WO2004080425A2 - Polypeptide compounds for inhibiting angiogenesis and tumor growth - Google Patents
Polypeptide compounds for inhibiting angiogenesis and tumor growth Download PDFInfo
- Publication number
- WO2004080425A2 WO2004080425A2 PCT/US2004/007755 US2004007755W WO2004080425A2 WO 2004080425 A2 WO2004080425 A2 WO 2004080425A2 US 2004007755 W US2004007755 W US 2004007755W WO 2004080425 A2 WO2004080425 A2 WO 2004080425A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ephb4
- polypeptide
- ephrin
- protein
- soluble
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2866—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
Definitions
- Angiogenesis the development of new blood vessels from the endothelium of a preexisting vasculature, is a critical process in the growth, progression, and metastasis of solid tumors within the host.
- angiogenesis the autocrine, paracrine, and amphicrine interactions ofthe vascular endothelium with its surrounding stromal components are tightly regulated both spatially and temporally.
- the levels and activities of proangiogenic and angiostatic cytokines and growth factors are maintained in balance.
- the pathological angiogenesis necessary for active tumor growth is sustained and persistent, representing a dysregulation ofthe normal angiogenic system.
- Solid and hematopoietic tumor types are particularly associated with a high level of abnormal angiogenesis.
- the disclosure provides polypeptide agents that inhibit EphB4 or EphrinB2 mediated functions, including monomeric ligand binding portions ofthe EphB4 and EphrinB2 proteins and antibodies that bind to and affect EphB4 or EphrinB2 in particular ways.
- EphB4 and EphrinB2 participate in various disease states, including cancers and diseases related to unwanted or excessive angiogenesis. Accordingly, certain polypeptide agents disclosed herein may be used to treat such diseases.
- the disclosure relates to the discovery that EphB4 and/or EphrinB2 are expressed, often at high levels, in a variety of tumors.
- polypeptide agents that downregulate EphB4 or EphrinB2 function may affect tumors by a direct effect on the tumor cells as well as an indirect effect on the angiogenic processes recruited by the tumor, h certain embodiments, the disclosure provides the identity of tumor types particularly suited to treatment with an agent that downregulates EphB4 or EphrinB2 function.
- the disclosure provides soluble EphB4 polypeptides comprising an amino acid sequence of an extracellular domain of an EphB4 protein.
- the soluble EphB4 polypeptides bind specifically to an EphrinB2 polypeptide.
- the term "soluble" is used merely to indicate that these polypeptides do not contain a transmembrane domain or a portion of a transmembrane domain sufficient to compromise the solubility ofthe polypeptide in a physiological salt solution.
- Soluble polypeptides are preferably prepared as monomers that compete with EphB4 for binding to ligand such as EphrinB2 and inhibit the signaling that results from EphB4 activation.
- a soluble polypeptide may be prepared in a multimeric form, by, for example, expressing as an Fc fusion protein or fusion with another multimerization domain. Such multimeric forms may have complex activities, having agonistic or antagonistic effects depending on the context.
- the soluble EphB4 polypeptide comprises a globular domain of an EphB4 protein.
- a soluble EphB4 polypeptide may comprise a sequence at least 90% identical to residues 1-522 ofthe amino acid sequence defined by Figure 65.
- a soluble EphB4 polypeptide may comprise a sequence at least 90% identical to residues 1-412 ofthe amino acid sequence defined by Figure 65.
- a soluble EphB4 polypeptide may comprise a sequence at least 90% identical to residues 1-312 ofthe amino acid sequence defined by Figure 65.
- a soluble EphB4 polypeptide may comprise a sequence as set forth in Figure 1 or 2.
- the soluble EphB4 polypeptide may inhibit the interaction between Ephrin B2 and EphB4.
- the soluble EphB4 polypeptide may inhibit clustering of or phosphorylation of Ephrin B2 or EphB4. Phosphorylation of EphrinB2 or EphB4 is generally considered to be one ofthe initial events in triggering intracellular signaling pathways regulated by these proteins.
- the soluble EphB4 polypeptide may be prepared as a monomeric or multimeric fusion protein.
- the soluble polypeptide may include one or more modified amino acids. Such amino acids may contribute to desirable properties, such as increased resistance to protease digestion.
- the disclosure provides soluble EphrinB2 polypeptides comprising an amino acid sequence of an extracellular domain of an EphrinB2 protein.
- the soluble EphrinB2 polypeptides bind specifically to an EphB4 polypeptide.
- the term "soluble" is used merely to indicate that these polypeptides do not contain a transmembrane domain or a portion of a transmembrane domain sufficient to compromise the solubility ofthe polypeptide in a physiological salt solution.
- Soluble polypeptides are preferably prepared as monomers that compete with EphrinB2 for binding to ligand such as EphB4 and inhibit the signaling that results from EphrinB2 activation.
- a soluble polypeptide may be prepared in a multimeric form, by, for example, expressing as an Fc fusion protein or fusion with another multimerization domain. Such multimeric forms may have complex activities, having agonistic or antagonistic effects depending on the context.
- a soluble EphrinB2 polypeptide may comprise residues 1-225 ofthe amino acid sequence defined by Figure 66.
- a soluble EphrinB2 polypeptide may comprise a sequence defined by Figure 3.
- the soluble EphrinB2 polypeptide may inhibit the interaction between Ephrin B2 and EphB4.
- the soluble EphrinB2 polypeptide may inhibit clustering of or phosphorylation of EphrinB2 or EphB4.
- the soluble EphrinB2 polypeptide may be prepared as a monomeric or multimeric fusion protein.
- the soluble polypeptide may include one or more modified amino acids. Such amino acids may contribute to desirable properties, such as increased resistance to protease digestion.
- the disclosure provides antagonist antibodies for EphB4 and
- EphrinB2 An antibody may be designed to bind to an extracellular domain of an EphB4 protein and inhibit an activity ofthe EphB4. An antibody may be designed to bind to an extracellular domain of an Ephrin B2 protein and inhibit an activity ofthe Ephrin B2. An antibody may be designed to inhibit the interaction between Ephrin B2 and EphB4.
- An antagonist antibody will generally affect Eph and/or Ephrin signaling. For example, an antibody may inhibit clustering or phosphorylation of Ephrin B2 or EphB4.
- An antagonist antibody may be essentially any polypeptide comprising a variable portion of an antibody, including, for example, monoclonal and polyclonal antibodies, single chain antibodies, diabodies, minibodies, etc.
- the disclosure provides pharmaceutical formulations comprising a polypeptide reagent and a pharmaceutically acceptable carrier.
- the polypeptide reagent may be any disclosed herein, including, for example, soluble EphB4 or EphrinB2 polypeptides and antagonist antibodies. Additional formulations include cosmetic compositions and diagnostic kits.
- a method may comprise contacting the cell with an effective amount of a polypeptide agent, such as (a) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an EphB4 protein, wherein the EphB4 polypeptide is a monomer and binds specifically to an Ephrin B2 polypeptide; (b) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an Ephrin B2 protein, wherein the soluble Ephrin B2 polypeptide is a monomer and binds with high affinity to an EphB4 polypeptide; (c) an antibody which binds to an extracellular domain of an EphB4 protein and inhibits an activity ofthe EphB4; or (d) an antibody which binds to an extracellular domain of an Ephrin B2 protein and inhibits an activity ofthe Ephrin B2.
- a polypeptide agent such as (a) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an Ep
- the disclosure provides methods for reducing the growth rate of a tumor, comprising administering an amount of a polypeptide agent sufficient to reduce the growth rate ofthe tumor, wherein the polypeptide agent is selected from the group consisting of: (a) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an EphB4 protein, wherein the EphB4 polypeptide is a monomer and binds specifically to an Ephrin B2 polypeptide; (b) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an Ephrin B2 protein, wherein the soluble Ephrin B2 polypeptide is a monomer and binds with high affinity to an EphB4 polypeptide; (c) an antibody which binds to an extracellular domain of an EphB4 protein and inhibits an activity ofthe EphB4; and (d) an antibody which binds to an extracellular domain of an Ephrin B2 protein and inhibits an activity ofthe Ephrin B2.
- the tumor comprises cells expressing a higher level of EphB4 and/or EphrinB2 than noncancerous cells of a comparable tissue.
- a method may comprise administering to the patient a polypeptide agent selected from the group consisting of: (a) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an EphB4 protein, wherein the EphB4 polypeptide is a monomer and binds specifically to an Ephrin B2 polypeptide; (b) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an Ephrin B2 protein, wherein the soluble Ephrin B2 polypeptide is a monomer and binds with high affinity to an EphB4 polypeptide; (c) an antibody which binds to an extracellular domain of an EphB4 protein and inhibits an activity ofthe EphB4; and (d) an antibody which binds to an extrapeptide
- the cancer comprises cancer cells expressing EphrinB2 and/or EphB4 at a higher level than noncancerous cells of a comparable tissue.
- the cancer may be a metastatic cancer.
- the cancer may be selected from the group consisting of colon carcinoma, breast tumor, mesothelioma, prostate tumor, squamous cell carcinoma, Kaposi sarcoma, and leukemia.
- the cancer is an angiogenesis-dependent cancer or an angiogenesis independent cancer.
- the polypeptide agent employed may inhibit clustering or phosphorylation of Ephrin B2 or EphB4.
- a polypeptide agent may be co-administered with one or more additional anti- cancer chemotherapeutic agents that inhibit cancer cells in an additive or synergistic manner with the polypeptide agent.
- the disclosure provides methods of inhibiting angiogenesis.
- a method may comprise contacting a cell with an amount of a polypeptide agent sufficient to inhibit angiogenesis, wherein the polypeptide agent is selected from the group consisting of: (a) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an EphB4 protein, wherein the EphB4 polypeptide is a monomer and binds specifically to an Ephrin B2 polypeptide; (b) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an Ephrin B2 protein, wherein the soluble Ephrin B2 polypeptide is a monomer and binds with high affinity to an EphB4 polypeptide; (c) an antibody which binds to an extracellular domain of an EphB4 protein
- the disclosure provides methods for treating a patient suffering from an angiogenesis-associated disease, comprising administering to the patient a polypeptide agent selected from the group consisting of: (a) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an EphB4 protein, wherein the EphB4 polypeptide is a monomer and binds specifically to an Ephrin B2 polypeptide; (b) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an Ephrin B2 protein, wherein the soluble Ephrin B2 polypeptide is a monomer and binds with high affinity to an EphB4 polypeptide; (c) an antibody which binds to an extracellular domain of an EphB4 protein and inhibits an activity ofthe EphB4; and (d) an antibody which binds to an extracellular domain of an Ephrin B2 protein and inhibits an activity ofthe Ephrin B2.
- a polypeptide agent selected from the group consisting of:
- the soluble polypeptide may be formulated with a pharmaceutically acceptable carrier.
- An angiogenesis related disease or unwanted angiogenesis related process may be selected from the group consisting of angiogenesis-dependent cancer, benign tumors, inflammatory disorders, chronic articular rheumatism and psoriasis, ocular angiogenic diseases, Osier- Webber Syndrome, myocardial angiogenesis, plaque neovascularization, telangiectasia, hemophiliac joints, angiofibroma, wound granulation, wound healing, telangiectasia psoriasis scleroderma, pyogenic granuloma, cororany collaterals, ischemic limb angiogenesis, rubeosis, arthritis, diabetic neovascularization, fractures, vasculogenesis, and hematopoiesis.
- An polypeptide agent may be co-administered with at least one additional anti-angiogenesis agent that inhibits angiogenesis in an
- the disclosure provides for the use of a polypeptide agent in the manufacture of medicament for the treatment of cancer or an angiogenesis related disorder, wherein the polypeptide agent is selected from the group consisting of: (a) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an EphB4 protein, wherein the EphB4 polypeptide is a monomer and binds specifically to an Ephrin B2 polypeptide; (b) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an Ephrin B2 protein, wherein the soluble Ephrin B2 polypeptide is a monomer and binds with high affinity to an EphB4 polypeptide; (c) an antibody which binds to an extracellular domain of an EphB4 protein and inhibits an activity ofthe EphB4; and (d) an antibody which binds to an extracellular domain of an Ephrin B2 protein and inhibits an activity ofthe Ephrin B2.
- the polypeptide agent is selected
- the disclosure provides methods for for treating a patient suffering from a cancer, comprising: (a) identifying in the patient a tumor having a plurality of cancer cells that express EphB4 and/or EphrinB2; and (b) administering to the patient a polypeptide agent selected from the group consisting of: (i) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an EphB4 protein, wherein the EphB4 polypeptide is a monomer and binds specifically to an Ephrin B2 polypeptide; (ii) a soluble polypeptide comprising an amino acid sequence of an extracellular domain of an Ephrin B2 protein, wherein the soluble Ephrin B2 polypeptide is a monomer and binds with high affinity to an EphB4 polypeptide; (iii) an antibody which binds to an extracellular domain of an EphB4 protein and inhibits an activity ofthe EphB4; and (iv) an antibody which bind
- the disclosure provides methods for identifying a tumor that is suitable for treatment with an EphrinB2 or EphB4 antagonist.
- a method may comprise detecting in the tumor cell one or more ofthe following characteristics: (a) expression of EphB4 protein and/or mRNA; (b) expression of EphrinB2 protein and/or mRNA; (c) gene amplification ofthe EphB4 gene; or (d) gene amplification ofthe EphrihB2 gene.
- a tumor cell having one or more of characteristics (a)-(d) may be suitable for treatment with an EphrinB2 or EphB4 antagonist, such as a polypeptide agent described herein.
- Figure 1 shows amino acid sequence ofthe B4ECv3 protein (predicted sequence of the precursor including uncleaved Eph B4 leader peptide is shown).
- Figure 2 shows amino acid sequence ofthe B4ECv3NT protein (predicted sequence ofthe precursor including uncleaved Eph B4 leader peptide is shown).
- Figure 3 shows amino acid sequence ofthe B2EC protein (predicted sequence ofthe precursor including uncleaved Ephrin B2 leader peptide is shown).
- Figure 4 shows amino acid sequence ofthe B4ECv3-FC protein (predicted sequence ofthe precursor including uncleaved Eph B4 leader peptide is shown).
- Figure 5 shows amino acid sequence ofthe B2EC-FC protein (predicted sequence of the precursor including uncleaved Ephrin B2 leader peptide is shown).
- Figure 6 shows B4EC-FC binding assay (Protein A-agarose based).
- Figure 7 shows B4EC-FC inhibition assay (Inhibition in solution).
- Figure 8 shows B2EC-FC binding assay (Protein- A- agarose based assay).
- Figure 9 shows chemotaxis of HUAEC in response to B4Ecv3.
- Figure 10 shows chemotaxis of HHEC in response to B2EC-FC.
- Figure 11 shows chemotaxis of HHAEC in response to B2EC.
- Figure 12 shows effect of B4Ecv3 on HUAEC tubule formation.
- Figure 13 shows effect of B2EC-FC on HUAEC tubule formation.
- Figure 14 is a schematic representation of human Ephrin B2 constructs.
- Figure 15 is a schematic representation of human EphB4 constructs.
- Figure 16 shows the domain structure ofthe recombinant soluble EphB4EC proteins. Designation ofthe domains are as follows: L - leader peptide, G- globular (ligand-binding domain), C - Cys-rich domain, FI, F2 - fibronectin type III repeats, H - 6 x His-tag.
- Figure 17 shows purification and ligand binding properties ofthe EphB4EC proteins.
- A SDS-PAAG gel electrophoresis of purified EphB4-derived recombinant soluble proteins (Coomassie-stained).
- B Binding of Ephrin B2-AP fusion to EphB4-derived recombinant proteins immobilized on Ni-NTA-agarose beads. Results of tliree independent experiments are shown for each protein. Vertical axis - optical density at 420 nm.
- Figure 18 shows that EphB4v3 inhibits chemotaxis.
- Figure 19 shows that EphB4v3 inhibits tubule formation on Matrigel.
- A displays the strong inhibition of tubule formation by B4v3 in a representative experiment.
- B shows a quantitation ofthe reduction of tube-length obtained with B4v3 at increasing concentrations as well as a reduction in the number of junctions, in comparison to cells with no protein. Results are displayed as mean values _ S.D. obtained from three independent experiments performed with duplicate wells.
- Figure 20 shows that soluble EphB4 has no detectable cytotoxic effect as assessed by MTS assay.
- Figure 21 shows that B4v3 inhibits invasion and tubule formation by endothelial cells in the Matrigel assay.
- A to detect total invading cells, photographed at 20X magnification or with Masson's Trichrome
- Top left of A B displays section of a Matrigel plug with no GF
- top right of A displays section with B4IgG containing GF and lower left section contains GF
- lower right shows GF in the presence of B4v3.
- Significant invasion of endothelial cells is only seenin GF containing Matrigel.
- Top right displays an area with a high number of invaded cells induced by B4IgG, which signifies the dimeric form of B4v3.
- the left upper parts ofthe pictures correspond to the cell layers formed around the Matrigel plug from which cells invade toward the center ofthe plug located in the direction ofthe right lower corner.
- Total cells in sections ofthe Matrigel plugs were quantitated with Scion Image software. Results obtained from two experiments with duplicate plugs are displayed as mean values _ S.D.
- Figure 22 shows tyrosine phosphorylation of EphB4 receptor in PC3 cells in response to stimulation with EphrinB2-Fc fusion in presence or absence of EphB4-derived recombinant soluble proteins.
- Figure 23 shows effects of soluble EphB4ECD on viability and cell cycle.
- Figure 24 shows that B4v3 inhibitis neovascular response in a murine corneal hydron micropocket assay.
- Figure 25 shows that that SCC15, B16, and MCF-7 co-injected with sB4v3 in the presence of matrigel and growth factors, inhibits the in vivo tumor growth of these cells.
- Figure 26 shows that soluble EphB4 causes apoptosis, necrosis and decreased angiogenesis in threee tumor types, B16 melanoma, SCC15, head and neck carcinoma, and MCF-7 Breast carcinoma. Tumors were injected premixed with Matrigel plus growth factors and soluble EphB4 subcutaneously. After 10 to 14 days, the mice were injected intravenously with fitc-lectin (green) to assess blood vessel perfusion.
- Tumors treated with control PBS displayed abundant tumor density and a robust angiogenic response
- Tumors treated with sEphB4 displayed a decrease in tumor cell density and a marked inhibition of tumor angiogenesis in regions with viable tumor cells, as well as tumor necrosis and apoptosis.
- Figure 27 shows expression of EphB4 in prostate cell lines.
- Figure 28 shows expression of EphB4 in prostate cancer tissue.
- Stroma and the normal epithelia are negative. Note membrane localization of stain in the tumor tissue, consistent with trans- membrane localization of EphB4.
- Representative QRT-PCR of RNA extracted from cancer specimens and adjacent BPH tissues (lower right).
- Figure 29 shows downregulation of EphB4 in prostate cancer cells by tumor suppressors and RXR expression.
- A) PC3 cells were co-transfected with truncated CD4 and p53 or PTEN or vector only. 24 h later CD4-sorted cells were collected, lysed and analyzed sequentially by Western blot for the expression of EphB4 and ⁇ -actin, as a normalizer protein.
- LNCaP-FGF is a stable transfection clone of FGF-8, while CWR22R-RXR stably expresses the RXR receptor.
- BPH- 1 was established from benign hypertrophic prostatic epithelium.
- Figure 30 shows downregulation of EphB4 in prostate cancer cells by EGFR and
- IGFR-1 Western Blot of PC3 cells treated with or without EGFR specific inhibitor AG1478 (1 M) for 36 hours. Decreased EphB4 signal is observed after AG 1478 treatment. The membrane was stripped and reprobed with ⁇ -actin, which was unaffected.
- Figure 31 shows effect of specific EphB4 AS-ODNs and siRNA on expression and prostate cell functions.
- Figure 32 shows effect of EphB4 siRNA 472 on cell cycle and apoptosis.
- Figure 33 shows that EphB4 and EphrinB2 are expressed in mesothelioma cell lines as shown by RT-PCR (A) and Western Blot (B).
- Figure 34 shows expression of ephrin B2 and EphB4 by in situ hybridization in mesothelioma cells.
- Figure 35 shows cellular expression of EphB4 and ephrin B2 in mesothelioma cultures.
- Figure 36 shows expression of ephrin B2 and EphB4 in mesothelioma tumor.
- Figure 37 shows effects of EPHB4 antisense probes (A) and EPHB4 siRNAs (B) on the growth of H28 cells.
- Figure 38 shows effects of EPHB4 antisense probes (A) and EPHB4 siRNAs (B) on cell migration.
- FIG 39 shows that EphB4 is expressed in HNSCC primary tissues and metastases.
- the right hand column are frozen sections of lymph node metastasis stained with EphB4 polyclonal antibody (top right) and visualized with DAB. Control (middle) was incubation with goat serum and H&E (bottom) reveals the location ofthe metastatic foci surrounded by sfroma which does not stain.
- Figure 40 shows that EphB4 is expressed in HNSCC cell lines and is regulated by EGF:
- Figure 41 shows mechanism of regulation of EphB4 by EGF: A) Schematic ofthe EGFR signaling pathways, showing in red the sites of action and names of specific kinase inhibitors used. B) SCC 15 cells were serum-starved for 24 h prior to an additional 24 incubation as indicated with or without EGF (10 ng/ml), 3 ⁇ M U73122, or 5 ⁇ M SH-5, 5 ⁇ M SP600125, 25 nM LY294002, - ⁇ M PD098095 or 5 ⁇ M SB203580. N/A indicates cultures that received equal volume of diluent (DMSO) only. Cell lysates were subjected to Western Blot with EphB4 monoclonal antibody, ⁇ -actin signal serves as control of protein loading and transfer.
- DMSO diluent
- Figure 42 shows that specific EphB4 siRNAs inhibit EphB4 expression, cell viability and cause cell cycle arrest.
- GFP green fluorescence protein
- C) SCC 15 cells transfected with siRNAs as indicated were analyzed 24 h post transfection for cell cycle status by flow cytometry as described in the Methods. Shown are the plots of cell number vs. propidium iodide fluorescence intensity. Top and middle row show plots for cells 16 h after siRNA transfection, bottom row shows plots for cells 36 h post transfection. Specific siRNA and concentration are indicated for each plot. Lipo LipofectamineTM200 mock transfection.
- Figure 43 shows in vitro effects of specific EphB4 AS-ODNs on SCC cells.
- AS-ODNs that were active in inhibiting EphB4 protein levels were also effective inhibitors of SCC 15 cell viability.
- Figure 44 shows that EphB4 AS-ODN inhibits tumor growth in vivo.
- * P 0.0001 by Student's t-test compared to scrambled ODN treated group.
- Figure 45 shows that Ephrin B2, but not EphB4 is expressed in KS biopsy tissue.
- A In situ hybridization with antisense probes for ephrin B2 and EphB4 with corresponding H&E stained section to show tumor architecture. Dark blue color in the ISH indicates positive reaction for ephrin B2. No signal for EphB4 was detected in the Kaposi's sarcoma biopsy. For contrast, ISH signal for EphB4 is strong in squamous cell carcinoma tumor cells. Ephrin B2 was also detected in KS using EphB4-AP fusion protein (bottom left).
- B Detection of ephrin B2 with EphB4/Fc fusion protein. Adjacent sections were stained with H&E (left) to show tumor architecture, black rectangle indicates the area shown in the
- EphB4/Fc treated section (middle) detected with FITC-labeled anti-human Fc antibody as described in the methods section. As a control an adjacent section was treated with human Fc fragment (right). Specific signal arising from EphB4/Fc binding to the section is seen only in areas of tumor cells.
- C Co-expression of ephrin B2 and the HHV8 latency protein LANA1. Double-label confocal immunofluorescence microscopy with antibodies to ephrin B2 (red) LANA1 (green), or EphB4 (red) of frozen KS biopsy material directly demonstrates co- expression of LANAl and ephrin B2 in KS biopsy. Coexpression is seen as yellow color. Double label confocal image of biopsy with antibodies to PEC AM- 1 (green) in cells with nuclear propidium iodide stain (red), demonstrating the vascular nature ofthe tumor.
- Figure 46 shows that HHV-8 induces arterial marker expression in venous endothelial cells.
- A Immunofluorescence of cultures of HUVEC and HUVEC/BC-1 for artery/vein markers and viral proteins. Cultures were grown on chamber slides and processed for immunofluorescence detection of ephrin B2 (a, e, i), EphB4 (m, q, u), CD 148 (j, v), and the HHV-8 proteins LANAl (b, f, m) or ORF59 (r) as described in the Materials and Methods. Yellow color in the merged images ofthe same field demonstrate co-expression of eplirin B2 and LANA or ephrin B2 and CD 148.
- Ephrin B2 product (200 bp) is seen in HUVEC/BC-1
- HUVEC/BC-3 and EphB4 product (400 bp) is seen in HUVEC.
- FIG. 47 shows that HHV-8 induces arterial marker expression in Kaposi's sarcoma cells.
- SLK-vGPCR is a stable clone of SLK expressing the HHV-8 vGPCR
- SLK-pCEFL is control stable clone transfected with empty expression vector.
- SLK cells transfected with LANA or LANA ⁇ 440 are SLK-LANA and SLK- ⁇ 440 respectively. Quantity of protein loading and transfer was determined by reprobing the membranes with ⁇ -actin monoclonal antibody.
- KS-SLK cells (0.8 x 105/ ell) were transfected with 0.8 ⁇ g DNA using Lipofectamine 2000. 24 hr later cells were fixed and stained with ephrin B2 polyclonal antibody and FITC conjugated secondary antibody as described in the methods.
- C Transient transfection of HUVEC with vGPCR induces transcription from ephrin B2 luciferase constructs.
- Figure 48 shows that VEGF and VEGF-C regulate ephrin B2 expression.
- Figure 49 shows that Eplirin B2 knock-down with specific siRNA inhibits viability in KS cells and HUVEC grown in the presence of VEGF but not IGF, EGF or bFGF.
- KS- SLK cells were transfected with various siRNA to ephrin B2 and controls. After 48 hr the cells were harvested and crude cell lysates fractionated on 4-20% SDS-PAGE. Western blot was performed with monoclonal antibody to ephrin B2 generated in-house. The membrane was stripped and reprobed with ⁇ -actin monoclonal antibody (Sigma) to illustrate equivalent loading and transfer.
- the cells were transfected using Lipofectamine 2000 (Invitrogen) in Opti-MEM medium containing 10 nM of siRNA to ephrin B2, Eph B4 or green fluorescence protein (GFP) as control.
- the cells were incubated for 2 hr and then the fresh media containing growth factors or VEGF alone was added to their respective wells. After 48 hrs, the cells were stained with crystal violet and the pictures were taken immediately by digital camera at 10X magnification.
- Figure 50 shows that soluble EphB4 inhibits KS and EC cord formation and in vivo angiogenesis.
- Cord formation assay of HUVEC in MatrigelTM (upper row).
- Figure 52 shows that transfection of p53 inhibit the expression of EPHB4 in 5637 cell.
- Figure 53 shows growth inhibition of bladder cancer cell line (5637) upon treatment with EPHB4 siRNA 472.
- Figure 54 shows results on apoptosis study of 5637 cells transfected with EPHB4 siRNA 472.
- Figure 55 shows effects of EPHB4 antisense probes on cell migration.
- 5637 cells were treated with EPHB4AS10 (10 ⁇ M).
- Figure 56 shows effects of EPHB4 siRNA on cell invasion.
- 5637 cells were transfected with siRNA 472 or control siRNA.
- Figure 57 shows comparison of EphB4 monoclonal antibodies by G250 and in pulldown assay.
- Figure 58 shows that EphB4 antibodies inhibit the growth of SCC15 xenograft tumors.
- Figure 59 shows that Epl ⁇ B4 antibodies cause apoptosis, necrosis and decreased angiogenesis in SCC 15, head and neck carcinoma tumor type.
- Figure 60 shows that systemic administration of EphB4 antibodies leads to tumor regression.
- Figure 61 shows a genomic nucleotide sequence of human EphB4.
- Figure 62 shows a cDNA nucleotide sequence of human EphB4.
- Figure 63 shows a genomic nucleotide sequence of human Ephrin B2.
- Figure 64 shows a cDNA nucleotide sequence of human Ephrin B2.
- Figure 65 shows an amino acid sequence of human EphB4.
- Figure 66 shows an amino acid sequence of human Ephrin B2.
- the current invention is based in part on the discovery that signaling through the ephrin/epl rin receptor pathway contributes to tumorigenesis.
- Applicants detected expression of ephrin B2 and EphB4 in tumor tissues and developed anti-tumor therapeutic agents for blocking signaling through the ephrin ephrin receptor.
- the disclosure provides polypeptide therapeutic agents and methods for polypep tide-based inhibition ofthe function of EphB4 and/or Ephrin B2. Accordingly, in certain aspects, the disclosure provides numerous polypeptide compounds (agents) that may be used to treat cancer as well as angiogenesis related disorders and unwanted angiogenesis related processes.
- Ephrin and Eph are used to refer, respectively, to ligands and receptors. They can be from any of a variety of animals (e.g., mammals/non-mammals, vertebrates/non-vertebrates, including humans). The nomenclature in this area has changed rapidly and the terminology used herein is that proposed as a result of work by the Eph
- Ephrin B2 and EphB4 refers to Ephrin B2 and EphB4.
- the present invention contemplates any ephrin ligand and/or Eph receptor within their respective family, which is expressed in a tumor.
- the ephrins (ligands) are of two structural types, which can be further subdivided on the basis of sequence relationships and, functionally, on the basis ofthe preferential binding they exhibit for two corresponding receptor subgroups. Structurally, there are two types of ephrins: those which are membrane- anchored by a glycerophosphatidylinositol (GPI) linkage and those anchored through a transmembrane domain.
- GPI glycerophosphatidylinositol
- the ligands are divided into the Ephrin-A subclass, which are GPI-linked proteins which bind preferentially to EphA receptors, and the Ephrin-B subclass, which are transmembrane proteins which generally bind preferentially to EphB receptors.
- Eph family receptors are a family of receptor protein-tyrosine kinases which are related to Eph, a receptor named for its expression in an erythropoietin-producing human hepatocellular carcinoma cell line. They are divided into two subgroups on the basis ofthe relatedness of their extracellular domain sequences and their ability to bind preferentially to Ephrin-A proteins or Ephrin-B proteins. Receptors which interact preferentially with Ephrin- A proteins are EphA receptors and those which interact preferentially with Ephrin-B proteins are EphB receptors.
- Eph receptors have an extracellular domain composed ofthe ligand-binding globular domain, a cysteine rich region followed by a pair of fibronectin type III repeats (e.g., see Figure 16).
- the cytoplasmic domain consists of a juxtamembrane region containing two conserved tyrosine residues; a protein tyrosine kinase domain; a sterile ⁇ -motif (SAM) and a PDZ-domain binding motif.
- EphB4 is specific for the membrane-bound ligand Ephrin B2 (Sakano, S. et al 1996; Brambilla R. et al 1995).
- Ephrin B2 belongs to the class of Eph ligands that have a transmembrane domain and cytoplasmic region with five conserved tyrosine residues and PDZ domain. Eph receptors are activated by binding of clustered, membrane attached ephrins (Davis S et al, 1994), indicating that contact between cells expressing the receptors and cells expressing the ligands is required for Eph activation.
- an Eph receptor dimerizes and autophosphorylate the juxtamembrane tyrosine residues to acquire full activation (Kalo MS et al, 1999, Binns KS, 2000).
- reverse signaling can occur through the ephrin Bs. Eph engagement of ephrins results in rapid phosphorylation ofthe conserved intracellular tyrosines (Bruckner K, 1997) and somewhat slower recruitment of PDZ binding proteins (Palmer A 2002).
- Eph/ephrins may be associated with increased potentials for tumor growth, tumorigenicity, and metastasis (Easty DJ, 1999; Kiyokawa E, 1994; Tang XX, 1999; Vogt T, 1998; Liu W, 2002; Stephenson SA, 2001; Steube KG 1999; Berclaz G, 1996).
- the present invention provides polypeptide therapeutic agents that inhibit activity of Ephrin B2, EphB4, or both.
- polypeptide therapeutic agent or “polypeptide agent” is a generic term which includes any polypeptide that blocks signaling through the Ephrin B2/EphB4 pathway.
- a preferred polypeptide therapeutic agent ofthe invention is a soluble polypeptide of Ephrin B2 or EphB4.
- Another preferred polypeptide therapeutic agent ofthe invention is an antagonist antibody that binds to Ephrin B2 or EphB4.
- such polypeptide therapeutic agent can inhibit function of Ephrin B2 or EphB4, inhibit the interaction between Ephrin B2 and EphB4, inhibit the phosphorylation of Ephrin B2 or EphB4, or inhibit any ofthe downstream signaling events upon binding of Ephrin B2 to EphB4.
- the invention relates to a soluble polypeptide comprising an extracellular domain of an Ephrin B2 protein (referred to herein as an Ephrin B2 soluble polypeptide) or comprising an extracellular domain of an EphB4 protein (referred to herein as an EphB4 soluble polypeptide).
- the subject soluble polypeptide is a monomer and is capable of binding with high affinity to Ephrin B2 or EphB4.
- the EphB4 soluble polypeptide ofthe invention comprises a globular domain of an EphB4 protein.
- Specific examples EphB4 soluble polypeptides are provided in Figures 1, 2, and 15.
- Specific examples of Ephrin B2 soluble polypeptides are provided in Figures 3 and 14.
- the subject soluble polypeptides include fragments, functional variants, and modified forms of EphB4 soluble polypeptide or an Ephrin B2 soluble polypeptide. These fragments, functional variants, and modified forms ofthe subject soluble polypeptides antagonize function of EphB4, Ephrin B2 or both.
- isolated fragments ofthe subject soluble polypeptides can be obtained by screening polypeptides recombinantly produced from the corresponding fragment ofthe nucleic acid encoding an EphB4 or Ephrin B2 soluble polypeptides.
- fragments can be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f-Moc or t-Boc chemistry.
- the fragments can be produced (recombinantly or by chemical synthesis) and tested to identify those peptidyl fragments that can function to inhibit function of EphB4 or Ephrin B2, for example, by testing the ability ofthe fragments to inhibit angiogenesis or tumor growth.
- a functional variant of an EphB4 soluble polypeptide has an amino acid sequence that is at least 90%, 95%, 97%>, 99% or 100% identical to residues 1- 522, residues 1-412, or residues 1-312 ofthe amino acid sequence defined by Figure 65.
- a functional variant of an Ephrin B2 soluble polypeptide has a sequence at least 90%, 95%, 97%, 99% or 100% identical to residues 1-225 ofthe amino acid sequence defined by Figure 66.
- the present invention contemplates making functional variants by modifying the structure ofthe subject soluble polypeptide for such purposes as enhancing therapeutic or prophylactic efficacy, or stability (e.g., ex vivo shelf life and resistance to proteolytic degradation in vivo).
- modified soluble polypeptide are considered functional equivalents ofthe naturally-occurring EphB4 or Ephrin B2 soluble polypeptide.
- Modified soluble polypeptides can be produced, for instance, by amino acid substitution, deletion, or addition.
- This invention further contemplates a method of generating sets of combinatorial mutants ofthe EphB4 or Ephrin B2 soluble polypeptides, as well as truncation mutants, and is especially useful for identifying functional variant sequences.
- the purpose of screening such combinatorial libraries may be to generate, for example, soluble polypeptide variants which can act as antagonists of EphB4, EphB2, or both.
- Combinatorially-derived variants can be generated which have a selective potency relative to a naturally occurring soluble polypeptide.
- Such variant proteins when expressed from recombinant DNA constructs, can be used in gene therapy protocols.
- mutagenesis can give rise to variants which have intracellular half-lives dramatically different than the corresponding wild-type soluble polypeptide.
- the altered protein can be rendered either more stable or less stable to proteolytic degradation or other cellular process which result in destruction of, or otherwise inactivation ofthe protein of interest (e.g., a soluble polypeptide).
- Such variants, and the genes which encode them can be utilized to alter the subject soluble polypeptide levels by modulating their half-life. For instance, a short half-life can give rise to more transient biological effects and, when part of an inducible expression system, can allow tighter control of recombinant soluble polypeptide levels within the cell.
- proteins, and particularly their recombinant nucleic acid constructs can be used in gene therapy protocols.
- the library of potential homologs can be generated from a degenerate oligonucleotide sequence.
- Chemical synthesis of a degenerate gene sequence can be carried out in an automatic DNA synthesizer, and the synthetic genes then be ligated into an appropriate gene for expression.
- the purpose of a degenerate set of genes is to provide, in one mixture, all ofthe sequences encoding the desired set of potential soluble polypeptide sequences.
- the synthesis of degenerate oligonucleotides is well known in the art (see for example, Narang, SA (1983) Tetrahedron 39:3; Itakura et al., (1981) Recombinant DNA, Proc. 3rd Cleveland Sympos.
- soluble polypeptide variants can be generated and isolated from a library by screening using, for example, alanine scanning mutagenesis and the like (Ruf et al., (1994) Biochemistry 33:1565-1572; Wang et al., (1994) J. Biol. Chem. 269:3095-3099; Balint et al., (1993) Gene 137:109-118; Grodberg et al, (1993) Eur. J. Biochem. 218:597-601; Nagashima et al., (1993) J. Biol. Chem.
- a wide range of techniques are known in the art for screening gene products of combinatorial libraries made by point mutations and truncations, and, for that matter, for screening cDNA libraries for gene products having a certain property. Such teclmiques will be generally adaptable for rapid screening ofthe gene libraries generated by the combinatorial mutagenesis ofthe subject soluble polypeptides.
- the most widely used techniques for screening large gene libraries typically comprises cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates relatively easy isolation ofthe vector encoding the gene whose product was detected.
- the subject soluble polypeptides ofthe invention include a a small molecule such as a peptide and a peptidomimetic.
- a small molecule such as a peptide and a peptidomimetic.
- peptidomimetic includes chemically modified peptides and peptide-like molecules that contain non-naturally occurring amino acids, peptoids, and the like. Peptidomimetics provide various advantages over a peptide, including enhanced stability when administered to a subject.
- Methods for identifying a peptidomimetic are well known in the art and include the screening of databases that contain libraries of potential peptidomimetics.
- the Cambridge Structural Database contains a collection of greater than 300,000 compounds that have known crystal structures (Allen et al., Acta Crystallogr. Section B, 35:2331 (1979)). Where no crystal structure of a target molecule is available, a structure can be generated using, for example, the program CONCORD (Rusinko et al., J. Chem. Inf. Comput. Sci. 29:251 (1989)).
- Another database contains about 100,000 compounds that are commercially available and also can be searched to identify potential peptidomimetics of the EphB4 or Ephrin B2 soluble polypeptides.
- peptidomimetic compounds can be generated which mimic those residues involved in binding. For instance, non-hydrolyzable peptide analogs of such residues can be generated using benzodiazepine (e.g., see Freidinger et al., in Peptides: Chemistry and Biology, G.R.
- the soluble polypeptides ofthe invention may further comprise post-translational modifications.
- modifications include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
- the modified soluble polypeptides may contain non-amino acid elements, such as polyethylene glycols, lipids, poly- or mono-saccharide, and phosphates. Effects of such non- amino acid elements on the functionality of a soluble polypeptide may be tested for its antagozing role in Epl ⁇ B4 or Ephrin B2 function, e.g, it inhibitory effect on angiogenesis or on tumor growth.
- functional variants or modified forms ofthe subject soluble polypeptides include fusion proteins having at least a portion ofthe soluble polypeptide and one or more fusion domains.
- fusion domains include, but are not limited to, polyhistidine, Glu-Glu, glutathione S transferase (GST), thioredoxin, protein A, protein G, and an immunoglobulin heavy chain constant region (Fc), maltose binding protein (MBP), which are particularly useful for isolation ofthe fusion proteins by affinity chromatography.
- relevant matrices for affinity chromatography such as glutathione-, amylase-, and nickel- or cobalt- conjugated resins are used.
- Fusion domains also include "epitope tags," which are usually short peptide sequences for which a specific antibody is available.
- epitope tags for which specific monoclonal antibodies are readily available include FLAG, influenza virus haemagglutinin (HA), and c-myc tags.
- the fusion domains have a protease cleavage site, such as for Factor Xa or Thrombin, which allows the relevant protease to partially digest the fusion proteins and thereby liberate the recombinant proteins therefrom. The liberated proteins can then be isolated from the fusion domain by subsequent chromatographic separation.
- the soluble polypeptides ofthe present invention contain one or more modifications that are capable of stabilizing the soluble polypeptides.
- modifications enhance the in vitro half life ofthe soluble polypeptides, enhance circulatory half life ofthe soluble polypeptides or reducing proteolytic degradation ofthe soluble polypeptides.
- soluble polypeptides (unmodified or modified) ofthe invention can be produced by a variety of art-known techniques.
- such soluble polypeptides can be synthesized using standard protein chemistry techniques such as those described in Bodansky, M. Principles of Peptide Synthesis, Springer Verlag, Berlin (1993) and Grant G. A. (ed.), Synthetic Peptides: A User's Guide, W. H. Freeman and Company, New York (1992).
- automated peptide synthesizers are commercially available (e.g., Advanced ChemTech Model 396; Milligen/Biosearch 9600).
- the soluble polypeptides, fragments or variants thereof may be recombinantly produced using various expression systems as is well known in the art (also see below).
- the invention relates to isolated and/or recombinant nucleic acids encoding an EphB4 or Ephrin B2 soluble polypeptide.
- the subject nucleic acids may be single-stranded or double-stranded, DNA or RNA molecules. These nucleic acids are useful as therapeutic agents. For example, these nucleic acids are useful in making recombinant soluble polypeptides which are administered to a cell or an individual as therapeutics. Alternative, these nucleic acids can be directly administered to a cell or an individual as therapeutics such as in gene therapy.
- the invention provides isolated or recombinant nucleic acid sequences that are at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to a region ofthe nucleotide sequence depicted in Figure 62 or 63.
- nucleic acid sequences complementary to the subject nucleic acids, and variants ofthe subject nucleic acids are also within the scope of this invention.
- the nucleic acid sequences ofthe invention can be isolated, recombinant, and/or fused with a heterologous nucleotide sequence, or in a DNA library.
- nucleic acids ofthe invention also include nucleotide sequences that hybridize under highly stringent conditions to the nucleotide sequence depicted in Figure 62 or 63, or complement sequences thereof.
- appropriate stringency conditions which promote DNA hybridization can be varied.
- appropriate stringency conditions which promote DNA hybridization can be varied. For example, one could perform the hybridization at 6.0 x sodium chloride/sodium citrate (SSC) at about 45 °C, followed by a wash of 2.0 x SSC at 50 °C.
- SSC sodium chloride/sodium citrate
- the salt concentration in the wash step can be selected from a low stringency of about 2.0 x SSC at 50 °C to a high stringency of about 0.2 x SSC at 50 °C.
- the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22 °C, to high stringency conditions at about 65 °C. Both temperature and salt may be varied, or temperature or salt concentration may be held constant while the other variable is changed.
- the invention provides nucleic acids which hybridize under low stringency conditions of 6 x SSC at room temperature followed by a wash at 2 x SSC at room temperature.
- Isolated nucleic acids which differ from the subject nucleic acids due to degeneracy in the genetic code are also within the scope ofthe invention. For example, a number of amino acids are designated by more than one triplet. Codons that specify the same amino acid, or synonyms (for example, CAU and CAC are synonyms for histidine) may result in "silent" mutations which do not affect the amino acid sequence ofthe protein. However, it is expected that DNA sequence polymorphisms that do lead to changes in the amino acid sequences ofthe subject proteins will exist among mammalian cells.
- nucleotides up to about 3-5% ofthe nucleotides
- nucleic acids encoding a particulai- protein may exist among individuals of a given species due to natural allelic variation. Any and all such nucleotide variations and resulting amino acid polymorphisms are within the scope of this invention.
- the recombinant nucleic acids ofthe invention may be operably linked to one or more regulatory nucleotide sequences in an expression construct.
- Regulatory nucleotide sequences will generally be appropriate for a host cell used for expression. Numerous types of appropriate expression vectors and suitable regulatory sequences are known in the art for a variety of host cells.
- said one or more regulatory nucleotide sequences may include, but are not limited to, promoter sequences, leader or signal sequences, ribosomal binding sites, transcriptional start and termination sequences, translational start and termination sequences, and enhancer or activator sequences. Constitutive or inducible promoters as known in the art are contemplated by the invention.
- the promoters may be either naturally occurring promoters, or hybrid promoters that combine elements of more than one promoter.
- An expression construct may be present in a cell on an episome, such as a plasmid, or the expression construct may be inserted in a chromosome.
- the expression vector contains a selectable marker gene to allow the selection of transformed host cells. Selectable marker genes are well known in the art and will vary with the host cell used.
- the subject nucleic acid is provided in an expression vector comprising a nucleotide sequence encoding an Epl ⁇ B4 or Ephrin B2 soluble polypeptide and operably linked to at least one regulatory sequence.
- regulatory sequence includes promoters, enhancers, and other expression control elements. Exemplary regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, CA (1990). For instance, any of a wide variety of expression control sequences that confrol the expression of a DNA sequence when operatively linked to it may be used in these vectors to express DNA sequences encoding a soluble polypeptide.
- Such useful expression confrol sequences include, for example, the early and late promoters of S V40, tet promoter, adenovirus or cytomegalovirus immediate early promoter, the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage lambda , the control regions for fd coat protein, the promoter for 3 -phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters ofthe yeast ⁇ -mating factors, the polyhedron promoter ofthe baculovirus system and other sequences Icnown to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
- the design ofthe expression vector may depend on such factors as the choice ofthe host cell to be transformed and/or the type of protein desired to be expressed. Moreover, the vector's copy number, the ability to control that copy number and the expression of any other protein encoded by the vector, such as antibiotic markers, should also be considered.
- This invention also pertains to a host cell transfected with a recombinant gene including a coding sequence for one or more ofthe subject soluble polypeptide.
- the host cell may be any prokaryotic or eukaryotic cell.
- a soluble polypeptide ofthe invention may be expressed in bacterial cells such as E. coli, insect cells (e.g., using a baculovirus expression system), yeast, or mammalian cells. Other suitable host cells are known to those skilled in the art.
- the present invention further pertains to methods of producing the subject soluble polypeptides.
- a host cell transfected with an expression vector encoding an ⁇ phB4 soluble polypeptide can be cultured under appropriate conditions to allow expression ofthe EphB4 soluble polypeptide to occur.
- the EphB4 soluble polypeptide may be secreted and isolated from a mixture of cells and medium containing the soluble polypeptides.
- the soluble polypeptides may be retained cytoplasmically or in a membrane fraction and the cells harvested, lysed and the protein isolated.
- a cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well l ⁇ iown in the art.
- the soluble polypeptides can be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins, including ion- exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for particular epitopes ofthe soluble polypeptides.
- the soluble polypeptide is a fusion protein containing a domain wliich facilitates its purification.
- a recombinant nucleic acid ofthe invention can be produced by li gating the cloned gene, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells (yeast, avian, insect or mammalian), or both.
- Expression vehicles for production of a recombinant soluble polypeptide include plasmids and other vectors.
- suitable vectors include plasmids ofthe types: pBR322-derived plasmids, pEMBL- derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli.
- the prefe ⁇ ed mammalian expression vectors contain both prokaryotic sequences to facilitate the propagation ofthe vector in bacteria, and one or more eukaryotic transcription units that are expressed in eukaryotic cells.
- the pcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, pTk2, pRSVneo, pMSG, ⁇ SVT7, pko-neo and pHyg derived vectors are examples of mammalian expression vectors suitable for transfection of eukaryotic cells.
- vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both prokaryotic and eukaryotic cells.
- bacterial plasmids such as pBR322
- derivatives of viruses such as the bovine papilloma virus (BPV-1), or Epstein-Ban- virus (pHEBo, pREP-derived and p205) can be used for transient expression of proteins in eukaryotic cells.
- BBV-1 bovine papilloma virus
- pHEBo Epstein-Ban- virus
- pREP-derived and p205 Epstein-Ban- virus
- examples of other viral (including retroviral) expression systems can be found below in the description of gene therapy delivery systems.
- the various methods employed in the preparation ofthe plasmids and transformation of host organisms are well known in the art.
- baculovirus expression systems examples include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941), pAcUW-derived vectors (such as pAcUWl), and pBlueBac-derived vectors (such as the ⁇ -gal containing pBlueBac III).
- Techniques for making fusion genes are well known. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
- the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
- PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al., John Wiley & Sons: 1992).
- the present invention provides antagonist antibodies against Ephrin B2 or EphB4.
- the term "antagonist antibody” refers to an antibody that inliibits function of Eplirin B2 or EphB4.
- the antagonist antibody binds to an extracellular domain of Ephrin B2 or EphB4.
- antibodies of the invention may be polyclonal or monoclonal; intact or truncated, e.g., F(ab')2, Fab, Fv; xenogeneic, allogeneic, syngeneic, or modified forms thereof, e.g., humanized, chimeric, etc.
- anti-protein/anti-peptide antisera or monoclonal antibodies can be made by standard protocols (see, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)).
- a mammal such as a mouse, a hamster or rabbit can be immunized with an immunogenic form ofthe peptide. (e.g., a polypeptide or an antigenic fragment which is capable of eliciting an antibody response, or a fusion protein).
- Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art.
- An immunogenic portion of an Ephrin B2 or EphB4 polypeptide can be administered in the presence of adjuvant.
- the progress of immunization can be monitored by detection of antibody titers in plasma or serum.
- Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies, h one embodiment, antibodies ofthe invention are specific for the extracellular portion ofthe Ephrin B2 or EphB4 protein. In another embodiment, antibodies ofthe invention are specific for the intracellular portion or the transmembrane portion ofthe Ephrin B2 or EphB4 protein, hi a further embodiment, antibodies ofthe invention are specific for the extracellular portion ofthe Ephrin B2 or EphB4 protein.
- antibody-producing cells can be harvested from an immunized animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells.
- Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with an Ephrin B2 or EphB4 polypeptide and monoclonal antibodies isolated from a culture comprising such hybridoma cells.
- antibody as used herein is intended to include fragments thereof which are also specifically reactive with an Ephrin B2 or EphB4 polypeptides.
- Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab)2 fragments can be generated by treating antibody with pepsin. The resulting F(ab)2 fragment can be freated to reduce disulfide bridges to produce Fab fragments.
- the antibody ofthe present invention is further intended to include bispecific, single-chain, and chimeric and humanized molecules having affinity for an Ephrin B2 or EphB4 polypeptide confened by at least one CDR region ofthe antibody. Techniques for the production of single chain antibodies (US Patent No.
- the antibodies can also be adapted to produce single chain antibodies.
- transgenic mice or other organisms including other mammals may be used to express humanized antibodies.
- the antibodies further comprise a label attached thereto and able to be detected (e.g., the label can be a radioisotope, fluorescent compound, enzyme or enzyme co- factor).
- an antibody ofthe invention is a monoclonal antibody, and in certain embodiments the invention makes available methods for generating novel antibodies.
- a method for generating a monoclonal antibody that binds specifically to an Ephrin B2 or EphB4 polypeptide may comprise administering to a mouse an amount of an immunogenic composition comprising the Ephrin B2 or EphB4 polypeptide effective to stimulate a detectable immune response, obtaining antibody-producing cells (e.g., cells from the spleen) from the mouse and fusing the antibody-producing cells with myeloma cells to obtain antibody-producing hybridomas, and testing the antibody-producing hybridomas to identify a hybridoma that produces a monocolonal antibody that binds specifically to the Eplirin B2 or EphB4 polypeptide.
- antibody-producing cells e.g., cells from the spleen
- a hybridoma can be propagated in a cell culture, optionally in culture conditions where the hybridoma-derived cells produce the monoclonal antibody that binds specifically to the Ephrin B2 or EphB4 polypeptide.
- the monoclonal antibody may be purified from the cell culture.
- the techniques used to screen antibodies in order to identify a desirable antibody may influence the properties ofthe antibody obtained.
- an antibody to be used for certain therapeutic purposes will preferably be able to target a particular cell type. Accordingly, to obtain antibodies of this type, it maybe desirable to screen for antibodies that bind to cells that express the antigen of interest (e.g., by fluorescence activated cell sorting).
- an antibody is to be used for binding an antigen in solution, it may be desirable to test solution binding.
- a variety of different techniques are available for testing antibody: antigen interactions to identify particularly desirable antibodies. Such techniques include ELISAs, surface plasmon resonance binding assays (e.g.
- Biacore binding assay Bia-core AB, Uppsala, Sweden
- sandwich assays e.g. the paramagnetic bead system of IGEN International, Inc., Gaithersburg, Maryland
- western blots immunoprecipitation assays and immunohistochemistry.
- test agents can be any chemical (element, molecule, compound, drug), made synthetically, made by recombinant techniques or isolated from a natural source.
- test agents can be peptides, polypeptides, peptoids, sugars, hormones, or nucleic acid molecules.
- test agents can be small molecules or molecules of greater complexity made by combinatorial chemistry, for example, and compiled into libraries.
- Test agents can also be natural or genetically engineered products isolated from lysates or growth media of cells ⁇ bacterial, animal or plant — or can be the cell lysates or growth media themselves. Presentation of test compounds to the test system can be in either an isolated form or as mixtures of compounds, especially in initial screening steps.
- an assay can be carried out to screen for compounds that specifically inhibit binding of Ephrin B2 (ligand) to EphB4 (receptor), or vice-versa, e.g., by inhibition of binding of labeled ligand- or receptor-Fc fusion proteins to immortalized cells.
- Compounds identified through this screening can then be tested in animals to assess their anti- angiogenesis or anti-tumor activity in vivo.
- samples of cells expressing one type of cell surface molecule are contacted with either labeled ligand (e.g., Ephrin B2, or a soluble portion thereof, or a fusion protein such as a fusion ofthe extracellular domain and the Fc domain of IgG) or labeled ligand plus a test compound (or group of test compounds).
- labeled ligand e.g., Ephrin B2, or a soluble portion thereof, or a fusion protein such as a fusion ofthe extracellular domain and the Fc domain of IgG
- test compound or group of test compounds
- a lesser amount of label (where the label can be, for example, a radioactive isotope, a fluorescent or colormetric label) in the sample contacted with the test compound(s) is an indication that the test compound(s) interferes with binding.
- the reciprocal assay using cells expressing a ligand e.g., an Ephrin B2 ligand or a soluble form thereof
- a ligand e.g., an Ephrin B2 ligand or a soluble form thereof
- An assay to identify a substance which interferes with interaction between an Eph receptor and an ephrin can be performed with the component (e.g., cells, purified protein, including fusion proteins and portions having binding activity) which is not to be in competition with a test compound, linked to a solid support.
- the solid support can be any suitable solid phase or matrix, such as a bead, the wall of a plate or other suitable surface (e.g., a well of a microtiter plate), column pore glass (CPG) or a pin that can be submerged into a solution, such as in a well.
- Linkage of cells or purified protein to the solid support can be either direct or through one or more linker molecules.
- an isolated or purified protein e.g., an Eph receptor or an ephrin
- a suitable affinity matrix by standard techniques, such as chemical cross-linking, or via an antibody raised against the isolated or purified protein, and bound to a solid support.
- the matrix can be packed in a column or other suitable container and is contacted with one or more compounds (e.g., a mixture) to be tested under conditions suitable for binding ofthe compound to the protein. For example, a solution containing compounds can be made to flow tlirough the matrix.
- the matrix can be washed with a suitable wash buffer to remove unbound compounds and non-specifically bound compounds. Compounds which remain bound can be released by a suitable elution buffer.
- the elution buffer can comprise a release component or components designed to disrupt binding of compounds (e.g., one or more ligands or receptors, as appropriate, or analogs thereof which can disrupt binding or competitively inhibit binding of test compound to the protein).
- a release component or components designed to disrupt binding of compounds e.g., one or more ligands or receptors, as appropriate, or analogs thereof which can disrupt binding or competitively inhibit binding of test compound to the protein).
- Fusion proteins comprising all, or a portion of, a protein (e.g., an Eph receptor or an eplirin) linked to a second moiety not occurring in that protein as found in nature can be prepared for use in another embodiment ofthe method.
- Suitable fusion proteins for this purpose include those in which the second moiety comprises an affinity ligand (e.g., an enzyme, antigen, epitope).
- the fusion proteins can be produced by inserting the protein (e.g., an Eph receptor or an ephrin) or a portion thereof into a suitable expression vector which encodes an affinity ligand.
- the expression vector can be introduced into a suitable host cell for expression. Host cells are disrupted and the cell material, containing fusion protein, can be bound to a suitable affinity matrix by contacting the cell material with an affinity matrix under conditions sufficient for binding ofthe affinity ligand portion ofthe fusion protein to the affinity matrix.
- a fusion protein in one aspect of this embodiment, can be immobilized on a suitable affinity matrix under conditions sufficient to bind the affinity ligand portion ofthe fusion protein to the matrix, and is contacted with one or more compounds (e.g., a mixture) to be tested, under conditions suitable for binding of compounds to the receptor or ligand protein portion of the bound fusion protein.
- the affinity matrix with bound fusion protein can be washed with a suitable wash buffer to remove unbound compounds and non-specifically bound compounds without significantly disrupting binding of specifically bound compounds.
- Compounds which remain bound can be released by contacting the affinity matrix having fusion protein bound thereto with a suitable elution buffer (a compound elution buffer).
- compound elution buffer can be formulated to permit retention ofthe ftision protein by the affinity matrix, but can be formulated to interfere with binding ofthe compound(s) tested to the receptor or ligand protein portion ofthe fusion protein.
- a change in the ionic strength or pH ofthe elution buffer can lead to release of compounds, or the elution buffer can comprise a release component or components designed to disrupt binding of compounds to the receptor or ligand protein portion of the fusion protein (e.g., one or more ligands or receptors or analogs thereof which can disrupt binding of compounds to the receptor or ligand protein portion ofthe fusion protein).
- Immobilization can be performed prior to, simultaneous with, or after contacting the fusion protein with compound, as appropriate.
- fusion protein with compound bound thereto can be eluted from the affinity matrix with a suitable elution buffer (a matrix elution buffer).
- a suitable elution buffer a matrix elution buffer
- cleavage from the affinity ligand can release a portion ofthe fusion with compound bound thereto.
- Bound compound can then be released from the fusion protein or its cleavage product by an appropriate method, such as extraction.
- the present invention provides methods of inhibiting angiogenesis and methods of treating angiogenesis-associated diseases.
- the present invention provides methods of inhibiting or reducing tumor growth and methods of treating an individual suffering from cancer. These methods involve administering to the individual a therapeutically effective amount of one or more polypeptide therapeutic agents as described above. These methods are particularly aimed at therapeutic and prophylactic treatments of animals, and more particularly, humans.
- angiogenesis-associated diseases include, but are not limited to, angiogenesis-dependent cancer, including, for example, solid tumors, blood born tumors such as leukemias, and tumor metastases; benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas; inflammatory disorders such as immune and non-immune inflammation; chronic articular rheumatism and psoriasis; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis; Osier- Webber Syndrome; myocardial angiogenesis; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; and wound granulation and wound healing; telangiectasia ps
- angiogenesis-independent cancer refers to a cancer (tumor) where there is no or little neovascularization in the tumor tissue.
- polypeptide therapeutic agents ofthe present invention are useful for treating or preventing a cancer (tumor), including, but not limited to, colon carcinoma, breast cancer, mesothelioma, prostate cancer, bladder cancer, squamous cell carcinoma ofthe head and neck (HNSCC), Kaposi sarcoma, and leukemia.
- polypeptide therapeutic agents can be administered, together (simultaneously) or at different times (sequentially).
- polypeptide therapeutic agents can be administered with another type of compounds for treating cancer or for inhibiting angiogenesis.
- the subject methods ofthe invention can be used alone.
- the subject methods may be used in combination with other conventional anti- cancer therapeutic approaches directed to treatment or prevention of proliferative disorders (e.g., tumor).
- proliferative disorders e.g., tumor
- such methods can be used in prophylactic cancer prevention, prevention of cancer recu ⁇ ence and metastases after surgery, and as an adjuvant of other conventional cancer therapy.
- the present invention recognizes that the effectiveness of conventional cancer therapies (e.g., chemotherapy, radiation therapy, phototherapy, immunotherapy, and surgery) can be enhanced through the use of a subject polypeptide therapeutic agent.
- conventional cancer therapies e.g., chemotherapy, radiation therapy, phototherapy, immunotherapy, and surgery
- a wide anay of conventional compounds have been shown to have anti-neoplastic activities. These compounds have been used as pharmaceutical agents in chemotherapy to shrink solid tumors, prevent metastases and further growth, or decrease the number of malignant cells in leukemic or bone marrow malignancies.
- chemotherapy has been effective in treating various types of malignancies, many anti-neoplastic compounds induce undesirable side effects.
- the treatments may work synergistically and allow reduction of dosage of each of the treatments, thereby reducing the detrimental side effects exerted by each compound at higher dosages.
- malignancies that are refractory to a treatment may respond to a combination therapy of two or more different treatments.
- a polypeptide therapeutic agent ofthe present invention When a polypeptide therapeutic agent ofthe present invention is administered in combination with another conventional anti-neoplastic agent, either concomitantly or sequentially, such therapeutic agent is shown to enhance the therapeutic effect ofthe antineoplastic agent or overcome cellular resistance to such anti-neoplastic agent. This allows decrease of dosage of an anti-neoplastic agent, thereby reducing the undesirable side effects, or restores the effectiveness of an anti-neoplastic agent in resistant cells.
- Pharmaceutical compounds that may be used for combinatory anti-tumor therapy include, merely to illustrate: aminoglutethimide, amsacrine, anastrozole, asparaginase, beg, bicalutamide, bleomycin, buserelin, busulfan, campothecin, capecitabine, carboplatin, cannustine, chlorambucil, cisplatin, cladribine, clodronate, colchicine, cyclophosphamide, cyproterone, cytarabine, dacarbazine, dactinomycin, daunorubicin, dienestrol, diethylstilbestrol, docetaxel, doxorubicin, epirubicin, estradiol, estramustine, etoposide, exemestane, filgrastim, fludarabine, fludrocortisone, fluorouracil, fluoxymesterone, flutamide, gemcitabine, gen
- chemotherapeutic anti-tumor compounds may be categorized by their mechanism of action into, for example, following groups: anti-metabolites/anti-cancer agents, such as pyrimidine analogs (5-fluorouracil, floxuridine, capecitabine, gemcitabine and cytarabine) and purine analogs, folate antagonists and related inhibitors (mercaptopurine, thioguanine, pentostatin and 2-chlorodeoxyadenosine (cladribine)); antiproliferative/antimitotic agents including natural products such as vinca alkaloids (vinblastine, vincristine, and vinorelbine), microtubule disrupters such as taxane (paclitaxel, docetaxel), vincristin, vinblastin, nocodazole, epothilones and navelbine, epidipodophyllotoxins (etoposide, teniposide), DNA damaging agents (actinomycin, amsacrine, anthracychnes
- pharmaceutical compounds that may be used for combinatory anti-angiogenesis therapy include: (1) inhibitors of release of "angiogenic molecules," such as bFGF (basic fibroblast growth factor); (2) neutralizers of angiogenic molecules, such as an anti- ⁇ bFGF antibodies; and (3) inhibitors of endothelial cell response to angiogenic stimuli, including collagenase inhibitor, basement membrane turnover inhibitors, angiostatic steroids, fungal-derived angiogenesis inhibitors, platelet factor 4, thrombospondin, arthritis drugs such as D-penicillamine and gold thiomalate, vitamin D 3 analogs, alpha-interferon, and the like.
- angiogenic molecules such as bFGF (basic fibroblast growth factor)
- neutralizers of angiogenic molecules such as an anti- ⁇ bFGF antibodies
- inhibitors of endothelial cell response to angiogenic stimuli including collagenase inhibitor, basement membrane turnover inhibitors, angiostatic steroids, fungal-derived angiogenesis inhibitors, platelet factor 4,
- angiogenesis there are a wide variety of compounds that can be used to inhibit angiogenesis, for example, peptides or agents that block the VEGF-mediated angiogenesis pathway, endostatin protein or derivatives, lysine binding fragments of angiostatin, melanin or melanin-promoting compounds, plasminogen fragments (e.g., Kringles 1-3 of plasminogen), tropoin subunits, antagonists of vitronectin ⁇ v ⁇ 3 , peptides derived from Saposin B, antibiotics or analogs (e.g., tetracycline, or neomycin), dienogest-containing compositions, compounds comprising a MetAP-2 inhibitory core coupled to a peptide, the compound EM-138, chalcone and its analogs, and naaladase inhibitors.
- plasminogen fragments e.g., Kringles 1-3 of plasminogen
- tropoin subunits e.g., antagonist
- administration ofthe polypeptide therapeutic agents ofthe invention may be continued while the other therapy is being administered and/or thereafter.
- Administration ofthe polypeptide therapeutic agents may be made in a single dose, or in multiple doses.
- administration ofthe polypeptide therapeutic agents is commenced at least several days prior to the conventional therapy, while in other instances, administration is begun either immediately before or at the time ofthe adminisfration ofthe conventional therapy.
- the subject polypeptide therapeutic agents e.g., soluble polypeptides or antibodies
- a pharmaceutically acceptable carrier e.g., a pharmaceutically acceptable carrier.
- Such therapeutic agents can be administered alone or as a component of a pharmaceutical formulation (composition).
- the compounds may be fo ⁇ nulated for administration in any convenient way for use in human or veterinary medicine.
- Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
- Formulations ofthe subject polypeptide therapeutic agents include those suitable for oral/ nasal, topical, parenteral, rectal, and/or intravaginal administration.
- the formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy.
- the amount of active ingredient which can be combined with a canier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of adminisfration.
- the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount ofthe compound which produces a therapeutic effect.
- methods of preparing these formulations or compositions include combining another type of anti-tumor or anti-angiogenesis therapeutic agent and a carrier and, optionally, one or more accessory ingredients.
- the formulations can be prepared with a liquid carrier, or a finely divided solid carrier, or both, and then, if necessary, shaping the product.
- Formulations for oral adminisfration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in- water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predete ⁇ nined amount of a subject polypeptide therapeutic agent as an active ingredient.
- lozenges using a flavored basis, usually sucrose and acacia or tragacanth
- one or more polypeptide therapeutic agents ofthe present invention may be mixed with one or more pharmaceutically acceptable earners, such as sodium citrate or dicalcium phosphate, and/or any ofthe following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl py ⁇ olidone, sucrose, and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) we
- compositions may also comprise buffering agents.
- Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
- Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs, hi addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3 -butylene glycol, oils (in particular, cottonseed, groundnut, corn, ge ⁇ n, olive, castor, and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
- the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspend
- Suspensions in addition to the active compounds, may contain suspending agents such as ethoxylated isostearyl alcohols, poiyoxyethylene sorbitol, and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
- suspending agents such as ethoxylated isostearyl alcohols, poiyoxyethylene sorbitol, and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
- topical formulations may further include one or more ofthe wide variety of agents known to be effective as skin or stratum corneum penetration enhancers. Examples of these are 2- py ⁇ olidone, N-methyl-2-pynolidone, dimethylacetamide, dimethylformamide, propylene glycol, methyl or isopropyl alcohol, dimethyl sulfoxide, and azone. Additional agents may further be included to make the formulation cosmetically acceptable. Examples of these are fats, waxes, oils, dyes, fragrances, preservatives, stabilizers, and surface active agents. Keratolytic agents such as those known in the art may also be included. Examples are salicylic acid and sulfur.
- Dosage forms for the topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants.
- the subject polypeptide therapeutic agents may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
- the ointments, pastes, creams and gels may contain, in addition to a subject polypeptide agent, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
- Powders and sprays can contain, in addition to a subject polypeptide therapeutic agent, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates, and polyamide powder, or mixtures of these substances.
- Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
- phrases suitable for parenteral administration may comprise one or more polypeptide therapeutic agents in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which maybe reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood ofthe intended recipient or suspending or thickening agents.
- aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
- polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
- vegetable oils such as olive oil
- injectable organic esters such as ethyl oleate.
- Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance ofthe required particle size in the case of dispersions, and by the use of surfactants.
- compositions may also contain adjuvants, such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention ofthe action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption ofthe injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
- adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.
- Prevention ofthe action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium
- Injectable depot forms are made by forming microencapsule matrices of one or more polypeptide therapeutic agents in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature ofthe particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue.
- Formulations for intravaginal or rectally administration may be presented as a suppository, which may be prepared by mixing one or more compounds ofthe invention with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound.
- suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound.
- the polypeptide therapeutic agents ofthe instant invention can be expressed within cells from eukaryotic promoters.
- a soluble polypeptide of EphB4 or Ephrin B2 can be expressed in eukaryotic cells from an appropriate vector.
- the vectors are preferably DNA plasmids or viral vectors.
- Viral vectors can be constructed based on, but not limited to, adeno-associated virus, refrovirus, adenovirus, or alphavirus.
- the vectors stably introduced in and persist in target cells.
- viral vectors can be used that provide for transient expression. Such vectors can be repeatedly administered as necessary.
- Delivery of vectors encoding the subject polypeptide therapeutic agent can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that would allow for introduction into the desired target cell (for a review see Couture et al., 1996, TIG., 12, 510).
- Soluble derivatives of the extracellular domains of human Ephrin B2 and EphB4 proteins represent either truncated full-length predicted extracellular domains of Ephrin B2 (B4ECv3, B2EC) or translational fusions of the domains with constant region of human immunoglobulins (IgGl Fc fragment), such as B2EC-FC, B4ECv2-FC and B4ECv3-FC.
- B4ECv3, B2EC truncated full-length predicted extracellular domains of Ephrin B2
- IgGl Fc fragment constant region of human immunoglobulins
- the cDNA fragments encoding these recombinant proteins were subcloned into mammalian expression vectors, expressed in transiently or stably transfected mammalian cell lines and purified to homogeneity as described in detail in Materials and Methods section (see below).
- Predicted amino acid sequences ofthe proteins are shown in Figures 1-5. High purity ofthe isolated proteins and their recognition by the co ⁇ esponding anti-Ephrin B2 and anti- EphB4 monoclonal or polyclonal antibodies were confirmed.
- the recombinant proteins exhibit the expected liigh-affmity binding, binding competition and specificity properties with their corresponding binding partners as co ⁇ oborated by the biochemical assays (see e.g., Figures 6-8).
- Such soluble derivative proteins human Ephrin B2 and EphB4 exhibit potent biological activity in several cell-based assays and in vivo assays which measure angiogenesis or anti-cancer activities, and are therefore perspective drug candidates for anti-angiogenic and anti-cancer therapy.
- B4ECv3 as well as B2EC and B2EC-FC proteins blocked chemotaxis of human endothelial cells (as tested with umbilical cord and hepatic AECs or VECs), with a decrease in degradation ofthe extracellular matrix, Matrigel, and a decrease in migration in response to growth factor stimuli (Figures 9-11).
- B4ECv3 and B2EC-FC proteins have potent anti-angiogenic effect as demonstrated by their inhibition of endothelial cell tube formation ( Figures 12-13).
- Plasmids vectors for expressing recombinant soluble derivatives of Ephrin B2 and EphB4 were based on pEF6/V5-His-TOPO vector (Invitrogen), pIG (Novagen) or pRK5.
- pEF6/V5-His-TOPO contains human elongation factor la enhancer/promoter and blasticidin resistance marker.
- pIG vector is designed for high-level expression of protein fusions with Fc portion of human IgGlunder CMV promoter confrol and pRK5 is a general purpose CMV promoter-containing mammalian expression vector.
- pEF6- B4EC-NT cDNA fragment of human EphB4 was amplified by PCR using oligo primers 5'- GGATCCGCC ATGGAGCTC CGGGTGCTGCT-3' and 5'-TGGATCCCT GCTCCCGC CAGCCCTCG CTCTCATCCA-3', and TOPO-cloned into pEF6/V5-His-TOPO vector.
- pEF6-hB4ECv3 was derived from pEF6-B4ECNT by digesting the plasmid DNA with EcoRV and BstBI, filling-in the ends with Klenow enzyme and religating the vector.
- EphB4 derivative encoded by pEF6-B4EC-NT does not contain epitope- or purification tags, while the similar B4ECv3 protein encoded by pEF6-hB4ECv3 contains V5 epitope tag and 6xHis tag on its C-terminus to facilitate purification from conditioned media.
- Plasmid construct pEF6-hB2EC was created by PCR amplification of Ephrin B2 cDNA using oligo primers 5'- TGGATCCAC CATGGCTGT GAGAAGGGAC-3' plus 5'- ATTAATGGTGATGGT GAT GATGACTAC CCACTTCGG AACCGAGGATGTTGTTC- 3' and TOPO-cloning into ⁇ EF6/V5-His-TOPO vector.
- Plasmid construct pIG-hB2EC-FC was created by PCR amplification of Eplirin B2 cDNA with oligo primers 5 '-
- pIG-hB2EC and pIG-hB4ECv3 were generated by PCR amplifying portions of EphB4 ECD cDNA using oligo primers 5 ' - ATAAGCTTCC
- HEK293T human embryonic kidney line
- DMEM fetal calf serum
- penicillin/streptomycin/neomycin antibiotics 1%> penicillin/streptomycin/neomycin antibiotics.
- Cells were maintained at 37 °C in a humidified atmosphere of 5% CO 2 /95% air.
- Transfections were performed using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's protocol. One day before transfections, 293T cells were seeded at a high density to reach 80% confluence at the time of transfection.
- Plasmid DNA and Lipofectamine reagent at 1:3 ratio were diluted in Opti-MEM I reduced serum medium (Invitrogen) for 5 min and mixed together to form DNA:Lipofectamine complex.
- Opti-MEM I reduced serum medium Invitrogen
- 10 ⁇ g of plasmid DNA was used for each 10 cm culture dish. After 20 min, above complex was added directly to cells in culture medium. After 16 hours of transfection, medium was aspirated, washed once with serum free DMEM and replaced with serum free DMEM. Secreted proteins were harvested after 48 hours by collecting conditional medium. Conditional medium was clarified by centrifugation at 10,000 g for 20 min, filtered through 0.2 ⁇ m filter and used for purification.
- HEK293T cells were transfected with either pEF6-B4ECv3 or pEF6-B4EC-NT plasmid constructs as described above and selected using antibiotic Blasticidin. After 24 hours of transfection, cells were seeded at low density. Next day, cells were treated with 10 ⁇ g/ml of Blasticidin. After two weeks of drug selection, surviving cells were pooled and selected further for single cell clone expansion. After establishing stable cells, they were maintained at 4 ⁇ g/ml Blasticidin. Conditioned media were tested to confirm expression and secretion of the respective recombinant proteins. Specificity of expression was confirmed by Western blot with anti-B4 mono- or polyclonal ABs and B2EC-AP reagent binding and competition assays.
- HEK293 cells were transiently transfected with a plasmid encoding secreted fonn of
- EphB4ectodomain (B4ECv3).
- Conditional media was harvested and supplemented with 10 mM imidazole, 0.3 M NaCl and centrifuged at 20,000g for 30 min to remove cell debris and insoluble particles.
- 80 ml of obtained supernatant were applied onto the pre-equilibrated column with 1 ml of Ni-NTA-agarose (Qiagen) at the flow rate of 10 ml/h. After washing the column with 10 ml of 50 mM Tris-HCl, 0.3 M NaCl and 10 mM imidazole, pH 8, remaining proteins were eluted with 3 ml of 0.25 M imidazole.
- Eluted proteins were dialyzed against 20 mM Tris-HCl, 0.15 M NaCl, pH 8 overnight. Purity and identity of B4ECv3 was verified by PAGE/Coomassie G-250 and Western blot with anti-Eph.B4 antibody. Finally, the concentration of B4ECv3 was measured, and the protein was aliquoted and stored at -70 °C.
- B4EC-FC protein and B2EC-FC protein were similarly purified.
- Ni-NTA- Agarose 10 ⁇ l were incubated in microcentrifuge tubes with 50 ⁇ l of indicated amount of B4ECv3 diluted in binding buffer BB (20 mM Tris-HCl, 0.15 M NaCl, 0.1%) bovine serum albumin pH 8) After incubation for 30 min on shaking platform, Ni-NTA beads were washed twice with 1.4 ml of BB, followed by application of 50 ⁇ l of B2-AP in the final concentration of 50 nM. Binding was performed for 30 min on shaking platform, and then tubes were centrifuged and washed one time with 1.4 ml of BB. Amount of precipitated AP was measured colorimetrically after application of PNPP.
- B4ECv3 was serially diluted in 20 mM Tris-HCl, 0.15 M NaCl,
- BSA 0.1%) BSA, pH 8 and mixed with 5,000 HEK293 cells expressing membrane-associated full- length Ephrin B2.
- 50 ⁇ l of 5 nM B4EC-AP reagent protein fusion of EphB4 ectodomain with placental alkaline phosphatase were added into each tube for 30 min to detect unoccupied Ephrin B2 binding sites. Binding reactions were stopped by dilution with 1.2 ml of BB and centrifugation. Colorimetric reaction of cell-precipitated AP was developed with PNPP substrate.
- Protein A-agarose based assay 10 ⁇ l of Protein A-agarose were incubated in Eppendorf tubes with 50 ⁇ l of indicated amount of B4EC-FC diluted in binding buffer BB (20 mM Tris-HCl, 0.15 M NaCl, 0.1 % BSA pH 8). After incubation for 30 min on shaking platform, Protein AAagarose beads were washed twice with 1.4 ml of BB, followed by application of 50 ⁇ l of B2ECAP reagent at the final concentration of 50 nM. Binding was performed for 30 min on shaking platform, and then tubes were centrifuged and washed once with 1.4 ml of BB. Colorimetric reaction of precipitated AP was measured after application of PNPP (Fig. 6).
- Nitrocellulose based assay B4EC-FC was serially diluted in 20 mM Tris-HCl, 0.15 M NaCl, 50 ⁇ g/ml BSA, pH 8. 2 ⁇ l of each fraction were applied onto nitrocellulose strip and spots were dried out for 3 min. Nitrocellulose strip was blocked with 5%> non-fat milk for 30 min, followed by incubation with 5 nM B2EC-AP reagent. After 45 min incubation for binding, nitrocellulose was washed twice with 20 mM Tris-HCl, 0.15 M NaCl, 50 ⁇ g/ml BSA, pH 8 and color was developed by application of alkaline phosphatase substrate Sigma Fast (Sigma).
- Nitrocellulose based assay See above, for B4EC-FC.
- Human umbilical cord vein endothelial cells (1.5x103) are plated in a 96- well plate in 100 ⁇ l of EBM-2 (Clonetic # CC3162). After 24 hours (day 0), the test recombinant protein (100 ⁇ l) is added to each well at 2X the desired concentration (5-7 concentration levels) in EBM-2 medium. On day 0, one plate is stained with 0.5% crystal violet in 20% methanol for 10 minutes, rinsed with water, and air-dried. The remaining plates are incubated for 72 h at 37 °C. After 72 h, plates are stained with 0.5%) crystal violet in 20% methanol, rinsed with water and airdried.
- EBM-2 Human umbilical cord vein endothelial cells
- the stain is eluted with 1:1 solution of ethanol: 0.1 M sodium citrate (including day 0 plate), and absorbance is measured at 540 nm with an ELISA reader (Dynatech Laboratories). Day 0 absorbance is subtracted from the 72 h plates and data is plotted as percentage of control proliferation (vehicle treated cells). IC50 (drug concentration causing 50%> inhibition) is calculated from the plotted data.
- Matrigel (60 ⁇ l of 10 mg/ml; Collaborative Lab # 35423) is placed in each well of an ice-cold 96-well plate. The plate is allowed to sit at room temperature for 15 minutes then incubated at 37 °C for 30 minutes to permit the matrigel to polymerize.
- HUVECs are prepared in EGM-2 (Clonetic # CC3162) at a concentration of 2X10 5 cells/ml.
- the test compound is prepared at 2X the desired concenfration (5 concentration levels) in the same medium.
- Cells (500 ⁇ l) and 2X drug (500 ⁇ l) is mixed and 200 ⁇ l of this suspension are placed in duplicate on the polymerized matrigel. After 24 h incubation, triplicate pictures are taken for each concentration using a Bioquant Image Analysis system. Drug effect (IC50) is assessed compared to untreated controls by measuring the length of cords formed and number ofjunctions.
- the bottom chamber wells receive 27-29 ⁇ l of DMEM medium alone (baseline) or medium containing chemo-attractant (bFGF, VEGF or Swiss 3T3 cell conditioned medium).
- the top chambers receive 45 ⁇ l of HUVEC cell suspension (1X10 cells/ml) prepared in DMEM+1% BSA with or without test compound. After 5 h incubation at 37 °C, the membrane is rinsed in PBS, fixed and stained in Diff-Quick solutions.
- the filter is placed on a glass slide with the migrated cells facing down and cells on top are removed using a Kimwipe.
- the testing is perfonned in 4-6 replicates and five fields are counted from each well.
- Negative unstimulated control values are subtracted from stimulated control and drug treated values and data is plotted as mean migrated cell ⁇ S.D.
- IC50 is calculated from the plotted data.
- Example 2 Extracellular domain fragments of EphB4 receptor inhibit angiogenesis and tumor growth.
- Globular domain of EphB4 is required for EphrinB2 binding and for the activity of Epl ⁇ B4-derived soluble proteins in endothelial tube formation assay.
- EphB4EC containing globular domain and Cys-rich domain B4-GC
- globular, Cys-rich and the first FNIII domain GCF1
- ECD version with deleted globular domain CF2
- Our attempts to produce several versions of truncated EphB4EC protein containing the globular domain alone were not successful due to the lack of secretion of proteins expressed from all these constructs and absence of ligand binding by the intracellularly expressed recombinant proteins.
- GCF2- F a non-tagged version of B4-GCF2, called GCF2- F, containing complete extracellular domain of EphB4 with no additional fused amino acids was expressed, purified and used in some ofthe experiments described here.
- Sequence ofthe extracellular domain of human EphB4 contains three predicted N-glycosylation sites (NXS/T) which are located in the Cys-rich domain, within the first fibronectin type III repeat and between the first and the second fibronectin repeats.
- PC3 human prostate cancer cell line is known to express elevated levels of human Eph B4. Stimulation of PC3 cells with Eplirin B2 IgG Fc fusion protein leads to a rapid induction of tyrosine phosphorylation ofthe receptor. However, preincubation ofthe ligand with GCF2, GCF1 or GC, but not CF2 proteins suppresses subsequent EphB4 autophosphorylation. Addition ofthe proteins alone to the PC3 cells or preincubation ofthe cells with the proteins followed by changing media and adding the ligand does not affect EphB4 phosphorylation status. Further, we found that globular domain of EphB4 is required for the activity of
- EphB4-derived soluble proteins in endothelial tube formation assay EphB4-derived soluble proteins in endothelial tube formation assay.
- EphB4 receptor phosphorylation in HUVECs was examined by performing Western blot analyses with lysates from soluble EphB4-treated cells and antibodies against phosphor- tyrosine. We found that soluble EphB4 treatment of serum-starved HUVECs stimulated a rapid and transient decrease in the level of phosphorylated EphB4, in the presence of
- EphrinB2Fc EphB4 ligand dimer. Ephrin B2Fc without the soluble EphB4 protein induced phosphorylation of EphB4 receptor (Fig. 22).
- Microvessel density was similar in the outer viable rim of tumor cells (the unifonn layer of cells adjacent to the tumor periphery with well defined nuclei) in control and soluble EphB4- treated tumors. Microvessel density was significantly in the inner, less viable region of tumor cells abutting the necrotic central areas in soluble EphB4-treated than control tumors. Fibrin deposition, as identified by Masson's Trichrome staining, was increased in and around blood vessels in the inner viable rim and the central necrotic core of soluble EphB4 treated than control tumors. In the outer viable rim of soluble EphB4 treated tumors, although the vessel lumen remained patent and contained red blood cells, fibrin deposition was evident around many vessels. Soluble EphB4 was found to have no such effects on the endothelium in the normal tissues examined (lungs, liver and kidneys).
- cloned full-length human EphB4 cDNA was amplified by PCR using the following oligo primers: TACTAGTCCGCCATGGAGCTCCGGGTGCTGCT (common EphB4 N- terminal primer) and GCGGCCGCTTAATGGTGATGGTGA TGATGAGCCGAAGGA GGGGTGGTGCA (B4-GC), AGCGGCCGCTTAATGGTGATGGTGAT GATGGACATTGA CAGGCTCAAATGGGA (B4-GCF1) or TGCGGCCGCTTAATGGTGATGGTGATGAT
- GCTGCTCCCGCCAGCCCTCGCTCTCAT (B4-GCF2).
- the resulting PCR fragments were TA-cloned into mammalian expression vector pEF6/V5-His-TOPO (Invitrogen) under EF-l ⁇ promoter control.
- the expressed recombinant proteins encode the following fragments ofthe mature extracellular part of human EphB4: amino acid positions 1-522 (GCF2), 1-412 (GCF1) and 1-312 (GC).
- EphB4 cDNA was amplified by two-step overlap PCR using oligo primers TACTAGTCCGCCATGGAGCTCCGGGTGCTGCT, CAGCTGAGTTTCCAATTTTGTGTTC,
- Vector for producing secreted human Epl ⁇ rinB2-alkaline phosphatase (B2-AP) reagent was constructed by PCR amplification of human Ephrin B2 cDNA using primers TAAAGCTTCCGCCATGGCTGTGAGAAGGGAC and TAGGATCCTTCGGAACCG AGGATGTTGTTCCC and cloning the resulting fragment, digested with Hind III and Bam HI, into Hind III-Bgl II digested pAPTag2 vector (GenHunter, Inc.). In each case, inserts in expression vectors were verified by complete sequencing.
- Anti-Eph B4 monoclonal antibodies mAB79 and mAB23 were raised in mice against the GCF2 protein containing amino acids 1-522 of mature human EphB4 and purified from hybridoma supernatants by Protein A chromatography.
- the anti-phosphotyrosine antibody 4G10 was from UBI (Lake Placid, NY). Protein G-HRP conjugate was purchased from Bio- Rad.
- HEK293T were transfected with the conesponding plasmid constructs using standard calcium phosphate or Lipofectamin 2000 reagent (Invitrogen) protocols. Twelve to sixteen hours post-transfection, the growth medium (DMEM+10%> fetal bovine serum) was aspirated, cells washed once with serum free DMEM and replaced with serum free DMEM. Conditioned media containing the secreted proteins were harvested 72-96 hours later, clarified by centrifugation and used for purification of His-tagged proteins using Ni-NTA Agarose (Qiagen).
- DMEM+10%> fetal bovine serum was aspirated, cells washed once with serum free DMEM and replaced with serum free DMEM.
- Conditioned media containing the secreted proteins were harvested 72-96 hours later, clarified by centrifugation and used for purification of His-tagged proteins using Ni-NTA Agarose (Qiagen).
- the purity and quantity ofthe recombinant proteins was tested by SDS- PAAG elecfrophoresis with Coomassie Blue or silver staining, Western blotting and UV spectroscopy. Purified proteins were dialyzed against 20 mM Tris-HCl, 0.15 M NaCl, pH 8 and stored at -70 °C.
- Ni-NTA-Agarose (Qiagen) were incubated in microcentrifuge tubes with 10-500 ng sample of a B4-ECD protein diluted in 0.5 ml of binding buffer BB (20 mM Tris-HCl, 0.15 M NaCl, 0.1% bovine serum albumin, pH 8). After incubation for 30 min on shaking platform, Ni-NTA beads were washed twice with 1.4 ml of BB, followed by addition of B2-AP fusion protein at concentration of 50 nM. Binding was performed for 30 min on a shaking platform. Tubes were centrifuged and washed once with 1.4 ml of BB. Amount of precipitated AP was measured colorimetrically at 420 nm after application of p-nitrophenyl phosphate (PNPP) and incubation for 5-30 min.
- PNPP p-nitrophenyl phosphate
- lysates were processed at 4 °C.
- Cells were lysed in 1 ml of buffer containing 20 mM Hepes at pH 7.4, 100 mM sodium chloride, 50 mM sodium fluoride, 2 mM EDTA, 2 mM EGTA, 1 mM sodium orthovanadate, l%(v/v) NP-40, 0.5% (w/v) sodium deoxycholate, 1 mM phenyl methylsulphonyl fluoride (added freshly) and 100U Trasylol. Lysates were scraped into Epperidorf tubes and 50 ⁇ l of boiled, formalin-fixed Staphylococcus aureus was added (Calbiochem, San Diego).
- the lysates were centrifuged for 5 min at 25,000g in a minifuge and the supematants transfened to new tubes containing the appropriate antibody. Lysates were mixed with antibodies for 1 h, after which time 50 ⁇ l of protein A-Sepharose beads were added and the contents ofthe tubes mixed for 1 h to collect the immunoprecipitates. Protein A beads were collected by centrifugation at 25,000g for 30 s. The supematants were discarded and the beads washed tliree times with 1 ml lysis buffer minus deoxycholate.
- the human prostate carcinoma cell line PC3 cells were maintained in RPMI medium with 10%) dialyzed fetal calf serum and 1% penicillin/streptomycin/neomycin antibiotics mix. Cells were maintained at 37 °C in a humidified atmosphere of 5% CO 2 /95%) air. Typically, cells were grown in 60 mm dishes until confluency and were either treated with mouse Eplirin B2-Fc fusion at 1 ⁇ g/ml in RPMI for 10 min to activate EphB4 receptor or plain medium as a control. To study the effect of different derivatives of soluble EphB4 ECD proteins on EphB4 receptor activation, three sets of cells were used.
- cells were treated with various proteins (5 proteins; GC, GCF1, GCF2, GCF2-F, CF2) at 5 ⁇ g/ml for 20 min.
- proteins were premixed with ephrinB2-Fc at 1 :5 (EphB4 protein: B2-Fc) molar ratio, incubated for 20 min and applied on cells for 10 min.
- EphB4 protein: B2-Fc B2-Fc molar ratio
- cells were first treated with the proteins for 20 min at 5 ⁇ g/ml, media was replaced with fresh media containing 1 ⁇ g/ml of EphrinB2-Fc and incubated for another 10 min.
- the immunoprecipitated proteins were solubilized in IX SDS-PAGE sample loading buffer and separated on 10% SDS-PAGE.
- electroblotted membrane was probed with anti-pTyr specific antibody 4G10 at 1 : 1000 dilution followed by Protein G-HRP conjugate at 1 :5000 dilutions.
- HUVECs were obtained from Cambrex (BioWhittaker) and maintained in EBM2 medium supplemented with 0.1 mg/ml endothelial growth supplement (crude extract from bovine brain), penicillin (50 U/ml), streptomycin (50 U/ml), 2 mmol/1 glutamine and 0.1 mg/ml sodium heparin. Aliquots of cells were preserved frozen between passages 1 and 3. For all experiments, HUVECs were used at passages 4 or below and collected from a confluent dish. 7) Endothelial Cell Tube Formation Assay
- Matrigel (60 ⁇ l of lOmg/ml; Collaborative Lab, Cat. No. 35423) was placed in each well of an ice-cold 96-well plate. The plate was allowed to sit at room temperature for 15 minutes then incubated at 37 °C for 30 minutes to permit Matrigel to polymerize.
- human umbilical vein endothelial cells were prepared in EGM-2 (Clonetic, Cat. No. CC3162) at a concentration of 2x10 5 cells/ml. The test protein was prepared at 2x the desired concentration (5 concentration levels) in the same medium.
- HUVECs to VEGF were assessed using a modified Boyden chamber, franswell membrane filter inserts in 24 well plates, 6.5 mm diam, 8 ⁇ m pore size, 10 ⁇ m thick matrigel coated, polycarbonate membranes (BD Biosciences).
- the cell suspensions of HUVECs (2x 10 5 cells/ml) in 200 ⁇ l of EBM were seeded in the upper chamber and the soluble EphB4 protein were added simultaneously with stimulant (VEGF or bFGF) to the lower compartment ofthe chamber and their migration across a polycarbonate filter in response to 10- 20 ng/ml of VEGF with or without 100 nM-1 ⁇ M test compound was investigated.
- stimulant VEGF or bFGF
- HUVEC 1.5xl0 3 cells
- EBM-2 Epidermal-Benoic fibroblasts
- test recombinant protein 100 ⁇ l
- the test recombinant protein 100 ⁇ l
- one plate was stained with 0.5% crystal violet in 20%> methanol for 10 minutes, rinsed with water, and air-dried.
- the remaining plates were incubated for 72 h at 37 °C. After 72 h, plates were stained with 0.5% crystal violet in 20% methanol, rinsed with water and air-dried.
- the stain was eluted with 1:1 solution of ethanol: 0.1M sodium citrate (including day 0 plate), and absorbance measured at 540 nm with an ELISA reader (Dynatech Laboratories). Day 0 absorbance was subtracted from the 72 h plates and data is plotted as percentage of control proliferation (vehicle treated cells). IC 50 value was calculated from the plotted data.
- Murine Matrigel Plug Angiogenesis Assay In vivo angiogenesis was assayed in mice as growth of blood vessels from subcutaneous tissue into a Matrigel plug containing the test sample. Matrigel rapidly forms a solid gel at body temperature, trapping the factors to allow slow release and prolonged exposure to su ⁇ ounding tissues. Matrigel (8.13 mg/ml, 0.5 ml) in liquid fonn at 4 °C was mixed with Endothelial Cell Growth Supplement (ECGS), test proteins plus ECGS or Matrigel plus vehicle alone (PBS containing 0.25% BSA). Matrigel (0.5ml) was injected into the abdominal subcutaneous tissue of female nu/nu mice (6 wks old) along the peritoneal mid line.
- ECGS Endothelial Cell Growth Supplement
- test proteins plus ECGS or Matrigel plus vehicle alone PBS containing 0.25% BSA
- mice There were 3 mice in each group. The animals were cared for in accordance with institutional and NIH guidelines. At day 6, mice were sacrificed and plugs were recovered and processed for histology. Typically the overlying skin was removed, and gels were cut out by retaining the peritoneal lining for support, fixed in 10%o buffered formalin in PBS and embedded in paraffin. Sections of 3 ⁇ m were cut and stained with H&E or Masson's trichrome stain and examined under light microscope
- Mouse corneal micropocket assay was performed according to that detailed by Kenyon et al., 1996. Briefly, hydron pellets (polyhydroxyethylmethacrylate [polyHEMA], hiterferon Sciences, New Brunswick, NJ, U.S.A.) containing either 90 ng of bFGF (R&D) or 180 ng of VEGF (R&D Systems, Minneapolis, MN, U.S.A.) and 40 ⁇ g of sucrose aluminium sulfate (Sigma) were prepared. Using an operating microscope, a stromal linear keratotomy was made with a surgical blade (Bard-Parker no. 15) parallel to the insertion ofthe lateral rectus muscle in an anesthetized animal.
- polyHEMA polyhydroxyethylmethacrylate
- An infrastromal micropocket was dissected using a modified von Graefe knife (2 " 30 mm).
- a single pellet was implanted and advanced toward the temporal corneal limbus (within 0 ⁇ 7 ⁇ 1 ⁇ 0 mm for bFGF pellets and 0 ⁇ 5 mm for VEGF pellets). The difference in pellet location for each growth factor was determined to be necessary given the relatively weaker angiogenic stimulation of VEGF in this model.
- Antibiotic ointment erythromycin. was then applied to the operated eye to prevent infection and to decrease surface i ⁇ egularities.
- the subsequent vascular response was measured extending from the limbal vasculature toward the pellet and the contiguous circumferential zone of neovascularization Data and clinical photos presented here were obtained on day 6 after pellet implantation, which was found to be the day of maximal angiogenic response.
- Microgel matrix-coated 9-mm cell culture inserts (pore size, 8 ⁇ m; Becton Dickinson, Franklin Lakes, NJ) were set in a 24-well plate.
- the HUVEC cells were seeded at a density of 5x10 3 cells per well into the upper layer ofthe culture insert and cultured with serum-free EBM in the presence of EphB4 ECD for 24 h.
- the control group was cultured in the same media without EphB4. Then 0.5 ml ofthe human SCC15 cell line, conditioned medium was filled into the lower layer ofthe culture insert as a chemo-attractant.
- Tumor volumes in the EphB4 ECD group, in the presence and absence of growth factor after implantation were three-fold smaller than those in the vehicle groups. There was no difference in body weight between the groups.
- Immunohistochemical examination of cross- sections of resected tumors and TUNEL-positive apoptosis or necrosis, CD34 immunostaining, and BrdU proliferation rate will be performed, after deparaffinized, rehydrated, and quenched for endogenous peroxidase activity, and after 10 min permeabilization with proteinase K. Quantitative assessment of vascular densities will also be performed. Local intratumoral delivery or IV delivery of EphB4 ECD will also be performed twice a week.
- mice 30 athymic nude mice, BALB/c (nu/nu), were each injected with 1 x 10 6 B16 melanoma cells with 0.1 ml PBS mixed with 0.1 ml matrigel or 1.5 x 10 6 SCC 15 cells resuspended in 200 ⁇ l of DMEM serum-free medium and injected subcutaneously on day 0 on the right shoulder region of mice. Proteins were injected intravenously or subcutaneously, around the tumor beginning on day 1 at a loading dose of 4 ⁇ g/mg, with weekly injections of 2ug/mg. (10 ⁇ g/g, 50 ⁇ g/kg/day), and at 2 weeks post-inoculation. Mice are sacrificed on Day 14. Control mice received PBS 50 ⁇ l each day.
- Tumor formation in nude mice All animals were treated under protocols approved by the institutional animal care committees. Cancer cells (5xl0 6 ) were subcutaneously inoculated into the dorsal skin of nude mice. When the tumor had grown to a size of about 100 mm (usually it took 12 days), sEphB4 was either infraperitoneally or subcutaneously injected once/day, and tumorigenesis was monitored for 2 weeks. Tumor volume was calculated according to the formula a 2 xb, where a and b are the smallest and largest diameters, respectively. A Student's t test was used to compare tumor volumes, with P ⁇ .05 being considered significant.
- Tumors were fixed in 4% formaldehyde, embedded in paraffin, sectioned by 5 ⁇ m, and stained with hematoxylineosin. Vessel density was semi-quantitated using a computer- based image analyzer (five fields per section from three mice in each group).
- EphB4 protein was expressed in a variety of prostate cancer cell lines by Western blot.
- prostate cancer cell lines show marked variation in the abundance ofthe 120 kD EphB4.
- the levels were relatively high in PC3 and even higher in PC3M, a metastatic clone of PC3, while normal prostate gland derived cell lines (MLC) showed low or no expression of EphB4 (Fig. 27 A).
- MLC normal prostate gland derived cell lines
- Fig. 27 A We next checked the activation status of EphB4 in PC3 cells by phosphorylation study.
- EphB4 is phosphorylated though it can be further induced by its ligand, ephrin B2 (Fig. 27B).
- EphB4 is expressed in clinical prostate samples.
- tumor tissues and adjacent normal tissue from prostate cancer surgical specimens were examined.
- the histological distribution of EphB4 in the prostate specimens was determined by iinmunohistochemistry.
- EphB4 expression is confined to the neoplastic epithelium (Fig. 28, top left), and is absent in stromal and normal prostate epithelium (Fig. 28, top right), prostate tissue anay, 24 ofthe 32 prostate cancers examined were positive.
- EphB4 mRNA is expressed both in the normal and tumor tissues of clinical samples by quantitative RT-PCR.
- tumor EphB4 mRNA levels were at least 3 times higher than in the normal in this case (Fig. 28, lower right).
- PC3 cells are known to lack PTEN expression (Davis, et al., 1994, Science. 266:816- 819) and wild-type p53 function (Gale, et al., 1997, Cell Tissue Res. 290:227-241).
- EphB4 is related to p53 and/or PTEN by re-introducing wild-type p53 and/or PTEN into PC3 cells.
- transfected cells were sorted for the cofransfected truncated CD4 marker.
- the co-transfection of p53 and PTEN did not further inhibit the expression of EphB4 (Fig. 29 A).
- RXR ⁇ Retinoid X receptor regulates the expression of EphB4
- EphB4 expression has the reverse expression pattern when we looked at "normal” prostate (MLC), prostate cancer (PC3), and metastatic prostate cancer (PC3M) (Fig. 27A), we considered whether RXR ⁇ regulates the expression of EphB4.
- MLC normal prostate
- PC3M metastatic prostate cancer
- the expression of EphB4 was compared between CWR22R and CWR22R-RXR ⁇ , which constitutively expresses RXR ⁇ .
- FGF8 has no effect on EphB4 expression. Consistent with initial results, EphB4 was not found in "normal" benign prostate hyperfrophic cell line BPH-1 (Fig. 29B).
- EphB4 was down-regulated after blocking the EGFR signaling using EGFR kinase inhibitor AG 1478 (Fig. 30A) or upon blockade ofthe IGF-IR signaling pathway using IGF- 1R neutralizing antibody (Fig. 30B).
- EphB4 siRNA and antisense ODNs inhibit PC3 cell viability
- EphB4 overexpression in our prostate cancer model
- PC3 cells which have a relatively high expression of EphB4.
- the two approaches to decreasing EphB4 expression were siRNA and AS-ODNs.
- a number of different phosphorothioate-modif ⁇ ed AS-ODNs complementary to different segments of the EphB4 coding region were tested for specificity and efficacy of EphB4 inhibition.
- AS-10 full-length EphB4 expression vector AS-10 was found to be the most effective (Fig. 3 IB).
- a Similar approach was applied to the selection of specific siRNA.
- EphB4 siRNA 472 effectively knocks down EphB4 protein expression (Fig. 31 A).
- Both siRNA 472 and antisense AS-10 ODN reduced the viability of PC3 cells in a dose dependent manner (Fig. 31C, D).
- Unrelated siRNA or sense oligonucleotide had no effect on viability.
- EphB4 siRNA and antisense ODNs inhibit the mobility of PC3 Cells
- PC3 cells can grow aggressively locally and can form lymph node metastases when injected orthotopically into mice, hi an effort to study the role of EphB4 on migration of PC3 cells in vitro, we performed a wound-healing assay.
- a wound was introduced into a monolayer of PC3 cells, over the course ofthe next 20 hours cells progressively migrated into the cleared area.
- siRNA 472 when cells were transfected with siRNA 472 and the wound was introduced, this migration was significantly inhibited (Fig. 3 IE).
- Pretreatment of PC3 cells with 10 ⁇ M EphB4 AS-10 for 12 hours generated the same effect (Fig. 3 IF), hi addition, knock-down of EphB4 expression in PC3 cells with siRNA 472 severely reduced the ability of these cells to invade Matrigel as assessed by a double-chamber invasion assay (Fig. 31G), compared to the control siRNA.
- EphB4 siRNA induces cell cycle anest and apoptosis in PC3 cells
- siRNA 472 resulted in an accumulation of cells in the sub GO and S phase fractions compared to cells treated with control siRNA.
- the sub GO fraction increased from 1 % to 7.9%, and the S phase fraction from 14.9 % to 20.8 % in siRNA 472 freated cells compared to control siRNA treated cells (Fig. 32A).
- Cell cycle arrest at sub GO and G2 is indicative of apoptosis. Apoptosis as a result of EphB4 knock-down was confirmed by ELISA assay.
- Neutralizing IGF-IR antibody was from R&D Systems (Minneapolis MN). Anti-IGF- lR( ⁇ ), -EGFR, -EphB4(C-16) were from Santa Cruz Biotech (Santa Cruz, CA). ⁇ -actin monoclonal antibody was purchased from Sigma Chemical Co. (St Louis, MO). Media and fetal bovine seram (FBS) were from Invitrogen (Carlsbad, CA). AG 1478(4-(3'- ChloiOanilino)-6,7-dimethoxy-quinazoline) was from Calbiochem (San Diego, CA).
- EphB4 specific antisense phosphorothioate-modified oligodeoxynucleotide (ODN) and sense ODN were synthesized and purified by Qiagen (Alameda CA). The sequences are: Sense, 5'-TCC-TGC-AAG-GAG-ACC-TTC-AC-3'; AS1: 5'-GTG-CAG-GGA-TAG-CAG ⁇ GGC-CAT-3'; AS10: 5'-ATG-GAG-GCC-TCG-CTC-AGA-AA-3'. siRNAs were synthesized at the USC/Norris Comprehensive Cancer Center Microchemical Core laboratory.
- EphB4 siRNAs are siRNA 472 5'-GGU-GAA-UGU-CAA-GAC- GCU-GUU-3' and siRNA 2303 5'-cuc-uuc-cga-ucc-cac-cua-cuu-3'.
- Negative control siRNA to scrambled GAPDH was from Ambion (Austin, TX) 3) Cell lines and culture The prostate cancer cell lines, PC3, PC3M, DU145, ALVA31, LAPC-4, LNCaP, CWR22R and adult human normal prostate epithelial cell line MLC SV40, and BPH-1 were obtained and cultured as described previously (7). Stable cell line CWR22R-RXR, LNCaP- FGF8 were established and cultured as described before (7, 33). 4) Generation of EphB4 monoclonal antibody
- EphB4 extracellular domain expressed as a GST fusion protein in BL21 E. coli was purified by affinity chromatography and the GST domain was cleaved by thrombin. Monoclonal antibody was generated and the sensitivity and specificity ofthe antibody was reconfirmed by Western blot with whole cell lysate of 293 cells stably transfected with EphB4.
- RNA STAT-60 Tel-Test, hie. Friendswood TX
- For quantitative RT-PCR first sfrand cDNA was synthesized from 5 ⁇ g of total RNA using Superscript III (Invitrogen, Carlsbad CA). Quantitative RT-PCR was performed on the Stratagene MX3000P system (Stratagene, La Jolla CA) using SYBR Green I Brilliant Mastermix (Stragene) according to the manufacture's instructions.
- Optimized reactions for EphB4 and ⁇ -actin were 150 nM each ofthe forward primer ( ⁇ -actin, 5'-GGA-CCT-GAC- TGA-CTA-CCT-A-3 5 ; EphB4, 5 5 -AAG-GAG-ACC-TTC-ACC-GTC-TT-3 5 ) and reverse primer ( ⁇ -actin 5 5 -TTG-AAG-GTA-GTT-TCG-TGG-AT-3'; EphB4, 5'-TCG-AGT-CAG- GTT-CAC-AGT-CA-3') with DNA denaturation/activation of polymerase at 95 °C for 10 min followed by 40 cycles of 95 °C for 30s, 60 °C for lmin, 72 °C for lmin. The specificity ofthe gene-specific amplification was confirmed by the presence of a single dissociation peak. All reactions were performed in triplicate with RT and no template negative controls.
- OCT-embedded tissues were sectioned at 5 ⁇ m and fixed in phosphate-buffered 4% parafomialdehyde. Sections were washed for 3 x 5 min in PBS and endogenous peroxidase was blocked by incubation in 0.3% H 2 O 2 in PBS for 10 min at room temperature. Sections were incubated with Eph4 (C-l 6) antibody (1 :50) for 1 h at room temperature followed by three washes in PBS and incubation with donkey anti-goat secondary antibody (Santa Cruz Biotech.) for 1 h at room temperature. After three washes in PBS, peroxidase activity was localized by incubation in DAB substrate solution (Vector Laboratories, hie.
- Membranes were first probed with primary antibody overnight, stripped with RestoreTM Western Blot stripping buffer (Pierce, Rockford IL) and reprobed with ⁇ -actin to confirm equivalent loading and transfer of protein. Signal was detected using SuperSignal West Femto Maximum Sensitivity Substrate (Pierce).
- Cells growing in 60 mm dishes were either serum starved (1% FBS supplemented RPMI 1640, 24 hours) or cultured in normal conditions (10% FBS) and then treated with or without 1 ⁇ g/ml mouse ephrin B2/F c for 10 min to activate EphB4 receptor Cleared cell lysates were incubated with EphB4 monoclonal antibody overnight at 4°C.
- Antigen-antibody complex was immunoprecipitated by the addition of 100 ⁇ l of Protein G-Sepharose in 20 mM sodium phosphate, pH 7.0 with incubation overnight at 4 °C.
- Immunoprecipitates were analyzed by Western blot with pTyr specific antibody (Upstate, clone 4G10) at 1 : 1000 dilution followed by incubation with protein G-HRP (Bio-Rad) at 1:5000 dilution. To monitor immunoprecipitation efficiency, a duplicate membrane was probed with EphB4 specific monoclonal antibody.
- pC53-SN3 PTEN vector or both using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
- the molar ratio of CD4 to p53 or PTEN or vector was 1 :3 and total plasmid was 24 ⁇ g for a 10 cm 2 dish of 90% confluent cells using 60 ⁇ l of Lipofectamine 2000. 24 hours after transfection, a single cell suspension was made and sorted using truncated CD4 as a surface marker according to the manufacturer's protocol (Miltenyi Biotec, Germany). Sorted cells were lysed in 1 x SDS sampling buffer and analyzed by Western blot.
- PC3 cells were seeded into 6-well plates and cultured until 80%> confluent and treated with 2 ⁇ g/ml neutralizing IGF-IR monoclonal antibody, MAB391 (Hailey, et al, 2002, Mol Cancer Ther. 1:1349-1353), or with 1 nM AG 1478, a strong EGFR inhibitor (Liu, et al, 1999, J Cell Sci. 112 (Pt 14):2409-2417) for 24 h. Crude cell lysates were analyzed by
- PC3 cells were seeded on 48-well plates at a density of approximately l lO 4 cells/well in a total volume of 200 ml. Media was changed after the cells were attached and the cells were treated with various concentrations (1-10 ⁇ M) of Epl ⁇ B4 antisense ODN or sense ODN as control. After three days media was changed and fresh ODNs added. Following a further 48 h incubation, cell viability was assessed by MTT as described previously (36). EphB4 siRNAs (10-100 nM) were introduced into 2 x 10 4 PC3 cells/well of a 48-well plate using 2 ⁇ l of LipofectamineTM 2000 according to the manufacturer's instructions. 4 h post-transfection the cells were returned to growth media (RPMI 1640 supplemented with 10 % FBS). Viability was assayed by MTT 48 h following transfection.
- PC3 cells were seeded into 6-well plates and cultured until confluent. 10 ⁇ M AS-10 or sense ODN as control were introduced to the wells as described for the viability assay 12 hours before wounding the monolayer by scraping it with a sterile pipette tip. Medium was changed to RPMI 1640 supplemented with 5% FBS and fresh ODNs. Confluent cultures transfected with 50 nM siRNA 472 or GAPDH negative control siRNA 12 hours prior to wounding were also examined. The healing process was examined dynamically and recorded with a Nikon Coolpix 5000 digital camera with microscope adapter.
- 80% confluent cultures of PC3 cells in 6-well plates were transfected with siRNA472 (100 nM) using LipofectamineTM 2000. 24 hours after transfection, cells were trypsinized, washed in PBS and incubated for 1 h at 4oC in 1 ml of hypotonic solution containing 50 ⁇ g/ml propidium iodide, 0.1% sodium citrate, 0.1 Triton X-100 and 20 ⁇ g/ml Dnase-free RnaseA. Cells were analyzed in linear mode at the USC Flow cytometry facility.
- Results were expressed as percentages of elements detected in the different phases ofthe cell cycle, namely Sub GO peak (apoptosis), G0/G1 (no DNA synthesis), S (active DNA systhesis), G2 (premitosis) and M (mitosis).
- Example 4 Expression of EPHB4 in Mesothelioma: a candidate target for therapy
- Malignant mesothelioma (MM) is a rare neoplasm that most often arises from the pleural and peritoneal cavity serous surface. The pleural cavity is by far the most frequent site affected (> 90%), followed by the peritoneum (6-10%) (Carbone et al., 2002, Semin Oncol. 29:2-17).
- asbestos exposure about 80% of malignant mesothelioma cases occur in individuals who have ingested or inhaled asbestos. This tumor is particularly resistant to the cu ⁇ ent therapies and, up to now, the prognosis of these patients is dramatically poor (Lee et al, 2000, Cu ⁇ Opin Pulm Med. 6:267-74).
- EPHB4 and EphrinB2 is expressed in mesothelioma cell lines
- Ephrin B2 and EphB4 in malignant mesothelioma cell lines was detenxiined at the RNA and protein level by a variety of methods. RT-PCR showed that all of the four cell lines express EphrinB2 and EPHB4 (fig. 33 A). Protein expression was determined by Western blot in these cell lines. Specific bands for EphB4 were seen at 120 kD. In addition, Ephrin B2 was detected in all cell lines tested as a 37 kD band on Western blot (fig. 33B). No specific band for Ephrin B2 was observed in 293 human embryonic kidney cells, which were included as a negative control.
- EphB4 transcription in mesothelioma cells was ca ⁇ ied out on NCI H28 cell lines cultured on chamber slides. Specific signal for EphB4 was detected using antisense probe Ephrin B2 transcripts were also detected in the same cell line. Sense probes for both EphB4 and Ephrin B2 served as negative controls and did not hybridize to the cells (figure 34). Expression of EphB4 and Ephrin B2 proteins was confirmed in the cell lines by immunofluorescence analysis (fig. 35). Tliree cell lines showed strong expression of Epl B4, whereas expression of Ephrin B2 was present in H28 and H2052, and weakly detectable in H2373.
- Tumor cells cultured from the pleural effusion of a patient diagnosed with pleural malignant mesothelioma were isolated and showed positive staining for both EphB4 and Ephrin B2 at passage 1 (figure 35, bottom row). These results confirm co-expression of EphB4 and Ephrin B2 in mesothelioma cell lines.
- tumor biopsy samples were subjected to immunohistochemical staining for EphB4 and Ephrin B2. Antibodies to both proteins revealed positive stain in the tumor cells. Representative data is shown in figure 36.
- EPHB4 is involved in the cell growth and migration of mesothelioma
- EphB4 The role of EphB4 in cell proliferation was tested using EPHB4 specific antisepses oligonucleotides and siRNA. The freatment of cultured H28 with EPHB4 antisense reduced cell viability.
- EPHB4AS-10 One ofthe most active inhibitor of EphB4 expression is EPHB4AS-10 (fig. 37A). Transfection of EPHB4 siRNA 472 generated the same effect (fig. 37B).
- MM is a locally advancing disease with frequent extension and growth into adjacent vital stractures such as the chest wall, heart, and esophagus.
- wound healing assay using previously described techniques (3:36).
- a wound was introduced into sub confluent H28 cells, over the course ofthe next 28 hours cells would progressively migrate into the area ofthe wound.
- cells were pretreated with EPHB4AS-10 for 24 hours, and the wound was introduced, this migration was virtually completely prevented (fig. 38 A).
- the migration study with Boyden Chamber assay with EPHB4 siRNA showed that cell migration was greatly inhibited with the inhibition of EPHB4 expression (Fig. 38B).
- NCI H28, NCI H2052, NCI H2373, MSTO 21 IH mesothelioma cell lines and 293 human embryonic kidney cells were obtained from the ATCC (Manassas, VA). Cells were maintained in RPMI 1640 media supplemented with 10 %> heat-inactivated fetal bovine seram (FBS; Life Technologies, Gaithersburg, MD) and antibiotics. Primary cells were obtained from pleural effusion of patients with mesothelioma. A large number of EPHB4 phosphorothioate modified antisense oligonucleotides were synthesized. Similarly a number of EphB4 specific siRNAs were generated. Monoclonal antibody produced against EPHB4 was used for western blot. Polyclonal antibody against EphrinB2 and EPHB4 (C-l 6) (for immunohistochemical staining) was from Santa Cruz.
- Primers for EphB4 and EphrinB2 were designed with Primer 3 software. The sequences for all primers are as follows: EPHB4 forward primer and EPHB4 reverse primer (see, e.g., in Example 2); EphrinB2 forward primer and EphrinB2 reverse primer (see, e.g., in Example 6); G3PDH forward primer, 5'-GGAGCCAAAAGGGTCATCAT-3'; G3PDH reverse primer, 5'-GGCATTGCTGCAAAGAAAGAG-3'; Clonetics kit was used for PCR. PCRs were performed with the ABI PCR System 2700 (Applied Biosystem). The PCR conditions were 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 seconds, 60 °C for 30 seconds and 72 °C for lmin.
- Ephrin-B2 and EphB4 PCR products were cloned using the pGEM-T Easy System (Promega, Madison WI) according to the manufacturer's description.
- the primers and PCR products were 5'-tccgtgtggaagtactgctg-3' (forward), 5'-tctggtttggcacagttgag-3' (reverse), for ephrin-B2 that yielded a 296-bp product and 5'-ctttggaagagaccctgctg-3' (forward), 5 s - agacggtgaaggtctccttg-3', for EphB4 that yielded a 297-bp product.
- the authenticity and insert orientation were confirmed by DNA sequencing.
- pGEM-T Easy plasmids containing the PCR product ofthe human ephrin-B2 or EphB4 gene were linearized with Spe I or Nco I.
- Antisense or sense digoxigenin (DIG)- labeled RNA probes were transcribed from T7 or SP6 promoters by ran-off transcription using a DIG RNA labeling kit (Roche, Indianapolis IN). RNA probes were quantitated by spot assay as described in the DIG RNA labeling kit instructions.
- Cells were cultured in Labtech II 4-well chamber slides (Nalge Nunc International, Naperville, IL). Cells were washed in PBS (37 °C), then fixed for 30 min at 25 °C in a solution of 4% (w/v) fo ⁇ naldehyde, 5% (v/v) acetic acid, and 0.9%> (w/v) NaCl. After fixation, slides were rinsed with PBS and stored in 70% ethanol at 4 °C until further use. Before in situ hybridization, cells were dehydrated, washed in 100% xylene to remove residual lipid and then rehydrated, finally in PBS.
- Slides were hybridized overnight at 42 °C with 25 ng antisense or sense RNA probes in 40% deionized formamide, 10%> dextran sulfate, IX Denhardt's solution, 4 X SSC, 10 mM DTT, 1 mg/ml yeast t-RNA and lmg/ml denatured and sheared salmon spenn DNA in a total volume of 40 ⁇ l. Slides were then washed at 37 °C as follows: 2 X 15 min with 2 X SSC, 2 X 15min with 1 X SSC, 2 X 15 min with 0.5 X SSC and 2 X 30 min with 0.2 X SSC.
- Hybridization signal was detected using alkaline- phosphatase-conjugated anti-DIG antibodies (Roche) according to the manufacturer's instructions. Color development was stopped by two washes in 0.1 M Tris-HCl, linM EDTA, pH 8.0 for 10 min. Cells were visualized by counterstaining of nucleic acids with Nuclear Fast Red (Vector Laboratories, Burlingame, CA) and the slides were mounted with DVIMU- MOUNT (Shandon, Astmoor UK).
- Crude cell lysates were prepared by incubation in cell lysis buffer (10 mM Tris, pH 7.5, 1 mM EDTA, 150 mM NaCl, 1 % Triton X-100, 1 mM DTT, 10 % glycerol). Lysates were cleared by centrifugation at 10,000 x g for 10 min. Total protein was determined by Bradford assay (Bio-Rad). Samples (20 ⁇ g protein) were fractionated on a 4-20 % Tris- glycine polyacrylamide gel and transfened to polyvinylidene difluoride (PVDT) membrane (Bio-Rad) by electroblotting.
- PVDT polyvinylidene difluoride
- Membranes were blocked with 5 % non-fat milk prior to incubation with antibody to EphB4 (1:5000 dilution) at 4° C, for 16 h. Secondary antibody (1:100,000 dilution) conjugated with horseradish peroxidase was applied for 1 h at 25 °C. The membranes were developed using the SuperSignal West Femto Maximum sensitivity chemiluminescent substrate (Pierce, Rockford, IL) according to the manufacturer's instructions.
- Nuclei were counterstained with 4',6-diamidino- 2-phenylindole dihydrochloride hydrate (DAPI), washed extensively with PBS and mounted with Vectasheild antifade mounting solution (Vector Laboratories). Images were obtained using an Olympus AX70 fluorescence microscope and Spot v2.2.2 (Diagnostic Instruments Inc., Sterling Heights, MI) digital imaging system.
- DAPI 4',6-diamidino- 2-phenylindole dihydrochloride hydrate
- HNSCC Squamous cell carcinoma ofthe head and neck
- EphB4 Although high expression of EphB4 has been reported in hematologic malignancies, breast carcinoma, endometrial carcinoma, and colon carcinoma, there is limited data on the protein levels of EphB4, and complete lack of data on the biological significance of this protein in tumor biology such as HNSCC.
- FIG. 39A (top left) illustrates a representative case, showing that EphB4 is expressed in the tumor regions only, as revealed by the H&E tumor architecture (Fig. 39A bottom left). Note the absence of staining for EphB4 in the stroma. Secondly, a metastatic tumor site in the lymph node shows positive staining while the remainder ofthe lymph node is negative (Fig. 39A, top right).
- EphB4 transcripts were detected in situ hybridization. Strong signal for EphB4 specific antisense probe was detected indicating the presence of transcripts ( Figure 39 B, top left). Comparison with the H&E stain (Fig. 39B, bottom left) to illustrate tumor architecture reveals that the signal was localized to the tumor cells, and was absent from the stromal areas. Ephrin B2 transcripts were also detected in tumor sample, and as with EphB4, the signal was localized to the tumor cells (Fig. 39B, top right). Neither EphB4 nor ephrin B2 sense probes hybridized to the sections, proving specificity ofthe signals.
- EphB4 expression and regulation by EGFR activity in HNSCC cell lines Having demonstrated the expression of EphB4 limited to tumor cells, we next sought to determine whether there was an in vitro model of EphB4 expression in HNSCC.
- Six HN SCC cell lines were surveyed for EphB4 protein expression by Western Blot (Fig. 40A). A majority of these showed strong EphB4 expression and thus established the basis for subsequent studies. Since EGFR is strongly implicated in HNSCC we asked whether EphB4 expression is associated with the activation of EGFR.
- SCC-15 and -25 serve as models for EphB4 being regulated by EGFR activity
- SCC-9, -12, -13 and -71 are models for regulation of EphB4 in HNSCC independent of EGFR activity, where there may be input from other factors such as p53, PTEN, IL-6 etc.
- EphB4 levels were induced in SCC 15 cells that had been serum starved for 24 h prior to 24 h treatment with 10 ng/ml EGF as shown in figure 41B (lanes 1 and 2).
- the downstream signaling pathways known for EGFR activation shown in figure 41A, (for review see Yarden & Slikowski 2001) were then investigated for their input into EGF mediated induction of EphB4.
- siRNA2302 that was not effective in reducing EphB4 levels and had only minor effects on viability did not produce any changes in the cell cycle when compared with the mock LipofectamineTM2000 transfection.
- Eph B4 50 5 ' -GAGACCCUGCUGAACACAAUU-3 ' 3 ' -UUCUCUGGGACGACUUGUGUU-5 '
- Eph B4 472 5 ' -GGUGAAUGUCAAGACGCUGUU-3 ' 3 ' -UUCCACUUACAGUUCUGCGAC-5 '
- Eph B4 1562 5 ' -CAUCACAGCCAGACCCAACUU-3 ' 3 ' -UUGUAGUGUCGGUCUGGGUUG-5 '
- the IC 50 for AS-10 was approximately 1 ⁇ M, while even 10 ⁇ M AS-11 was not sufficient to attain 50 % reduction of viability.
- AS-10 had on the cell cycle was investigated, it was found that the sub GO fraction increased from 1.9 % to 10.5 % compared to non-treated cells, indicative of apoptosis (Fig. 43C).
- EphB4 AS-10 which reduces cell viability and motility, was determined in SCC15 tumor xenografts in Balb/C nude mice.
- HNSCC-4, -9, 12, -13, -15, -25, and -71 were obtained from and 293 human embryonic kidney cells were obtained from the ATCC (Manassas, VA). Cells were maintained in RPMI 1640 media supplemented with 10% heat-inactivated fetal bovine serum (FBS; Invitrogen, Carlsbad, CA) and antibiotics.
- FBS heat-inactivated fetal bovine serum
- EGFR, EphB4(C-16) polyclonal antibodies were from Santa Craz Biotech (Santa Cruz, CA). ⁇ -actin monoclonal antibody was purchased from Sigma Chemical Co. (St Louis, MO).
- Ephrin B2 and EphB4 polyclonal antibodies and their conesponding blocking peptides were obtained from Santa Craz Biotechnology (Santa Cruz, CA).
- AG 1478 (4-(3'-Chloroanilino)-6,7-dimethoxy-quinazoline) was from Calbiochem (San Diego, CA).
- Kinase inhibitors SH-5 and SP 600125 were from A.G. Scientific (San Diego, CA), PD98095, U73122, SB203580, LY294002, and Wortmannin were obtained from Sigma.
- Sections were washed for 3 x 5 min in PBS and endogenous peroxidase was blocked by incubation in 0.3% H 2 O 2 in PBS for 10 min at room temperature. Sections were incubated with Eph4 (C-16) antibody (1 :50) for 1 h at room temperature followed by three washes in PBS and incubation with donkey anti-goat secondary antibody (Santa Craz Biotech.) for 1 h at room temperature. After three washes in PBS, peroxidase activity was localized by incubation in DAB substrate solution (Vector Laboratories, Inc. Burlingame CA) for 10 min at room temperature. Sections were counterstained with Hematoxylin for 20 s, dehydrated and mounted.
- Negative control for staining was substitution of normal goat serum for primary antibody. Immunohistochemical staining on prostate anay (BioMeda, Foster City, CA) was done using goat ABC Staining System (Santa Craz Biotech.) according to the manufacturer's instructions.
- siRNA construction kit (Ambion, Austin TX) was used to synthesize siRNA to EphB4. Briefly, 21 bp target sequences containing 19 bp downstream of 5'-AA dinucleotides were identified that showed no significant homology to other sequences in the GenBank database. Sense and antisense siRNA 29-mer DNA oligonucleotide templates were synthesized at the USC No ⁇ is Microchemical Core Facility. Antisense template conesponded to the target sequence followed by 8 bp addition (5'-CCTGTCTC-3') at the 3' end complementary to the T7 promoter primer provided by the SilencerTM siRNA construction kit. Sense template comprised 5'-AA followed by the complement ofthe target 19 bp, then the T7 8 bp sequence as above. In separate reactions, the two siRNA oligonucleotide templates were hybridized to a
- T7 promoter primer The 3 3 ends ofthe hybridized oligonucleotides were extended by the Klenow fragment of DNA polymerase to create double-stranded siRNA transcription templates.
- the sense and antisense siRNA templates were transcribed by T7 RNA polymerase and the resulting RNA transcripts were hybridized to create dsRNA.
- the leader sequences were removed by digesting the dsRNA with a single-stranded specific ribonuclease leaving the overhanging UU dinucleotides.
- the DNA template was removed at the same time by treatment with RNase free deoxyribonuclease.
- the resulting siRNA was purified by glass fiber filter binding to remove excess nucleotides, short oligomers, proteins, and salts in the reaction.
- the end products (shown in Table 3) were double-stranded 21-mer siRNAs with 3 ' terminal uridine that can effectively reduce the expression of target mRNA when transfected into cells.
- Eph B4 AS-1 (552-572) GTG CAG GGA TAG CAG GGC CAT Eph B4 AS-2 (952-972) AAG GAG GGG TGG TGC ACG GTG Eph B4 AS-3 (1007-1027) TTC CAG GTG CAG GGA GGA GCC Eph B4 AS-4 (1263-1285) GTG GTG ACA TTG ACA GGC TCA Eph B4 AS-5 (1555-1575) TCT GGC TGT GAT GTT CCT GGC Eph B4 AS-6 (123-140) GCC GCT CAG TTC CTC CCA Eph B4 AS-7 (316-333) TGA AGG TCT CCT TGC AGG Eph B4 AS-8 (408-428) CGC GGC CAC CGT GTC CAC CTT Eph B4 AS-9 (1929-1949) CTT CAG GGT CTT GAT TGC CAC Eph B4 AS-10 (1980-1999) ATG GAG GCC TCG CTC AGA
- siRNAs 10-100 nM
- 2 x 10 4 cells/well of SCC- 4, -15, -25 or -71 in a 48-well plate were transfected with siRNAs (10-100 nM) using 2 ⁇ l of LipofectamineTM 2000 according to the manufacturer's instructions. 4 h post-transfection the cells were returned to growth media (RPMI 1640 supplemented with 10 % FBS). Viability was assayed by MTT 48 h following transfection.
- Results were expressed as percentages of elements detected in the different phases of the cell cycle, namely Sub GO pealc (apoptosis), G0/G1 (no DNA synthesis), S (active DNA systhesis), G2 (premitosis) and M (mitosis).
- Sub GO pealc apoptosis
- G0/G1 no DNA synthesis
- S active DNA systhesis
- G2 premitosis
- M mitosis
- SCC 15 cells were seeded into 6-well plates and cultured until confluent. 10 ⁇ M AS-1, AS-10, or sense ODN as control were infroduced to the wells as described for the viability assay 12 hours before wounding the monolayer by scraping it with a sterile pipette tip. Medium was changed to RPMI 1640 supplemented with 5% FBS and fresh ODNs. The healing process was examined dynamically and recorded with a Nikon Coolpix 5000 digital camera with microscope adapter. 10) Boyden Chamber assay of migration
- SCC15 (5 x 10 6 cells) were injected subcutaneously in the lower back of 5-week old male Balb/C Nu /nu athymic mice. Treatment consisted of daily intraperitoneal injection of ODN (20 mg/kg in a total volume of 100 ⁇ l) or diluent (PBS) begun the day following tumor cell implantation and continued for two weeks. Tumor growth in mice was measured as previously described (Masood CCR '01). Mice were sacrificed at the conclusion ofthe study. All mice were maintained in accord with the University of Southern California Animal Care and Use Committee guidelines governing the care of laboratory mice.
- Kaposi's Sarcoma manifests as a multifocal angioproliferative disease, most commonly ofthe skin and mucus membranes, with subsequent spread to visceral organs (1) Hallmarks ofthe disease are angiogenesis, edema, infiltration of lymphomononuclear cells and growth of spindle-shaped tumor cells.
- the KS vascular network is distinct from normal vessels in the lack of basement membranes and the abnormal spindle shaped endothelial cell (tumor cell) lining these vessels. Defective vasculature results in an accumulation ofthe blood components including albumin, red and mononuclear cells in the lesions (1).
- the KS tumor is endothelial in origin; the tumor cells express many endothelial markers, including lectin binding sites for Ulex europeaus agglutinin-1 (UEA-1), CD34, EN- 4, PAL-E (2) and the endothelial cell specific tyrosine kinase receptors, VEGFR-1 (Flt-1), VEGFR-2 (Flk-1/KDR), VEGFR-3 (Flt-4), Tie-1 and Tie-2 (3, RM & PSG unpublished data).
- KS cells co-express lymphatic endothelial cell related proteins including LYVE and podoplanin (4).
- the herpesviras HHV-8 is considered the etiologic agent for the disease.
- sequences of this new herpes virus were identified in KS tumor tissue (5), and subsequent molecular-epidemiology studies have shown that nearly all KS tumors contain viral genome.
- Sero-epidemiology studies show that HIV infected patients with KS have the highest prevalence of HHV-8 and secondly that those with HIV infection but no KS have increased risk of developement of KS over the ensuing years if they are also seropositive for HHV-8 (6).
- Direct evidence for the role of HHV-8 in KS is the transfomiation of bone manow endothelial cells after infection with HHV-8 (7). A number of HHV-8 encoded genes could contribute to cellular transformation (reviewed in 8). However, the most evidence has accumulated for the G-protein coupled receptor (vGPCR) in this role (9).
- KS tumor cells are derived from arterial or venous endothelium.
- HHV-8 has an effect on expression of arterial or venous markers in a model of KS.
- KS tumor cells were found to express the ephrin B2 arterial marker.
- ephrin B2 expression was induced by HHV-8 vGPCR in KS and endothelial cell lines.
- Ephrin B2 is a potential target for treatment of KS because inhibition of ephrin B2 expression or signaling was detrimental to KS cell viability and function.
- KS tumors express Eplirin B2, but not EphB4
- EphB4 and ephrin B2 are markers for venous and arterial endothelial cells, respectively.
- Ephrin B2 but not EphB4 transcripts were detected in tumor cells of KS biopsies by in situ hybridization (figure 45A). Comparison ofthe positive signal with ephrin B2 antisense probe and tumor cells as shown by H&E staining shows that ephrin B2 expression is limited to the areas ofthe biopsy that contain tumor cells.
- KS with EphB4 antisense probe The lack of signal in KS with EphB4 antisense probe is not due to a defect in the probe, as it detected transcripts in squamous cell carcinoma, which we have shown expresses this protein (18). Additional evidence for the expression of ephrin B2 in KS tumor tissue is afforded by the localization of EphB4/Fc signal to tumor cells, detected by FITC conjugated anti human Fc antibody. Because ephrin B2 is the only ligand for EphB4 this reagent is specific for the expression of ephrin B2 (figure 45B, left). An adjacent section freated only with the secondary reagent shows no specific signal.
- HHV-8 the presumed etiologic agent for KS, could itself induce expression of ephrin B2 and repress EphB4 expression in endothelial cells.
- HUVEC express EphB4 venous marker strongly at the RNA level, but not ephrin B2 (figure 46B).
- HHV-8 infected cultures (HUVEC/BC-1 and HUVEC/BC-3) express eplirin B2, while EphB4 transcripts are almost absent.
- HHV-8 infected HUVEC now express ephrin B2 but not EphB4 (Fig. 46A(e, q, u), respectively). Expression of ephrin B2 and LANAl co-cluster as shown by yellow signal in the merged image (Fig. 46A(h)). HHV-8 infected HUVEC positive for eplirin B2 and negative for Eph B 4 also express the arterial marker CD148 (19) (Fig. 46A (j, v)). Expression of ephrin B2 and CD148 co-cluster as shown by yellow signal in the merged image (Fig. 46A(1)). Uninfected HUVEC expressing Eph B4 were negative for CD 148 (not shown).
- HHV-8 vGPCR induces ephrin B2 expression
- KS-SLK cells were stably transfected with HHV-8 LANA, or LANA ⁇ 440 or vGPCR.
- Western Blot of stable clones revealed a five-fold induction of ephrin B2 in KS-SLK transfected with vGPCR compared to SLK-LANA or SLK-LANA ⁇ 440 (Fig. 47A).
- SLK transfected with vector alone (pCEFL) was used as a confrol.
- SLK-vGPCR and SLK-pCEFL cells were also examined for ephrin B2 and Eph B4 expression by immunofluorescence in transiently transfected KS-SLK cells.
- Figure 47B shows higher expression of ephrin B2 in the SLK-vGPCR cells compared to SLK-pCEFL. No changes in Eph B4 were observed in SLK-vGPCR compared to SLK-pCEFL.
- SLK-vGPCR cells expressed high levels of ephrin B2 compared to SLK-pCEFL cells.
- vGPCR of HHV-8 is directly involved in the induction of Ephrin B2 and the arterial phenotype switch in KS. Since we had shown that HHV-8 induced expression of ephrin B2 in HUVEC, we next asked if this could be mediated by a transcriptional effect.
- Ephrin B2 5 '-flanking DNA-luciferase reporter plasmids were constructed as described in the Materials and Methods and transiently transfected into HUVECs. Ephrin B2 5 '-flanking DNA sequences -2491/-11 have minimal activity in HUVEC cells (figure 47C). This is consistent with ephrin B2 being an arterial, not venous marker. However, we have noted that HUVEC in culture do express some ephrin B2 at the RNA level. Cotransfection of HHV-8 vGPCR induces ephrin B2 transcription approximately 10-fold compared to the control expression vector pCEFL.
- Ephrin B2 is regulated by VEGF and VEGF-C
- KS growth factors could be involved in the vGPCR- mediated induction of ephrin B2 expression.
- SLK-vGPCR cells were treated with neutralizing antibodies to oncostatin-M, IL-6, IL-8, VEGF or VEGF-C for 36 hr.
- Figure 48A shows that neutralization of VEGF completely blocked expression of ephrin B2 in SLK- vGPCR cells. A lesser, but significant decrease in ephrin B2 was seen neutralization of
- VEGF-C and IL-8 are integral to the induction of ephrin B2 expression.
- HUVECs were grown in EBM-2 media containing 5 %> FBS with two different concentration of individual growth factor (10 ng, 100 ng/ml) for 48 h. Only VEGF-A or VEGF-C induced eplirin B2 expression in a dose dependent manner ( Figure 48B). In contrast, EGF had no effect on expression of ephrin B2.
- Ephrin B2 siRNA inhibits the expression of Ephrin B2 in KS
- KS- SLK cells were transfected with siRNA and 48 h later ephrin B2 expression was determined by Western Blot.
- Ephrin B2 siRNAs 137 or 254 inhibited about 70% of ephrin B2 expression compared to control siRNA such as siRNA Eph B4 50 or siRNA GFP.
- Ephrin B2 63 siRNA was less effective than the above two siRNA Ephrin B2 ( Figure 49 A).
- Ephrin B2 is necessary for full KS and EC viability, cord formation and in vivo angiogenesis activities
- ephrin B2 siRNA 254 was then used to detemiine whether inhibiting expression of ephrin B2 has any effect on the growth of KS-SLK or HUVEC cells.
- the viability of KS-SLK cells was decreased by the same siRNAs that inhibited eplirin B2 protein levels (figure 49B).
- KS-SLK express high levels of ephrin B2 and this result shows maintenance of ephrin B2 expression is integral to cell viability in this setting.
- HUVECs do not express ephrin B2, except when stimulated by VEGF as shown in Fig. 48B.
- Ephrin B2 siRNA 264 dramatically reduced growth of HUVECs cultured with VEGF as the sole growth factor. In contrast, no significant effect was seen when HUVECs were cultured with IGF, EGF and bFGF. As a control, EphB4 siRNA 50 had no detrimental effect on HUVECs in either culture condition (figure 49C).In addition to inhibition of viability of KS and primary endothelial cells, EphB4-ECD inhibits cord formation in HUVEC and KS-SLK and in vivo angiogenesis in the MatrigelTM plug assay (Figure 50). G. Methods and Materials
- Human vascular endothelial cells were from Clonetics (San Diego, CA) and were maintained in EGM-2 and EGM-2MV media respectively (Clonetics).
- TI human fibroblast line was from Dr. Peter Jones, USC. BC-1 and BC-3 human pleural effusion lymphoma cell lines and monoclonal antibodies to LANAl and ORF59 were the kind gift of Dr. Dharam Ablashi (Advanced Biotechnologies Inc., Columbia, MD).
- KS-SLK was isolated from a Classic Kaposi's sarcoma patient (15).
- Polyclonal antibodies to EphB4, ephrin B2, CD148, PECAM-1 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).
- VEGF vascular endothelial growth factor
- VEGF-C vascular endothelial growth factor
- IL-8 interleukin-(IL)6, IL-8 and oncostatin-M
- pKSvGPCR-CEFL and pCEFL were the kind gift of Dr. Enrique Mesri (Cornell University, New York, NY).
- Expression vectors for HHV-8 latency associated nuclear antigen (LANA) were kindly provided by Dr Matthew Rettig, Veteran's Administration Greater Los Angeles Healthcare System.
- RNAzol Tel-Test, Inc., Friendswoods, TX
- cDNAs were synthesized by reverse franscriptase using a random hexamer primer (Superscript II; Invitrogen, Carlsbad, CA).
- Eplirin B2 and EphB4 PCR products from the primers shown in Table 4 for in situ hybridization were cloned using the pGEM-T Easy system (Promega, Madison WI) according to the manufacturer's description using. The authenticity and insert orientation were confirmed by DNA sequencing.
- the pGEM-T Easy plasmids containing the PCR product ofthe human ephrin-B2 or EphB4 gene were linearized with Spe I or Nco I.
- Antisense or sense digoxigenin (DIG)-labeled RNA probes were transcribed from T7 or SP6 promoters by run-off transcription using a DIG RNA labeling kit (Roche, Indianapolis IN). RNA probes were quantitated by spot assay as described in the DIG RNA labeling kit instructions.
- HUVEC cells were grown to 50-70%> confluence in EGM-2 on gelatin-coated Labtech II 4-well chamber slides (Nalge Nunc International, Naperville, IL). Co-culture with BC-1 or BC-3 was essentially as described by Sakurada and coworkers (16). Briefly, BC-1 or BC-3 cells were preheated with TPA (20 ng/ml) to induce viras for 48 hrs and then added to the HUVEC culture at a ratio of 10:1 for cocultivation for two days. The HUVECs were washed extensively with PBS to remove the attached BC-1 or BC-3 cells. 6) Preparation of cDNA and RT-PCR
- the TITANIUMTM One-Step RT-PCR kit (Clontech, Palo Alto, CA) was used for RT-PCR from 1 x 10 5 cells.
- Primer pairs for amplification of EphB4, ephrin B2 and ⁇ -actin are shown in Table 4.
- Each PCR cycle consisted of denaturation at 94 °C for 30 s, primer annealing at 60 °C for 30 s and extension at 72 °C for 30 s.
- the samples were amplified for 30 cycles. PCR products were separated on 1.5% agarose gels and stained with ethidium bromide.
- KS-SLK cells were seeded at a density of 1 x 10 4 per well in 48-well plates on day 0 in appropriate growth media containing 2% fetal calf seram (FCS). On the following day, the media was changed and cells were freated with 0, 10 or 100 nM siRNA. On day 3, viability was assessed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) as previously described (17).
- FCS 2% fetal calf seram
- EphrinB2 with EPHB4-Fc was done as follows. Frozen sections fixed in 4% parafomialdehyde and blocked with 20% FBS were incubated with 5 ⁇ g/ml EphB4/Fc (R&D Systems) for 1 h at RT. Sections were then incubated with 10 ⁇ g/ml rabbit anti-human IgG-FITC in PBS (Jackson ImmunoResearch Laboratories West Grove, PA) at RT for 1 hour. Nuclei were counterstained with DAPI and sections mounted as above. Human Fc (Jackson ImmunoResearch) was used as the negative confrol.
- MatrigelTM Basement Membrane Matrix (BD Biosciences Discovery Labware, Bedford, MA) was mixed with growth medium (3:1) on ice and 0.5 ml liquid placed in 24- well plates. Incubation of plates at 37 °C for 15 min caused MatrigelTM 1 polymerization.
- HUVEC or KS-SLK in exponential phase growth were treated with 2 or 8 ⁇ g/ml EphB4-ECD or PBS as control for 16 h prior to trypsinizing and plating on the MatrigelTM.
- Culture on Matrigel was continued in the presence of recombinant fusion proteins for 6 h. Cultures were fixed in 4% parafomialdehyde for 30 min and evaluated by inverted phase-contrast photomicroscopy.
- the SilencerTM siRNA constraction kit (Ambion, Austin TX) was used to synthesize siRNA to eplirin B2 and EphB4. Briefly, three 21 bp target sequences comprising 19 bp downstream of a 5'-AA dinucleotide were identified in the ephrin B2 cDNA (Accession number NM_004093) that showed no significant homology to other sequences in the
- Sense and antisense siRNA 29-mer DNA oligonucleotide templates were synthesized at the USC Nonis Microchemical Core Facility. Antisense template conesponded to the target sequence followed by 8 bp addition (5'-CCTGTCTC-3') at the 3' end complementary to the T7 promoter primer provided with the Silencer SiRNA Constraction Kit. Sense template comprised 5'-AA followed by the complement ofthe target 19 bp, then the T7 8 bp sequence as above. In separate reactions, the two siRNA oligonucleotide templates were hybridized to a T7 promoter primer.
- the 3' ends ofthe hybridized oligonucleotides were extended by the Klenow fragment of DNA polymerase to create double-stranded siRNA transcription templates.
- the sense and antisense siRNA templates were transcribed by T7 RNA polymerase and the resulting RNA transcripts were hybridized to create dsRNA.
- the dsRNA consisted of 5' terminal single-stranded leader sequences, a 19 nt target specific dsRNA, and 3' terminal UUs.
- the leader sequences were removed by digesting the dsRNA with a single-stranded specific ribonuclease.
- the DNA template was removed at the same time by treatment with RNAse free deoxyribonuclease.
- siRNAs were purified by glass fiber filter binding to remove excess nucleotides, short oligomers, proteins, and salts in the reaction. End product double-stranded 21mer siRNAs are shown in Table 5. Similarly, an EphB4 and green fluorescence protein (GFP) siRNAs were synthesized.
- GFP green fluorescence protein
- Table 5 siRNAs of eplirin B2 and EphB4.
- HUVEC were seeded on eight-well chamber slides coated with fibronectin and grown overnight in EGM-2 (Cambrex, WalkersviUe, MD). 16 h later media was replaced either with EBM-2 supplemented with 5% fetal calf serum (FCS) and EGM-2 BulletKit supplements bFGF, hEGF and R -IGF-I at the concentrations provided by the manufacturer, or EBM-2 supplemented with 5% FCS and 10 ng/ml rhVEGF (R&D Systems).
- FCS fetal calf serum
- R&D Systems EBM-2 supplemented with 5% FCS and 10 ng/ml rhVEGF
- the cells were transfected using Lipofectamine 2000 (1 ⁇ g/ml; Invitrogen) and 10 nM specific siRNAs in Opti-MEM-1 serum-free medium (Invitrogen). Following transfection for 2 hr in Opti-MEM-1, media supplemented as above was replaced in the appropriate wells. After 48 hrs, the cells were stained with crystal violet and immediately photographed at 10X magnification.
- Human ephrin B2 5 '-flanking DNA from -2491 to -11 with respect to the translation start site was amplified from BACPAC clone RP11-29716 (BacPac Resources, Children's Hospital, Oakland, CA) using the Advantage GC Genomic PCR kit (Clontech Palo Alto, CA) to overcome the large tracts of CG-rich sequence in the target area.
- Primers were designed to contain Mlul sites for cloning. Amplified product was digested with Mlul, gel purified and ligated into the Mlul site in the multiple cloning site of pGL3Basic (Promega, Madison, WI). Orientation ofthe resulting clones was confirmed by restriction digest analysis.
- the conect clone was designated pEFNB2 -2 1/- nluc. Digestion of this clone with either Kpnl or Sacl followed by recircularization yielded pEFNB2 -1242/ -iiluc and pEFNB2 -577/- ⁇ 1 luc, respectively. Plasmid DNAs used for transient transfections were purified using a Mega Prep kit (QIAGEN, Valencia, CA).
- HUVEC cells (0.8 x 10 4 cells/well in 24 well plates) maintained in EGM-2 media were transiently co-transfected with 0.5 ⁇ g/well eplirin B2 promoter-luciferase constructs together with 50 ng/well either pCEFL or pKSvGPCR-CEFL, using Superfect reagent (QIAGEN) according to the manufacturer's instructions.
- Cells were harvested 48 h post- transfection and lysed with Luciferase cell lysis buffer (Promega). Luciferase activity was assayed using the Luciferase Assay System (Promega) according to the manufacturer's instructions. Luciferase was normalized to protein, because pCEFL-vGPCR induced the expression of ⁇ -galactosidase from pCMV-Sport- ⁇ gal (Invitrogen).
- Example 7 Expression of EphB4 in Bladder cancer: a candidate target for therapy Figure 51 shows expression of EPHB4 in bladder cancer cell lines (A), and regulation of EPHB4 expression by EGFR signaling pathway (B).
- Figure 52 shows that transfection of p53 inhibit the expression of EPHB4 in 5637 cell.
- Figure 53 shows growth inhibition of bladder cancer cell line (5637) upon treatment with EPHB4 siRNA 472.
- Figure 54 shows results on apoptosis study of 5637 cells transfected with EPHB4 siRNA 472.
- Figure 55 shows effects of EPHB4 antisense probes on cell migration. 5637 cells were treated with EPHB4AS10 (10 ⁇ M).
- Figure 56 shows effects of EPHB4 siRNA on cell invasion.
- 5637 cells were transfected with siRNA 472 or control siRNA.
- Eph B4 162 CTG GCT GAC CAG CTC GAA GG (2804-2823) 25 Eph B4 161 AGC CAA AGC CAG CGG CTG CG (2784-2803) + 33
- Eph B4 142 ATC CCG TAA CTC CAG GCA TC (2403-2422) ++ 40
- Eph B4 104 CAC CAG GAC CAG GAC CAC AC (1643-1662) ++++ 70
- Eph B4 102 ATC AGG GCC AGC TGC CC CG (1603-1622) +++ 50
- Eph B4 94 ACG TCT TCA GGA ACC GCA CG (1443-1462) ++++ 80
- Eph B4 86 AGG TAC CTC TCG GTC AGT GG (1283-1302) ++ 50
- Eph B4 82 CAG TGA CCT CAA AGG TAT AG (1203-1222) ++++ 70
- Eph B4 78 GGG TCA AAA GTC AGG TCT CC (1123-1142) ++++ 70
- Eph B4 76 CTC CGG GTC GGC ACT CCC GG (1083-1102) +++ 60
- Eph B4 72 AGG TGC AGG GAG GAG CCG TT (1003-1022) ++++ 70
- Eph B4 66 ACG GCT GAT CCA ATG GTG TT (883-902) ++ 50
- Eph B4 65 AGA GTG GCT ATT GGC TGG GC (863-882 ( ++++ 60
- Eph B4 39 TCC GCA TCG CTC TCA TAG TA (343-362) +++ 60
- Eph B4 37 TGC AGG AGC GCC CAG CCC GA (303-322) +++ 50
- Eph B4 30 CAC ACT TCG TAG GTG CGC AC (163-182) +++ 70
- Eph B4 24 AGC AGG GTC TCT TCC AAA GC (43-62) ++++ 80
- Eph B4 22 AGA GCA GCA CCC GGA GCT CC (3-22) +++ 50
- EphB4 AS-2 AAG GAG GGG TGG TGC ACG GTG (952-972)
- EphB4 AS-7 TGA AGG TCT CCT TGC AGG (316-333)
- EphB4 AS-9 CTT CAG GGT CTT GAT TGC CAC (1929-1949)
- EphB4 AS-10 ATG GAG GCC TCG CTC AGA AA (1980-1999)
- Ephb4 AS- 11 CAT GCC CAC GAG CTG GAT GAC (2138-2158)
- KS SLK a cell line expressing endogenous high level of ephrin B2.
- Cell viability was tested using fixed dose of each oligonuceotide (5UM).
- Gene expression downregulation was done using cell line 293 engineered to stably express full-length ephrin B2.
- KS SLK expressing EphrinB2 were also used to test the viability in response to RNAi probes tested at the fixed dose of 50 nM. Protein expression levels were measured using 293 cells stably expressing full-length EphrinB2, in cell lysates after 24 hr treatment with fixed 50 nM of RNAi probes.
- Ephrin B2 antisense probes were summarized below in Table 8.
- Ephrin B2 RNAi probes were summarized below in Table 9.
- Figure 57 shows results on comparison of Epl ⁇ B4 monoclonal antibodies by G250 and in Pull-down assay.
- Figure 58 shows that EphB4 antibodies, in the presence of matrigel and growth factors, inhibit the in vivo tumor growth of SCC 15 cells.
- SCC 15 is a head and neck squamous cell carcinoma line. Tumors were initiated in nu/nu mice by injecting 2.5-5xl0 6 cells premixed with matrigel and Growth factors, and Ab's subcutaneously to initiate tumor xenografts. Mice were opened 14 days after injections. SCC 15 is a head and neck squamous cell carcinoma line, B16 is a melanoma cell line, and MCF-7 is a breast carcinoma line. The responses of tumors to these treatments were compared to control treated mice, which receive PBS injections. Animals were observed daily for tumor growth and subcutaneous tumors were measured using a caliper every 2 days. Antibodies #1 and #23 showed significant regression of SCC 15 tumor size compared to control, especially with no additional growth factor added.
- Figure 59 shows that EphB4 antibodies cause apoptosis, necrosis and decreased angiogenesis in SCC 15, head and neck carcinoma tumor type.
- Angiogenesis was assessed by CD-31 immunohistochemistry. Tumor tissue sections from freated and untreated mice were stained for CD31. Apoptosis was assessed by immunohistochemical TUNNEL, and proliferation by BrdU assay. Following surgical removal, tumors were immediately sliced into 2 mm serial sections and embedded in paraffin using standard procedures. Paraffin embedded tissue were sectioned at 5 ⁇ m, the wax removed and the tissue rehydrated. The rehydrated tissues were microwave inadiated in antigen retreival solution. .
- Masson's Trichrome and Hematoxylin and Eosin were also used to stain the slides to visualize morphology. Masson's Trichrome allows to visualize necrosis and fibrosis.
- the tumor gets blood support from tumor/skin, muscle boundary. As tumor grows, inner regions get depleted of nutrients. This leads to necrosis (cell death), preferably at the tumor center. After cells die, (tumor) tissue gets replaced with fibroblastic tissue. Slides were visualized under 20-fold magnification with digital images acquired. A different morphology was obtained on SCC tumors with each antibody administered. Ab #1 showed an increase in necrosis and fibrosis but not apoptosis.
- Ab #23 showed an increase in apoptosis, necrosis and fibrosis and a decrease in vessel infiltration.
- Ab #35 showed an increase in necrosis and fibrosis, and a small increase in apoptosis and a decrease in vessel infiltration.
- Ab #79 showed a large increase in apoptosis, and necrossis and fibrosis.
- Ab #91 showed no change in apoptosis but an increase in proliferation.
- Ab #138 showed an increase in apoptosis, necrosis, fibrosis and a decrease in proliferation and vessel infiltration. Tumors treated with control PBS displayed abundant tumor density and a robust angiogenic response.
- Tumors treated with EphB4 antibodies displayed a decrease in tumor cell density and a marked inhibition of tumor angiogenesis in regions with viable tumor cells, as well as tumor necrosis and apoptosis.
- Figure 60 shows that systemic administration of antibodies on xenografts leads to tumor regression in SCC15 tumor xenografts.
- EphB4 monoclonal antibody or an equal volume of PBS as control were initiated on day 4, after the tumors have established, and continued for 14 days. Systemic administration was administered either IP or SC with no significant difference. All the experiments were carried out in a double-blind manner to eliminate investigator bias. Mice were sacrificed at the conclusion ofthe two week treatment period. Tumors were harvested immediately postmortem and fixed and processed for immunohistochemistry. EphB4 antibodies 40 mg per kg body weight were administered. Treatment with EphB4 antibody significantly inhibited human SCC tumor growth compared with control-treated mice (p ⁇ 0.05). Treatment with EphB4 antibody significantly inhibited tumor weight compared with control-treated mice (p ⁇ 0.05).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Genetics & Genomics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- Rheumatology (AREA)
- Diabetes (AREA)
- Physical Education & Sports Medicine (AREA)
- Dermatology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Physics & Mathematics (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Cardiology (AREA)
- Gastroenterology & Hepatology (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2004220459A AU2004220459B2 (en) | 2003-03-12 | 2004-03-12 | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| JP2006507160A JP2006521111A (ja) | 2003-03-12 | 2004-03-12 | 血管形成及び腫瘍増殖阻害用ポリペプチド化合物及びその応用 |
| CA002518912A CA2518912A1 (en) | 2003-03-12 | 2004-03-12 | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| EP20040720444 EP1605961A4 (en) | 2003-03-12 | 2004-03-12 | POLYPEPTIDE COMPOUNDS FOR INHIBITING ANGIOGENESIS AND TUMOR GROWTH |
| AU2010238577A AU2010238577B2 (en) | 2003-03-12 | 2010-11-01 | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US45430003P | 2003-03-12 | 2003-03-12 | |
| US45443203P | 2003-03-12 | 2003-03-12 | |
| US60/454,432 | 2003-03-12 | ||
| US60/454,300 | 2003-03-12 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2004080425A2 true WO2004080425A2 (en) | 2004-09-23 |
| WO2004080425A3 WO2004080425A3 (en) | 2005-07-07 |
Family
ID=32994555
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2004/007755 Ceased WO2004080425A2 (en) | 2003-03-12 | 2004-03-12 | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| PCT/US2004/007491 Ceased WO2004080418A2 (en) | 2003-03-12 | 2004-03-12 | Nucleic acid compounds for inhibiting angiogenesis and tumor growth |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2004/007491 Ceased WO2004080418A2 (en) | 2003-03-12 | 2004-03-12 | Nucleic acid compounds for inhibiting angiogenesis and tumor growth |
Country Status (6)
| Country | Link |
|---|---|
| US (5) | US7585967B2 (https=) |
| EP (2) | EP1606305A4 (https=) |
| JP (3) | JP2006521111A (https=) |
| AU (3) | AU2004220525B2 (https=) |
| CA (2) | CA2518912A1 (https=) |
| WO (2) | WO2004080425A2 (https=) |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006022295A1 (ja) * | 2004-08-24 | 2006-03-02 | Kyowa Hakko Kogyo Co., Ltd. | 抗エフリンb2抗体 |
| WO2006034455A3 (en) * | 2004-09-23 | 2006-07-20 | Vasgene Therapeutics Inc | Polipeptide compounds for inhibiting angiogenesis and tumor growth |
| WO2006034456A3 (en) * | 2004-09-23 | 2006-08-10 | Vasgene Therapeutics Inc | Compositions and methods for detecting and treating tumors |
| WO2006081418A3 (en) * | 2005-01-27 | 2006-12-07 | Burnham Inst | Ephb receptor-binding peptides |
| WO2005090406A3 (en) * | 2004-03-12 | 2006-12-28 | Vasgene Therapeutics Inc | Antibodies binding to ephb4 for inhibiting angiogenesis and tumor growth |
| WO2007038395A3 (en) * | 2005-09-23 | 2007-06-07 | Vasgene Therapeutics Inc | Use of ephrinb2 directed agents for the treatment or prevention of viral infections |
| US7381410B2 (en) | 2003-03-12 | 2008-06-03 | Vasgene Therapeutics, Inc. | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| JP2008527352A (ja) * | 2005-01-06 | 2008-07-24 | ジェネンテック・インコーポレーテッド | 癌の予後予測方法、診断方法及び治療方法 |
| JP2009523828A (ja) * | 2006-01-20 | 2009-06-25 | ジェネンテック・インコーポレーテッド | 抗エフリンb2抗体とその使用方法 |
| US7585967B2 (en) | 2003-03-12 | 2009-09-08 | Vasgene Therapeutics, Inc. | Nucleic acid compounds for inhibiting angiogenesis and tumor growth |
| US7939071B2 (en) | 1998-04-13 | 2011-05-10 | California Institute Of Technology | Artery- and vein-specific proteins and uses therefor |
| US8461119B2 (en) | 2002-09-24 | 2013-06-11 | The Burnham Institute | Agents that modulate Eph receptor activity |
| US8981062B2 (en) | 2004-03-12 | 2015-03-17 | Vasgene Theapeutics, Inc | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| US9381208B2 (en) | 2006-08-08 | 2016-07-05 | Rheinische Friedrich-Wilhelms-Universität | Structure and use of 5′ phosphate oligonucleotides |
| US9399658B2 (en) | 2011-03-28 | 2016-07-26 | Rheinische Friedrich-Wilhelms-Universität Bonn | Purification of triphosphorylated oligonucleotides using capture tags |
| US9738680B2 (en) | 2008-05-21 | 2017-08-22 | Rheinische Friedrich-Wilhelms-Universität Bonn | 5′ triphosphate oligonucleotide with blunt end and uses thereof |
| US10059943B2 (en) | 2012-09-27 | 2018-08-28 | Rheinische Friedrich-Wilhelms-Universität Bonn | RIG-I ligands and methods for producing them |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2002951409A0 (en) * | 2002-09-16 | 2002-09-26 | North Western Adelaide Health Services | Methods for regulating cancer |
| DE102004054016A1 (de) * | 2004-11-09 | 2006-05-11 | Robert Bosch Gmbh | Steuergerät zum Steuern und/oder regeln mindestens einer Fahrzeugfunktion |
| WO2006055727A2 (en) * | 2004-11-18 | 2006-05-26 | The Board Of Trustees Of The University Of Illinois | MULTICISTRONIC siRNA CONSTRUCTS TO INHIBIT TUMORS |
| FR2889200B1 (fr) | 2005-07-27 | 2008-01-04 | Inst Vaisseaux Et Du Sang Ass | Systeme marqueur cellulaire/ligand, ou le marqueur est du type eph, materiau cellulaire comprenant ce systeme, procede de preparation et utilisation proangiogenique |
| WO2009006336A1 (en) * | 2007-06-28 | 2009-01-08 | Sylgen Laboratories, Inc. | Compositions and methods for inhibiting angiogenesis and tumorigenesis |
| AU2008287427B2 (en) | 2007-08-13 | 2014-10-09 | Vasgene Therapeutics, Inc. | Cancer treatment using humanized antibodies that bind to EphB4 |
| EP2109690B9 (en) * | 2007-11-29 | 2012-10-24 | MOLECULAR HEALTH GmbH | Eph-b4 specific sirna for reducing epo-induced tumor cell growth during anemia treatment in cancer patients, tissue protective erythropoietin receptor (nepor) and methods of use. |
| US8357501B2 (en) | 2007-11-29 | 2013-01-22 | Molecular Health Gmbh | Tissue protective erythropoietin receptor (NEPOR) and methods of use |
| WO2012112434A1 (en) * | 2011-02-14 | 2012-08-23 | Allergan, Inc. | Inhibiting aberrant blood vessel formation using retargeted endopeptidases |
| JP2015071566A (ja) * | 2013-10-03 | 2015-04-16 | 住友ベークライト株式会社 | Fgf4遺伝子増幅腫瘍の医薬組成物 |
| DK3556855T3 (da) * | 2016-12-14 | 2026-02-23 | Univ Shinshu | Kimærisk antigenreceptor genmodificeret lymfocyt der har cytocidal effekt |
| US20200224239A1 (en) * | 2019-01-10 | 2020-07-16 | Massachusetts Institute Of Technology | Functional analysis of cancer cells |
| WO2020154111A2 (en) | 2019-01-23 | 2020-07-30 | Massachusetts Institute Of Technology | Rapid analysis of live cells |
| CA3181420A1 (en) * | 2020-05-28 | 2021-12-02 | Cytobay Inc. | Cytopathological staining |
| EP4105328A1 (en) * | 2021-06-15 | 2022-12-21 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Antisense-oligonucleotides for prevention of kidney dysfunction promoted by endothelial dysfunction by ephrin-b2 suppression |
| CN119384291A (zh) * | 2022-05-18 | 2025-01-28 | 国立研究开发法人国立癌症研究中心 | 利用通用癌抗原鸡尾酒的癌症疫苗、tcr/car-t细胞治疗药、伴随诊断方法和基于血中循环癌细胞检测的癌症发病风险诊断方法 |
Family Cites Families (83)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| JPH04218000A (ja) | 1990-02-13 | 1992-08-07 | Kirin Amgen Inc | 修飾ポリペプチド |
| EP0590030B1 (en) | 1991-06-21 | 2004-09-29 | The Walter and Eliza Hall Institute of Medical Research | A receptor-type tyrosine kinase [human eph/elk-like kinase - hek] and use thereof |
| US6331302B1 (en) | 1992-01-22 | 2001-12-18 | Genentech, Inc. | Protein tyrosine kinase agonist antibodies |
| CA2128722A1 (en) | 1992-01-22 | 1993-08-05 | William I. Wood | Novel protein tyrosine kinases |
| US5635177A (en) | 1992-01-22 | 1997-06-03 | Genentech, Inc. | Protein tyrosine kinase agonist antibodies |
| WO2002081494A1 (en) * | 2001-03-26 | 2002-10-17 | Sirna Therapeutics, Inc. | Oligonucleotide mediated inhibition of hepatitis b virus and hepatitis c virus replication |
| BR9207175A (pt) | 1992-10-28 | 1995-12-12 | Genentech Inc | Composição contendo antagonista de fator de crescimento de célula endotelial vascular sequência aminoácida de anticorpo monoclonal polipeptídeo e método de tratamento de tumor em mamífero |
| CA2149333C (en) | 1992-11-13 | 2002-01-22 | Timothy D. Bartley | Eck receptor ligands |
| US5824303A (en) | 1992-11-13 | 1998-10-20 | Amgen Inc. | Eck receptor ligands |
| US5512591A (en) | 1993-02-18 | 1996-04-30 | President And Fellows Of Harvard College | Treatments for diseases characterized by neovascularization |
| ES2152753B1 (es) | 1993-03-29 | 2001-09-01 | Ct Investig Energeticas Ciemat | Animales transgenicos para la determinacion de agentes que estimulan o reprimen la hiperproliferacion epidermica y el crecimiento del pelo |
| US5801154A (en) * | 1993-10-18 | 1998-09-01 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of multidrug resistance-associated protein |
| US6303769B1 (en) | 1994-07-08 | 2001-10-16 | Immunex Corporation | Lerk-5 dna |
| US5624899A (en) | 1994-07-20 | 1997-04-29 | Genentech Inc. | Method for using Htk ligand |
| WO1996003043A1 (en) | 1994-07-26 | 1996-02-08 | Rutgers, The State University Of New Jersey | Human brain specific kinase |
| US5795734A (en) | 1994-09-19 | 1998-08-18 | President And Fellows Of Harvard College | EPH receptor ligands, and uses related thereto |
| WO1996013518A1 (en) | 1994-10-27 | 1996-05-09 | Genentech, Inc. | Al-1 neurotrophic factor, a ligand for an eph-related tyrosine kinase receptor |
| US6057124A (en) | 1995-01-27 | 2000-05-02 | Amgen Inc. | Nucleic acids encoding ligands for HEK4 receptors |
| WO1996026958A2 (en) | 1995-02-27 | 1996-09-06 | President And Fellows Of Harvard College | Eph RECEPTOR LIGAND ELF-2 |
| GB9508538D0 (en) | 1995-04-27 | 1995-06-14 | Zeneca Ltd | Quinazoline derivatives |
| DE69628652T3 (de) | 1995-09-08 | 2012-05-03 | Genentech, Inc. | Vegf-verwandtes protein |
| US6346398B1 (en) * | 1995-10-26 | 2002-02-12 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for the treatment of diseases or conditions related to levels of vascular endothelial growth factor receptor |
| US5837534A (en) | 1995-11-14 | 1998-11-17 | The Board Of Regents Of The University Of Texas System | Smooth muscle 22α promoter, gene transfer vectors containing the same, and method of use of the same to target gene expression in arterial smooth muscle cells |
| AUPN727795A0 (en) | 1995-12-22 | 1996-01-18 | Walter And Eliza Hall Institute Of Medical Research, The | A novel receptor-type tyrosine kinase and use thereof |
| US6696557B1 (en) * | 1996-04-19 | 2004-02-24 | Genentech, Inc. | AL-2 neurotrophic factor nucleic acid |
| US6100071A (en) | 1996-05-07 | 2000-08-08 | Genentech, Inc. | Receptors as novel inhibitors of vascular endothelial growth factor activity and processes for their production |
| CA2259157A1 (en) | 1996-07-05 | 1998-01-15 | Mount Sinai Hospital Corporation | Oligomerized receptors which affect pathways regulated by transmembrane ligands for elk-related receptor tyrosine kinases |
| UA73073C2 (uk) | 1997-04-03 | 2005-06-15 | Уайт Холдінгз Корпорейшн | Заміщені 3-ціанохіноліни, спосіб їх одержання та фармацевтична композиція |
| JP3957765B2 (ja) | 1997-04-07 | 2007-08-15 | ジェネンテク・インコーポレイテッド | 抗vegf抗体 |
| AU6887698A (en) | 1997-04-08 | 1998-10-30 | Sugen, Inc. | Study and treatment of diseases related to specific cellular functions of receptor protein tyrosine kinases |
| US6440954B1 (en) | 1997-04-18 | 2002-08-27 | President And Fellows Of Harvard College | Inhibition of vascular smooth muscle cell proliferation |
| US6555321B1 (en) * | 1997-08-19 | 2003-04-29 | Vanderbilt University | Methods for determining cell responses through EphB receptors |
| AU9594598A (en) | 1997-10-02 | 1999-04-27 | Millennium Pharmaceuticals, Inc. | Modulation of lerk-2-mediated cell adhesion |
| JP2002505338A (ja) | 1998-03-05 | 2002-02-19 | カイロン コーポレイション | 生物学的に活性な分子の血清半減期を増加するための方法 |
| US6887674B1 (en) | 1998-04-13 | 2005-05-03 | California Institute Of Technology | Artery- and vein-specific proteins and uses therefor |
| US6864227B1 (en) | 1998-04-13 | 2005-03-08 | California Institute Of Technology | Artery-and vein-specific proteins and uses therefor |
| AU8788998A (en) | 1998-10-02 | 2000-04-06 | Universite Paris 7 | Vascular specific regulatory elements contained in the desmin 5' flanking region |
| AUPP674898A0 (en) | 1998-10-27 | 1998-11-19 | Walter And Eliza Hall Institute Of Medical Research, The | A method of treatment |
| DE69925024T2 (de) * | 1998-11-20 | 2006-03-02 | Genentech, Inc., South San Francisco | Verwendung von eph-rezeptor-antagonisten und agonisten zur behandlung von vaskulären krankheiten |
| US6150162A (en) * | 1998-12-17 | 2000-11-21 | Isis Pharmaceuticals Inc. | Antisense modulation of CD44 expression |
| US6770633B1 (en) * | 1999-10-26 | 2004-08-03 | Immusol, Inc. | Ribozyme therapy for the treatment of proliferative skin and eye diseases |
| EP1246637A2 (en) * | 2000-01-06 | 2002-10-09 | The Hospital for Sick Children | Methods of modulation of the immune system |
| WO2002081628A2 (en) * | 2001-04-05 | 2002-10-17 | Ribozyme Pharmaceuticals, Incorporated | Modulation of gene expression associated with inflammation proliferation and neurite outgrowth, using nucleic acid based technologies |
| JP2004509604A (ja) * | 2000-03-28 | 2004-04-02 | アイシス・ファーマシューティカルス・インコーポレーテッド | mRNAプロセッシングのアンチセンスモジュレーションによる、細胞行動の改変 |
| EP2206720A1 (en) * | 2000-04-12 | 2010-07-14 | Human Genome Sciences, Inc. | Albumin fusion proteins |
| CA2407086A1 (en) | 2000-04-21 | 2001-11-01 | Amgen, Inc. | Integrin/adhesion antagonists |
| US6271030B1 (en) * | 2000-06-14 | 2001-08-07 | Isis Pharmaceuticals, Inc. | Antisense inhibition of C/EBP beta expression |
| US6277640B1 (en) * | 2000-07-31 | 2001-08-21 | Isis Pharmaceuticals, Inc. | Antisense modulation of Her-3 expression |
| AU2001283108A1 (en) | 2000-08-03 | 2002-02-18 | The University Of Utah Research Foundation | Manipulation of arterial-venous identity |
| US6812339B1 (en) * | 2000-09-08 | 2004-11-02 | Applera Corporation | Polymorphisms in known genes associated with human disease, methods of detection and uses thereof |
| AU2002212292A1 (en) | 2000-09-29 | 2002-04-08 | Novartis Ag | Extracellular polypeptides of eph b receptors and ephrin b ligands and the corresponding nucleic acid molecules |
| US7136808B2 (en) * | 2000-10-20 | 2006-11-14 | Microsoft Corporation | Detection and correction of errors in german grammatical case |
| IL156009A0 (en) | 2000-11-20 | 2003-12-23 | California Inst Of Techn | Artery smooth muscle and vein smooth muscle specific proteins and uses therefor |
| US20040259247A1 (en) * | 2000-12-01 | 2004-12-23 | Thomas Tuschl | Rna interference mediating small rna molecules |
| AU2002243623A1 (en) | 2001-01-26 | 2002-08-06 | Regeneron Pharmaceuticals, Inc. | Methods of imaging and targeting vasculature |
| CA2437194A1 (en) | 2001-01-31 | 2002-08-08 | Mount Sinai Hospital | Methods for regulating the kinase domain of ephb2 |
| US20040110177A1 (en) | 2001-02-02 | 2004-06-10 | Axel Ullrich | Method for identifying functional nucleic acids |
| US6919313B2 (en) | 2001-03-30 | 2005-07-19 | President & Fellows Of Harvard College | Protein waving a PDZ and a RGS domain |
| CA2448320A1 (en) * | 2001-05-29 | 2002-12-05 | Sirna Therapeutics, Inc. | Ribozyme based treatment of female reproductive diseases |
| CA2633171C (en) | 2001-06-20 | 2012-11-20 | Genentech, Inc. | Antibodies against tumor-associated antigenic target (tat) polypeptides |
| AU2002329540A1 (en) | 2001-06-20 | 2003-01-02 | Morphosys Ag | Antibodies that block receptor protein tyrosine kinase activation, methods of screening for and uses thereof |
| CA2452578A1 (en) | 2001-07-03 | 2003-01-16 | The Hospital For Sick Children | Ephrin and eph receptor mediated immune modulation |
| JP3876656B2 (ja) * | 2001-07-13 | 2007-02-07 | 住友金属工業株式会社 | 管用ねじ継手 |
| AU2002353972A1 (en) * | 2001-11-02 | 2003-05-19 | Pfizer Products Inc. | Lung cancer therapeutics and diagnostics |
| US20060241027A1 (en) | 2002-02-07 | 2006-10-26 | Hans-Peter Hauser | Hiv inhibiting proteins |
| WO2004014292A2 (en) | 2002-05-10 | 2004-02-19 | Purdue Research Foundation | EphA2 AGONISTIC MONOCLONAL ANTIBODIES AND METHODS OF USE THEREOF |
| US20040028685A1 (en) | 2002-05-10 | 2004-02-12 | Kinch Michael S. | EphA2 monoclonal antibodies and methods of use thereof |
| US20040110150A1 (en) | 2002-12-10 | 2004-06-10 | Isis Pharmaceuticals Inc. | Modulation of Ephrin-B2 expression |
| AU2003254641A1 (en) | 2002-08-28 | 2004-03-19 | Maxygen Aps | Interferon beta-like molecules for treatment of cancer |
| AU2003260169B9 (en) * | 2002-09-16 | 2011-06-09 | The Queen Elizabeth Hospital Research Foundation Inc. | Methods for regulating cancer |
| AU2002951409A0 (en) | 2002-09-16 | 2002-09-26 | North Western Adelaide Health Services | Methods for regulating cancer |
| EP2305812A3 (en) * | 2002-11-14 | 2012-06-06 | Dharmacon, Inc. | Fuctional and hyperfunctional sirna |
| US7250289B2 (en) * | 2002-11-20 | 2007-07-31 | Affymetrix, Inc. | Methods of genetic analysis of mouse |
| CA2518912A1 (en) | 2003-03-12 | 2004-09-23 | Vasgene Therapeutics, Inc. | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| KR20050120663A (ko) | 2003-03-24 | 2005-12-22 | 세쿠오이아 파마큐티컬스 인코오퍼레이티드 | 장기간 작용하는 생물학적 활동 컨쥬게이트들 |
| US20050059592A1 (en) | 2003-04-11 | 2005-03-17 | Kiener Peter A. | EphA2 and hyperproliferative cell disorders |
| AU2004230539A1 (en) | 2003-04-11 | 2004-10-28 | Medimmune, Llc | EphA2, hypoproliferative cell disorders and epithelial and endothelial reconstitution |
| WO2005048917A2 (en) | 2003-06-06 | 2005-06-02 | Medimmune, Inc. | Use of epha4 and modulator or epha4 for diagnosis, treatment and prevention of cancer |
| EP1677735B1 (en) | 2003-10-17 | 2014-07-23 | Joslin Diabetes Center, Inc. | Methods and compositions for modulating adipocyte function |
| KR20060135671A (ko) | 2003-11-20 | 2006-12-29 | 메디뮨 인코포레이티드 | EphA2 작동성 모노클로날 항체 및 이의 사용 방법 |
| AU2005224081B2 (en) | 2004-03-12 | 2011-06-30 | Vasgene Therapeutics, Inc. | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| WO2006034455A2 (en) | 2004-09-23 | 2006-03-30 | Vasgene Therapeutics, Inc. | Polipeptide compounds for inhibiting angiogenesis and tumor growth |
-
2004
- 2004-03-12 CA CA002518912A patent/CA2518912A1/en not_active Abandoned
- 2004-03-12 WO PCT/US2004/007755 patent/WO2004080425A2/en not_active Ceased
- 2004-03-12 JP JP2006507160A patent/JP2006521111A/ja active Pending
- 2004-03-12 US US10/800,077 patent/US7585967B2/en not_active Expired - Fee Related
- 2004-03-12 AU AU2004220525A patent/AU2004220525B2/en not_active Ceased
- 2004-03-12 EP EP04720327A patent/EP1606305A4/en not_active Withdrawn
- 2004-03-12 AU AU2004220459A patent/AU2004220459B2/en not_active Ceased
- 2004-03-12 WO PCT/US2004/007491 patent/WO2004080418A2/en not_active Ceased
- 2004-03-12 CA CA002518898A patent/CA2518898A1/en not_active Abandoned
- 2004-03-12 US US10/800,350 patent/US7862816B2/en not_active Expired - Fee Related
- 2004-03-12 EP EP20040720444 patent/EP1605961A4/en not_active Withdrawn
- 2004-03-12 JP JP2006507095A patent/JP4762889B2/ja not_active Expired - Fee Related
-
2006
- 2006-10-06 US US11/544,855 patent/US8063183B2/en not_active Expired - Fee Related
-
2009
- 2009-09-01 US US12/552,185 patent/US20100093831A1/en not_active Abandoned
-
2010
- 2010-11-01 AU AU2010238577A patent/AU2010238577B2/en not_active Ceased
- 2010-11-23 US US12/952,593 patent/US20110129482A1/en not_active Abandoned
-
2011
- 2011-07-15 JP JP2011157200A patent/JP2011256179A/ja active Pending
Non-Patent Citations (1)
| Title |
|---|
| See references of EP1605961A4 * |
Cited By (39)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7939071B2 (en) | 1998-04-13 | 2011-05-10 | California Institute Of Technology | Artery- and vein-specific proteins and uses therefor |
| US8461119B2 (en) | 2002-09-24 | 2013-06-11 | The Burnham Institute | Agents that modulate Eph receptor activity |
| US7862816B2 (en) | 2003-03-12 | 2011-01-04 | Vasgene Therapeutics, Inc. | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| US7381410B2 (en) | 2003-03-12 | 2008-06-03 | Vasgene Therapeutics, Inc. | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| US8273858B2 (en) | 2003-03-12 | 2012-09-25 | Vasgene Therapeutics, Inc. | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| US7585967B2 (en) | 2003-03-12 | 2009-09-08 | Vasgene Therapeutics, Inc. | Nucleic acid compounds for inhibiting angiogenesis and tumor growth |
| US8063183B2 (en) | 2003-03-12 | 2011-11-22 | Vasgene Therapeutics, Inc. | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| US7977463B2 (en) | 2004-03-12 | 2011-07-12 | Vasgene Therapeutics, Inc. | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| WO2005090406A3 (en) * | 2004-03-12 | 2006-12-28 | Vasgene Therapeutics Inc | Antibodies binding to ephb4 for inhibiting angiogenesis and tumor growth |
| US8981062B2 (en) | 2004-03-12 | 2015-03-17 | Vasgene Theapeutics, Inc | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| EP2287194A3 (en) * | 2004-03-12 | 2012-02-29 | Vasgene Therapeutics, Inc. | Antibodies binding to ephb4 for inhibiting angiogenesis and tumor growth |
| EP2275445A3 (en) * | 2004-03-12 | 2012-02-29 | Vasgene Therapeutics, Inc. | Antibodies binding to ephb4 for inhibiting angiogenesis and tumor growth |
| WO2006022295A1 (ja) * | 2004-08-24 | 2006-03-02 | Kyowa Hakko Kogyo Co., Ltd. | 抗エフリンb2抗体 |
| WO2006034456A3 (en) * | 2004-09-23 | 2006-08-10 | Vasgene Therapeutics Inc | Compositions and methods for detecting and treating tumors |
| AU2005286662B2 (en) * | 2004-09-23 | 2011-10-06 | Vasgene Therapeutics, Inc. | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| US9533026B2 (en) | 2004-09-23 | 2017-01-03 | Vasgene Therapeutics, Inc | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| EP2301963A1 (en) * | 2004-09-23 | 2011-03-30 | Vasgene Therapeutics, Inc. | Polypeptide compounds for inhibiting angiogenesis and tumor growth |
| WO2006034455A3 (en) * | 2004-09-23 | 2006-07-20 | Vasgene Therapeutics Inc | Polipeptide compounds for inhibiting angiogenesis and tumor growth |
| JP2012177698A (ja) * | 2005-01-06 | 2012-09-13 | Genentech Inc | 癌の予後予測方法、診断方法及び治療方法 |
| JP2008527352A (ja) * | 2005-01-06 | 2008-07-24 | ジェネンテック・インコーポレーテッド | 癌の予後予測方法、診断方法及び治療方法 |
| JP2008528614A (ja) * | 2005-01-27 | 2008-07-31 | ザ・バーンハム・インスティテュート | EphB受容体結合ペプチド |
| AU2006208068B2 (en) * | 2005-01-27 | 2011-08-04 | The Burnham Institute | EphB receptor-binding peptides |
| US7999069B2 (en) | 2005-01-27 | 2011-08-16 | Sanford-Burnham Medical Research Institute | EphB receptor-binding peptides |
| WO2006081418A3 (en) * | 2005-01-27 | 2006-12-07 | Burnham Inst | Ephb receptor-binding peptides |
| US7582438B2 (en) | 2005-01-27 | 2009-09-01 | Burnham Institute For Medical Research | EphB receptor-binding peptides |
| WO2007038395A3 (en) * | 2005-09-23 | 2007-06-07 | Vasgene Therapeutics Inc | Use of ephrinb2 directed agents for the treatment or prevention of viral infections |
| JP2009523828A (ja) * | 2006-01-20 | 2009-06-25 | ジェネンテック・インコーポレーテッド | 抗エフリンb2抗体とその使用方法 |
| US9115191B2 (en) | 2006-01-20 | 2015-08-25 | Genentech, Inc. | Anti-EphrinB2 antibodies and methods using same |
| US9845354B2 (en) | 2006-01-20 | 2017-12-19 | Genentech, Inc. | Anti-EPHRINB2 antibodies and methods using same |
| US9381208B2 (en) | 2006-08-08 | 2016-07-05 | Rheinische Friedrich-Wilhelms-Universität | Structure and use of 5′ phosphate oligonucleotides |
| US10238682B2 (en) | 2006-08-08 | 2019-03-26 | Rheinische Friedrich-Wilhelms-Universität Bonn | Structure and use of 5′ phosphate oligonucleotides |
| US9738680B2 (en) | 2008-05-21 | 2017-08-22 | Rheinische Friedrich-Wilhelms-Universität Bonn | 5′ triphosphate oligonucleotide with blunt end and uses thereof |
| US10036021B2 (en) | 2008-05-21 | 2018-07-31 | Rheinische Friedrich-Wilhelms-Universität Bonn | 5′ triphosphate oligonucleotide with blunt end and uses thereof |
| US10196638B2 (en) | 2008-05-21 | 2019-02-05 | Rheinische Friedrich-Wilhelms-Universität Bonn | 5′ triphosphate oligonucleotide with blunt end and uses thereof |
| US9399658B2 (en) | 2011-03-28 | 2016-07-26 | Rheinische Friedrich-Wilhelms-Universität Bonn | Purification of triphosphorylated oligonucleotides using capture tags |
| US9896689B2 (en) | 2011-03-28 | 2018-02-20 | Rheinische Friedrich-Wilhelms-Universität Bonn | Purification of triphosphorylated oligonucleotides using capture tags |
| US10059943B2 (en) | 2012-09-27 | 2018-08-28 | Rheinische Friedrich-Wilhelms-Universität Bonn | RIG-I ligands and methods for producing them |
| US10072262B2 (en) | 2012-09-27 | 2018-09-11 | Rheinische Friedrich-Wilhelms-Universität Bonn | RIG-I ligands and methods for producing them |
| US11142763B2 (en) | 2012-09-27 | 2021-10-12 | Rheinische Friedrich-Wilhelms-Universität Bonn | RIG-I ligands and methods for producing them |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2518898A1 (en) | 2004-09-23 |
| US20100093831A1 (en) | 2010-04-15 |
| EP1605961A2 (en) | 2005-12-21 |
| US20050164965A1 (en) | 2005-07-28 |
| JP2011256179A (ja) | 2011-12-22 |
| WO2004080418A2 (en) | 2004-09-23 |
| JP2006519610A (ja) | 2006-08-31 |
| US7862816B2 (en) | 2011-01-04 |
| WO2004080425A3 (en) | 2005-07-07 |
| CA2518912A1 (en) | 2004-09-23 |
| EP1606305A2 (en) | 2005-12-21 |
| AU2004220459A1 (en) | 2004-09-23 |
| JP4762889B2 (ja) | 2011-08-31 |
| AU2010238577A1 (en) | 2010-11-18 |
| AU2004220459B2 (en) | 2010-08-05 |
| EP1606305A4 (en) | 2009-06-24 |
| US20050084873A1 (en) | 2005-04-21 |
| US8063183B2 (en) | 2011-11-22 |
| AU2010238577B2 (en) | 2012-05-24 |
| EP1605961A4 (en) | 2009-11-11 |
| US7585967B2 (en) | 2009-09-08 |
| US20070031435A1 (en) | 2007-02-08 |
| US20110129482A1 (en) | 2011-06-02 |
| JP2006521111A (ja) | 2006-09-21 |
| AU2004220525A1 (en) | 2004-09-23 |
| WO2004080418A3 (en) | 2005-05-06 |
| AU2004220525B2 (en) | 2011-03-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2010238577B2 (en) | Polypeptide compounds for inhibiting angiogenesis and tumor growth | |
| US8273858B2 (en) | Polypeptide compounds for inhibiting angiogenesis and tumor growth | |
| EP1799713B1 (en) | Polypeptide compounds for inhibiting angiogenesis and tumor growth | |
| AU2007338734A1 (en) | Methods for using and identifying modulators of delta-like 4 | |
| CA2710082A1 (en) | Methods for using and identifying modulators of delta-like 4 | |
| CA2661669A1 (en) | A pharmaceutical composition for treating cholangiocarcinoma, a method for inhibiting growth or invasion of cholangiocarcinoma and a method for treating cholangniocarcinoma | |
| JP2006521111A5 (https=) | ||
| EP1623995A1 (en) | Inhibitors of L1 and ADAM10 for the treatment of carcinomas |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2006507160 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2518912 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004220459 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004720444 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2004220459 Country of ref document: AU Date of ref document: 20040312 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004220459 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004720444 Country of ref document: EP |