells, irrespective of whether they are bacteria, yeasts, fungi, animals or plants.
- Proteins containing both an N-terminal signal peptide for insertion into the endoplasmic reticulum and a C-terminal vacuolar targeting signal are expected to contain complex glycans, which is attached to them in the Golgi [Lerouge et al., (1998) Plant MoI. Biol. 38:31-48].
- the nature of such C- terminal sorting signals can vary very widely.
- US 6,054,637 describes peptide fragments obtained from the region of tobacco basic chitinase, which is a vacuolar protein that act as vacuolar targeting peptides.
- vacuolar protein containing a C-terminal targeting signal and complex glycans is the phaseolin storage protein from bean seeds [Frigerio et al., (1998) Plant Cell 10:1031-1042; Frigerio et al., (2001) Plant Cell 13:1109-1126.].
- the paradigm is that in all eukaryotic cells vacuolar proteins pass via the ER and the Golgi before sequestering in the vacuole as their final destination.
- the transformed plant root cells of the present invention produced an unexpected high mannose GCD and ⁇ -galactosidase A.
- this high mannose product was found to be biologically active and therefore no further steps were needed for its activation.
- any type of mechanism which is capable to produce high mannose glycosylation including any type of mechanism to by-pass the Golgi, may be used in accordance with the present invention.
- the present invention relates to a host cell producing a high mannose recombinant protein of interest.
- This cell may be transformed or transfected with a recombinant nucleic acid molecule encoding a protein of interest or with an expression vector comprising the nucleic acid molecule.
- nucleic acid molecule comprises a first nucleic acid sequence encoding the protein of interest operably linked to a second nucleic acid sequence encoding a vacuolar targeting signal peptide.
- the first nucleic acid sequence may be optionally further operably linked to a third nucleic acid sequence encoding an ER (endoplasmic reticulum) targeting signal peptide.
- the host cell of the invention is characterized in that the protein of interest is produced by the cell in a highly mannosylated form.
- the host cell of the invention may be a eukaryotic or prokaryotic cell.
- the host cell of the invention is a prokaryotic cell, preferably, a bacterial cell, most preferably, an Agrobacterium tumefaciens cell. These cells are used for infecting the preferred plant host cells described below.
- the host cell of the invention may be a eukaryotic cell, preferably, a plant cell, and most preferably, a plant root cell selected from the group consisting of Agrobacterium rihzogenes transformed root cell, celery cell, ginger cell, horseradish cell and carrot cell.
- the plant root cell is a carrot cell. It should be noted that the transformed carrot cells of the invention are grown in suspension. As mentioned above and described in the Examples, these cells were transformed with the
- Agrobacterium tumefaciens cells Agrobacterium tumefaciens cells.
- the recombinant nucleic acid molecule comprised within the host cell of the invention comprises a first nucleic acid sequence encoding a lysosomal enzyme that is in operable linkage with a second nucleic acid sequence encoding a vacuolar targeting signal peptide derived from the basic tobacco chitinase A gene.
- This vacuolar signal peptide has the amino acid sequence as denoted by SEQ ID NO:
- the first nucleic acid sequence may be optionally further linked in an operable linkage with a third nucleic acid sequence encoding an ER (endoplasmic reticulum) targeting signal peptide as denoted by SEQ ID NO: 1.
- the recombinant nucleic acid molecule comprised within the host cell of the invention further comprises a promoter that is functional in plant cells. This promoter should be operably linked to the recombinant molecule of the invention.
- this recombinant nucleic acid molecule may optionally further comprise an operably linked terminator which is preferably functional in plant cells.
- the recombinant nucleic acid molecule of the invention may optionally further comprise additional control, promoting and regulatory elements and/or selectable markers. It should be noted that these regulatory elements are operably linked to the recombinant molecule.
- the high mannose protein of interest produced by the host cell of the invention may be a high mannose glycoprotein having exposed mannose terminal residues.
- Such high mannose protein may be according to another preferred embodiment, a lysosomal enzyme selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N-acetylgalactosaminidise, acid lipase, ⁇ - galactosidase, glucocerebrosidase, ⁇ -L-iduronidase, iduronate sulfatase, ⁇ -mannosidase and sialidase.
- GCD glucocerebrosidase
- acid sphingomyelinase acid sphingomyelinase
- hexosaminidase hexosaminidase
- the lysosomal enzyme may be the human glucocerebrosidase (GCD) or ⁇ -galactosidase A.
- GCD human glucocerebrosidase
- rGCD rhGCD
- GCD human glucocerebrosidase
- rhGCD rhGCD
- A-gal, A-gal A, recombinant A-gal, rA-gal, rhA-gal all refer to various forms of recombinant human ⁇ -galactosidase A [Genbank accession numbers NMOOO 169 (coding sequence) and CAA29232 (amino acid sequence)] unless otherwise indicated.
- Gaucher' s disease the most prevalent lysosomal storage disorder, is caused by point mutations in the hGCD (human glucocerebrosidase) gene (GBA), which result in accumulation of GlcCer in the lysosomes of macrophages.
- GCD human glucocerebrosidase gene
- suitably glycosylated hGCD or ⁇ -galactosidase A is preferably provided by controlling the expression of hGCD or h ⁇ -galactosidase A in plant cell culture, optionally and more preferably by providing an ER signal and/or otherwise by optionally and more preferably blocking transportation to the Golgi.
- the hGCD or ⁇ -galactosidase A has at least one oligosaccharide chain comprising an exposed mannose residue for the treatment or prevention of Gaucher's disease.
- this preferred host cell is transformed or transfected by a recombinant nucleic acid molecule which further comprises an 35 S promoter from Cauliflower Mosaic Virus, an octopine synthase terminator of Agrobacterium tumefaciens and TMV (Tobacco Mosaic Virus) omega translational enhancer element.
- this recombinant nucleic acid molecule comprises the nucleic acid sequence substantially as denoted by SEQ ID NO: 13 and encodes a high mannose GCD having the amino acid sequence substantially as denoted by SEQ ID NOs: 14 or 15.
- the present invention further provides for an expression vector comprising a nucleic acid molecule encoding a biologically active lysosomal enzyme.
- the expression vector of the invention comprises a nucleic acid molecule encoding a biologically active high mannose human glucocerebrosidase (GCD) or ⁇ -galactosidase A.
- this preferred expression vector comprises a nucleic recombinant nucleic acid molecule which having the nucleic acid sequence substantially as denoted by SEQ ID NOs: 13, 17 or 19.
- the present invention relates to a recombinant high mannose protein produced by the host cell of the invention.
- this high mannose protein may be a biologically active high mannose lysosomal enzyme selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N- acetylgalactosaminidise, acid lipase, ⁇ -galactosidase, glucocerebrosidase, ⁇ -L- iduronidase, iduronate sulfatase, ⁇ -mannosidase and sialidase.
- this lysosomal enzyme may be human glucocerebrosidase (GCD).
- the invention provides for a recombinant biologically active high mannose lysosomal enzyme having at least one oligosaccharide chain comprising an exposed mannose residue.
- the recombinant lysosomal enzyme of the invention can bind to a mannose receptor on a target cell in a target site.
- this site may be within a subject suffering from a lysosomal storage disease.
- the recombinant lysosomal enzyme has increased affinity for the target cell, in comparison with the corresponding affinity of a naturally occurring lysosomal enzyme for the target cell.
- the target cell at the target site may be a Kupffer cell in the liver of the subject.
- the recombinant lysosomal enzyme may be selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N-acetylgalactosaminidise, acid lipase, ⁇ -galactosidase, glucocerebrosidase, ⁇ -L-iduronidase, iduronate sulfatase, ⁇ -mannosidase or sialidase.
- GCD glucocerebrosidase
- acid sphingomyelinase acid sphingomyelinase
- hexosaminidase hexosaminidase
- ⁇ -N-acetylgalactosaminidise acid lipase
- ⁇ -galactosidase glucocerebrosidase
- this recombinant lysosomal enzyme is glucocerebrosidase (GCD).
- the invention relates to a method of producing a high mannose protein. Accordingly, the method of the invention comprises the steps of: (a) preparing a culture of recombinant host cells transformed or transfected with a recombinant nucleic acid molecules encoding a recombinant protein of interest or with an expression vector comprising the recombinant nucleic acid molecules; (b) culturing these host cell culture prepared by step (a) under conditions permitting the expression of the protein, wherein the host cells produce the protein in a highly mannosylated form; (c) recovering the protein from the cells and harvesting the cells from the culture provided in (a); and (d) purifying the protein of step (c) by a suitable protein purification method.
- the host cell used by this method is the host cell of the invention.
- the high mannose protein produced by the method of the invention may be a biologically active high mannose lysosomal enzyme having at least one oligosaccharide chain comprising an exposed mannose residue.
- This recombinant enzyme can bind to a mannose receptor on a target cell in a target site. More particularly, the recombinant enzyme produced by the method of the invention has increased affinity for the target cell, in comparison with the corresponding affinity of a naturally occurring lysosomal enzyme to the target cell. Accordingly, the target cell at the target site may be Kupffer cell in the liver of the subject.
- this lysosomal enzyme may be selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N-acetylgalactosaminidise, acid lipase, ⁇ -galactosidase, glucocerebrosidase, ⁇ -L- iduronidase, iduronate sulfatase, ⁇ -mannosidase and sialidase. Most preferably, this lysosomal enzyme may be glucocerebrosidase (GCD) or an ⁇ -galactosidase A.
- GCD glucocerebrosidase
- A ⁇ -galactosidase
- the host cell used by the method of the invention may be a plant root cell selected from the group consisting of Agrobacterium rihzogenes transformed root cell, celery cell, ginger cell, horseradish cell and carrot cell. Most preferably, the plant root cell is a carrot cell. It should be particularly noted that in the method of the invention, the transformed host carrot cells are grown in suspension.
- the present invention relates to a method for treating a subject having lysosomal storage disease using exogenous recombinant lysosomal enzyme, comprising: (a) providing a recombinant biologically active form of lysosomal enzyme purified from transformed plant root cells, and capable of efficiently targeting cells abnormally deficient in the lysosomal enzyme.
- This recombinant biologically active enzyme has exposed terminal mannose residues on appended oligosaccharides; and (b) administering a therapeutically effective amount of the recombinant biologically active lysosomal enzyme to the subject.
- the recombinant high mannose lysosomal enzyme used by the method of the invention may be produced by the host cell of the invention.
- this host cell is a carrot cell.
- the lysosomal enzyme used by the method of the invention may be a high mannose enzyme comprising at least one oligosaccharide chain having an exposed mannose residue.
- This recombinant enzyme can bind to a mannose receptor on a target cell in a target site within a subject. More preferably, this recombinant lysosomal enzyme has increased affinity for these target cells, in comparison with the corresponding affinity of a naturally occurring lysosomal enzyme to the target cell.
- the lysosomal enzyme used by the method of the invention may be selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N-acetylgalactosaminidise, acid lipase, ⁇ - galactosidase, glucocerebrosidase, ⁇ -L-iduronidase, iduronate sulfatase, ⁇ -mannosidase or sialidase.
- this lysosomal enzyme is glucocerebrosidase (GCD).
- the method of the invention is therefore intended for the treatment of a lysosomal storage disease, particularly Gaucher's disease.
- the target cell at the target site may be a Kupffer cell in the liver of the subject.
- the invention further provides for a pharmaceutical composition for the treatment of a lysosomal storage disease comprising as an active ingredient a recombinant biologically active high mannose lysosomal enzyme as defined by the invention.
- the composition of the invention may optionally further comprise pharmaceutically acceptable dilluent, carrier or excipient.
- composition of the invention is intended for the treatment of Gaucher's disease.
- Such composition may preferably comprise as an effective ingredient a biologically active high mannose human glucocerebrosidase (GCD), as defined by the invention.
- GCD biologically active high mannose human glucocerebrosidase
- the invention further relates to the use of a recombinant biologically active high mannose lysosomal enzyme of the invention in the manufacture of a medicament for the treatment or prevention of a lysosomal storage disease. More particularly, such disease may be Gaucher's disease.
- this biologically active lysososomal enzyme is a biologically active high mannose human glucocerebrosidase (GCD), as defined by the invention.
- a host cell producing a high mannose recombinant protein comprising a polynucleotide encoding the recombinant protein and a signal for causing the recombinant protein to be produced as a high mannose protein.
- the polynucleotide comprises a first nucleic acid sequence encoding the protein of interest operably linked to a second nucleic acid sequence encoding a signal peptide.
- the signal peptide comprises an ER (endoplasmic reticulum) targeting signal peptide.
- the polynucleotide further comprises a third nucleic acid sequence for encoding a vacuolar targeting signal peptide.
- the signal causes the recombinant protein to be targeted to the ER. More preferably, the signal comprises a signal peptide for causing the recombinant protein to be targeted to the ER. Most preferably, the polynucleotide comprises a nucleic acid segment for encoding the signal peptide. Optionally and preferably, the signal causes the recombinant protein to by-pass the Golgi. Preferably, the signal comprises a signal peptide for causing the recombinant protein to not be targeted to the Golgi. More preferably, the polynucleotide comprises a nucleic acid segment for encoding the signal peptide.
- the host cell is any one of a eukaryotic and a prokaryotic cell.
- the prokaryotic cell is a bacterial cell, preferably an
- the eukaryotic cell is a plant cell. More preferably, the plant cell is a plant root cell selected from the group consisting of Agrobacterium rihzogenes transformed root cell, celery cell, ginger cell, horseradish cell and carrot cell. Most preferably, the plant root cell is a carrot cell.
- the recombinant polynucleotide comprises a first nucleic acid sequence encoding the protein of interest that is in operable link with a second nucleic acid sequence encoding a vacuolar targeting signal peptide derived from the basic tobacco chitinase A gene, which vacuolar signal peptide has the amino acid sequence as denoted by SEQ ID NO: 2, wherein the first nucleic acid sequence is optionally further operably linked to a third nucleic acid sequence encoding an ER (endoplasmic reticulum) targeting signal peptide as denoted by SEQ ID NO: 1.
- the recombinant polynucleotide further comprises a promoter that is functional in plant cells, wherein the promoter is operably linked to the recombinant molecule.
- the recombinant polynucleotide further comprises a terminator that is functional in plant cells, wherein the terminator is operably linked to the recombinant molecule.
- the recombinant polynucleotide optionally further comprises additional control, promoting and regulatory elements and/or selectable markers, wherein the regulatory elements are operably linked to the recombinant molecule.
- the high mannose protein is a high mannose glycoprotein having glycosylation with at least one exposed mannose residue.
- the high mannose protein is a biologically active high mannose lysosomal enzyme selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N-acetylgalactosaminidise, acid lipase, ⁇ -galactosidase, glucocerebrosidase, ⁇ -L-iduronidase, iduronate sulfatase, ⁇ -mannosidase and sialidase
- the lysosomal enzyme is human glucocerebrosidase (GCD).
- the GCD comprises the amino acid sequence substantially as denoted by SEQ ID NO: 8, encoded by the nucleic acid sequence as denoted by SEQ ID NO: 7.
- the cell is transformed or transfected with a recombinant polynucleotide or with an expression vector comprising the molecule, which recombinant polynucleotide further comprises an 35 S promoter from Cauliflower Mosaic
- Virus an octopine synthase terminator of Agrobacterium tumefaciens
- the regulatory element is the TMV (Tobacco Mosaic Virus) omega translational enhancer element, and having the nucleic acid sequence substantially as denoted by SEQ ID NO: 13 encoding GCD having the amino acid sequence substantially as denoted by SEQ ID NOs: 14 or 15.
- TMV tobacco Mosaic Virus
- SEQ ID NOs: 13 encoding GCD having the amino acid sequence substantially as denoted by SEQ ID NOs: 14 or 15.
- the high mannose protein is a biologically active high mannose lysosomal enzyme selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N-acetylgalactosaminidise, acid lipase, ⁇ - galactosidase, glucocerebrosidase, ⁇ -L-iduronidase, iduronate sulfatase, ⁇ -mannosidase and sialidase.
- GCD glucocerebrosidase
- acid sphingomyelinase acid sphingomyelinase
- hexosaminidase hexosaminidase
- ⁇ -N-acetylgalactosaminidise acid lipase
- ⁇ - galactosidase glucocerebrosidase
- the lysosomal enzyme is human glucocerebrosidase (GCD).
- a recombinant biologically active high mannose lysosomal enzyme having at least one oligosaccharide chain comprising an exposed mannose residue.
- a recombinant protein comprising a first portion having signal peptide activity and a second portion having lysosomal enzyme activity, the first portion causing the second portion to be processed in a plant cell with at least one oligosaccharide chain comprising an exposed mannose residue.
- the lysosomal enzyme comprises a protein for the treatment or prevention of Gaucher's disease.
- the protein comprises hGCD.
- the lysosomal enzyme comprises a protein for the treatment or prevention of Fabry disease.
- the protein comprises ⁇ -galactosidase A.
- the first portion comprises a plant cell ER targeting signal peptide.
- the recombinant enzyme can bind to a mannose receptor on a target cell in a target site within a subject suffering from a lysosomal storage disease.
- the recombinant lysosomal enzyme has increased affinity for the target cell, in comparison with the corresponding affinity of a naturally occurring lysosomal enzyme for the target cell.
- the target cell can be a fibroblast, macrophage, and the like which having mannose receptors.
- the recombinant lysosomal enzyme is selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N-acetylgalactosaminidise, acid lipase, ⁇ -galactosidase, glucocerebrosidase, ⁇ -L- iduronidase, iduronate sulfatase, ⁇ -mannosidase or sialidase.
- GCD glucocerebrosidase
- acid sphingomyelinase acid sphingomyelinase
- hexosaminidase hexosaminidase
- ⁇ -N-acetylgalactosaminidise acid lipase
- ⁇ -galactosidase glucocerebrosidase
- the recombinant lysosomal enzyme is glucocerebrosidase (GCD).
- GCD glucocerebrosidase
- the target cell at the target site is a Kupffer cell in the liver of the subject.
- a recombinant high mannose protein produced in plant cell culture.
- the protein features a plant signal peptide for targeting a protein to the ER.
- the plant signal peptide comprises a peptide for targeting the protein to the ER in a root plant cell culture.
- the root plant cell culture comprises carrot cells.
- a recombinant mannose-rich hGCD or ⁇ -galactosidase A protein produced in plant cell culture.
- a plant cell culture for producing a high mannose protein.
- a method of producing a high mannose protein comprising: preparing a culture of recombinant host cells transformed or transfected with a recombinant polynucleotide encoding for a recombinant protein; culturing the host cell culture under conditions permitting the expression of the protein, wherein the host cells produce the protein in a highly mannosylated form.
- the host cell culture is cultured in suspension. More preferably, the method further comprises purifying the protein.
- the method is performed with the host cell as previously described.
- the high mannose protein is a biologically active high mannose lysosomal enzyme having at least one oligosaccharide chain comprising an exposed mannose residue.
- the recombinant enzyme binds to a mannose receptor on a target cell in a target site.
- the recombinant enzyme has increased affinity for the target cell, in comparison with the corresponding affinity of a naturally occurring lysosomal enzyme to the target cell.
- the lysosomal enzyme is selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N- acetylgalactosaminidise, acid lipase, ⁇ -galactosidase, glucocerebrosidase, ⁇ -L- iduronidase, iduronate sulfatase, ⁇ -mannosidase and sialidase.
- GCD glucocerebrosidase
- acid sphingomyelinase acid sphingomyelinase
- hexosaminidase hexosaminidase
- ⁇ -N- acetylgalactosaminidise acid lipase
- ⁇ -galactosidase glucocerebrosidase
- the lysosomal enzyme is glucocerebrosidase (GCD) or ⁇ - galactosidase A.
- GCD glucocerebrosidase
- ⁇ - galactosidase A glucocerebrosidase
- the target cell at the target site is a fibroblast or a Kupffer cell in the liver of the subject.
- the host cell is a plant root cell selected from the group consisting of
- the host cell is a tobacco cell. More preferably, the plant root cell is a carrot cell.
- the transformed host carrot cells are grown in suspension.
- a method for treating a subject having lysosomal storage disease using exogenous recombinant lysosomal enzyme comprising: providing a recombinant biologically active form of lysosomal enzyme purified from transformed plant root cells, and capable of efficiently targeting cells abnormally deficient in the lysosomal enzyme, wherein the recombinant biologically active enzyme has exposed terminal mannose residues on appended oligosaccharides; and administering a therapeutically effective amount of the recombinant biologically active lysosomal enzyme to the subject.
- This method may optionally be performed with any host cell and/or protein as previous described.
- the recombinant enzyme can bind to a mannose receptor on a target cell in a target site within a subject. More preferably, the recombinant lysosomal enzyme has increased affinity for the target cell, in comparison with the corresponding affinity of a naturally occurring lysosomal enzyme to the target cell. Most preferably, the lysosomal enzyme is selected from the group consisting of glucocerebrosidase
- GCD glucocerebrosidase
- the lysosomal storage disease is Gaucher's disease.
- the target cell at the target site is a Kupffer cell in the liver of the subject.
- the storage disease is Fabry's disease
- the lysosomal enzyme is ⁇ -galactosidase A
- the target cell is a fibroblast.
- a pharmaceutical composition for the treatment of a lysosomal storage disease comprising as an active ingredient a recombinant biologically active high mannose lysosomal enzyme as described above, which composition optionally further comprises pharmaceutically acceptable dilluent, carrier or excipient.
- the lysosomal storage disease is Gaucher's disease.
- the recombinant lysosomal enzyme is a biologically active high mannose human glucocerebrosidase (GCD).
- a recombinant biologically active mannose-rich lysosomal enzyme as described above, in the manufacture of a medicament for the treatment or prevention of a lysosomal storage disease.
- the disease is Gaucher's disease.
- the biologically active lysososomal enzyme is a biologically active high mannose human glucocerebrosidase (GCD).
- the disease is Fabry's disease and the biologically active lysosomal enzyme is ⁇ -galactosidase A.
- IA shows the resulting expression cassette comprising 35 S promoter from
- Cauliflower Mosaic Virus TMV (Tobacco Mosaic Virus) omega translational enhancer element, ER targeting signal, the human GCD sequence (also denoted by SEQ ID NO: 7), vacuolar signal and octopine synthase terminator sequence from Agrobacterium twnefaciens.
- IB shows a schematic map of pGreenll plasmid backbone.
- Figure 2 shows Western blot analysis of hGCD transformed cell extracts using anti hGCD specific antibody.
- Standard Cerezyme (lane 1) was used as a positive control, untransformed callus was used as negative control (lane 2), various selected calli extracts are shown in lanes 3-8.
- Figure 3A-3C shows the first step of purification of rhGCD on a strong cation exchange resin (Macro-Prep high-S support, Bio-Rad), packed in a XK column
- the column was integrated with an AKTA prime system (Amersham Pharmacia Biotech) that allows conductivity monitoring, pH and absorbency at 280nm.
- Fig 3 A represents a standard run of this purification step.
- the fractions collected during the run were monitored by enzyme activity assay, as shown by Fig 3B, and tubes exhibiting enzymatic activity (in the elution peak) were pooled.
- Fig 3 C shows coomassie-blue stain of elution fractions assayed for activity.
- Figures 3D-3F show corresponding graphs as for figures 3A-3C but for the second column.
- Figure 4A-C shows the final purification step of the recombinant hGCD on a hydrophobic interaction resin (TSK gel, Toyopearl Phenyl-650C, Tosoh Corp.), packed in a XK column (2.6x20cm).
- TSK gel Toyopearl Phenyl-650C, Tosoh Corp.
- XK column 2.6x20cm
- the column was integrated with an AKTA prime system (Amersham Pharmacia Biotech) that allows conductivity monitoring, pH and absorbency at 280nm.
- the GCD elution pool from the previous column was loaded at 6ml/min followed by washing with equilibration buffer until the UV absorbance reach the baseline.
- the pure GCD was eluted by 1OmM citric buffer containing 50% ethanol.
- Fig 4 A represents a standard run of this purification step.
- Fig 4B shows the fractions collected during the run that were monitored by enzyme activity assay.
- Fig 4C shows coomassie-blue stain of elution fractions assayed for activity.
- Figure 5 shows activity of recombinant hGCD following uptake by peritoneal macrophages ( Figures 5A-5C), while Figure 5D shows a Western blot of recombinant GCD according to the present invention.
- Figure 6 shows comparative glycosylation structures for rGCD according to the present invention and that of CerezymeTM.
- Figure 7 shows glycosylation structures for rGCD according to the present invention.
- Figure 8a-8d shows additional N-glycan glycosylation structures for rGCD according to the present invention.
- Figures 9a-9b show the antigenic and electrophoretic identity of purified recombinant human GCD of the present invention and a commercial human GCD (Cerezyme ®) recombinantly produced in mammalian CHO cells.
- Fig. 9a is a Coomassie blue stained SDS-PAGE analysis of the plant produced hGCD of the invention (lanes 1 and 2, 5 and 10 ⁇ g of protein, respectively) and Cerezyme®, (lanes 3 and 4, 5 and 10 ⁇ g protein, respectively).
- Fig. 9b is a Western blot analysis of SDS- PAGE separated recombinant human GCD (lanes 1 and 2, 50 and 10 ng respectively) of the present invention compared to the commercial Cerezyme ® enzyme.
- FIG. 10a shows the results of a major glycan structure analysis of the GCD, indicating all structures and their relative amounts based on HPLC, enzyme array digests and MALDI. Retention time of individual glycans is compared to the retention times of a standard partial hydrolysis of dextran giving a ladder of glucose units (GU).
- Fig. 10b shows the glycan structures of the mammalian-cell (CHO) prepared enzyme (Cerezyme®), before and after the in-vitro modification process. Note the predominance of the xylose and exposed mannose glycosides in the recombinant human GCD of the present invention;
- Figure 11 is a HP-anion exchange chromatography analysis of the gycan profile of the recombinant human GCD of the present invention, showing the consistent and reproducible glycan structure of recombinant human GCD from batch to batch;
- Figure 12 is a kinetic analysis showing the identical catalytic kinetics characteristic of both recombinant human GCD of the invention (open triangles) and the mammalian-cell (CHO) prepared enzyme (Cerezyme®) (closed squares).
- Recombinant human GCD of the invention and Cerezyme® (0.2 ⁇ g) were assayed using C6- NBDGlcCer (5 min, 37 0 C) in MES buffer (50 mM, pH 5.5).
- Michaelis-Menten kinetics was analyzed using GraphPad Prism software. Data are means of two independent experiments;
- Figures 13A and 13B are plots of the results of Molecular Weight analysis of human recombinant ⁇ -galactosidase A expressed in tobacco plants.
- Figure 13 A shows molecular weight as determined by gel filtration as described herein.
- Figure 13B shows molecular weight as determined by mass spectrometry (MALDI-Tof). Note the prominent peak (on MS) at 48.6 kDa, corresponding to the MW of native human ⁇ - galactosidase A;
- Figures 14A and 14B are a PAGE analysis and amino acid sequence of human recombinant ⁇ -galactosidase A expressed in tobacco plants.
- Figure 14A shows two distinct bands of human recombinant ⁇ -galactosidase A, corresponding to 62 kDa and 47.6 kDa, resolved in the PAGE.
- Figure 14B shows the amino acid sequence derived from each of the two bands (labeled "Upper band” and "Lower band”). The portion of the polypeptides available for sequencing in each band is indicated in red. Regions unable to provide sequence data (possibly masked by glycan structures) are indicated in black. Note the complete agreement of sequenced regions between upper and lower bands, indicating identical polypeptides with possible distinctions in glycan structure;
- Figure 15 is photograph of a Western blot showing immunoreactivity of human recombinant ⁇ -galactosidase A expressed in tobacco plants.
- Protein extracted from tobacco plants expressing either the human ⁇ -galactosidase A targeted to the vacuole ( ⁇ - gal-vac, lane "vac") or human ⁇ -galactosidase with ER retention signal ( ⁇ -gal-KDEL, lane "ICDEL”) was separated on PAGE, blotted onto nitrocellulose, and reacted with anti- ⁇ -galactosidase A antibody (against amino acids 326-429 of human ⁇ - galactosidase), and visualized with HRP second antibody.
- Figures 16A and 16B are graphs representing kinetic analysis of catalytic properties of human recombinant ⁇ -galactosidase expressed in plants.
- Figure 16A is a Michaelis-Menten plot comparing plant expressed human recombinant ⁇ -galactosidase A and commercially available recombinant ⁇ -galactosidase A preparations.
- Figure 16B is a Lineweaver-Burke plot of the enzyme kinetics derived from Figure 16 A, showing Km and Vmax (detailed in table inset).
- Green indicates plant-expressed human recombinant ⁇ -galactosidase; black indicates Fabrazyme and blue indicates Replagal. Note the close correspondence in enzyme kinetics between plant-expressed human recombinant ⁇ -galactosidase and the commercially available preparations;
- FIGS 17A and 17B are photographs of SDS-PAGE showing the stability of human recombinant ⁇ -galactosidase expressed in plants in a range of temperatures.
- Human recombinant ⁇ -galactosidase expressed in plants Plant a-Gal
- commercial human recombinant ⁇ -galactosidase Repplagal
- Figure 17A activity buffer
- Figure 17B cell media
- Figure 18 is a photograph of Western blot analysis of fibroblast cell lysate showing uptake and retention of plant-expressed human recombinant ⁇ -galactosidase in Fabry fibroblasts.
- Lanes "Plant ⁇ GalA” are fibroblast lysate from human Fabry ( ⁇ - galactosidase-deficient) fibroblasts incubated with plant expressed human recombinant ⁇ -galactosidase for 2 hours, washed and lysed. Rightmost lane is Fabrazyme®, inbetween are molecular weight ladders;
- Figure 19 is a plot of NP-HPLC profile showing peaks of characteristic glycan structures, and the schematics of the glycans themselves.
- Proteins for pharmaceutical use have been traditionally produced in mammalian or bacterial expression systems. In the past few years a promising new expression system was found in plants. Due to the relative simplicity of introducing new genes and potential for mass production of proteins and peptides, 'molecular pharming 1 is becoming increasingly popular as a protein expression system.
- Carbohydrate moiety is one of the most common post-translational modifications of proteins. Protein glycosylation is divided into two categories: N-linked and O-linked. The two types differ in amino acid to which the glycan moity is attached on protein - N-linked are attached to Asn residues, while O-linked are attached to Ser or Thr residues. In addition, the glycan sequences of each type bears unique distinguishing features. Of the two types, N-linked glycosylation is the more abundant, and its effect on proteins has been extensively studied. O-linked glycans, on other hand are relatively scarce, and less information is available regarding their influence on proteins. The majority of data available on protein glycosylation in plants focuses on N-linked, rather than O-linked glycans.
- the present invention describes herein a plant expression system based on transgenic plant cells, which are preferably root cells, optionally and preferably grown in suspension.
- This expression system is particularly designed for efficient production of a high mannose protein of interest.
- high mannose includes glycosylation having at least one exposed mannose residue.
- the present invention relates to a host cell producing a high mannose recombinant protein of interest.
- the recombinant protein features an ER (endoplasmic reticulum) signal peptide, more preferably an ER targeting signal peptide.
- the recombinant protein features a signal that causes the protein to by-pass the Golgi.
- the signal preferably enables the recombinant protein to feature high mannose glycosylation, more preferably by retaining such glycosylation, and most preferably by targeting the ER and/or by bypassing the Golgi.
- such a signal is preferably implemented as a signal peptide, which more preferably forms part of the protein sequence, optionally and more preferably through engineering the protein to also feature the signal peptide as part of the protein.
- the signal may optionally be a targeting signal, a retention signal, an avoidance (by-pass) signal, or any combination thereof, or any other type of signal capable of providing the desired high mannose glycosylation structure.
- ER targeting signal peptides are well known in the art; they are N-terminal signal peptides.
- any suitable ER targeting signal peptide may be used with the present invention.
- a host cell according to the present invention may optionally be transformed or transfected (permanently and/or transiently) with a recombinant nucleic acid molecule encoding a protein of interest or with an expression vector comprising the nucleic acid molecule.
- Such nucleic acid molecule comprises a first nucleic acid sequence encoding the protein of interest, optionally and preferably operably linked to a second nucleic acid sequence encoding a vacuolar targeting signal peptide. It should be noted that as used herein, the term "operably” linked does not necessarily refer to physical linkage.
- the first nucleic acid sequence may optionally and preferably further be operably linked to a third nucleic acid sequence encoding an ER (endoplasmic reticulum) targeting signal peptide.
- the cell of the invention is characterized in that the protein of interest is produced by the cell in a form that includes at least one exposed mannose residue, but is preferably a highly mannosylated form.
- the cell of the protein of interest is produced by the cell in a form that includes an exposed mannose and at least one xylose residue, in yet a more preferred embodiment, in a form that further includes an exposed mannose and at least one fucose residue.
- the protein is produced by the cell in a form that includes an exposed mannose, a core ⁇ (1,2) xylose residue and a core ⁇ -(l,3) fucose residue.
- Cells “host cells” or “recombinant host cells” are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cells but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generation due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
- Cell or “host cell” as used herein refers to cells which can be transformed with naked DNA or expression vectors constructed using recombinant DNA techniques.
- the term “transfection” means the introduction of a nucleic acid, e.g., naked DNA or an expression vector, into a recipient cells by nucleic acid-mediated gene transfer.
- Transformation refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA, and, for example, the transformed cell expresses a recombinant form of the desired protein.
- a drug resistance or other selectable marker is intended in part to facilitate the selection of the transformants.
- the presence of a selectable marker, such as drug resistance marker may be of use in keeping contaminating microorganisms from multiplying in the culture medium. Such a pure culture of the transformed host cell would be obtained by culturing the cells under conditions which are required for the induced phenotype's survival.
- nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA).
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- the terms should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides.
- the cell of the invention may be transfected or transformed with an expression vector comprising the recombinant nucleic acid molecule.
- “Expression Vectors”, as used herein, encompass vectors such as plasmids, viruses, bacteriophage, integratable DNA fragments, and other vehicles, which enable the integration of DNA fragments into the genome of the host.
- Expression vectors are typically self-replicating DNA or RNA constructs containing the desired gene or its fragments, and operably linked genetic control elements that are recognized in a suitable host cell and effect expression of the desired genes. These control elements are capable of effecting expression within a suitable host.
- the genetic control elements can include a prokaryotic promoter system or a eukaryotic promoter expression control system.
- Such system typically includes a transcriptional promoter, an optional operator to control the onset of transcription, transcription enhancers to elevate the level of RNA expression, a sequence that encodes a suitable ribosome binding site, RNA splice junctions, sequences that terminate transcription and translation and so forth.
- Expression vectors usually contain an origin of replication that allows the vector to replicate independently of the host cell.
- Plasmids are the most commonly used form of vector but other forms of vectors which serves an equivalent function and which are, or become, known in the art are suitable for use herein. See, e.g., Pouwels et al. Cloning Vectors: a Laboratory Manual (1985 and supplements), Elsevier, N. Y.; and Rodriquez, et al. (eds.) Vectors: a Survey of Molecular Cloning Vectors and their Uses, Buttersworth, Boston, Mass (1988), which are incorporated herein by reference.
- such vectors contain, in addition, specific genes which are capable of providing phenotypic selection in transformed cells.
- the use of prokaryotic and eukaryotic viral expression vectors to express the genes coding for the polypeptides of the present invention are also contemplated.
- the vector may be a general plant vector (as described with regard to the Examples below).
- the vector may optionally be specific for root cells.
- the cell of the invention may be a eukaryotic or prokaryotic cell.
- the cell of the invention is a prokaryotic cell, preferably, a bacterial cell, most preferably, an Agrobacterium tumefaciens cell. These cells are used for infecting the preferred plant host cells described below.
- the cell of the invention may be a eukaryotic cell, preferably, a plant cell, and most preferably, a plant root cell selected from the group consisting of Agrobacterium ⁇ hzogenes transformed plant root cell, celery cell, ginger cell, horseradish cell and carrot cell.
- the plant root cell is a carrot cell. It should be noted that the transformed carrot cells of the invention are grown in suspension. As mentioned above and described in the Examples, these cells were transformed with the Agrobacterium tumefaciens cells of the inventioa
- the expression vectors or recombinant nucleic acid molecules used for transfecting or transforming the host cells of the invention may be further modified according to methods known to those skilled in the art to add, remove, or otherwise modify peptide signal sequences to alter signal peptide cleavage or to increase or change the targeting of the expressed lysosomal enzyme through the plant endomembrane system.
- the expression construct can be specifically engineered to target the lysosomal enzyme for secretion, or vacuolar localization, or retention in the endoplasmic reticulum (ER).
- the expression vector or recombinant nucleic acid molecule can be engineered to incorporate a nucleotide sequence that encodes a signal targeting the lysosomal enzyme to the plant vacuole.
- the recombinant nucleic acid molecule comprised within the host cell of the invention comprises a first nucleic acid sequence encoding a lysosomal enzyme that is in operable linkage with a second nucleic acid sequence encoding a vacuolar targeting signal peptide derived from the basic tobacco chitinase A gene.
- This vacuolar signal peptide has the amino acid sequence as denoted by SEQ ID NO: 2.
- the first nucleic acid sequence may be optionally further linked in an operable linkage with a third nucleic acid sequence encoding an ER (endoplasmic reticulum) targeting signal peptide as denoted by SEQ ID NO: 1.
- the recombinant nucleic acid molecule comprised within the host cell of the invention further comprises a promoter that is functional in plant cells. This promoter should be operably linked to the recombinant molecule of the invention.
- operably linked is used herein for indicating that a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
- operably linked DNA sequences are contiguous (e.g. physically linked) and, where necessary to join two protein-coding regions, in the same reading frame.
- a DNA sequence and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s).
- this recombinant nucleic acid molecule may optionally further comprise an operably linked terminator which is preferably functional in plant cells.
- the recombinant nucleic acid molecule of the invention may optionally further comprise additional control, promoting and regulatory elements and/or selectable markers. It should be noted that these regulatory elements are operably linked to the recombinant molecule.
- Regulatory elements that may be used in the expression constructs include promoters which may be either heterologous or homologous to the plant cell.
- the promoter may be a plant promoter or a non-plant promoter which is capable of driving high levels transcription of a linked sequence in plant cells and plants.
- Non-limiting examples of plant promoters that may be used effectively in practicing the invention include cauliflower mosaic virus (CaMV) 35 S, rbcS, the promoter for the chlorophyll a/b binding protein, Adhl, NOS and HMG2, or modifications or derivatives thereof.
- the promoter may be either constitutive or inducible.
- an inducible promoter can be a promoter that promotes expression or increased expression of the lysosomal enzyme nucleotide sequence after mechanical gene activation (MGA) of the plant, plant tissue or plant cell.
- MAA mechanical gene activation
- the expression vectors used for transfecting or transforming the host cells of the invention can be additionally modified according to methods known to those skilled in the art to enhance or optimize heterologous gene expression in plants and plant cells.
- Such modifications include but are not limited to mutating DNA regulatory elements to increase promoter strength or to alter the protein of interest.
- the high mannose protein of interest produced by the host cell of the invention may be a mannose-rich glycoprotein having at least one exposed mannose residue (at least one terminal mannose residue).
- the glycoprotein of the invention has most (greater than 75%) of the mannose residues are terminal, exposed mannose residues.
- Such high mannose protein may be according to another preferred embodiment, a lysosomal enzyme selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N-acetylgalactosaminidise, acid lipase, ⁇ - galactosidase, glucocerebrosidase, ⁇ -L-iduronidase, iduronate sulfatase, ⁇ -mannosidase and sialidase
- GCD glucocerebrosidase
- acid sphingomyelinase acid sphingomyelinase
- hexosaminidase hexosaminidase
- ⁇ -N-acetylgalactosaminidise acid lipase
- ⁇ - galactosidase glucocerebrosidase
- lysosomal enzyme refers to a recombinant peptide expressed in a transgenic plant cell from a nucleotide sequence encoding a human or animal lysosomal enzyme, a modified human or animal lysosomal enzyme, or a fragment, derivative or modification of such enzyme.
- Useful modified human or animal lysosomal enzymes include but are not limited to human or animal lysosomal enzymes having one or several naturally occurring or artificially introduced amino acid additions, deletions and/or substitutions.
- Soluble lysosomal enzymes share initial steps of biosynthesis with secretory proteins, i.e., synthesis on the ribosome, binding of the N-terminal signal peptide to the surface of the rough endoplasmic reticulum (ER), transport into the lumen of the ER where the signal peptide is cleaved, and addition of oligosaccharides to specific asparagine residues (N-linked), followed by further modifications of the nascent protein in the Golgi apparatus [von Figura and Hasilik, Annu. Rev. Biochem. 55:167-193
- the N-linked oligosaccharides can be complex, diverse and heterogeneous, and may contain high-mannose residues.
- the proteins undergo further processing in a post- ER, pre-Golgi compartment and in the cis-Golgi to form either an N-linked mannose 6- phosphate (M-6-P) oligosaccharide-dependent or N-linked M-6-P oligosaccharide- independent recognition signal for lysosomal localized enzymes [Kornfeld & Mellman, Ann. Rev. Cell Biol., 5:483-525 (1989); Kaplan et al., Proc. Natl. Acad. Sci. USA 74:2026 (1977)].
- M-6-P mannose 6- phosphate
- the lysosomal enzyme may be the human glucocerebrosidase (GCD) or human ⁇ -galactosidase A.
- this preferred host cell is transformed or transfected by a recombinant nucleic acid molecule which further comprises an 35 S promoter from Cauliflower Mosaic Virus, preferably, having the nucleic acid sequence as denoted by SEQ ID NO: 9, an octopine synthase terminator of Agrobacterium tumefaciens, preferably, having the nucleic acid sequence as denoted by SEQ ID NO: 12 and TMV (Tobacco Mosaic Virus) omega translational enhancer element.
- a recombinant nucleic acid molecule which further comprises an 35 S promoter from Cauliflower Mosaic Virus, preferably, having the nucleic acid sequence as denoted by SEQ ID NO: 9, an octopine synthase terminator of Agrobacterium tumefaciens, preferably, having the nucleic acid sequence as denoted by SEQ ID NO: 12 and TMV (Tobacco Mosaic Virus) omega translational enhancer element.
- this recombinant nucleic acid molecule comprises the nucleic acid sequence substantially as denoted by SEQ ID NO: 13 and encodes a high mannose GCD having the amino acid sequence substantially as denoted by SEQ ID NOs: 14 or 15.
- the present invention further provides for an expression vector comprising a nucleic acid molecule encoding a biologically active high mannose lysosomal enzyme.
- the expression vector of the invention comprises a nucleic acid molecule encoding a biologically active high mannose human glucocerebrosidase (GCD).
- GCD biologically active high mannose human glucocerebrosidase
- this preferred expression vector comprises a recombinant nucleic acid molecule which having the nucleic acid sequence substantially as denoted by SEQ ID NO: 13.
- a preferred expression vector utilizes the pGREEN II plasmid as described by the following Example 1.
- the expression vector comprises a nucleic acid molecule encoding a biologically active high mannose human ⁇ -galactosidase ( ⁇ -gal-A).
- this preferred expression vector comprises a recombinant nucleic acid molecule which having the nucleic acid sequence substantially as denoted by SEQ ID NO: 17 or 19.
- a preferred expression vector utilizes the pICH19170 plasmid as described by the following Example 5 a.
- the invention provides for an expression cassette comprised within the expression vector described above.
- the present invention relates to a recombinant high mannose protein produced by the host cell of the invention.
- this high mannose protein may be a biologically active high mannose lysosomal enzyme selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N- acetylgalactosaminidise, acid lipase, ⁇ -galactosidase, glucocerebrosidase, ⁇ -L- iduronidase, iduronate sulfatase, ⁇ -mannosidase and sialidase.
- this lysosomal enzyme may be human glucocerebrosidase (GCD).
- biologically active is used herein with respect to any recombinant lysosomal enzyme produced in a plant expression system to mean that the recombinant lysosomal enzyme is able to hydrolyze either the natural substrate, or an analogue or synthetic substrate of the corresponding human or animal lysosomal enzyme, at detectable levels.
- the invention provides for a recombinant biologically active mannose-rich lysosomal enzyme having at least one oligosaccharide chain comprising an exposed mannose residue.
- the recombinant lysosomal enzyme of the invention can bind to a mannose receptor on a target cell in a target site.
- this site may be within a subject suffering from a lysosomal storage disease.
- the recombinant lysosomal enzyme has increased affinity for the target cell, in comparison with the corresponding affinity of a naturally occurring lysosomal enzyme for the target cell.
- the target cell at the target site may be a Kupffer cell in the liver of the subject.
- the recombinant lysosomal enzyme may be selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N-acetylgalactosaminidise, acid lipase, ⁇ -galactosidase, glucocerebrosidase, ⁇ -L-iduronidase, iduronate sulfatase, ⁇ -mannosidase or sialidase.
- GCD glucocerebrosidase
- acid sphingomyelinase acid sphingomyelinase
- hexosaminidase hexosaminidase
- ⁇ -N-acetylgalactosaminidise acid lipase
- ⁇ -galactosidase glucocerebrosidase
- this recombinant lysosomal enzyme is glucocerebrosidase (GCD) or ⁇ -galactosidase A.
- GCD glucocerebrosidase
- ⁇ -galactosidase A ⁇ -galactosidase A
- the method of the invention comprises the steps of: (a) preparing a culture of recombinant host cells transformed or transfected with a recombinant nucleic acid molecules encoding for a recombinant protein of interest or with an expression vector comprising the recombinant nucleic acid molecules; (b) culturing the host cell culture prepared by step (a) in suspension under conditions permitting the expression of the high mannose protein, wherein the host cells produce the protein in a highly mannosylated form; (c) harvesting the cells from the culture provided in (a) and recovering the protein from the cells; and (d) purifying the protein of step (c) by a suitable prote . in purification method.
- the recombinant protein may be produced by plant cells according to the present invention by culturing in a device described with regard to US Patent No. 6,391,638, issued on May 21 2002 and hereby incorporated by reference as if fully set forth herein. Conditions for culturing plant cells in suspension with this device are described with regard to the US patent application entitled "CELL/TISSUE CULTURING DEVICE, SYSTEM AND METHOD" by one of the present inventors and owned in common with the present application, which is hereby incorporated by reference as if fully set forth herein and which was filed on the same day as the present application.
- the recombinant protein can be expressed in a whole plant, or a part thereof.
- the method of the invention comprises the steps of: (a) transforming or transfecting a plant or plant cells with a recombinant nucleic acid molecules encoding for a recombinant protein of interest or with an expression vector comprising the recombinant nucleic acid molecules; (b) growing the transformed or transfected plant or cells prepared by step (a) under conditions permitting the expression of the mannose-rich protein, wherein the plant cells produce the protein in mannosylated form having exposed and terminal mannose residues; (c) harvesting the plants or tissues from the plant or plant tissues provided in (a) and recovering the protein from the cells; and (d) purifying the protein of step (c) by a suitable protein purification method.
- transformation of the plants with the vector is stable transformation, and step (b) is followed by selection of plants expressing the recombinant protein of interest, and propagation of the selected transgenic plants, before harvesting and recovering the recombinant protein.
- Transforming plants or plant tissues including, but not limited to callus, immature embryo, pollen, seed, shoot apex parts in culture as well as in planta
- recombinant expression vectors for constitutive or conditional expression of desired mammalian polypeptide, is well known in the art, for example, using a binary plasmid for A. tumefaciens- mediated transformation of tobacco plants (as described in US Patent No: 5,763,748), using an co-integrated vector, or using a mobilization vector.
- a particular and non limiting example for recovering and purification of a high mannose protein of interest produced by the method of the invention may be found in the following Examples.
- the Examples show that a recombinant h-GCD produced by the invention was unexpectedly bound to internal membrane of the transformed carrot cells of the invention and not secreted to the medium.
- the soluble rh-GCD may be separated from cell debris and other insoluble component according to means known in the art such as filtration or precipitation.
- the cells undergo breakage and release of intracellular soluble proteins, whereas the h- GCD remains bound to insoluble membrane debris. This soluble and insoluble membrane debris mixture was next centrifuged and the soluble fraction was removed thus simplifying the purification.
- the membrane bound h-GCD can then be dissolved by mechanical disruption in the presence of a mild detergent, protease inhibitors and neutralizing oxidation reagent.
- the soluble enzyme may be further purified using chromatography techniques, such as cation exchange and hydrophobic interaction chromatography columns.
- chromatography techniques such as cation exchange and hydrophobic interaction chromatography columns.
- the h-GCD identity, yield, purity and enzyme activity can be determined by one or more biochemical assays. Including but not limited to detecting hydrolysis of the enzyme's substrate or a substrate analogue, SDS-polyacrylamide gel electrophoresis analysis and immunological analyses such as ELISA and Western blot.
- Yield, purity, enzyme activity, antigenic character, biological activity and glycan profile of recombinant proteins expressed in whole plants and plant tissues can be assessed by one or more biochemical assays, including but not limited to detecting hydrolysis of the enzyme's substrate or a substrate analogue, SDS-polyacrylamide gel electrophoresis analysis, immunological analyses such as ELISA and Western blot, glycan analysis by glycosidase enzymes and chromatography.
- the host cell used by this method comprises the host cell of the invention.
- the high mannose protein produced by the method of the invention may be a biologically active high mannose lysosomal enzyme having at least one oligosaccharide chain comprising an exposed mannose residue.
- This recombinant enzyme can bind to a mannose receptor on a target cell in a target site. More particularly, the recombinant enzyme produced by the method of the invention has increased affinity for the target cell, in comparison with the corresponding affinity of a naturally occurring lysosomal enzyme to the target cell. Accordingly, the target cell at the target site may be Kupffer cell in the liver of the subject.
- this lysosomal enzyme may be selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N-acetylgalactosaminidise, acid lipase, ⁇ -galactosidase, glucocerebrosidase, ⁇ -L- iduronidase, iduronate sulfatase, ⁇ -mannosidase and sialidase. Most preferably, this lysosomal enzyme may be glucocerebrosidase (GCD).
- GCD glucocerebrosidase
- the host cell used by the method of the invention may be a plant root cell selected from the group consisting of Agrobacterium rihzogenes transformed root cell, celery cell, ginger cell, horseradish cell and carrot cell. Most preferably, the plant root cell is a carrot cell. It should be particularly noted that the transformed host carrot cells are grown in suspension.
- the present invention relates to a method for treating a subject, preferably a mammalian subject, having lysosomal storage disease by using exogenous recombinant lysosomal enzyme.
- Plasmid CE was digested with Sail.
- the Sail cohesive end was made blunt-ended using the large fragment of DNA polymerase I. Then the plasmid was digested with Pstl and ligated to a DNA fragment coding for the ER targeting signal from the basic endochitinase gene [ Arabidopsis thaliana ] ATGAAGACTAATCTTTTTCTCTTTCTCATCTTTTCA CTTCTCCTATCATTATCCTCGGCCGAATTC, and vacuolar targeting signal from Tobacco chitinase A: GATCTTTTAGTCGATACTATG digested with Smal and PstI.
- Expression from the pGREEN II vector is controlled by the 35S promoter from Cauliflower Mosaic Virus, the TMV (Tobacco Mosaic Virus) omega translational enhancer element and the octopine synthase terminator sequence from Agrobacterium tumefaciens.
- cDNA hGCD - obtained from ATCC (Accession No. 65696), GC-2.2 [GCS-2kb; lambda-EZZ-gamma3 Homo sapiens] containing glucosidase beta acid [glucocerebrosidase]. Insert lengths (kb): 2.20; Tissue: fibroblast WI-38 cell.
- the cDNA coding for hGCD (ATTC clone number 65696) was amplified using the forward: 5' CAGAATTCGCCCGCCCCTGCA 3' and the reverse: 5'
- CTCAGATCTTGGCGATGCCACA 3' primers The purified PCR DNA product was digested with endonucleases EcoRI and BgIII (see recognition sequences underlined in the primers) and ligated into an intermediate vector having an expression cassette E-T digested with the same enzymes.
- the expression cassette was cut and eluted from the intermediate vector and ligated into the binary vector pGREENII using restriction enzymes Smal and Xbal, forming the final expression vector. Kanamycine resistance is conferred by the NPTII gene driven by the nos promoter obtained together with the pGREEN vector (Fig. IB).
- the resulting expression cassette is presented by Fig. IA.
- the resulting plasmid was sequenced to ensure correct in-frame fusion of the signals using the following sequencing primers: 5' 35S promoter: 5' CTCAGAAGACCAGAGGGC 3', and the 3' terminator: 5' CAAAGCGGCCATCGTGC 3'.
- Transformation of carrot cells was preformed using Agrobacterium transformation by an adaptation of a method described previously [Wurtele, E.S. and Bulka, K. Plant Sci. 61 :253-262 (1989)]. Cells growing in liquid media were used throughout the process instead of calli. Incubation and growth times were adapted for transformation of cells in liquid culture. Briefly, Agrobacteria were transformed with the pGREEN II vector by electroporation [den DuIk-Ra, A. and Hooykaas, PJ. (1995) Methods MoI. Biol. 55:63-72] and then selected using 30 mg/ml paromomycine antibiotic. Carrot cells were transformed with Agrobacteria and selected using 60 mg/ml of paromomycine antibiotics in liquid media.
- 7755 mmiiccrrooggrraammss rreeccoommbbiinnaanntt GCD (CerezymeTM) were suspended in 3 ml complete Freund's adjuvant and injected to each of two rabbits. Each rabbit was given a booster injection after two weeks. The rabbits were bled about 10 days after the booster injection and again at one week intervals until the antibody titer began to drop. After removal of the clot the serum was divided into aliquots and stored at -2O 0 C.
- Suspension cell culture was prepared by sub-culturing the transformed callus in a MSD liquid medium (Murashige & Skoog (1962) containing 0.2 mg/1 2,4- dicloroacetic acid), as is well known in the art.
- the suspension cells were cultivated in 250ml Erlenmeyer flask (working volume starts with 25ml and after 7 days increases to 50ml) at 25 0 C with shaking speed of 60rpm. Subsequently, cell culture volume was increased to IL Erlenmeyer by addition of working volume up to 300ml under the same conditions.
- Inoculum of the small bio-reactor (10L) [see WO98/13469] containing 4L MSD medium was obtained by addition of 400ml suspension cells derived from two IL Erlenmeyer that were cultivated for seven days. After week of cultivation at 25°C with lLpm airflow, MDS medium was added up to 1OL and the cultivation continued under the same conditions. After additional five days of cultivation, most of the cells were harvested and collected by passing the cell media through 80 ⁇ net. The extra medium was squeezed out and the packed cell cake was store at -70 0 C. Further details of the bioreactor device may be found with regard to US Patent
- frozen cell cake containing about lOOg wet weight cells was thawed, followed by centrifugation of the thawed cells at 17000xg for 20min at 4 0 C.
- the insoluble materials and intact cells were washed by re-suspension in 100ml washing buffer (2OmM sodium phosphate pH 7.2, 2OmM EDTA), and then precipitated by centrifugation at 1700Og for 20min at 4 0 C.
- the rh-GCD (recombinant human GCD) was extracted and solubilized by homogenization of the pellet in 200ml extraction buffer (2OmM sodium phosphate pH 7.2, 2OmM EDTA, ImM PMSF, 2OmM ascorbic acid, 3.8g polyvinylpolypyrrolidone (PVPP), ImM DTT and 1% Triton-x-100).
- the homogenate was then shaken for 30min at room temperature and clarified by centrifugation at 17000xg for 20min at 4 0 C.
- the pellet was discarded and the pH of the supernatant was adjusted to pH 5.5 by addition of concentrated citric acid. Turbidity generated after pH adjustment was clarified by centrifugation under the same conditions described above.
- Pre-elution of the rh- GCD was performed with equilibration buffer containing 20OmM NaCl and the elution was obtained with equilibration buffer containing 60OmM NaCl. Fractions collected during the run were monitored by enzyme activity assay, and tubes exhibiting enzymatic activity (in the elution peak) were pooled. Pooled samples were diluted (1:5) in water containing 5% ethanol and pH adjusted to 6.0 with NaOH. Sample containing the rh-GCD was applied on the second XK column (1.6x20cm) packed with 10ml of the same resin as in the previous column. The resin in this column was equilibrate with 2OmM citrate buffer pH 6.0 containing 5% ethanol.
- the column was washed with the equilibration buffer and the GCD was eluted from the column by elution buffer (2OmM citrate buffer pH 6.0, 5% ethanol and IM NaCl).
- elution buffer 2OmM citrate buffer pH 6.0, 5% ethanol and IM NaCl.
- the fractions of the absorbent peak in the elution step were pooled and applied on a third column.
- the final purification step was performed on a XK column (1.6x20cm) packed with 8ml hydrophobic interaction resin (TSK gel, Toyopearl Phenyl-650C, Tosoh Corp.). The resin was equilibrated in 1OmM citrate buffer pH 6.0 containing 5% ethanol.
- the GCD elution pool from the previous column was loaded at 6ml/min followed by washing with equilibration buffer until the UV absorbent reach the baseline.
- the pure GCD was eluted by 1OmM citric buffer containing 50% ethanol, pooled and stored at -20 0 C. Determination of protein concentration
- Enzymatic activity of GCD was determined using p-nitrophenyl- ⁇ -D- glucopyranoside (Sigma) as a substrate.
- Assay was preformed in 96 well ELISA plates, 0-50 microliter of sample were incubated with 250 microliter assay buffer and substrate was added to final concentration of 4mM. The reaction was incubated at 37 0 C for 60min. Product (p-nitrophenyl; pNP) formation was detected by absorbance at 405nm.
- GCD activity was assayed as described by hereinabove with some modifications, using a fluorescent short-acyl-chain analogue of glucosylceramide, N-[6- [(7-nitrobenzo-2-oxa- 1 ,3-diazol-4-yl)amino]hexanoyl]-D eryt/jr ⁇ -glucosylsphingosine (C6-NBD-Z)-eryt/zro-GlcCer).
- C ⁇ -NBD-GlcCer was synthesized by N-acylation of glucosylsphingosine using succinimidyl 6-7-nitrobenzo-2-oxa-l,3-diazol-4-yl) aminohexanoate as described by Schwarzmann and Sandhoff (1987).
- the assay was performed using 0.2 ⁇ g of either Cerezyme® or plant GCD of the invention in a final volume of 200 ⁇ l MES buffer (50 mM, pH 5.5). Concentrations of C ⁇ -NBD-GlcCer ranged from 0.25 to 100 ⁇ M. Reactions were allowed to proceed for 5 min at 37 0 C, and were stopped by addition of 1.5 ml of chloroform/methanol (1:2, v/v) prior to extraction and analysis of the fluorescent lipids.
- the stained protein bands in the gel were cut with a clean razor blade and the proteins in the gel were reduced with 1OmM DTT and modified with 100 mM iodoacetamide in 1OmM ammonium bicarbonate.
- the gel pieces were treated with 50% acetonitrile in 10 mM ammonium bicarbonate to remove the stain from the proteins following by drying the gel pieces.
- the dried gel pieces were rehydrated with 10% acetonitrile in 10 mM ammonium bicarbonate containing about 0.1 ⁇ g trypsin per sample.
- the gel pieces were incubated overnight at 37 0 C and the resulting peptides were recovered with 60% acetonitrile with 0.1% trifiuoroacetate.
- the tryptic peptides were resolved by reverse-phase chromatography on 0.1 X 300-mm fused silica capillaries (J&W, 100 micrometer ID) home-filled with porous R2 (Persepective).
- the peptides were eluted using a 80-min linear gradient of 5 to 95% acetonitrile with 0.1% acetic acid in water at flow rate of about 1 ⁇ l/min.
- the liquid from the column was electrosprayed into an ion-trap mass spectrometer (LCQ, Finnegan, San Jose, CA). Mass spectrometry was performed in the positive ion mode using repetitively full MS scan followed by collision induces dissociation (CID) of the most dominant ion selected from the first MS scan.
- CID dissociation
- mice Male, strain C57-B6 were injected intraperitoneally with 2.5 ml of 2.4% Bacto-thioglycolate medium w/o dextrose (Difco Cat. No. 0363-17-2). After 4-5 days, treated mice were sacrificed by cervical dislocation and the peritoneal cavity rinsed with phosphate buffered saline.
- This Example describes the construction of an exemplary expression plasmid, used with regard to the Examples below, in more detail.
- the cDNA coding for hGCD (ATTC clone number 65696) was amplified using the forward: 5' CAGAATTCGCCCGCCCCTGCA 3' (also denoted by SEQ ID NO: 1) and the reverse: 5' CTCAGATCTTGGCGATGCCACA 3' (also denoted by SEQ ID NO: 2) primers.
- CE-T includes ER targeting signal MKTNLFLFLIFSLLLSLSSAEA (also denoted by SEQ ID NO: 3) from the basic endochitinase gene [Arabidopsis thaliana], and vacuolar targeting signal from Tobacco chitinase A: DLLVDTM* (also denoted by SEQ ID NO: 4).
- the expression cassette was cut and eluted from the intermediate vector and ligated into the binary vector pGREENII using restriction enzymes Smal and Xbal, forming the final expression vector. Kanamycine resistance is conferred by the NPTII gene driven by the nos promoter together with the pGREEN vector (Fig. IB). The resulting expression cassette is presented by Fig. IA.
- the resulting plasmid was sequenced to ensure correct in-frame fusion of the signals using the following sequencing primers:
- This Example describes an exemplary method for transforming carrot cells according to the present invention, as used in the Examples below.
- Transformation of carrot cells was performed by Agrobacterium transformation as described previously by [Wurtele and Bulka (1989) ibid.]. Genetically modified carrot cells were plated onto Murashige and Skoog (MS) agar medium with antibiotics for selection of transformants. As shown by Fig. 2, extracts prepared from arising calli were tested for expression of GCD by Western blot analysis using anti hGCD antibody, and were compared to Cerezyme standard (positive control) and extracts of non- transformed cells (negative control). Of the various calli tested, one callus (number 22) was selected for scale-up growth and protein purification.
- the Western blot was performed as follows. For this assay, proteins from the obtained sample were separated in SDS polyacrylamide gel electrophoresis and transferred to nitrocellulose. For this purpose, SDS polyacrylamide gels were prepared as follows. The SDS gels consist of a stacking gel and a resolving gel (in accordance with Laemmli, UK 1970, Cleavage of structural proteins during assembly of the head of bacteriphage T4, Nature 227, 680-685).
- composition of the resolving gels was as follows: 12% acrylamide (Bio-Rad), 4 microliters of TEMED (N 5 N 5 N' ,N'-tetramethylethylenediamine; Sigma catalog number T9281) per 10ml of gel solution, 0.1% SDS, 375 mM Tris-HCl, pH 8.8 and ammonium persulfate (APS), 0.1%.
- TEMED and ammonium persulfate were used in this context as free radical starters for the polymerization.
- the stacking gel (3% acrylamide, 0.1% SDS, 126 mM Tris-HCl, pH 6.8, 0.1% APS and 5 microliters of TEMED per 5ml of stacking gel solution) was poured above the resolving gel, and a 12 or 18 space comb was inserted to create the wells for samples.
- the anode and cathode chambers were filled with identical buffer solution: Tris glycine buffer containing SDS (Biorad, catalog number 161-0772), pH 8.3.
- the antigen- containing material was treated with 0.5 volume of sample loading buffer (30ml glycerol (Sigma catalog number G9012), 9% SDS, 15 ml mercaptoethanol (Sigma catalog number M6250), 187.5 mM Tris-HCl, pH 6.8, 500 microliters bromophenol blue, all volumes per 100 ml sample buffer), and the mixture was then heated at 100 °C for 5 minutes and loaded onto the stacking gel.
- the electrophoresis was performed at room temperature for a suitable time period, for example 45-60 minutes using a constant current strength of 50-70 volts followed by 45-60 min at 180-200 Volt for gels of 13 by 9 cm in size.
- the antigens were then transferred to nitrocellulose (Schleicher and Schuell, Dassel).
- Protein transfer was performed substantially as described herein.
- the gel was located, together with the adjacent nitrocellulose, between Whatmann 3 MM filter paper, conductive, 0.5 cm-thick foamed material and wire electrodes which conduct the current by way of platinum electrodes.
- the filter paper, the foamed material and the nitrocellulose were soaked thoroughly with transfer buffer (TG buffer from Biorad, catalog number 161-0771, diluted 10 times with methanol and water buffer (20% methanol)). The transfer was performed at 100 volts for 90 minutes at 4°C.
- the blot strips were then incubated, at room temperature for 1 h, with a suitable secondary antibody (Goat anti rabbit (whole molecule) HRP (Sigma cat # A-4914)), dilution 1:3000 in buffer containing 1% dry milk (Dairy America), and 0.1% Tween 20 (Sigma Cat P 1379) diluted with phosphate buffer (Riedel deHaen, catalog number 30435)). After having been washed several times with PBS, the blot strips were stained with ECL developer reagents (Amersham RPN 2209).
- the blots were exposed to X-ray film FUJI Super RX 18x24, and developed with FUJI- AN ATOMIX developer and fixer (FUJI-X fix cat# FIXRTU 1 out of 2). The bands featuring proteins that were bound by the antibody became visible after this treatment.
- Recombinant h-GCD expressed in transformed carrot cells was found to be bound to internal membranes of the cells and not secreted to the medium. Mechanically cell disruption leaves the rGCD bound to insoluble membrane debris (data not shown). rGCD was then dissolved using mild detergents, and separated from cell debris and other insoluble components. The soluble enzyme was further purified using chromatography techniques, including cation exchange and hydrophobic interaction chromatography columns as described in Experimental procedures.
- frozen cell cake containing about lOOg wet weight cells was thawed, followed by centrifugation at 17000xg for 20min at 4 0 C.
- the insoluble materials and intact cells were washed by re- suspension in 100ml washing buffer (2OmM sodium phosphate pH 7.2, 2OmM EDTA), and precipitated by centrifugation at 1700Og for 20min at 4 0 C.
- the rGCD was extracted and solubilized by homogenization of the pellet in 200ml extraction buffer (2OmM sodium phosphate pH 7.2, 2OmM EDTA, ImM PMSF, 2OmM ascorbic acid, 3.8g polyvinylpolypyrrolidone (PVPP), ImM DTT, 1% Triton-x-100 (Sigma)).
- the homogenate was shaken for 30min at room temperature and clarified by centrifugation at 1700Og for 20min at 4 0 C.
- the pellet was discarded and the pH of the supernatant was adjusted to pH 5.5 by addition of concentrated citric acid. Turbidity generated after pH adjustment was clarified by centrifugation under the same conditions described above.
- Pre-elution of the rh- GCD was performed with equilibration buffer containing 20OmM NaCl and the elution was obtained with equilibration buffer containing 60OmM NaCl. Fractions collected during the run were monitored by enzyme activity assay, and tubes exhibiting enzymatic activity (in the elution peak) were pooled. Pooled samples were diluted (1:5) in water containing 5% ethanol and pH adjusted to 6.0 with NaOH.
- Fig. 3 A represents a standard run of this purification stage.
- the fractions collected during the run were monitored by enzyme activity assay, as shown by Fig. 3B, and Fig. 3C shows coomassie-blue stain of elution fractions assayed for activity.
- Fig. 3D represents a standard run of this purification stage. The fractions collected during the run were monitored by enzyme activity assay, as shown by Fig. 3E, and Fig. 3F shows a coomassie-blue stain of elution fractions assayed for activity.
- the fractions of the absorbent peak in the elution step were pooled and applied on a third column, for a third purification stage.
- the third purification stage was performed on a XK column (1.6x20cm) packed with 8ml hydrophobic interaction resin (TSK gel, Toyopearl Phenyl-650C, Tosoh Corp.).
- TSK gel Toyopearl Phenyl-650C, Tosoh Corp.
- the resin was equilibrated in 1OmM citrate buffer pH 6.0 containing 5% ethanol.
- the GCD elution pool from the previous column was loaded at 6ml/min followed by washing with equilibration buffer until the UV absorbance reached the baseline.
- the pure GCD was eluted by 1OmM citric buffer containing 50% ethanol, pooled and stored at -20 0 C.
- Fig. 4A represents a standard run of this purification stage.
- the fractions collected during the run were monitored by enzyme activity assay (Fig. 4B), and Fig. 4C shows coomassie-blue stain of elution fractions assayed for activity.
- rGCD protein was purified to a level greater than 95%; if only the first and third stages are performed, purity is achieved at a level of about 80% (results not shown).
- MSMS Mass-Spec Mass-Spec
- Amino-acid sequencing of the plant produced human recombinant GCD of the invention demonstrated that the rhGCD sequence (SEQ ID NO: 15) corresponds to that of the human GCD (Swiss Prot P04062, protein ID AAA35873), and includes two additional amino acids (EF) at the N-terminus (designated -2 and -1 accordingly), derived from the linker used for fusion of the signal peptide, and an additional 7 amino acids at the C-terminus (designated 497-503) derived from the vacuolar targeting signal.
- EF additional amino acids
- Immunodetection of the purified plant produced human recombinant GCD of the invention with anti-GCD polyclonal antibody was performed by Western blotting of the SDS-PAGE separated protein, along with Cerezyme ® protein (Fig. 9b), confirming antigenic identity of the plant produced and CHO-produced proteins.
- rhGCD To determine whether the rhGCD produced in carrot has been correctly glycosylated and can undergo uptake by target cells, and thus be useful for treatment of Gaucher' s disease, the ability of the rhGCD to bind to and be taken up by macrophages was next assayed. Targeting of rhGCD to macrophages is mediated by the Mannose/N- acetylglucosamine (Man/GlcNAc) receptor and can be determined using thioglycolate- elicited peritoneal macrophages. As shown by Fig. 5, rGCD undergoes uptake by cells at a high level.
- Figure 5A shows uptake by cells of rGCD according to the present invention with regard to mannan concentration.
- Figure 5 A shows uptake at comparable levels with CerezymeTM (this preparation was prepared to 80% purity with only the first and third stages of the purification process described above).
- Figures 5B and 5C show that rGCD uptake is at a higher level than CerezymeTM, as this preparation was prepared to greater than 95% purity with all three stages of the purification process described above.
- Figure 5 D shows that the rhGCD is also recognized by an anti-GCD antibody in a Western blot; rGCD refers to the protein according to the present invention, while GCD standard (shown at 5, 10 and 25 ng per lane) is commercially purchased GCD (Cerezyme®).
- mice were injected as follows: An initial dose of 1.8 mg/kg (clinical dose) was followed by doses of 9 and 18 mg/kg. Testing groups included six mice (ICR CD-I; 3 males and 3 females) for receiving rGCD (in a liquid carrier featuring 25 mM citrate buffer, 150 mM NaCl, 0.01% Tween 80, 5% ethanol) according to the present invention, and another six mice for being treated with the carrier alone as a control group. The mice were then observed for 14 days and were euthanized. In another study, vehicle solution alone, or doses of prGCD in multiples of 1, 5, or 10 times the standard clinical dose (60units/kg) were given to ICR (CD-I®) mice. The animals (6 per group, 3 males and 3 females), received the drug intravenously in a 10 ml/kg volume.
- the monosaccharide linkages for both N- and O-glycans were determined by using a hydrolysis and GC-MS strategy. This method estimates the linkage type of the carbohydrates to the peptide and the general monosaccharide composition of a glycoprotein. Based on prior knowledge and also the ratios between various monosaccharides, this method may suggest the types of glycans on the glycoprotein. This information is important to estimate the possible glycan structures present on the protein.
- Another method featured oligosaccharide analysis of the N-glycan population.
- FAB-MS and MALDI-TOF MS were performed, following digestion of aliquots of the samples with trypsin and peptide N-glycosidase F (PNGaseF) and permethylation of the glycans.
- PNGaseF trypsin and peptide N-glycosidase F
- This method is used to detach and isolate N-linked carbohydrates from the enzymatically digested glycoprotein.
- the masses of the glycan populations in the isolated glycan mix are determined and their masses are compared with those of known structures from databases and in light of the monosaccharide composition analysis.
- the proposed structures are based also on the glycosylation patterns of the source organism.
- O-glycans are not released by PNGase F, therefore, glycans remaining linked to peptides are most likely O-linked glycans. These glycans are then released by reductive elimination and their mass analyzed.
- Monosaccharide composition analysis revealed a characteristic distribution of hexoses, hexosamines and pentoses characteristic of plant glycosylation. The ratios between GlcNac and Mannose, suggest that characteristic N- linked structures are the predominant glycan population.
- GC-MS Gas Chromatography-Mass Spectrometry
- FAB-MS Fast Atom Bombardment-Mass Spectrometry
- DE-MALDI-TOF MS Delayed Extraction-Matrix Assisted Laser Desorption Ionisation-Time of Flight Mass- Spectrometry
- the N-glycan population was analysed by FAB-MS and MALDI-TOF MS following digestion of aliquots of the samples with trypsin and peptide N-glycosidase F (PNGaseF) and permethylation of the glycans.
- PNGaseF trypsin and peptide N-glycosidase F
- the O-glycan population was analysed following reductive elimination of the tryptic and PNGase F treated glycopeptides, desalting and permethylation.
- the monosaccharide linkages for both N- and O-glycans were determined using a hydrolysis, derivatisation GC-MS strategy.
- the samples were stored between -10 and -30 0 C until required.
- the tryptically cleaved peptide/glycopeptide mixtures from the glycoprotein sample was treated with the enzyme peptide N-glycosidase A (PNGaseA) in ammonium acetate buffer, pH 5.5 at 37 0 C for 15 hours.
- PNGaseA enzyme peptide N-glycosidase A
- the reaction was stopped by freeze-drying.
- the resulting products were purified using a C 18 Sep-Pak cartridge.
- NaOH sodium hydroxide
- MeI methyl iodide
- the permethylated glycan sample mixtures obtained following tryptic and PNGase A digestion or reductive elimination were hydrolysed (2M TFA, 2 hours at 12O 0 C) and reduced (sodium borodeuteride (NaBD 4 ) in 2M NH 4 OH, 2 hours at room temperature, SOP B025).
- the borate produced on the decomposition of the borodeuteride was removed by 3 additions of a mixture of methanol in glacial acetic acid (90:10) followed by lyophilisation.
- the samples were then acetylated using acetic anhydride (1 hour at 100 0 C).
- the acetylated samples were purified by extraction into chloroform.
- the partially methylated alditol acetates were then examined by gas chromatography/mass spectrometry (GC/MS). Standard mixtures of partially methylated alditol acetates and a blank were also run under the same conditions.
- GC/MS Gas Liquid Chromatography/Mass Spectrometry
- a blank containing lO ⁇ g of Arabitol and a standard monosaccharide mixture containing lO ⁇ g each of Fucose, Xylose, Mannose, Galactose, Glucose, N-acetylgalactosamine, N- acetylglucosamine, N-acetylneuraminic acid and Arabitol were prepared in parallel.
- Injector Temperature 4O 0 C
- Programme 1 minute at 9O 0 C then 25°C/minute to 14O 0 C, 5°C/minute to 22O 0 C, finally 10°C/minute to 300 0 C and held at 300 0 C for 5 minutes.
- Carrier Gas Helium
- MALDI-TOF mass spectrometry was performed using a Voyager STR Biospectrometry Research Station Laser-Desorption Mass Spectrometer coupled with Delayed Extraction (DE).
- Glycosylation patterns were analyzed by the Glycobiology Center of the National Institute for Biotechnology (Ben Gurion University, Beer Sheba, Israel) to determine glycan structure and relative amounts using sequential digestion with various exoglycosidases.
- the plant GCD samples of the invention were run on SDS-PAGE and a 61KDa band was cut out and incubated with either PNGase A, or with trypsin followed by PNGase A to release the N-linked glycans.
- the glycans were fluorescently labeled with anthranilamide (2AB) and run on normal phase HPLC.
- Sequencing of the labeled glycan pool was achieved by sequential digestion with various exoglycosidases followed by HPLC analysis. Retention times of individual glycans were compared to those of a standard partial hydrolysate of dextran giving a ladder of glucose units (GU). Unlabeled glycans were further purified and analyzed by MALDI mass spectrometry.
- Bovine testes -galactosidase hydrolyses non-reducing terminal galactose _ 1-3 and _ 1-4 linkages, Prozyme
- Streptococcus pneumoniae hexosaminidase digest 1 — 2,3,4,6 GaINAc and GIcNAc, Prozyme
- Glycosylation was further analyzed by M- Scan (Berkshire, England) using gas chromatography mass spectrometry (GC-MS), fast atom bombardment-mass spectrometry (FAB-MS), and delayed extraction-matrix assisted laser desorption ionization - time of flight mass-spectrometry (DE-MALDI- TOF MS).
- GC-MS gas chromatography mass spectrometry
- FAB-MS fast atom bombardment-mass spectrometry
- DE-MALDI- TOF MS delayed extraction-matrix assisted laser desorption ionization - time of flight mass-spectrometry
- the N-glycan population was analyzed by FAB-MS and MALDI-TOF MS, following digestion of samples with trypsin and PNGase A, and permethylation of the glycans.
- 0-glycans were analyzed following reductive elimination of the tryptic and PNGase A-treated glycopeptides, desalting and permethylation.
- the intact glycoprotein was subjected to dialysis followed by trypsin digestion and the lyophilised products were digested using PNGase A and then purified using a C is Sep-Pak.
- the 5% aq. acetic acid (N-linked oligosaccharide containing) fraction was permethylated and FAB mass spectra were obtained using a portion of the derivatised oligosaccharide in a low mass range for fragment ions and DE-MALDI-TOF mass spectra were obtained using a portion of the derivatised oligosaccharides in a high mass range for molecular ions.
- Table 1 lists the predominant fragment ions present in the FAB spectra and molecular ions present in the MALDI spectra.
- the molecular ion region (shown in Appendix III) contains a predominant signal at m/z 1505.8 (consistent with an [M+Na] + quasimolecular ion for a structure having the composition Pent.deoxyHex.Hex 3 .HexNAc 2 ).
- a range of less intense quasimolecular ions were also detected consistent with complex and high mannose structures.
- the high mannose structures detected range in size from Hex 5 .HexNAc 2 at m/z 1579.8 to Hex 8 .HexNAc 2 at m/z 2193.0.
- the complex signals are produced from less extensively processed N- glycans such as m/z 1331.7 (consistent with an [M+Na] + quasimolecular ion for a structure having the composition Pent.Hex 3 .HexNAc 2 ) or from larger N-glycans for example m/z 1751.0 (consistent with an [M+Na] + quasimolecular ion for a structure having the composition Pent.deoxyHex.Hex 3 .HexNAc 3 ), m/z 2375.4 (consistent with an [M+Na] + quasimolecular ion for a structure having the composition PentdeoxyHex ⁇ Hex ⁇ HexNAQ) and m/z 2753.6 (consistent with an [M+Na] + quasimolecular ion for a structure having the composition Pent.deoxyHex 3 .Hex 5 .HexNAc 4 ).
- the FAB mass spectrum provides information regarding antennae structures by virtual of fragment ions in the low mass region of the spectrum (data not shown). Signals were detected identifying hexose (at m/z 219) and HexNAc (at m/z 260) as non- reducing terminal monosaccharides in the N-glycans.
- Reductive elimination was carried out on the 60% 2-propanol fraction (potential O-linked glycopeptide fraction) from the Sep-Pak purification of Glucocerebrosidase following trypsin and PNGase A digestions.
- the sample was desalted following termination of the reaction and, after borate removal, was permethylated.
- FAB mass spectra were obtained using a portion of the derivatised oligosaccharide in a low mass range for fragment ions and DE-MALDI-TOF mass spectra were obtained using a portion of the derivatised oligosaccharides in a high mass range for molecular ions. No signals consistent with the presence of O-linked glycans were observed (data not shown).
- GCD obtained from CHO (Chinese hamster ovary) cells which are mammalian cells (CerezymeTM) and the GCD of the present invention, from carrot cells. As shown, remodeling of these structures is required to obtain exposed mannose residues for CerezymeTM. By contrast, such exposed mannose residues are directly obtained for the GCD obtained from plant cells according to the present invention, without requiring further manipulation, for example with glycosylases.
- Figure 7 represents the main glycan structure found in rGCD.
- Figure 7 shows proposed structures of: a) the predominant oligosaccharide population found on hGC expressed in carrot cell suspension (1505.7m/z); b) typical N-linked core; c) Fucosylated plant N-linked core.
- N-linked glycans are coupled to the protein via- Aspargine and through the reducing end of the GlcNac (GN) residue on the right hand of the diagrams.
- GlcNac (GN) residue GlcNac residue on the right hand of the diagrams.
- N plant glycosylation patterns, Fucose residues may be part of the core structure, bound to the first GlcNac using an alpha(l-3) glycosidic bond, while mammalian structures typically use the alpha(l- ⁇ ) glycosidic bond.
- Figures 8A-8D show all possible structures for the N-glycans detected on the rGCD protein according to the present invention.
- the dominant glycan structure that was identified is the core glycan structure found in most plant glycoproteins from pea, rice, maize and other edible plants. This structure contains a core xylose residue as well as a core alpha-(l,3)-fucose. Work done by Bardor et al (33) shows that 50% of nonallergic blood donors have specific antibodies for core xylose in their sera, and 25% have specific antibodies to core alpha- (l,3)-fucose.. However it is still to be studied whether such antibodies might introduce limitations to the use of plant-derived biopharmaceutical glycoproteins.
- the minor glycan populations of the hGCD produced as described above were mainly high mannose structures Hex4HexNAc2 to Hex8HexNAc2.
- the complex structures exhibited structures such as Pent.deoxyHex2.Hex4.HexNAc3 and Pent.deoxyHex3.Hex5.HexNAc3.
- Pent.Hex3.HexNAc2 was detected in smaller proportions.
- the major terminal monosaccharides are hexose (Mannose or Galactose) and N- acetylhexosamine, which is consistent with the presence of high mannose structures and partially processed complex structures. With regard to O-linked oligosaccharide screening, no signals that are consistent with typical O-linked glycans were observed.
- GCD is known in the art to not have O- linked oligosaccharides, such that these results are consistent with the known glycosylation of GCD from other cell systems, including native GCD and recombinant GCD produced in mammalian culture systems. However, in the monosaccharide composition, signals consistent with Arabinose were detected.
- hGCD protein N-glycan composition analysis showed that the majority of the N-glycans terminate with mannose residues. This agrees with the requirement for mannose terminating N- glycans assisting the uptake of therapeutic hGCD by the macrophage mannose receptor.
- native GCD nor recombinant GCD produced in mammalian cells is high mannose. Therefore, the present invention overcomes a significant drawback of commercially produced hGCD proteins, which is that these proteins are modified to terminate with mannose sugars, unlike the protein produced as described above. Further glycosylation analysis was performed on a purified human recombinant glucocerebrosidase prepared in plant cells.
- FIG. 10b shows the glycan structure of Cerezyme® before and after in vitro enzymatic processing.
- analysis of the glycan structures of the GCD of the invention revealed that >90% of the glycans were mannose-rich, bearing exposed, terminal mannose residues (Fig. 10a), whereas in the case of Cerezyme®, mannose residues are exposed only after a complex in-vitro procedure (Fig. 10b).
- the dominant glycan in the GCD of the invention is the core structure found in most glycoproteins purified from pea, rice, maize and other edible plants. This structure contains a core _-(l,2)-xylose residue as well as a core _-(l,3)-fucose (Fig.
- the DE-MALDI-MS data contained no signals consistent with typical O-linked glycans.
- Further analysis of the glycan profiles for the GCD of the invention obtained from different production batches was performed in order to asses the batch-to-batch reproducibility of the GCD produced in the carrot cell system. As presented in Fig. 11, the population of glycans on plant GCD of the invention is highly reproducible between batches.
- CELLS Human ⁇ -galactosidase A the lesion in the X-linked lysosomal storage disorder Fabry disease, has been sequenced and cloned.
- vectors including the human ⁇ -galactosidase A coding sequence targeted to the plant endoplasmic reticulum were expressed in plant cells, and polypeptide sequence, biological activity and glycan structure of the plant-derived, recombinant human ⁇ -galactosidase A was evaluated.
- Human ⁇ -galactosidase A expression vectors Vectors containing Human ⁇ - galactosidase A coding sequence and an N-terminal apple pectinase leader peptide (SEQ ID NO: l ⁇ -MALKTQLLWSFVVVFVVSFSTTSCSG), for targeting the translated protein to the plant endoplasmic reticulum (ER) secretory system, were constructed. Two different constructs were cloned, with different C-terminal sequences designed to sustain the translated protein in a specific cellular compartment.
- One construct contained a C-terminal vacuolar targeting signal (DLLVDTM, SEQ ID NO: 4) designed for transport of the protein from the ER to the plant vacuole, where the protein is retained.
- a second construct ( ⁇ -gal-KDEL, SEQ ID NO: 19) lacked the C-terminal vacuolar targeting signal, and contained a C-terminal ER retention sequence (KDEL, SEQ ID NO.23) designed to allow retrograde transport from the cw-Golgi back to the ER where the protein is retained (see Rayon et al. Journal of Experimental Botany, Vol. 49, No. 326, pp. 1463-1472, 1998; and Evron et al. 2007 FASEB J).
- the human ⁇ -gal coding sequence was artificially synthesized by GENEART AG. (Regensburg; Germany)(SEQ ID NO: 17).
- the ⁇ -gal-vac sequence includes the apple pectinase leader (SEQ ID NO: 16) (MALKTQLL WSFVVVFVVSFSTTSCSG), mature alpha-galactosidase sequence (SEQ ID NO:24) and a vacuolar retention signal (SEQ ID NO: 4).
- the synthetic gene is surrounded by restriction sites to facilitate sub- cloning. The gene was cloned using NCOI and Hindlll, into a vector developed by ICON genetics (Halle, Germany) for transient expression in Nicotiana benthamiama plants.
- the vacuolar signal was replaced with an ER retention signal by adding a phosphorylated linker (SEQ ID NO: 1
- the phosphorylated linker codes for the ER retention signal and has sticky ends compatible with the ends generated by the enzymes BgIII and Hindlll:
- the ⁇ -gal-vac construct (SEQ ID NO: 17) was digested with BgIII and Hindlll and ligated with the above linker. Insertion of the linker was verified by restriction with Sad. The resultant construct was then cloned into the ICON vector as described herein, for transient expression in N. benthamiama.
- the protein of interest is expressed from a strong duplicated viral promoter such as the coat protein sub-genomic promoter.
- the system relies on transient amplification (agroinfection) of viral vectors delivered to a plant by agrobacterium.
- agroinfection a plant functional promoter and RNA virus cDNA are transferred as T-DNA from agrobacterium into plant cells.
- the T-DNA is transcribed in-planta to generate biologically active viral RNAs that can initiate self replication
- This approach allows the rapid assembly and expression of arrays of proteins variants. This approach is not only very versatile but also provides milligram quantities of proteins in just a few days.
- Benthamiana plants are germinated and grown in commercial mix soil (Givaat Ada, IL) supplemented with granular slow release fertilizer (Scott Marysville, OH) under a long day (16h light / 8h dark) light regime (50 ⁇ E) at 24 ° C-25 ° C.
- Plants were infiltrated with Agrobacteria containing the 3 ICON plasmids by vacuum infiltration with standard methods known in the art. Briefly, N. benthamiana Plants, 5-6 week old were infiltrated by immersing all aerial plant organs into a bacterial suspension and were placed in a vacuum chamber. A -0.8 bar vacuum was applied for 1 minute, followed by a quick return to atmospheric pressure. Plants were returned to the greenhouse for additional 5-7 days under the same conditions.
- Tobacco leaves were frozen and thereafter ground with a mortar and pestle.
- the ground leaves were resuspended in extraction buffer containing 20mMTris 2OmM EDTA, 2OmM ascorbic acid ImMDTT, ImMPMSF pH 7.2 in a 1:1 volume to weight ratio.
- cells were disrupted and homogenized.
- the suspension was further homogenized using a knife homogenizer.
- the cell suspension was passed through a micro-fluid cell disruptor and the resulting preparation was centrifuged. The pellet was discarded and the supernatant was treated with ammonium sulfate and centrifuged.
- the pellet was then dissolved in citrate buffer (2OmM pH 6) and the solution was further acidified to pH 5.5, centrifuged, and filtered (0.45 ⁇ M). The filtrate was loaded on an hydrophobic interaction chromatography column and eluted fractions were pooled and loaded on a cation exchange chromatography column. Eluted fractions were pooled and analyzed for catalytic activity
- Western blot was performed to identify the ⁇ -galactosidase molecules from transformed tobacco plants by using polyclonal rabbit anti ⁇ -gal A antibody. Protein transfer was performed substantially as described herein. Briefly, transfer from the gel to nitrocellulose was performed at 100 volts for 90 minutes at 4°C. After the transfer, the blot was blocked with blocking buffer (1% dry milk, 0.1% Tween 20 (Sigma Cat Pl 379) in phosphate buffer). Blots were then immune detected by incubation with antibody, washed, and reacted with a suitable secondary antibody (Jackson-Labs HRP conjugated Goat anti Rabbit Ab). Blots were then developed with ECL developer reagents (Amersham RPN 2209), and autoradiography used for visualization.
- blocking buffer 1% dry milk, 0.1% Tween 20 (Sigma Cat Pl 379) in phosphate buffer.
- Determination of active a-galactosidase enzyme The level of active plant ⁇ -galactosidase A was determined against a calibration curve of the activity of the commercial a-galactosidase Fabrazyme (Oenzyme, Cambridge, Mass) plotted for the concentration range of 200-12.5 ng/ml. Activity was determined using /?-nitrophenyl- ⁇ -D-galactopyranoside (Sigma) as a hydrolysis substrate. Assay buffer contained 20 mM citric acid 3OmM sodium phosphate 0.1 % BSA and 0.67 % ethanol at pH 4.6.
- the concentration of p-nitrophenyl; pNP (Sigma) was varied in the range of 1000 ⁇ M to 45000 ⁇ M.
- Reaction mixtures containing 25 ng/mL of ⁇ -galactosidase and varying concentrations of the substrate were allowed to react for time periods ranging from 85 to 105 minutes at 37 °C.
- the reaction samples were quenched with saturated sodium carbonate and the absorbance of the p-nitrophenol product was detected at 430 nm.
- the stained protein bands in the gel were cut with a clean razor blade and the proteins in the gel were reduced with 1OmM DTT and modified with 100 raM iodoacetamide in 1OmM ammonium bicarbonate.
- the gel pieces were treated with 50% acetonitrile in 10 mM ammonium bicarbonate to remove the stain from the proteins following by drying the gel pieces.
- the dried gel pieces were rehydrated with 10% acetonitrile in 10 mM ammonium bicarbonate containing about 0.1 ⁇ g trypsin per sample.
- the gel pieces were incubated overnight at 37 0 C and the resulting peptides were recovered with 60% acetonitrile with 0.1% trifluoroacetate.
- the tryptic peptides were resolved by reverse-phase chromatography on 0.1 X
- the amino terminal of the protein was sequenced on Peptide Sequencer 494A (Perkin Elmer) according to manufacture instructions. MALDI-TOF.
- MALDI-TOF mass spectrometry was performed using a MALDI TOF TOF 4700 (Applied Biosystems) according to methods known in the art in Smoler Proteomics Center (Technion, Haifa, IL).
- ⁇ -galactosidase was tested on human fibroblasts originating from Fabry Patients (Cat. ID GM02775 Georgia Institute). Fibroblasts were cultured in DMEM medium (cat. D5546, Sigma) supplemented with 12 % FBS, 5ml L- Glutamine, 5 ml MEM Eagle vitamin solution 10 ml MEM amino acid solution 5 ml MEM Eagle non essential amino acid solution and 5 ml Pen-Strep solution, all supplements from Biological Indusries (Beit Haemek, IL).
- SDS-PAGE separates proteins primarily by their molecular weight.
- this technique provides a large amount of information about the purity and composition of proteins.
- the molecular weight identity and the protein impurity pattern of ⁇ - galactosidase produced from tobacco plants were examined by SDS-PAGE analysis using Coomassie Brilliant blue staining, according to standard gel separation protocols.
- the SDS gels consist of a stacking gel (3%) and a resolving gel (12%).
- Running buffer was Tris/SDS, pH 8.3, loading buffer glycerol-Tris-mercaptoethanol, pH 6.8.
- Figure 13 A and 13B shows the characterization of molecular weight of plant- derived recombinant ⁇ -galactosidase, expressed and produced in tobacco plants by the method of the instant invention by gel filtration (Fig. 13A) and mass spectrometry (Fig. 13B).
- the mass spectrometry profile shows that the estimate of the molecular weight of plant-expressed ⁇ -galactosidase consists of several populations in the range of 48- 52KDa. Since alpha Gal is a non-covalent dimer the energy of the MALDI-TOF causes the dissociation of the dimer to the monomers.
- This molecular weight reflects 407 amino acids contributing 46.3 kDa and the addition of the glycan structures for the remaining molecular weight.
- Mass spectrometry confirms the protein is 48.6 kDa, and these results are well in the range of the molecular weight of native human ⁇ - galactosidase (about 51 kDa).
- the gel filtration calibration curve shows the molecular weight corresponding to the retention time of the main peak of plant ⁇ -galactosidase (18.41 min.) is 76.56 kDa, suggesting a dimer.
- the very small peak at 20.403 min corresponds according to the calibration curve to a monomer (43.27 kDa). Since the gel filtration analysis is conducted at mild conditions it enables observing the protein at its dimer form.
- Fig. 14A Resolution of the recombinant ⁇ -galactosidase by PAGE analysis revealed two main bands (Fig. 14A), suggesting a difference in glycosylation of the mature recombinant enzyme. Sequencing of the isolated bands from PAGE indicated that this was indeed the case, as the regions of the polypeptide available for sequencing (i.e. not masked by glycans), although not located identically in the two bands, displayed 100% identity where overlapping (see Fig. 14B, sequenced portions in red).
- Fig 14B (Lower band) shows a complete sequence identification of a deglycosylated ⁇ -galactosidase [deglycosylation was effected using PNGase F (Sigma)].
- sequences in red indicate previously identified sequences.
- Green sequences indicate sequences available to sequencing following glycan removal.
- Black sequences indicate as yet unidentified sequences.
- Native glycosylation sites are depicted in yellow highlight.
- the C terminal KDEL was verified using an anti KDEL antibody (Santa Cruz, CA). Taken together, these results show the ⁇ -galactosidase protein expressed by the methods of the present invention is identical to the expected cloned sequence.
- Plant-expressed human recombinant a-galactosidase is antigenically identical to native recombinant a-galactosidase:
- Fig. 15 shows that polypeptides expressed in tobacco plants from both the ⁇ -gal-vac (lane "vac") and ⁇ -gal-KDEL (lane "KDEL”) constructs included a fraction detected by rabbit polyclonal antibody raised against the polypeptide fragment as set forth between amino acids 326 and 429 of native human ⁇ -galactosidase. Control plants, transformed with GFP (lane "GFP"), failed to produce any immune-reactive bands.
- Figs. 16A and 16B show the kinetics of recombinant ⁇ -galactosidase (red symbols) compared to those of commercially available recombinant human ⁇ -galactosidases Fabrazyme ® (black symbols) and Replagal ®. (blue symbols).
- Recombinant plant-expressed human a-galactosidase is stable in a wide range of temperatures:
- Figs. 17A and 17B show that the plant-expressed recombinant human ⁇ -galactosidase (Plant a-Gal) did not undergo any alteration in electrophoretic mobility, and was as stable as, if not more stable than commercially available recombinant ⁇ -galactosidase from mammalian cells (Replagal®), at all temperatures tested.
- the stability of the recombinant ⁇ - galactosidase was evident whether incubated in activity buffer (Fig. 17A) or cell media buffer (Fig. 17B).
- Monosaccharide composition analysis revealed a distribution of hexoses, hexosamines and pentoses characteristic of plant glycosylation.
- the recombinant protein produced according to the present invention preferably comprises a suitably glycosylated protein produced by a plant cell culture, which is preferably a lysosomal enzyme for example, and/or a high mannose glycosylated protein.
- the protein produced according to the present invention is suitable for treatment of a lysosomal-associated disease, such as a lysosomal storage disease for example.
- the method of treatment optionally and preferably comprises: (a) providing a recombinant biologically active form of lysosomal enzyme purified from transformed plant root cells, and capable of efficiently targeting cells abnormally deficient in the lysosomal enzyme.
- This recombinant biologically active enzyme has exposed terminal mannose residues on appended oligosaccharides; and (b) administering a therapeutically effective amount of the recombinant biologically active lysosomal enzyme, or of composition comprising the same to the subject.
- the recombinant high mannose lysosomal enzyme used by the method of the invention may be produced by the host cell of the invention.
- this host cell is a carrot cell.
- mammal or “mammalian patient” is meant any mammal for which gene therapy is desired, including human, bovine, equine, canine, and feline subjects, most preferably, a human subject.
- treatment also includes amelioration or alleviation of a pathological condition and/or one or more symptoms thereof, curing such a condition, or preventing the genesis of such a condition.
- the lysosomal enzyme used by the method of the invention may be a high mannose enzyme comprising at least one oligosaccharide chain having an exposed mannose residue. This recombinant enzyme can bind to a mannose receptor on a target cell in a target site within a subject.
- this recombinant lysosomal enzyme has increased affinity for these target cell, in comparison with the corresponding affinity of a naturally occurring lysosomal enzyme to the target cell. Therefore, each dose is dependent on the effective targeting of cells abnormally deficient in GCD and each dose of such form of GCD is substantially less than the dose of naturally occurring GCD that would otherwise be administered in a similar manner to achieve the therapeutic effect.
- the protein is suitable for the treatment of lysosomal storage diseases, such that the present invention also comprises a method for treating such diseases.
- Lysosomal storage diseases are a group of over 40 disorders which are the result of defects in genes encoding enzymes that break down glycolipid or polysaccharide waste products within the lysosomes of cells. The enzymatic products, e.g., sugars and lipids, are then recycled into new products.
- Each of these disorders results from an inherited autosomal or X-linked recessive trait which affects the levels of enzymes in the lysosome. Generally, there is no biological or functional activity of the affected enzymes in the cells and tissues of affected individuals.
- lysosomal storage diseases include but are not limited to Fabry disease ( ⁇ -galactosidase), Farber disease (ceramidase), Gaucher disease (glucocerebrosidase), G m i gangliosidosis ( ⁇ - galactosidase), Tay-Sachs disease ( ⁇ -hexosaminidase), Niemann-Pick disease (sphingomyelinase), Schindler disease ( ⁇ .-N-acetylgalactosaminidase), Hunter syndrome (iduronate-2-sulfatase), Sly syndrome ( ⁇ -glucuronidase), Hurler and Hurler/Scheie syndromes (iduronidase), and I-Cell/San Filipo syndrome (mannose 6- phosphate transporter).
- Fabry disease ⁇ -galactosidase
- Farber disease ceramidase
- Gaucher disease glucocerebrosidase
- G m i gangliosidosis
- Gaucher disease is the most common lysosomal storage disease in humans, with the highest frequency encountered in the Ashkenazi Jewish population. About 5,000 to 10,000 people in the United States are afflicted with this disease [Grabowski, Adv. Hum. Genet. 21:377-441(1993)]. Gaucher disease results from a deficiency in glucocerebrosidase (hGCD; glucosylceramidase).
- the lysosomal enzyme used by the method of the invention may be selected from the group consisting of glucocerebrosidase (GCD), acid sphingomyelinase, hexosaminidase, ⁇ -N-acetylgalactosaminidise, acid lipase, ⁇ - galactosidase, glucocerebrosidase, ⁇ -L-iduronidase, iduronate sulfatase, ⁇ -mannosidase or sialidase.
- the lysosomal enzyme used by the method of the invention is glucocerebrosidase (GCD).
- the protein of the present invention can be used to produce a pharmaceutical composition.
- a pharmaceutical composition which includes, as an active ingredient thereof, a protein and a pharmaceutical acceptable carrier.
- a pharmaceutical composition refers to a preparation of one or more of the active ingredients described herein, such as a recombinant protein, with other chemical components such as traditional drugs, physiologically suitable carriers and excipients.
- the purpose of a pharmaceutical composition is to facilitate administration of a protein or cell to an organism.
- compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
- the term "pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
- physiologically suitable carrier and “pharmaceutically acceptable carrier” are interchangeably used and refer to an approved carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered conjugate.
- carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
- Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
- Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
- the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
- the composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
- Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E. W. Martin. Such compositions will contain a therapeutically effective amount of the protein, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should be suitable for the mode of administration.
- excipient refers to an inert substance added to a pharmaceutical composition to further facilitate processes and administration of the active ingredients.
- excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols. Further techniques for formulation and administration of active ingredients may be found in "Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference as if fully set forth herein.
- compositions herein described may also comprise suitable solid or gel phase carriers or excipients.
- suitable solid or gel phase carriers or excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin and polymers such as polyethylene glycols.
- Suitable routes of administration may, for example, include oral, rectal, transmucosal, transdermal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections.
- compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more pharmaceutically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
- the active ingredients of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer.
- physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer.
- penetrants are used in the formulation. Such penetrants are generally known in the art.
- the active ingredients can be optionally formulated through administration of the whole cells producing a protein according to the present invention, such as GCD or ⁇ -galactosidase for example.
- the active ingredients can also be formulated by combining the active ingredients and/or the cells with pharmaceutically acceptable carriers well known in the art.
- Such carriers enable the active ingredients of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
- Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
- Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl- cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
- disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
- Dragee cores are provided with suitable coatings.
- suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active ingredient doses.
- compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
- the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
- the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
- stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
- compositions may take the form of tablets or lozenges formulated in conventional manner.
- the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the active ingredient and a suitable powder base such as lactose or starch.
- compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
- the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
- the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings.
- pharmaceutical compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
- the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
- the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
- an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
- compositions of the invention can be formulated as neutral or salt forms.
- Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
- the active ingredients of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
- compositions herein described may also comprise suitable solid of gel phase carriers or excipients.
- suitable solid of gel phase carriers or excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin and polymers such as polyethylene glycols.
- the topical route is optionally performed, and is assisted by a topical carrier.
- the topical carrier is one which is generally suited for topical active ingredient administration and includes any such materials known in the art.
- the topical carrier is selected so as to provide the composition in the desired form, e.g., as a liquid or non- liquid carrier, lotion, cream, paste, gel, powder, ointment, solvent, liquid diluent, drops and the like, and may be comprised of a material of either naturally occurring or synthetic origin. It is essential, clearly, that the selected carrier does not adversely affect the active agent or other components of the topical formulation, and which is stable with respect to all components of the topical formulation.
- suitable topical carriers include water, alcohols and other nontoxic organic solvents, glycerin, mineral oil, silicone, petroleum jelly, lanolin, fatty acids, vegetable oils, parabens, waxes, and the like.
- Preferred formulations herein are colorless, odorless ointments, liquids, lotions, creams and gels.
- Ointments are semisolid preparations, which are typically based on petrolatum or other petroleum derivatives.
- the specific ointment base to be used is one that will provide for optimum active ingredients delivery, and, preferably, will provide for other desired characteristics as well, e.g., emolliency or the like.
- an ointment base should be inert, stable, nonirritating and nonsensitizing. As explained in Remington: The Science and Practice of Pharmacy, 19th Ed.
- ointment bases may be grouped in four classes: oleaginous bases; emulsifiable bases; emulsion bases; and water-soluble bases.
- Oleaginous ointment bases include, for example, vegetable oils, fats obtained from animals, and semisolid hydrocarbons obtained from petroleum.
- Emulsifiable ointment bases also known as absorbent ointment bases, contain little or no water and include, for example, hydroxystearin sulfate, anhydrous lanolin and hydrophilic petrolatum.
- Emulsion ointment bases are either water-in-oil (W/O) emulsions or oil-in-water (O/W) emulsions, and include, for example, cetyl alcohol, glyceryl monostearate, lanolin and stearic acid.
- W/O water-in-oil
- O/W oil-in-water
- Preferred water-soluble ointment bases are prepared from polyethylene glycols of varying molecular weight; again, reference may be made to Remington: The Science and Practice of Pharmacy for further information.
- Lotions are preparations to be applied to the skin surface without friction, and are typically liquid or semiliquid preparations, in which solid particles, including the active agent, are present in a water or alcohol base. Lotions are usually suspensions of solids, and may comprise a liquid oily emulsion of the oil-in-water type. Lotions are preferred formulations herein for treating large body areas, because of the ease of applying a more fluid composition. It is generally necessary that the insoluble matter in a lotion be finely divided. Lotions will typically contain suspending agents to produce better dispersions as well as active ingredients useful for localizing and holding the active agent in contact with the skin, e.g., methylcellulose, sodium carboxymethylcellulose, or the like.
- Creams containing the selected active ingredients are, as known in the art, viscous liquid or semisolid emulsions, either oil-in-water or water-in-oil.
- Cream bases are water-washable, and contain an oil phase, an emulsifier and an aqueous phase.
- the oil phase also sometimes called the "internal" phase, is generally comprised of petrolatum and a fatty alcohol such as cetyl or stearyl alcohol; the aqueous phase usually, although not necessarily, exceeds the oil phase in volume, and generally contains a humectant.
- the emulsifier in a cream formulation is generally a nonionic, anionic, cationic or amphoteric surfactant.
- Gel formulations are preferred for application to the scalp.
- gels are semisolid, suspension-type systems.
- Single-phase gels contain organic macromolecules distributed substantially uniformly throughout the carrier liquid, which is typically aqueous, but also, preferably, contain an alcohol and, optionally, an oil.
- Various additives known to those skilled in the art, may be included in the topical formulations of the invention.
- solvents may be used to solubilize certain active ingredients substances.
- Other optional additives include skin permeation enhancers, opacifiers, anti-oxidants, gelling agents, thickening agents, stabilizers, and the like.
- the topical compositions of the present invention may also be delivered to the skin using conventional dermal-type patches or articles, wherein the active ingredients composition is contained within a laminated structure, that serves as a drug delivery device to be affixed to the skin.
- the active ingredients composition is contained in a layer, or "reservoir", underlying an upper backing layer.
- the laminated structure may contain a single reservoir, or it may contain multiple reservoirs.
- the reservoir comprises a polymeric matrix of a pharmaceutically acceptable contact adhesive material that serves to affix the system to the skin during active ingredients delivery.
- suitable skin contact adhesive materials include, but are not limited to, polyethylenes, polysiloxanes, polyisobutylenes, polyacrylates, polyurethanes, and the like.
- the particular polymeric adhesive selected will depend on the particular active ingredients, vehicle, etc., i.e., the adhesive must be compatible with all components of the active ingredients-containing composition.
- the active ingredients-containing reservoir and skin contact adhesive are present as separate and distinct layers, with the adhesive underlying the reservoir which, in this case, may be either a polymeric matrix as described above, or it may be a liquid or hydrogel reservoir, or may take some other form.
- the backing layer in these laminates which serves as the upper surface of the device, functions as the primary structural element of the laminated structure and provides the device with much of its flexibility.
- the material selected for the backing material should be selected so that it is substantially impermeable to the active ingredients and to any other components of the active ingredients-containing composition, thus preventing loss of any components through the upper surface of the device.
- the backing layer may be either occlusive or non-occlusive, depending on whether it is desired that the skin become hydrated during active ingredients delivery.
- the backing is preferably made of a sheet or film of a preferably flexible elastomeric material. Examples of polymers that are suitable for the backing layer include polyethylene, polypropylene, and polyesters.
- the laminated structure includes a release liner. Immediately prior to use, this layer is removed from the device to expose the basal surface thereof, either the active ingredients reservoir or a separate contact adhesive layer, so that the system may be affixed to the skin.
- the release liner should be made from an active ingredients/vehicle impermeable material.
- Such devices may be fabricated using conventional techniques, known in the art, for example by casting a fluid admixture of adhesive, active ingredients and vehicle onto the backing layer, followed by lamination of the release liner.
- the adhesive mixture may be cast onto the release liner, followed by lamination of the backing layer.
- the active ingredients reservoir may be prepared in the absence of active ingredients or excipient, and then loaded by "soaking" in an active ingredients/vehicle mixture.
- the active ingredients composition contained within the active ingredients reservoirs of these laminated system may contain a number of components.
- the active ingredients may be delivered "neat," i.e., in the absence of additional liquid.
- the active ingredients will be dissolved, dispersed or suspended in a suitable pharmaceutically acceptable vehicle, typically a solvent or gel.
- suitable pharmaceutically acceptable vehicle typically a solvent or gel.
- Other components which may be present, include preservatives, stabilizers, surfactants, and the like.
- the protein of the invention such as a high mannose lysosomal enzyme, is preferably administered to the patient in need in an effective amount.
- effective amount means an amount necessary to achieve a selected result.
- an effective amount of the composition of the invention may be selected for being useful for the treatment of a lysosomal storage disease.
- compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredient effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated.
- the therapeutically effective amount or dose can be estimated initially from activity assays in animals.
- a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC50 as determined by activity assays.
- Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in experimental animals, e.g., by determining the IC50 and the LD50 (lethal dose causing death in 50 % of the tested animals) for a subject active ingredient.
- the data obtained from these activity assays and animal studies can be used in formulating a range of dosage for use in human.
- therapeutically effective doses suitable for treatment of genetic disorders can be determined from the experiments with animal models of these diseases.
- the dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.l).
- Dosage amount and interval may be adjusted individually to provide plasma levels of the active moiety which are sufficient to maintain the modulating effects, termed the minimal effective concentration (MEC).
- MEC minimal effective concentration
- the MEC will vary for each preparation, but may optionally be estimated from whole animal data.
- Dosage intervals can also be determined using the MEC value. Preparations may optionally be administered using a regimen, which maintains plasma levels above the MEC for 10-90 % of the time, preferable between 30-90 % and most preferably 50-90 %.
- dosing can also be a single administration of a slow release composition described hereinabove, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
- compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
- the pack may, for example, comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- the pack or dispenser may also be accompanied by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
- Compositions comprising an active ingredient of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
- modulate includes substantially inhibiting, slowing or reversing the progression of a disease, substantially ameliorating clinical symptoms of a disease or condition, or substantially preventing the appearance of clinical symptoms of a disease or condition.
- a “modulator” therefore includes an agent which may modulate a disease or condition.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Epidemiology (AREA)
- Cell Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physical Education & Sports Medicine (AREA)
- Immunology (AREA)
- Alternative & Traditional Medicine (AREA)
- Botany (AREA)
- Medical Informatics (AREA)
- Mycology (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BRPI0810003-9A BRPI0810003A2 (pt) | 2007-04-30 | 2008-04-30 | "produção de proteínas de alta manose em cultura de plantas" |
| JP2010505007A JP2010525806A (ja) | 2007-04-30 | 2008-04-30 | 植物培養での高マンノース型タンパク質の製造 |
| EP08738278A EP2220105A4 (en) | 2007-04-30 | 2008-04-30 | PRODUCTION OF HIGH MANNOSE PROTEINS IN PLANT CULTURE |
| MX2009011751A MX2009011751A (es) | 2007-04-30 | 2008-04-30 | Produccion de proteinas de alto contenido de manosa en cultivo de plantas. |
| CA002685400A CA2685400A1 (en) | 2007-04-30 | 2008-04-30 | Production of high mannose proteins in plant culture |
| US12/451,188 US20100196345A1 (en) | 2003-04-27 | 2008-04-30 | Production of high mannose proteins in plant culture |
| AU2008243744A AU2008243744A1 (en) | 2007-04-30 | 2008-04-30 | Production of high mannose proteins in plant culture |
| CN200880023217A CN101855232A (zh) | 2007-04-30 | 2008-04-30 | 植物培养物中高甘露糖蛋白的生产 |
| IL201799A IL201799A0 (en) | 2007-04-30 | 2009-10-28 | Production of high mannose proteins in plant culture |
| ZA2009/08423A ZA200908423B (en) | 2007-04-30 | 2009-11-30 | Production of high mannose proteins in plant culture |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US11/790,991 US7951557B2 (en) | 2003-04-27 | 2007-04-30 | Human lysosomal proteins from plant cell culture |
| US11/790,991 | 2007-04-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008132743A2 true WO2008132743A2 (en) | 2008-11-06 |
| WO2008132743A3 WO2008132743A3 (en) | 2010-06-03 |
Family
ID=39929901
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2008/000576 Ceased WO2008132743A2 (en) | 2003-04-27 | 2008-04-30 | Production of high mannose proteins in plant culture |
Country Status (12)
| Country | Link |
|---|---|
| US (8) | US7951557B2 (https=) |
| EP (1) | EP2220105A4 (https=) |
| JP (1) | JP2010525806A (https=) |
| KR (1) | KR20100023833A (https=) |
| CN (1) | CN101855232A (https=) |
| AU (1) | AU2008243744A1 (https=) |
| BR (1) | BRPI0810003A2 (https=) |
| CA (1) | CA2685400A1 (https=) |
| MX (1) | MX2009011751A (https=) |
| RU (1) | RU2009143751A (https=) |
| WO (1) | WO2008132743A2 (https=) |
| ZA (1) | ZA200908423B (https=) |
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008132743A3 (en) * | 2007-04-30 | 2010-06-03 | Protalix Ltd. | Production of high mannose proteins in plant culture |
| WO2011017177A1 (en) | 2009-07-28 | 2011-02-10 | Shire Human Genetic Therapies | Compositions and methods for treating gaucher disease |
| WO2011061736A1 (en) | 2009-11-17 | 2011-05-26 | Protalix Ltd. | Alkaline alpha galactosidase for the treatment of fabry disease |
| WO2011068808A1 (en) * | 2009-12-01 | 2011-06-09 | Shire Human Genetic Therapies | Enzymatic activity based-detection |
| WO2011107991A1 (en) | 2010-03-02 | 2011-09-09 | Protalix Ltd. | Glucocerebrosidase multimers and uses thereof |
| WO2012098537A1 (en) | 2011-01-20 | 2012-07-26 | Protalix Ltd. | Nucleic acid construct for expression of alpha-galactosidase in plants and plant cells |
| WO2013121405A1 (en) | 2012-02-19 | 2013-08-22 | Protalix Ltd. | Oral unit dosage forms and uses of same for the treatment of gaucher disease |
| WO2013130963A1 (en) | 2012-03-02 | 2013-09-06 | Shire Human Genetic Therapies, Inc. | Compositions and methods for treating type iii gaucher disease |
| US8742079B2 (en) | 2007-08-20 | 2014-06-03 | Protalix Ltd. | Saccharide-containing protein conjugates and uses thereof |
| JP2014237694A (ja) * | 2010-03-02 | 2014-12-18 | プロタリクス リミテッド | 安定化α−ガラクトシダーゼおよびその使用 |
| US9075057B2 (en) | 2011-06-08 | 2015-07-07 | Shire Human Genetic Therapies, Inc. | Competition-based detection assays |
| WO2015118547A1 (en) | 2014-02-10 | 2015-08-13 | Protalix Ltd. | Method of maintaining disease stability in a subject having gaucher's disease |
| US9194011B2 (en) | 2009-11-17 | 2015-11-24 | Protalix Ltd. | Stabilized alpha-galactosidase and uses thereof |
| US9447396B2 (en) | 2011-03-09 | 2016-09-20 | Honda Motor Co., Ltd. | Method for accumulating protein in plant cells |
| WO2016146760A1 (en) | 2015-03-17 | 2016-09-22 | Greenovation Biotech Gmbh | Glycosylated lysosomal proteins, method of production and uses |
| US10364413B2 (en) | 2007-05-07 | 2019-07-30 | Protalix Ltd. | Large scale disposable bioreactor |
| EP3700526A1 (en) | 2017-10-26 | 2020-09-02 | Shire Human Genetic Therapies, Inc. | Formulations comprising glucocerebrosidase and isofagomine |
| EP3528617A4 (en) * | 2016-10-21 | 2020-11-25 | Vestaron Corporation | CLIVABLE PEPTIDES AND PROTEINS, INSECTICIDES AND NEMATICIDES CONTAINING THEM |
| US11103596B2 (en) | 2015-05-11 | 2021-08-31 | Ucl Business Plc | Fabry disease gene therapy |
| US11472854B2 (en) | 2012-03-09 | 2022-10-18 | Vestaron Corporation | Insecticidal peptide production, peptide expression in plants and combinations of cysteine rich peptides |
| US11692016B2 (en) | 2012-03-09 | 2023-07-04 | Vestaron Corporation | High gene expression yeast strain |
Families Citing this family (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050032211A1 (en) * | 1996-09-26 | 2005-02-10 | Metabogal Ltd. | Cell/tissue culturing device, system and method |
| IL155588A0 (en) * | 2003-04-27 | 2003-11-23 | Metabogal Ltd | Methods for expression of enzymatically active recombinant lysosomal enzymes in transgenic plant root cells and vectors used thereby |
| US20030100945A1 (en) * | 2001-11-23 | 2003-05-29 | Mindguard Ltd. | Implantable intraluminal device and method of using same in treating aneurysms |
| US20100196345A1 (en) * | 2003-04-27 | 2010-08-05 | Protalix | Production of high mannose proteins in plant culture |
| JP2009525950A (ja) * | 2006-01-04 | 2009-07-16 | ベーリンガー インゲルハイム インターナショナル ゲゼルシャフト ミット ベシュレンクテル ハフツング | 中等症持続型喘息の治療におけるチオトロピウム塩の使用 |
| WO2009004842A1 (ja) * | 2007-07-03 | 2009-01-08 | Idemitsu Kosan Co., Ltd. | ブタ浮腫病ワクチン |
| EP3009145A1 (en) | 2009-03-30 | 2016-04-20 | Mount Sinai School of Medicine of New York University | Influenza virus vaccines and uses thereof |
| SI3998078T1 (sl) | 2009-08-28 | 2026-02-27 | Genzyme Corporation | Encimsko nadomestno zdravljenje z naraščajočim odmerkom za zdravljenje pomanjkanja kisle sfingomielinaze |
| WO2011117249A1 (en) * | 2010-03-22 | 2011-09-29 | Philip Morris Products S.A. | Modifying enzyme activity in plants |
| EP3248615A1 (en) | 2010-03-30 | 2017-11-29 | Mount Sinai School of Medicine of New York University | Influenza virus vaccines and uses thereof |
| WO2012050175A1 (ja) | 2010-10-15 | 2012-04-19 | 日本ケミカルリサーチ株式会社 | 糖鎖の非還元末端がマンノース残基である糖蛋白質の製造方法 |
| EP2471929A1 (en) * | 2010-12-29 | 2012-07-04 | Algenics | Production of high mannose glycosylated proteins stored in the plastid of microalgae |
| IN2014CN02114A (https=) | 2011-09-20 | 2015-05-29 | Sinai School Medicine | |
| US9603907B2 (en) | 2012-02-01 | 2017-03-28 | Protalix Ltd. | Dry powder formulations of dNase I |
| EP2662083A1 (en) * | 2012-05-08 | 2013-11-13 | CSL Behring GmbH | Sugar compositions for treating hemophilia a and/or von willebrand disease |
| EA201591164A1 (ru) | 2012-12-18 | 2015-11-30 | Икан Скул Оф Медсин Эт Маунт Синай | Вакцины против вируса гриппа и их применение |
| US20160017020A1 (en) | 2013-03-06 | 2016-01-21 | Protalix Ltd. | Chimeric polypeptides, polynucleotides encoding same, cells expressing same and methods of producing same |
| US9908930B2 (en) | 2013-03-14 | 2018-03-06 | Icahn School Of Medicine At Mount Sinai | Antibodies against influenza virus hemagglutinin and uses thereof |
| US10000551B2 (en) | 2014-09-11 | 2018-06-19 | Protalix Ltd. | Chimeric polypeptides, polynucleotides encoding same, cells expressing same and methods of producing same |
| US9616114B1 (en) | 2014-09-18 | 2017-04-11 | David Gordon Bermudes | Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity |
| EP3247389A4 (en) | 2015-01-23 | 2019-10-30 | Icahn School of Medicine at Mount Sinai | INFLUENZAVIRUSSCHUTZIMPFPLÄNE |
| US9981021B1 (en) | 2015-04-09 | 2018-05-29 | Kinetiq, Inc. | Subcutaneous therapeutic enzyme formulations, uses, and methods for generating thereof |
| US10676723B2 (en) | 2015-05-11 | 2020-06-09 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| EP3454964B1 (en) * | 2016-05-13 | 2021-06-23 | Agilent Technologies, Inc. | Automated alignment, calibration and standardization of electrophoresis data |
| CA3023143A1 (en) | 2016-06-15 | 2017-12-21 | Icahn School Of Medicine At Mount Sinai | Influenza virus hemagglutinin proteins and uses thereof |
| US11180535B1 (en) | 2016-12-07 | 2021-11-23 | David Gordon Bermudes | Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria |
| US11129906B1 (en) | 2016-12-07 | 2021-09-28 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| WO2018187706A2 (en) | 2017-04-07 | 2018-10-11 | Icahn School Of Medicine At Mount Sinai | Anti-influenza b virus neuraminidase antibodies and uses thereof |
| EP3810634A4 (en) | 2018-06-21 | 2022-07-27 | Icahn School of Medicine at Mount Sinai | Mosaic influenza virus hemagglutinin polypeptides and uses thereof |
| CN111826391B (zh) * | 2019-03-29 | 2023-01-31 | 中国科学院分子植物科学卓越创新中心 | 一种nhx2-gcd1双基因或其蛋白的应用 |
| EP3959216A4 (en) | 2019-04-24 | 2023-01-11 | Icahn School of Medicine at Mount Sinai | ANTI-INFLUENZA B VIRUS NEURAMINIDASE ANTIBODIES AND USES THEREOF |
| US20220325265A1 (en) * | 2019-09-09 | 2022-10-13 | Hoffmann-La Roche Inc. | Glucocerebrosidase mutants |
| BR112023001456A2 (pt) | 2020-07-27 | 2023-04-11 | Voyager Therapeutics Inc | Composições e métodos para o tratamento de distúrbios neurológicos relacionados à deficiência de beta glicosilceramidase |
| CA3231087A1 (en) | 2021-09-13 | 2023-03-16 | Plantibodies | Genetically modified organism for recombinant protein production |
| EP4433490A2 (en) | 2021-11-17 | 2024-09-25 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of neurological disorders related to glucosylceramidase beta deficiency |
| WO2025019631A1 (en) | 2023-07-19 | 2025-01-23 | Icahn School Of Medicine At Mount Sinai | Immunogenic compositions containing inactivated influenza a virus and cpg oligonucleotide adjuvant and uses thereof |
| CN120695154A (zh) * | 2025-08-28 | 2025-09-26 | 山东大学 | 豌豆肽在制备防治卵巢损伤药物中的应用 |
Family Cites Families (192)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US609654A (en) * | 1898-08-23 | Cradle | ||
| GB1053848A (https=) | ||||
| US27127A (en) * | 1860-02-14 | Fiee-escape | ||
| US467993A (en) * | 1892-02-02 | Alfred jorgensen | ||
| US2147271A (en) * | 1937-07-16 | 1939-02-14 | Schwarz Lab Inc | Pure yeast culture apparatus |
| US2341259A (en) * | 1941-01-22 | 1944-02-08 | Lummus Co | Inoculating method and apparatus |
| US2504185A (en) * | 1945-04-27 | 1950-04-18 | Carnegie Illinois Steel Corp | Method for making basic furnace bottoms |
| US2836434A (en) * | 1952-08-21 | 1958-05-27 | Separator Ab | Arrangement for sterile interconnection and sealing of apparatuses in a plant for instance for cultivation of bacteria |
| US3201327A (en) * | 1962-08-21 | 1965-08-17 | Sun Oil Co | Fermentation apparatus and process |
| SE371208B (https=) * | 1966-10-06 | 1974-11-11 | Sanraku Ocean Co | |
| US3468520A (en) | 1967-05-12 | 1969-09-23 | American Cyanamid Co | Combination agitation and transfer unit for suspended cells |
| US3504185A (en) * | 1968-05-09 | 1970-03-31 | Univ Syracuse Res Corp | Apparatus for measuring and controlling cell population density in a liquid medium |
| GB1284077A (en) | 1968-10-18 | 1972-08-02 | British Petroleum Co | Process and apparatus for the cultivation of micro-organisms |
| US3540700A (en) | 1969-01-24 | 1970-11-17 | New Brunswick Scientific Co | Rotary processing apparatus |
| DE2059931C3 (de) * | 1970-12-05 | 1973-10-18 | Knapsack Ag, 5033 Huerth-Knapsack | Verfahren zum Verhindern von Schaumausbrüchen aus geschlossenen Reaktionsräumen |
| US3950227A (en) * | 1970-12-21 | 1976-04-13 | St. John's University | Batch method of establishing and maintaining a controlled aerobic environment for a microbial culture |
| US3793154A (en) * | 1970-12-21 | 1974-02-19 | Univ St Johns | Apparatus for gaseous environmental control of batch cultures of micro-organisms |
| CS192067B1 (en) | 1975-12-02 | 1979-08-31 | Drahoslav Pravda | Separation blood bag for the sterile preparation of the blood serum for single use |
| US4179339A (en) | 1977-03-02 | 1979-12-18 | Olympus Optical Company, Ltd. | Liquid feeder for automatic culture apparatus |
| US4228243A (en) | 1978-07-13 | 1980-10-14 | Toray Industries, Inc. | Cell culture propagation apparatus |
| US4328317A (en) * | 1980-03-31 | 1982-05-04 | Solargizer International, Inc. | Continuous chemical conversion or fermentation apparatus |
| DE3133314A1 (de) * | 1981-08-22 | 1983-03-10 | Hoechst Ag, 6000 Frankfurt | "vorrichtung zum dispergieren einer zweiten phase in einer ersten phase" |
| US4425908A (en) * | 1981-10-22 | 1984-01-17 | Beth Israel Hospital | Blood clot filter |
| US4519984A (en) * | 1982-01-18 | 1985-05-28 | Phillips Petroleum Company | Apparatus for carrying out sparged reaction |
| SE445884B (sv) * | 1982-04-30 | 1986-07-28 | Medinvent Sa | Anordning for implantation av en rorformig protes |
| CH663422A5 (de) * | 1982-05-27 | 1987-12-15 | Chemap Ag | Verfahren und fermenter zur zuechtung von gewebezellen. |
| US4643184A (en) * | 1982-09-29 | 1987-02-17 | Mobin Uddin Kazi | Embolus trap |
| US4708938A (en) | 1984-04-30 | 1987-11-24 | Hickinbotham Winemakers Pty. Ltd. | Alcoholic fermentation |
| DK151404C (da) | 1984-05-23 | 1988-07-18 | Cook Europ Aps William | Sammenklappeligt filter til implantation i en patients blodkar |
| JPS6198254A (ja) | 1984-10-19 | 1986-05-16 | ザ・ベントリー―ハリス・マニュファクチュアリング・カンパニー | 補綴ステント |
| JPH0446128Y2 (https=) | 1984-10-29 | 1992-10-29 | ||
| US4577631A (en) * | 1984-11-16 | 1986-03-25 | Kreamer Jeffry W | Aneurysm repair apparatus and method |
| DE3577578D1 (de) | 1985-02-01 | 1990-06-13 | Maerkl Herbert | Folienfermenter. |
| US4668632A (en) * | 1985-02-06 | 1987-05-26 | Vxr, Inc. | Sparger and apparatus for and method of growing cells |
| SE450809B (sv) * | 1985-04-10 | 1987-08-03 | Medinvent Sa | Plant emne avsett for tillverkning av en spiralfjeder lemplig for transluminal implantation samt derav tillverkad spiralfjeder |
| US5372945A (en) | 1985-06-06 | 1994-12-13 | Alchas; Paul G. | Device and method for collecting and processing fat tissue and procuring microvessel endothelial cells to produce endothelial cell product |
| CN85100412B (zh) | 1985-06-25 | 1988-02-10 | 山东省食品发酵工业研究所 | 用嗜热放线菌生产固定化葡萄糖异构酶的方法及其用于高果糖糖浆的生产方法 |
| US4713345A (en) | 1985-07-29 | 1987-12-15 | Grain Processing Corporation | Fermentation methods and apparatus |
| EP0224962A1 (en) | 1985-11-25 | 1987-06-10 | De Staat Der Nederlanden Vertegenwoordigd Door De Minister Van Welzijn, Volksgezondheid En Cultuur | Apparatus for the continuous cultivation of microorganisms in a culture liquid |
| SE453258B (sv) | 1986-04-21 | 1988-01-25 | Medinvent Sa | Elastisk, sjelvexpanderande protes samt forfarande for dess framstellning |
| US5166072A (en) | 1986-06-26 | 1992-11-24 | Bayer Aktiengesellschaft | Apparatus for the cultivation of immobilized micro-organisms |
| SE453752B (sv) | 1986-07-04 | 1988-02-29 | Alfa Laval Food & Dairy Eng | Forfarande och anordning for aseptisk overforing av en vetskemengd, serskilt vid provtagning |
| JPS63109772U (https=) | 1986-08-21 | 1988-07-14 | ||
| JPS63109772A (ja) | 1986-10-28 | 1988-05-14 | Nitto Electric Ind Co Ltd | 植物細胞等の培養方法 |
| JPS63133978A (ja) | 1986-11-26 | 1988-06-06 | Rikagaku Kenkyusho | 細胞培養装置 |
| US4717668A (en) * | 1986-12-12 | 1988-01-05 | Baxter Travenol Laboratories, Inc. | Plastic roller bottle for suspension cultures |
| US5081036A (en) * | 1987-01-23 | 1992-01-14 | Hoffmann-La Roche Inc. | Method and apparatus for cell culture |
| US4908315A (en) * | 1987-03-04 | 1990-03-13 | Agristar, Inc. | Integument and method for micropropagation and tissue culturing |
| GB2202549A (en) | 1987-03-20 | 1988-09-28 | Philip John Whitney | Foldable fermenter |
| DE3878203D1 (de) | 1987-11-28 | 1993-03-18 | Nippon Shinyaku Co Ltd | Verfahren zur herstellung von 2-amino-2-deoxy-d-mannit. |
| US6846968B1 (en) * | 1988-02-26 | 2005-01-25 | Large Scale Biology Corporation | Production of lysosomal enzymes in plants by transient expression |
| IL86442A (en) | 1988-05-19 | 1992-02-16 | Plant Biotec Ltd | Air lift fermenter formed from flexible plastic sheets |
| DE3823711C1 (https=) | 1988-07-13 | 1990-04-12 | Chemap Ag, Volketswil, Ch | |
| US4931401A (en) * | 1988-09-01 | 1990-06-05 | La Societe De Recherche Snc Inc. | Bioreactor |
| JPH02119771A (ja) | 1988-10-29 | 1990-05-07 | Nitto Denko Corp | 細胞培養方法及びこの方法で使用する細胞培養用撹拌翼 |
| US5073491A (en) | 1988-12-23 | 1991-12-17 | Hoffman-La Roche Inc. | Immobilization of cells in alginate beads containing cavities for growth of cells in airlift bioreactors |
| US5549892A (en) * | 1988-12-23 | 1996-08-27 | Genzyme Corporation | Enhanced in vivo uptake of glucocerebrosidase |
| US5100801A (en) * | 1989-01-26 | 1992-03-31 | Biocontrol Systems, Inc. | Device for sequential microbial enrichment in a single apparatus |
| US5188946A (en) * | 1989-01-26 | 1993-02-23 | Biocontrol Systems Incorporated | Process and device for sequential microbial enrichment in a single apparatus |
| US5843089A (en) | 1990-12-28 | 1998-12-01 | Boston Scientific Corporation | Stent lining |
| JPH0418055Y2 (https=) | 1990-02-28 | 1992-04-22 | ||
| EP0447256A3 (en) | 1990-03-16 | 1992-01-08 | Hitachi, Ltd. | Methods and apparatus for incubation and sterilization |
| JP2514102B2 (ja) | 1990-06-13 | 1996-07-10 | ユリカ株式会社 | ユリ科アロエ属に属する植物の真空凍結乾燥体を利用した錠剤製品及びその製造方法 |
| ATE290087T1 (de) | 1990-06-15 | 2005-03-15 | Syngenta Participations Ag | Neue signalsequenzen |
| EP0471947A1 (en) * | 1990-06-29 | 1992-02-26 | Sekisui Chemical Co., Ltd. | Culture bag |
| US5240598A (en) * | 1990-09-18 | 1993-08-31 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Microbubble generator for the transfer of oxygen to microbial inocula and microbubble generator immobilized cell reactor |
| US5401650A (en) | 1990-10-24 | 1995-03-28 | The Mount Sinai School Of Medicine Of The City University Of New York | Cloning and expression of biologically active α-galactosidase A |
| EP0485970A3 (en) | 1990-11-13 | 1992-07-01 | Yeda Research And Development Company Limited | Transgenic plants overproducing threonine and lysine |
| AT394576B (de) | 1991-01-16 | 1992-05-11 | Vogelbusch Gmbh | Reaktor zur durchfuehrung biologischer reaktionen mittels biokatalysatoren |
| US5350398A (en) | 1991-05-13 | 1994-09-27 | Dusan Pavcnik | Self-expanding filter for percutaneous insertion |
| US5304220A (en) | 1991-07-03 | 1994-04-19 | Maginot Thomas J | Method and apparatus for implanting a graft prosthesis in the body of a patient |
| US5415630A (en) * | 1991-07-17 | 1995-05-16 | Gory; Pierre | Method for removably implanting a blood filter in a vein of the human body |
| US5612188A (en) * | 1991-11-25 | 1997-03-18 | Cornell Research Foundation, Inc. | Automated, multicompartmental cell culture system |
| US5267791A (en) | 1991-12-13 | 1993-12-07 | Corning Incorporated | Suspended cell culture stirring vessel closure and apparatus |
| JPH05219834A (ja) | 1992-02-14 | 1993-08-31 | Fumiko Kobayashi | ディスポーサブル培養袋及び培養方法 |
| GB9209993D0 (en) | 1992-05-08 | 1992-06-24 | Munn Edward A | Vaccines |
| IL102189A (en) * | 1992-06-12 | 1995-07-31 | Univ Ben Gurion | Device for growing microorganisms |
| US5324304A (en) * | 1992-06-18 | 1994-06-28 | William Cook Europe A/S | Introduction catheter set for a collapsible self-expandable implant |
| US5562725A (en) | 1992-09-14 | 1996-10-08 | Meadox Medicals Inc. | Radially self-expanding implantable intraluminal device |
| US5383392A (en) * | 1993-03-16 | 1995-01-24 | Ward Holding Company, Inc. | Sheet registration control |
| US5409833A (en) * | 1993-07-01 | 1995-04-25 | Baxter International Inc. | Microvessel cell isolation apparatus |
| US5464449A (en) * | 1993-07-08 | 1995-11-07 | Thomas J. Fogarty | Internal graft prosthesis and delivery system |
| US5342781A (en) * | 1993-07-15 | 1994-08-30 | Su Wei Wen W | External-loop perfusion air-lift bioreactor |
| US5723004A (en) | 1993-10-21 | 1998-03-03 | Corvita Corporation | Expandable supportive endoluminal grafts |
| US5443497A (en) * | 1993-11-22 | 1995-08-22 | The Johns Hopkins University | Percutaneous prosthetic by-pass graft and method of use |
| EP0793717B1 (en) | 1994-10-24 | 2005-01-26 | The Texas A & M University System | Oral immunization with transgenic plants |
| WO1996013599A1 (en) | 1994-11-01 | 1996-05-09 | Winfried Wels | Nucleic acid transfer system |
| DE4441792A1 (de) | 1994-11-24 | 1996-05-30 | Bosch Gmbh Robert | Brennstoffeinspritzvorrichtung für eine Brennkraftmaschine |
| US5549626A (en) * | 1994-12-23 | 1996-08-27 | New York Society For The Ruptured And Crippled Maintaining The Hospital For Special Surgery | Vena caval filter |
| GB2298577B (en) * | 1995-03-09 | 1999-02-17 | Univ Bristol | Arteriovenous bypass grafting |
| US5725568A (en) * | 1995-06-27 | 1998-03-10 | Scimed Life Systems, Inc. | Method and device for recanalizing and grafting arteries |
| DE69637875D1 (de) | 1995-09-14 | 2009-04-30 | Virginia Tech Intell Prop | Produktion von lysosomalen enzymen in pflanzlichen expressionssystemen |
| US5769816A (en) | 1995-11-07 | 1998-06-23 | Embol-X, Inc. | Cannula with associated filter |
| ATE218052T1 (de) * | 1995-11-27 | 2002-06-15 | Schneider Europ Gmbh | Stent zur anwendung in einem körperlichen durchgang |
| US6576009B2 (en) * | 1995-12-01 | 2003-06-10 | Medtronic Ave, Inc. | Bifurcated intraluminal prostheses construction and methods |
| US6403371B1 (en) | 1996-02-08 | 2002-06-11 | Institut für Pflanzengenetik und Kulturpflanzenforschung | Cassettes for the expression of storable proteins in plants |
| US5871537A (en) * | 1996-02-13 | 1999-02-16 | Scimed Life Systems, Inc. | Endovascular apparatus |
| US5891191A (en) * | 1996-04-30 | 1999-04-06 | Schneider (Usa) Inc | Cobalt-chromium-molybdenum alloy stent and stent-graft |
| US5800514A (en) | 1996-05-24 | 1998-09-01 | Meadox Medicals, Inc. | Shaped woven tubular soft-tissue prostheses and methods of manufacturing |
| JPH1084802A (ja) | 1996-09-11 | 1998-04-07 | Science & Tech Agency | ニンジン不定胚の大量培養方法 |
| US6458574B1 (en) * | 1996-09-12 | 2002-10-01 | Transkaryotic Therapies, Inc. | Treatment of a α-galactosidase a deficiency |
| US6083725A (en) * | 1996-09-13 | 2000-07-04 | Transkaryotic Therapies, Inc. | Tranfected human cells expressing human α-galactosidase A protein |
| US20050032211A1 (en) * | 1996-09-26 | 2005-02-10 | Metabogal Ltd. | Cell/tissue culturing device, system and method |
| IL119310A (en) | 1996-09-26 | 1999-07-14 | Metabogal Ltd | Cell/tissue culturing device and method |
| IL155588A0 (en) * | 2003-04-27 | 2003-11-23 | Metabogal Ltd | Methods for expression of enzymatically active recombinant lysosomal enzymes in transgenic plant root cells and vectors used thereby |
| US5876367A (en) * | 1996-12-05 | 1999-03-02 | Embol-X, Inc. | Cerebral protection during carotid endarterectomy and downstream vascular protection during other surgeries |
| US5807330A (en) | 1996-12-16 | 1998-09-15 | University Of Southern California | Angioplasty catheter |
| US5919224A (en) * | 1997-02-12 | 1999-07-06 | Schneider (Usa) Inc | Medical device having a constricted region for occluding fluid flow in a body lumen |
| US5814064A (en) * | 1997-03-06 | 1998-09-29 | Scimed Life Systems, Inc. | Distal protection device |
| US5817126A (en) | 1997-03-17 | 1998-10-06 | Surface Genesis, Inc. | Compound stent |
| US5853419A (en) | 1997-03-17 | 1998-12-29 | Surface Genesis, Inc. | Stent |
| US6048360A (en) | 1997-03-18 | 2000-04-11 | Endotex Interventional Systems, Inc. | Methods of making and using coiled sheet graft for single and bifurcated lumens |
| US5843172A (en) | 1997-04-15 | 1998-12-01 | Advanced Cardiovascular Systems, Inc. | Porous medicated stent |
| DE69837704T2 (de) * | 1997-04-15 | 2007-09-06 | Schneider (Usa) Inc., Plymouth | Prothese mit ausgewählt geschweissten gekreuzten Fäden |
| EP1011532B1 (en) * | 1997-04-23 | 2014-05-07 | Ethicon Endo-Surgery, Inc. | Bifurcated stent and distal protection system |
| US6258120B1 (en) * | 1997-12-23 | 2001-07-10 | Embol-X, Inc. | Implantable cerebral protection device and methods of use |
| CA2235911C (en) * | 1997-05-27 | 2003-07-29 | Schneider (Usa) Inc. | Stent and stent-graft for treating branched vessels |
| JPH1112143A (ja) | 1997-06-20 | 1999-01-19 | Lion Corp | 口腔用組成物 |
| US5951599A (en) | 1997-07-09 | 1999-09-14 | Scimed Life Systems, Inc. | Occlusion system for endovascular treatment of an aneurysm |
| US5928260A (en) * | 1997-07-10 | 1999-07-27 | Scimed Life Systems, Inc. | Removable occlusion system for aneurysm neck |
| WO1999008607A1 (en) * | 1997-08-05 | 1999-02-25 | Boston Scientific Limited | Detachable aneurysm neck bridge |
| IL132580A0 (en) | 1997-08-12 | 2001-03-19 | Univ North Carolina State | Genetically engineered duckweed |
| US6190913B1 (en) * | 1997-08-12 | 2001-02-20 | Vijay Singh | Method for culturing cells using wave-induced agitation |
| US6086577A (en) * | 1997-08-13 | 2000-07-11 | Scimed Life Systems, Inc. | Detachable aneurysm neck bridge (III) |
| US5855599A (en) * | 1997-09-02 | 1999-01-05 | Sitek, Inc. | Silicon micro machined occlusion implant |
| US5941896A (en) * | 1997-09-08 | 1999-08-24 | Montefiore Hospital And Medical Center | Filter and method for trapping emboli during endovascular procedures |
| US6030414A (en) * | 1997-11-13 | 2000-02-29 | Taheri; Syde A. | Variable stent and method for treatment of arterial disease |
| US5976169A (en) | 1997-12-16 | 1999-11-02 | Cardiovasc, Inc. | Stent with silver coating and method |
| US6022374A (en) * | 1997-12-16 | 2000-02-08 | Cardiovasc, Inc. | Expandable stent having radiopaque marker and method |
| US5964798A (en) | 1997-12-16 | 1999-10-12 | Cardiovasc, Inc. | Stent having high radial strength |
| US5927988A (en) * | 1997-12-17 | 1999-07-27 | Jenkins; William M. | Method and apparatus for training of sensory and perceptual systems in LLI subjects |
| US6096546A (en) * | 1998-01-30 | 2000-08-01 | Board Of Trustees, Rutgers, The State University Of New Jersey | Methods for recovering polypeptides from plants and portions thereof |
| WO1999040873A1 (en) * | 1998-02-12 | 1999-08-19 | Marotta Thomas R | Endovascular prosthesis |
| ES2336861T3 (es) | 1998-06-22 | 2010-04-16 | Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Agriculture And Agri-Food | Produccion de il-10 en biorreactor de planta de cultivo no alimenticia. |
| US5928261A (en) * | 1998-06-29 | 1999-07-27 | Ruiz; Carlos E. | Removable vascular filter, catheter system and methods of use |
| US6093199A (en) * | 1998-08-05 | 2000-07-25 | Endovascular Technologies, Inc. | Intra-luminal device for treatment of body cavities and lumens and method of use |
| JP3689802B2 (ja) | 1998-08-06 | 2005-08-31 | 株式会社ロッテ | 歯牙エナメル質の再石灰化促進剤及び口腔用組成物並びに飲食物 |
| US6117117A (en) | 1998-08-24 | 2000-09-12 | Advanced Cardiovascular Systems, Inc. | Bifurcated catheter assembly |
| WO2000011953A1 (en) * | 1998-09-01 | 2000-03-09 | Penn State Research Foundation | Method and apparatus for aseptic growth or processing of biomass |
| PL347904A1 (en) | 1998-10-07 | 2002-04-22 | Syngenta Participations Ag | Therapeutically active proteins in plants |
| JP3689803B2 (ja) | 1998-10-20 | 2005-08-31 | 株式会社ロッテ | 歯牙エナメル質の再石灰化促進剤及び口腔用組成物並びに飲食物 |
| US6528063B2 (en) * | 1999-01-04 | 2003-03-04 | Rahan Meristem | Recombinant vaccines against IBDV |
| US6432698B1 (en) * | 1999-01-06 | 2002-08-13 | Rutgers, The State University | Disposable bioreactor for culturing microorganisms and cells |
| ES2313882T3 (es) * | 1999-02-01 | 2009-03-16 | Board Of Regents, The University Of Texas System | Protesis endovasculares tejidas bifurcadas y trifurcadas y procedimiento para fabricar las mismas. |
| US20040167613A1 (en) * | 1999-03-11 | 2004-08-26 | Ofer Yodfat | Implantable stroke prevention device |
| IL128938A0 (en) * | 1999-03-11 | 2000-02-17 | Mind Guard Ltd | Implantable stroke treating device |
| US6673089B1 (en) * | 1999-03-11 | 2004-01-06 | Mindguard Ltd. | Implantable stroke treating device |
| US6146370A (en) | 1999-04-07 | 2000-11-14 | Coaxia, Inc. | Devices and methods for preventing distal embolization from the internal carotid artery using flow reversal by partial occlusion of the external carotid artery |
| NL1012782C2 (nl) | 1999-08-05 | 2001-02-06 | Keygene Nv | Verbeterde gfp-variant, bruikbaar als markering, en gfp-construct. |
| US6409757B1 (en) * | 1999-09-15 | 2002-06-25 | Eva Corporation | Method and apparatus for supporting a graft assembly |
| US6383171B1 (en) * | 1999-10-12 | 2002-05-07 | Allan Will | Methods and devices for protecting a passageway in a body when advancing devices through the passageway |
| US20020127219A1 (en) | 1999-12-30 | 2002-09-12 | Okkels Jens Sigurd | Lysosomal enzymes and lysosomal enzyme activators |
| AU2352201A (en) | 1999-12-30 | 2001-07-16 | Maxygen Aps | Improved lysosomal enzymes and lysosomal enzyme activators |
| US20040010308A1 (en) * | 2000-01-18 | 2004-01-15 | Mindguard Ltd. | Implantable composite device and corresponding method for deflecting embolic material in blood flowing at an arterial bifurcation |
| US20040010307A1 (en) * | 2000-01-18 | 2004-01-15 | Mindguard Ltd. | Implantable integral device and corresponding method for deflecting embolic material in blood flowing at an arterial bifurcation |
| US6312463B1 (en) | 2000-02-01 | 2001-11-06 | Endotex Interventional Systems, Inc. | Micro-porous mesh stent with hybrid structure |
| JP2002000248A (ja) | 2000-06-23 | 2002-01-08 | Daiichi Kagaku Kk | 凍結法及び凍結乾燥法 |
| IL137326A0 (en) * | 2000-07-17 | 2001-07-24 | Mind Guard Ltd | Implantable braided stroke preventing device and method of manufacturing |
| EP1305437B1 (en) * | 2000-07-31 | 2010-09-01 | Biolex Therapeutics, Inc. | Expression of biologically active polypeptides in duckweed |
| US7138262B1 (en) | 2000-08-18 | 2006-11-21 | Shire Human Genetic Therapies, Inc. | High mannose proteins and methods of making high mannose proteins |
| CA2429210A1 (en) | 2000-11-15 | 2002-05-23 | Jason C. Goodrick | Expression system for recombinant proteins |
| EP2088200B1 (en) | 2000-11-17 | 2012-01-04 | Danisco US Inc. | Manipulation of the phenolic acid content and digestibility of plant cell walls by targeted expression of genes encoding cell wall degrading enzymes |
| JP2002238580A (ja) | 2001-02-20 | 2002-08-27 | Naoyuki Taniguchi | 動物型糖鎖付加機能を持つ植物細胞 |
| US6488704B1 (en) | 2001-05-07 | 2002-12-03 | Biomed Solutions, Llc | Implantable particle measuring apparatus |
| JP2004529645A (ja) | 2001-04-18 | 2004-09-30 | フラームス・インテルウニフェルシタイル・インステイチュート・フォール・ビオテヒノロヒー・ヴェーゼットウェー | 生物学的細胞での2次代謝物の生産促進のための膜トランスポーターポンプをコードする遺伝子の使用 |
| US7629309B2 (en) | 2002-05-29 | 2009-12-08 | Zystor Therapeutics, Inc. | Targeted therapeutic proteins |
| US20030100945A1 (en) * | 2001-11-23 | 2003-05-29 | Mindguard Ltd. | Implantable intraluminal device and method of using same in treating aneurysms |
| CA2353307A1 (fr) | 2001-07-13 | 2003-01-13 | Carmen Parent | Appareil et procede pour le traitement des effluents gazeux |
| WO2003013598A2 (en) | 2001-08-09 | 2003-02-20 | Lam Dominic M K | Novel vaccine compositions and methods of vaccine preparation for veterinary and human diseases |
| US6638294B1 (en) | 2001-08-30 | 2003-10-28 | Advanced Cardiovascular Systems, Inc. | Self furling umbrella frame for carotid filter |
| US20070124830A1 (en) | 2002-07-03 | 2007-05-31 | Henry Daniell | Plastid genetic engineering via somatic embryogenesis |
| ITRM20020115A1 (it) | 2002-03-01 | 2003-09-01 | Plantechno S R L | Espressione di enzimi lisosomiali in seme. |
| ES2224792B1 (es) | 2002-06-28 | 2007-02-16 | Era Plantech, S.L. | Produccion de peptidos y proteinas por acumulacion de cuerpos proteicos derivados de reticulos endoplasmico en plantas. |
| US7316774B2 (en) | 2002-07-22 | 2008-01-08 | Kinetico Incorporated | Fluid treatment system |
| US7951557B2 (en) * | 2003-04-27 | 2011-05-31 | Protalix Ltd. | Human lysosomal proteins from plant cell culture |
| US7296856B2 (en) * | 2003-10-08 | 2007-11-20 | Pride Mobility Products Corporation | Reclining seat with movable back support |
| CA2545160A1 (en) * | 2003-11-06 | 2005-05-19 | Compugen Ltd. | Variants of human glycoprotein hormone alpha chain: compositions and uses thereof |
| US20090130704A1 (en) | 2003-11-13 | 2009-05-21 | Gyure Dale C | Novel bioreactor |
| CN1882681B (zh) | 2003-11-18 | 2012-02-15 | 雀巢技术公司 | 细胞培养系统 |
| TWI228313B (en) * | 2003-11-21 | 2005-02-21 | Hannstar Display Corp | Pixel and repairing method thereof |
| AU2005240969A1 (en) | 2004-04-27 | 2005-11-17 | Baxter Healthcare S.A. | Stirred-tank reactor system |
| EP1602715B1 (en) | 2004-06-02 | 2008-06-11 | Millipore Corporation | Disposable bioreactor |
| MXPA06014099A (es) | 2004-06-04 | 2007-05-09 | Xcellerex Inc | Sistemas biorreactores desechables y metodos. |
| AU2005290847A1 (en) | 2004-10-03 | 2006-04-13 | Serge Goldman | Multi-cortical dental implant anchor, dental implant kit and template |
| CA2583691A1 (en) * | 2004-10-13 | 2006-04-20 | Protalix Ltd. | System and method for production of antibodies in plant cell culture |
| WO2007005882A2 (en) * | 2005-07-05 | 2007-01-11 | North Carolina State University | Methods and compositions for expressing proteins in plants |
| BRPI0616012A2 (pt) * | 2005-07-18 | 2011-05-31 | Protalix Ltd | administração via mucosa ou intestino de macromoléculas biologicamente ativas |
| US20070102128A1 (en) * | 2005-11-10 | 2007-05-10 | Levit Mikhail R | Wood pulp paper with high antimicrobial barrier level |
| US8470584B2 (en) | 2006-05-10 | 2013-06-25 | Ohio University | Apparatus and method for growing biological organisms for fuel and other purposes |
| WO2008066980A1 (en) * | 2006-12-01 | 2008-06-05 | Albemarle Corporation | Production of high purity decabromodiphenylalkanes |
| CN101861382B (zh) | 2007-05-07 | 2015-07-15 | 普罗塔里克斯有限公司 | 大规模一次性生物反应器 |
| US8956823B2 (en) * | 2007-08-20 | 2015-02-17 | Bio-Rad Laboratories, Inc. | Anti-antibody reagent |
-
2007
- 2007-04-30 US US11/790,991 patent/US7951557B2/en not_active Expired - Lifetime
-
2008
- 2008-04-30 KR KR1020097024840A patent/KR20100023833A/ko not_active Withdrawn
- 2008-04-30 CN CN200880023217A patent/CN101855232A/zh active Pending
- 2008-04-30 EP EP08738278A patent/EP2220105A4/en not_active Withdrawn
- 2008-04-30 JP JP2010505007A patent/JP2010525806A/ja active Pending
- 2008-04-30 BR BRPI0810003-9A patent/BRPI0810003A2/pt not_active IP Right Cessation
- 2008-04-30 AU AU2008243744A patent/AU2008243744A1/en not_active Abandoned
- 2008-04-30 MX MX2009011751A patent/MX2009011751A/es not_active Application Discontinuation
- 2008-04-30 WO PCT/IL2008/000576 patent/WO2008132743A2/en not_active Ceased
- 2008-04-30 RU RU2009143751/10A patent/RU2009143751A/ru not_active Application Discontinuation
- 2008-04-30 CA CA002685400A patent/CA2685400A1/en not_active Abandoned
-
2009
- 2009-04-23 US US12/385,894 patent/US8790641B2/en not_active Expired - Lifetime
- 2009-11-30 ZA ZA2009/08423A patent/ZA200908423B/en unknown
-
2011
- 2011-04-06 US US13/080,692 patent/US8227230B2/en not_active Expired - Fee Related
- 2011-04-06 US US13/080,694 patent/US8449876B2/en not_active Expired - Fee Related
-
2012
- 2012-07-23 US US13/555,243 patent/US8741620B2/en not_active Expired - Lifetime
- 2012-12-27 US US13/727,632 patent/US20130177538A1/en not_active Abandoned
-
2014
- 2014-06-02 US US14/292,966 patent/US9220737B2/en not_active Expired - Lifetime
-
2015
- 2015-11-11 US US14/937,939 patent/US20160095907A1/en not_active Abandoned
Cited By (41)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9220737B2 (en) | 2003-04-27 | 2015-12-29 | Protalix Ltd. | Plant cell culture expressing human lysosomal proteins and uses thereof |
| WO2008132743A3 (en) * | 2007-04-30 | 2010-06-03 | Protalix Ltd. | Production of high mannose proteins in plant culture |
| US10364413B2 (en) | 2007-05-07 | 2019-07-30 | Protalix Ltd. | Large scale disposable bioreactor |
| US8742079B2 (en) | 2007-08-20 | 2014-06-03 | Protalix Ltd. | Saccharide-containing protein conjugates and uses thereof |
| WO2011017177A1 (en) | 2009-07-28 | 2011-02-10 | Shire Human Genetic Therapies | Compositions and methods for treating gaucher disease |
| EP3354277A1 (en) | 2009-07-28 | 2018-08-01 | Shire Human Genetic Therapies, Inc. | Compositions and methods for treating gaucher disease |
| US9708595B2 (en) | 2009-11-17 | 2017-07-18 | Protalix Ltd. | Stabilized alpha-galactosidase and uses thereof |
| WO2011061736A1 (en) | 2009-11-17 | 2011-05-26 | Protalix Ltd. | Alkaline alpha galactosidase for the treatment of fabry disease |
| US12385026B2 (en) | 2009-11-17 | 2025-08-12 | Protalix Ltd. | Stabilized alpha-galactosidase and uses thereof |
| US10870842B2 (en) | 2009-11-17 | 2020-12-22 | Protalix Ltd. | Stabilized alpha-galactosidase and uses thereof |
| US10280414B2 (en) | 2009-11-17 | 2019-05-07 | Protalix Ltd. | Stabilized α-galactosidase and uses thereof |
| US9194011B2 (en) | 2009-11-17 | 2015-11-24 | Protalix Ltd. | Stabilized alpha-galactosidase and uses thereof |
| WO2011068808A1 (en) * | 2009-12-01 | 2011-06-09 | Shire Human Genetic Therapies | Enzymatic activity based-detection |
| US9383359B2 (en) | 2009-12-01 | 2016-07-05 | Shire Human Genetic Therapies, Inc. | Enzymatic activity based-detection |
| US8778622B2 (en) | 2009-12-01 | 2014-07-15 | Shire Human Genetic Therapies, Inc. | Enzymatic activity-based detection |
| JP2014237694A (ja) * | 2010-03-02 | 2014-12-18 | プロタリクス リミテッド | 安定化α−ガラクトシダーゼおよびその使用 |
| WO2011107991A1 (en) | 2010-03-02 | 2011-09-09 | Protalix Ltd. | Glucocerebrosidase multimers and uses thereof |
| EP3088514A1 (en) | 2010-03-02 | 2016-11-02 | Protalix Ltd. | Stabilized alpha-galactosidase and uses thereof |
| EP2865751A1 (en) | 2010-03-02 | 2015-04-29 | Protalix Ltd. | Stabilized alpha-galactosidase and uses thereof |
| WO2012098537A1 (en) | 2011-01-20 | 2012-07-26 | Protalix Ltd. | Nucleic acid construct for expression of alpha-galactosidase in plants and plant cells |
| US9732333B2 (en) | 2011-01-20 | 2017-08-15 | Protalix Ltd. | Nucleic acid construct for expression of alpha-galactosidase in plants and plant cells |
| EP3272861A1 (en) * | 2011-01-20 | 2018-01-24 | Protalix Ltd. | Alpha-galactosidase compositions |
| KR101883803B1 (ko) * | 2011-01-20 | 2018-07-31 | 프로탈릭스 리미티드 | 식물 및 식물 세포에서 알파-갈락토시다제의 발현용 핵산 작제물 |
| US9447396B2 (en) | 2011-03-09 | 2016-09-20 | Honda Motor Co., Ltd. | Method for accumulating protein in plant cells |
| US9562904B2 (en) | 2011-06-08 | 2017-02-07 | Shire Human Genetic Therapies, Inc. | Competition based-detection assays |
| US9075057B2 (en) | 2011-06-08 | 2015-07-07 | Shire Human Genetic Therapies, Inc. | Competition-based detection assays |
| WO2013121405A1 (en) | 2012-02-19 | 2013-08-22 | Protalix Ltd. | Oral unit dosage forms and uses of same for the treatment of gaucher disease |
| WO2013130963A1 (en) | 2012-03-02 | 2013-09-06 | Shire Human Genetic Therapies, Inc. | Compositions and methods for treating type iii gaucher disease |
| US11472854B2 (en) | 2012-03-09 | 2022-10-18 | Vestaron Corporation | Insecticidal peptide production, peptide expression in plants and combinations of cysteine rich peptides |
| US11692016B2 (en) | 2012-03-09 | 2023-07-04 | Vestaron Corporation | High gene expression yeast strain |
| US12410218B2 (en) | 2012-03-09 | 2025-09-09 | Vestaron Corporation | Insecticidal peptide production and combination of cysteine rich peptides |
| WO2015118547A1 (en) | 2014-02-10 | 2015-08-13 | Protalix Ltd. | Method of maintaining disease stability in a subject having gaucher's disease |
| US11401563B2 (en) | 2015-03-17 | 2022-08-02 | eleva GmbH | Glycosylated lysosomal proteins, method of production and uses |
| US12247215B2 (en) | 2015-03-17 | 2025-03-11 | eleva GmbH | Glycosylated lysosomal proteins, method of production and uses |
| WO2016146760A1 (en) | 2015-03-17 | 2016-09-22 | Greenovation Biotech Gmbh | Glycosylated lysosomal proteins, method of production and uses |
| US11103596B2 (en) | 2015-05-11 | 2021-08-31 | Ucl Business Plc | Fabry disease gene therapy |
| US12370268B2 (en) | 2015-05-11 | 2025-07-29 | Ucl Business Ltd | Fabry disease gene therapy |
| EP3528617A4 (en) * | 2016-10-21 | 2020-11-25 | Vestaron Corporation | CLIVABLE PEPTIDES AND PROTEINS, INSECTICIDES AND NEMATICIDES CONTAINING THEM |
| US11447531B2 (en) | 2016-10-21 | 2022-09-20 | Vestaron Corporation | Cleavable peptides and insecticidal and nematicidal proteins comprising same |
| US11535653B2 (en) | 2016-10-21 | 2022-12-27 | Vestaron Corporation | Cleavable peptides and insecticidal and nematicidal proteins comprising same |
| EP3700526A1 (en) | 2017-10-26 | 2020-09-02 | Shire Human Genetic Therapies, Inc. | Formulations comprising glucocerebrosidase and isofagomine |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2220105A4 (en) | 2011-01-19 |
| CA2685400A1 (en) | 2008-11-06 |
| US20160095907A1 (en) | 2016-04-07 |
| KR20100023833A (ko) | 2010-03-04 |
| US20110182868A1 (en) | 2011-07-28 |
| US20110250181A1 (en) | 2011-10-13 |
| CN101855232A (zh) | 2010-10-06 |
| US8449876B2 (en) | 2013-05-28 |
| BRPI0810003A2 (pt) | 2015-07-21 |
| US20140271577A1 (en) | 2014-09-18 |
| US8790641B2 (en) | 2014-07-29 |
| JP2010525806A (ja) | 2010-07-29 |
| US7951557B2 (en) | 2011-05-31 |
| US20130177538A1 (en) | 2013-07-11 |
| US8741620B2 (en) | 2014-06-03 |
| WO2008132743A3 (en) | 2010-06-03 |
| US9220737B2 (en) | 2015-12-29 |
| ZA200908423B (en) | 2010-12-29 |
| EP2220105A2 (en) | 2010-08-25 |
| MX2009011751A (es) | 2010-02-22 |
| US8227230B2 (en) | 2012-07-24 |
| US20120282231A1 (en) | 2012-11-08 |
| US20090208477A1 (en) | 2009-08-20 |
| US20080038232A1 (en) | 2008-02-14 |
| AU2008243744A1 (en) | 2008-11-06 |
| RU2009143751A (ru) | 2011-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8790641B2 (en) | Production of high mannose proteins in plant culture and therapeutic uses thereof | |
| EP2343378B1 (en) | Production of high mannose proteins in plant culture | |
| US20100196345A1 (en) | Production of high mannose proteins in plant culture | |
| AU2007201909B2 (en) | Production of High Mannose Proteins in Plant Culture | |
| HK1088041B (en) | High mannose glucocerebrosidease and its production in plant culture |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200880023217.7 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2685400 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201799 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2009/011751 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010505007 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008243744 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009143751 Country of ref document: RU Ref document number: 7705/DELNP/2009 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 20097024840 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008738278 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2008243744 Country of ref document: AU Date of ref document: 20080430 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12451188 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: PI0810003 Country of ref document: BR Kind code of ref document: A2 Effective date: 20091030 |