CA2128722A1

CA2128722A1 - Novel protein tyrosine kinases

Info

Publication number: CA2128722A1
Application number: CA 2128722
Authority: CA
Inventors: William I. Wood; David Goeddel; Hava Avraham; Jerome Groopman; Sally Cowley; David Scadden; James M. Lee; Brian D. Bennett
Original assignee: Individual
Current assignee: Genentech Inc; Beth Israel Deaconess Medical Center Inc
Priority date: 1992-01-22
Filing date: 1993-01-22
Publication date: 1993-08-05
Also published as: EP0624192A1; JPH07504813A; AU3482493A; WO1993015201A1

Abstract

2128722 9315201 PCTABS00024 The identification and isolation of novel protein tyrosine kinase genes present on human megakaryocytic and lymphocytic cells, the proteins encoded by these genes, antibodies specific for the encoded proteins, RNA nucleic acid sequences which hybridize to the genes and methods of use therefor.

Description

WO 93/~5201 2 1 2 ~ 7 ~ 2Pcr/US93/00586 NOVEL PROTEIN TYROSINE KINASES

Description Backqround of the Invention Transduction of signals that regulate cell growth and 5 differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases are enzymes that catalyze this process. Moreover, many act as growth factor receptors.

Summarv of_the Invention 10The present invention relates to novel protein tyrosine kinase genes present in human megakaryocytic and lymphocytic cells, the proteins encoded by these genes, antibodies specific for the encoded proteins, RNA nucleic acid sequences which hybridize to the genes and methods of 15 use therefor.
The genes isolated as describe'd herein are referred ; to, collectively, as protein tyrosine kinase (pTK) genes.
The nucleic acid sequences of these genes, isolated as discussed herèin, show significant ~omology with ;~ 20 previously identified protein tyrosine kinases containing extracellular domains which function as growth factor receptors. The pTK genes have been shown to be present in both megakaryocytic and lymphocytic cells.
The pTK genes of the present invention show 25 significant sequence homology with members of the c-kit subgroup of growth factor receptors with protein tyrosine kinase activity. The c-kit subgroup of receptor tyrosine kinases catalyze the phosphorylation of exogenous substrates, as well as tyrosine residues within their own 30 polypeptide chains. (Ullrich, A. and Schlessinger, J., Cell, 61:203 (1990)). Members of the c-kit subgroup include FLT/FLK (Fetal Liver Kinase), FGF (Fibroblast RC\~ P-~-M-iE~-CHEi~ ~ : ;3~ : 18~ ;178filY-~ +~';3 8~ >.3'J~I~
. .

Grc)wth Factor Receptor) and NGr (Nerve ~;rc~h F~ctGr ~eceptor) .
In particular, f ourteen pT}C gene~ have been identified. Two pTK ~enes, referred to as S~L-S1 and SAI.-5 D4 (also referred t~ ~s meqakaryoc}~te deri~ed F~,r-like recaptor tyrosine kina~;e) were identif ied in ~n~gakaryocytic cel ls. Fi~e pTK ~eneE;, re~er~ed to as LpTXs, were identif ied in 1 y3~phocytic cel ~ s and have been showr. to be presen~ in megakaryocytes a~ well. One p~:C
10 gene, referred to a HpTXs, was identified in hu~an hepatoma cell~ Six pT~ genes, refer~ed to as bpTX genes, ~ound in human brai~ ti55ue SAI,-Sl is related to the ~LT~FLK family o~ pTl~s..
SAL-D4 is rel~ted to the FG~ recep' or fa~ily of pTXs, ~nd 15 one LpTK tLpT~ 3 ) is related to the NGP receptor ~,~ily of P~Rg .
Th2 p~ genes, which are the subj QC'C of ~e present in~ention, were- ldentif'ed usin~ two ~ets of degenera~ive oligonucleotide primers: a fir~ ~et which ~mplifie~ all O pl'K DNA seg~en~s ~ SEQ ID NOS : t -2 ), and a second set which a~plif ies hi~7hly conse~ved ~equence~ preseT~ the cata~ytic domain or the c-kit sub~ up of p~X~; ~SEQ ID

NOS: 3-4) . l'he pT~; ~enes identifie~ in t2~is ~anner are de~cribed below.

SAL-Sl is expressed in several ~ega}c~ocytiG cell lines, but not in erythroid cell lines~ The nucleotide ~;eguen~e of SA~-Sl was obtained, revealing a se~auence conta~ning 1~0 }~alse pair~. ~SE~ :CI) NO:5). This iso~ated I~N~ fragment encoded an amino acid se~uence ( SEQ ID NO: 6) 30 which exhi~ited significant seguence homolo~y with known protein tyrosine kinase~ of the FLTtE'LE~ ~amily. The full ~tUeC~TlT~JT~ ET

F~C\;: ~ 0~: t:PA-Ml~ H~ 4 ~ ; 1 7~3t; 1'~354U-- +~9 ~ 'J~1;5: ~J 1~) ~I*~8722 length ~ene sequence ~SEQ l~ NO: 17) co~tains 682~ b.p.
and the d~duced amino acid sequence ~ SEQ ID NO~
contains 34 ~ re~;idues, SAL-D4, also expressed in megakaryocyti~: cells, is S DN~ fragnlent contain;ng the l~ucleotide se~;3uence of 14 7 base pairs. tS~;Q ID NO: 7) . This isolated l:)~lA fragment - encoded an aa~lino ~cid ~;s~auence ~SEQ ID NO: 8) which exh~b~ted ~igni~icant sequence homology with known protein tyrosine kinases of the EG~ receptor fa~i~y.
The LpTKs, including LpTK 2, LpTK 3, LpTK 4, and ~pTX
13 and Lp~K 25, are expressed in ly~nph~cy~:ic cellsr as well as ~egakaryocytic eells~ The nucleotid~ ~equence ~151 ~ase pair~) o~ the Lp~R 3 gen~ was o~ta~ned (SEQ ID
NO: 113, and e~hiblted s3ignificant homology with ~nown 15 protein tyrosine kinases of ~e NGF receptor fa~i~y. The nuclQotide ~e~uences o' thÇ! I.pTX 2, LpqX 4, ~nd I,pTK-1 gene~ conta~nod 14~ ba~;e pa~s (SEQ ID N0:9), 137 base pairs t5EQ ID ~10: ~3), and 211 base pairs (SEQ Il;) N0: 15~
respectiYely. Lpq'K 2S has a nucleotide sequence ~f 3120 ~0 b.p. (S~Q ID N0: 22). A full ler~gth gene sequenc:e ha~;
been obtained for Lp~K 2 (SEQ ID N0: 19) ~hich cont~ins 7607 ~.p. Additional sequencing oI~ IpTX 4 revealed a E;eguence o~ 404 b.p~ tSEQ ID ~0: 21~ .
The Hp'rK 5 gene, expres~ed in human hepato~ ~:ells, --ha~ a nucleotide sequence 0~ 3`g69 }~.p. ~SE~ ID tlO: Z3).
Nucleotide ~equ~nces of the ~p~K's, including bp~K 1, bpl`~

2, bp~R 3, bpTR 4, bpT~ 5 and bp~rR 7 are expressed in human brain t~ 8SU" encode proteins having the a~ino acid se~uences of SEQ ID NOS: 25-3Q respecti~ely.
rhus the present invention includes DN~ isolat~d fro~
a human megakaryocytic cell :line, whicb hybridizcs to a Y~B~;TITUTE S~ET

WO93/15201` PCT/US93/00586 ~ 4_ DNA fragment which hybridizes to DNA encoding an amino acid sequence which is highly conserved in the catalytic domain of protein tyrosine kinases of the c-kit subgroup.
The present invention also includes the proteins 5 encoded by the pT~ genes identified as described herein, which exhibit significant sequence homology with members of the c-kit subgroup of pTks (i.e. FLT/FLX tSAL-Sl), FGF
receptor (SAL-D4) or NGF receptor (LpTKS)) as well as the proteins encoded by HpTK 5 and the bpTKs. The present 10 invention also includes SAL-S1, SAL-D4, and LpTK, HpTK and bpTK homologues or equivalents (i.e., proteins which have amino acid sequences substantially similar, but not identical, to that of SAL-S1, SAL-D4, the LpTKs HpTK and the bpTKs, which exhibit tyrosine kinase activity.) This 15 invention further includes peptides (SAL-S1, SA~-D4, LpTK, HpTK and bpTK fragments) which retain tyrosine kinase activity, yet are less than the entire SAL-S1, SAL-D4, LpTK, HpTK and bpTK sequences), monoclonal and polyclonal antibodies specific for SAL-Sl, SAL-D4, the LpTKs, HpTK
20 and the bpTKs, and uses for the SAL-S1, SAL-D4, the LpTK, HpTK and the bpTK nucleic acid sequences and SAL-S1, SAL-D4, ~pTK, HpTK and bpTK equivalents.
The present invention further includes nucleic acid ~ sequences which hybridize with DNA or RNA encoding the ;~ 25 proteins described herein, which exhibit significant seguence homology with the FLT/F~K, FGF receptor or NGF
receptor family of protein tyrosine kinases contained within the c-kit su~group. Such nucleic acid sequences are useful as probes to identify pTK genes in other 30 vertebrates, particularly mammals, and in other cell types. They can also be used as anti-sense :
,.
..

WO93/15201 2 1 2 8 ~ 2 2 PCT/US93/~0586 oligonucleotides to inhibit protein tyrosine kinase ~ctivity, both in vitro and in vivo.
The SAL-Sl, SAL-D4, LpTK, HpTK and bpTX, tyrosine kinases of the present invention can be used as target 5 proteins in conjunction with the development of drugs and therapeutics to modulate cell growth, differentiation and other metabolic functions. The SAL-Sl, SAL-D4, LpTK, HpTK
- or bpTX proteins can be used as agonists or antagonists to other tyrosine kinases. The SAL-Sl, SAL-D4, LpTK, HpTX or l0 bpTK tyrosine kinases can also be instrumental in the modulation of megakaryocyte and/or platelet adhesion interactions.
In addition, the SAL-Sl, SAL-D4, LpTK, HpTK and bpTK
~; tyrosine ki~lases can be used in screening assays to detect 15 cellular growth and/or differentiation factors. Using standard laboratory techniques, the ligands of the pTKs of the present invention can be identified. Once identified, assays can be designed to detect these ligands present ; endogenously, within cells, as well as exogenously, in 20~ extra cellular fluids.~ Assays can also be designed as diagnostic aids~to detect these ligands in body fluids such as blood and urine.

Brief Description of the Drawinos Figure l depicts the nucleotide sequence of SAL-Sl (SEQ ID NO: 5) and the deduced amino acid sequence (SEQ ID
NO:6).
Figure 2 depicts the nucleotide sequence of SAL-D4 (SEQ ID NO:7) and its deduced amino acid sequence (SEQ ID
NO:8).

~, I~c~ E~lA ~ lE~ .3~ 34 : ] ~: ~r~ i 175~ 15~ +~ J4 ~;r~

. .
~12S7~2 Figur~ 3A depi.cts t~e nucl~ot~ide sequence ( S Q ID
No: 9) and its deduced amino acid sequence (SEQ I~ N0 for LpTK 2.
Figure 3B depicts th~ nucleotide se~uence ISEQ I0 5 N0: ll) and its deduced a~ino acid sequ~nce (SEQ ID N0: 12) f or LpTX 3 ~
Figure 3C depicts the n~cleotide sequence (SEQ ID
H0:13) and its ~}educed a~ino acid ~equence (SEQ ID N0:14 f ar LpT}~ 4 .
Fi~ure 3D depicts the nuclec)tide se~uence ~SEQ ID
N0:15) and its deduaed ar~ino acid seguence (SEQ ID N0:16) ~or the LpTX 13.
Figure 4~-4E~ depicts the full-ler~gth nucleo~ide E,e~uence ~S~Q ID N0: 17~ and its ded~lced ~mino acid 15 6equence ~SEQ ID N0: 18~ for SA~-Sl.
Figure SA-SK depicts the full length nucleotide - ~6equence ~SEQ ID N0: l9~ and the deduced amino acid sequence ( SE;:~ I0 N0: 2 0 ) f or Lp~K2 .
Fign~re 6~ depict~; the partial nucleotide sequence : 20. I~SEQ ID N0: 21) ~o~ ~pq~K4.
Figure 7A-7C depic~s the f~ll length nucleoti~e sequence (SE~ ID N0: 2~) for Lp~25.
Flgure 8A-8I dep~.cts t~e full length nucl~otide ~,equer~ce (SEQ II) N0: 23) and the deduced am~no acid ~e~luen~e (SEQ I~ N0: 24) 25 fo~ llpT~.
Figu~e 9 depicts the alnino acid sequence ~;EQ ID N0:
25~ o~ bpl~l.
; Figure 10 depicts the a~ino acid sequence tSE~ ID N0:
26) c~P bp~X2.

3 o Figure 11 depicts the ar~ino acid sec~uence (SEQ ID ~10:
z l l ~f ~pTK3 .

~CB~TITUTE ~T

W~93/15201 PCT/US93/00586 Figure 12 depicts the amino acid sequence (SEQ ID NO:
28) of bpTK4.
Figure 13 depicts the amino acid sequence (SEQ ID NO:
29) of bpTK5.
Figure 14 depicts the amino acid cequence (SEQ ID NO:
30) of bpTK7.

Detailed Des~ri~tion of the Invention Novel protein tyrosine kinase genes have been identified, their nucleic acid sequences determined, and lo the amino acid ~equences of the encoded proteins deduced. The genes isolated as described herein are referred to, collectively, as protein tyrosine kinase (pTK) genes. The nucleic acid sequences of these genes, isolated as discussed herein, show significant homology to 15 with previously identified protein tyrosine kinases containing extracellular domains which function as growth fact~r receptors. These yenes have been shown to be present in both megakaryocytic and lymphocytic cells.
To facilitate the isolation and identification of 20 these novel pTKs, two sets of DNA probes were used, as described in the Exemplification. The first set consisted of two degenerative oligonucleotide seguences, pTK 1 (SEQ
ID N0:1) and pTK 2 (SEQ ID NO:2) (Matthews, W. Cell 65:
1143 (1991; Wilks, A. F. Proc. Natl. Acad. Sci._USA
25 86:1603 (1989)). These sequences were used as primers in a polymerase chain reaction to amplify tyrosine kinase DNA
segments. (Mullis, K. et al., Cold S~rinq Harbor Symp.
Advan. Biol. 51:263 (1986).
The second set consisted of two oligonucleotide 30 sequences ! pTK 3 (SEQ ID NO:3) and pTKKW tSEQ ID NO:4) designed to amplify the nucleic acid sequence which encodes the highly conserved regions of the catalytic domains of the c-kit family df protein tyrosine kinases.
These sequences were used as primers in the polymerase 5 chain reaction in a second round of DNA amplification.
Using this two-step amplification procedure, DNA fragments which hybridized to these pTK primers were identified, isolated and subsequently sequenced.
In particular, fourteen pTK genes exhibiting 10 significant homology with the c-kit subgroup of protein tyrosine kinases have been identified. Two pTK genes, referred to as SAL-Sl and SAL-D4 (also referred to as ; megakaryocyte derived FGF-like receptor) were identified ~; in several megakaryocytic cell lines, including CMK 11-5, 15 DAMI, UT-7 and UT-7 grown in erythropoietin, but not in the erythroid cell lines ~EL, PMA stimulated HEL cells, or K562. Five pTK genes, referred to as LpTKs, were identified in lymphocytic, as well as in megakaryocytic cells. One pTK gene, referred to as HpTK5 was identified 20 in human hepatoma cells and six genes, referred to as bpTKs, were identified in human brain tissue.
SAL-Sl (SEQ ID NO:6 and 18) encoded by the nucleic acid seque~ce SEQ ID NOS:5 and 17, exhibits significant ; homology with the FLT/FLK family of pTKs. SAL-D4 (SEQ ID
25 NO:8) encoded by SEQ ID NO:7, is related to the FGF
receptor family of pTKs, and one LpTK (LpTK 3 (SEQ ID
NO:12) encoded by the SEQ ID NO:ll, is related to the NGF
receptor family of pTKs. The remaining LpTKs, LpTK2 (SEQ
ID NO:10) encoded by SEQ ID NO:9; LpTK4 (SEQ ID NO:14) 30 encoded by SEQ ID NO:13; LpTK13 (SEQ ID NO:1~) encoded by SEQ ID NO:15 LpTK25 encoded by SEQ ID NO: 22, also exhibit WO93/152~1 PCT/US93/00586 . .

7 2 ~

~e~uence homology with known protein tyrosine kinases (Data not ~hown).
HpTX5 (SEQ ID NO: 24) encoded by SEQ ID NO: 23 and the bpTKs l, 2, 3, 4, 5 and 7 (SEQ ID NOS: 25-30 5 respectively, also exhibit sequence homology with known protein tyrosine kinases.
Thus, as described above, DNA which hybridize with DNA encoding amino acid sequences present in the catalytic domain of a protein tyrosine kinase of the c-kit subgroup l0 of protein kinases have been isolated and sequenced.
These isolated DNA sequences, collectively referred to as pTKs genes, (and their deduced amino acid ~equences) have been shown to exhibit significant sequence homology with known members of receptor tyrosine kinase families.
~:
Once isolated, these DNA fragments can be amplified - using known standard techniques such as PCR. These amplified fragments can then be cloned into appropriate cloning vectors and their DNA sequences determined.
; These DNA sequences czn be excised from the cloning 20 vectors, labeled with a radiolabeled nucleotide such as 32p and used to screen appropriate cDNA libraries to obtain the full-length cDNA clone.
The pTk genes as described above have been isolated from the source in which they occur naturally, i.e.
25 megakaryocyte and lymphocytic cells. The present invention is intended to include pTk genes produced using genetic engineering techniques, such as recombinant technology, as well as pTk genes that are synthesized chemically.
The deduced amino acid sequences of the pTK genes 30 include amino acid sequences which encode peptides exhibiting significant homology with the catalytic domain .

of protein tyrosine kinases of the c-kit subgroup of tyrosine kinases. These proteins, encoded by the pTk genes, can i~clude seguences in which functionally equivalent amino acid residues are su~stituted for 5 residues within the sequence, resulting in a silent change, that is a change not detected phenotypically. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity which acts as a functional equivalent, lO resulting in a silent substitution.
In addition, the protein structure can be modified by deletions, additions, inversion, insertions or substitutions of one or more amino acid residues in the sequence which do not substantially detract from the 15 desired functional tyrosine kinases properties of the peptide.
Modified pTKs of the present invention, with receptor tyrosine kinasè activity can be made using recombinant DNA
techniques, such as excising it from a vector containing a ;~ 20 cDNA encoding such a protein, or by synthesizing DNA
encoding the desired protein mechanically and/or chemically using known techniques.
m~ ~ An alternate approach to producing the pTKs of the present invention is to use peptide synthesis to make a 25 peptide or polypeptide having the amino acid sequence of such a protein. The peptides or modified equivalents ~` thereof, can be synthesized directly by standard solid or liquid phase chemistries for peptide synthesis.
Preferably, the pTKs of the present invention will be 30 produced by inserting DNA encoding the proteins into an appropriate vector/host system where it will be expressed.

WO93/1~201 PCT/US93/00586 212~7.~2 The DNA sequences can be obtained from sources in which they ~ccur naturally, can be chemically synthesized or can be produced using ~tandard recombinant technology.
Thi~ invention also pertains to an expression vector 5 comprising a pTK gene of the present invention, encoding for a protein which exhibits receptor tyrosine kinase activity.
The pTK genes of the present invention can be used for a number of diagnostic and therapeutic purposes. ~or 10 example, the nucleic acid sequences of the pTK genes can be used as probes to identify other protein tyrosine kinases present in other cell types, including eukaryotic and prokaryotic cell types.
The nucleic acid sequences can be used to design 15 drugs that directly inhibit the kinase activity of protein tyrosine kinases, or to design peptides that bind to the catalytic domain of tyrosine kinases, thus inhibiting their activity. These sequences can also be used to ~;; design anti-sense nucleotides that can also inhibit, or 0 destroy, tyrosine kinase activity. Such inhibition of ~yrosine kinase activity would be desirable in pathological states where decreased cellular prolifération would be beneficial, such as leukemias or other ma~ignancies.
The nucleic acid sequences can also be used to desi~n drugs, peptides or anti-sense nucleotides as above, but with enhancing, rather than inhibitory effects, on tyrosine kinases. Such enhanced tyrosine kinase activity would result in increasing the phosphorylation of 30 substrates (exogenous, as well as endogenous tyrosine residues). Enhanced effects would be desirable in states ~" ~ ~",. , , . , " .~, '. ~ i . ' ' ,' ', ' " ' ' , ' WO93/1~201 PCT/US93/00586 .

wh~re increased cellular proliferation would be beneficial, ~uch as anemias, bleeding di~orders and during surgical procedures.
The pTK genes of the present invention can also be 5 used to o~*ain ~oluble fragments of receptor tyrosine kinases, capable of binding their respective ligands (i.e.
fibroblast growth factor).
` pTK genes encoding soluble receptor tyrosine kinase fragments can be produced using recombinant DNA techniques l0 or synthetically. In either case, the ~NA obtained encodes a soluble pTK fragment which lacks a substantial portion of the hydrophobic transmembrane region to permit solubilization of the fragment.
These soluble pTK protein fragments can be introduced 15 exogenously to act as competitors with the endogenous, membrane bound pTK for their respective ligands, thus inhibiting tyrosine kinase activity. Alternately, a modified soluble pTK protein fragment can be introduced which binds the ligand but does not activate kinase 20 activity.
These soluble pTK protein fragments can also be used in binding assays to detect ligands such as growth and differentiation factors. Once these ligands are identified, they may be altered or modified to inhibit or 25 enhance kinase activity. For example, the ligands may be modified or attached to substances that are toxic to the cell, such a ricin, thus destroying the target cell. The substance may be a super-activating substance which, after binding to the pTK, may substantially increase the kinase 30 activity, or activate other growth factors.

WO93/1520~ PCT/US93/00586 '~128722 pTk genes of the present invention would also be useful to develop diagnostic tools for in Yitro screening assays for ligands such as growth factors or differentiation factors that inhibit or enhance kinase 5 activity. The proteins encoded by the pTK genes can also be used in such assays, or as immunogens to produce monoclonal or polyclonal antibodies to be used in such assays.
Such antibodies can also be used in methods ~f 10 treating conditions in which an individual would benefit therapeutically if protein tyrosine kinase activity could be modified, such as increasing platelet production in bleeding disorders.
The present invention will now be illustrated by the 15 following Exemplification, which is not intended to be ~: limiting in any way.

Exem~l_fication: The Identification and Isolation of the pTK Genes To facilitate the isolation and identification of 20 these novel pTK genes, two sets of DNA probes were used.
(See Table).
The first set consisted of two degenerative oligonucleotide sequences, pTK 1 (SEQ ID NO:l) and pTK
2(SEQ ID NO:2). These sequences were used as polymerase 25 chain reaction (PCR) primers, using standard PCR
techniques, to amplify tyrosine kinase DNA segments.
The second set consisted of two oligonucleotide sequences, pTK 3 ~SEQ ID NO:3) and pTKKW (SEQ ID NO:4) selected from the highly conserved regions of the 30 catalytic domains of the c-kit subgroup of protein WO93/15201 PCT/US93/0058~

C~

tyrosine kinases. These sequences were also used as polymerase chain reaction primers in a second round of DNA
amplification. Using this two-step amplification procedure, DNA fragments which hybridized to these pTK
5 primers were identified, isolated and subsequently sequenced using known laboratory techniques.

TABLE

- ~irst Round of AmDlification PTKl "
~ GGAATTCCAAAGGACCAGACGTC

`~ Second Round of Am~lification PTK3 (~it family specific) PTKKW ~kit family specific) GGAATTCCTTCAGGAGCCATCCACTT

E~uivalents Those skilled in the art will recognize, or be able 20 to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

.

Claims

The invention claimed is:

1. Isolated DNA of human origin which hybridizes to SEQ
ID NO:3 or SEQ ID NO:4 which hybridize to DNA
encloding an amino acid sequence present in the catalytic domain of a protein tyrosine kina?e of the c-kit subgroup of protein tyrosine kinases.

2. Isolated DNA of claim 1 having a nucleotide sequence selected from the group of nucleotide sequences consisting of:
a) SAL-S1 (SEQ ID NOS:5 and 17);
b) SAL-D4 (SEQ ID No:7);
c) LPTK 2 (SEQ ID NOS:9 and 19);
d) LPTK 3 (SEQ ID NO:11);
e) LPTK 4 (SEQ ID NOS:13 and 21);
f) LPTK 23 (SEQ ID NO:15);
g) LPTK 25 (SEQ ID NO:22); and h) HPTK 5 (SEQ ID No:23).

SUBSTITUTE SHEET

3 . Isolated DNA of claim 1 which encodes an amino acid sequence selected from the group consisting of:
a) SAL-S1 (SEQ ID NOS:6 and 18);
b) SAL-D4 (SEQ ID No:8);
c) LPTK 2 (SEQ ID NOS:10 and 20);
d) LPTK 3 (SEQ ID NO:12) e) LPTK 4 (SEQ ID NO:14);
f) LPTK 13 (SEQ ID NO:16);
g) HPTK 5 (SEQ ID NO:24);
h) bpTK 1 (SEQ ID NO:25);
i) bpTK 2 (SEQ ID NO:26);
j) bpTK 3 (SEQ ID NO:27);
k) bpTK 4 (SEQ ID NO:28);
l) bpTK 5 (SEQ ID NO:29); and m) bpTK 7 (SEQ ID NO:30).

4. Isolated DNA of human origin which comprise? a DNA
fragment that hybridizes with SEQ ID NO:3 or SEQ ID
NO:4 who?e sequences encode an amino acid sequence present in the catalytic domain of a protein tyrosine kinase of the c-kit subgroup of prttein tyrosine kinases.

SUBSTITUTE SHEET

5. Isolated DNA of claim 4 which encodes an amino acid sequence selected from the group consisting of:
a) SAL-S1 (SEQ ID NOS:6 and 18);
b) SAL-D$ (SEQ ID NO:6);
c) LPTK 2 (SEQ ID NOS:10 and 20);
d) LPTK 3 (SEQ ID NO:12);
e) LPTK 4 (SEQ ID NO:14);
f) LPTK 13 (SEQ ID NO:16);
g) HPTK 5 (SEQ ID NO:2?):
h) bpTK 1 (SEQ ID NO:25);
i) bpTK 2 (SEQ ID NO:26);
j) bpTK 3 (SEQ ID NO:27);
k) bpTK 4 (SEQ ID NO:28);
l) bpTk 5 (SEQ ID NO:29); and m) bpTK 7 (SEQ ID NO:30).

6. A homogeneous protein of human origin which includes an a?ino acid sequence encoded by SEQ ID NO:3 or SEQ
ID NO:4 which exhibit sequence homology with the catalytic domain of tyrosine kinases of the c-kit family.

SUBSTITUTE SHEET

7.
A homogeneous protein of claim 6 which the amino acid sequence is selected from the group consisting of:
a) SAL-S1 (SEQ ID NOS:6 and 18);
b) SAL-D4 (SEQ ID NO:8);
c) LpTK 2 (SEQ ID NOS:10 and 20);
d) LpTK 3 (SEQ ID NO:12);
e) LpTK 4 (SEQ ID NO:14);
f) LpTK 13 (SEQ ID NO:16);
g) HpTK 5 (SEQ ID NO:24);
H) bpTK 1 (SEQ ID NO:25);
i) bpTK 2 (SEQ ID NO:26);
j) bpTK 3 (SEQ ID NO:27);
k) bpRK 4 (SEQ ID NO:28);
l) bpTK 5 (SEQ ID NO:29);
m) bpTK 7 (SEQ ID NO:30).

8. A protein of human megakaryoctic origin which includes an amino acid ?equence encoded by SEQ ID
NO:3 or SEQ ID NO:4 which exhibit sequence homology with the FLT/FLK family of protein tyrosine kinases.

9. A protein of claim 8 encoded by the nucleotide sequence (SEQ ID NO:5).

10. A protein of claim 8 encoded by the amino acid sequence (SEQ ID NO:6).

11. A protein of claim 8 encoded by the nucleotide s?quence (SEQ ID NO:17).

12. A protein of claim 8 encoded by the amino acid sequence (SEQ ID NO:18).

?UB?TITUTE ?HEET

13. A protein of human megakaryocytic origin which includes an amino sequence encoded by SEQ ID
NO:3 or SEQ ID NO:4 which exhibit sequence homology with the FGF rec?ptor family of protein tyrosine kinases.

14. A protein of Claim 13 encoded by the nucleotide sequence ( SEQ ID NO:7).

15. A protein of Claim 13 encoded by the amino acid sequence ( SEQ ID NO:8).

16. A protein of human megakaryocytic or lymphocytic origin which includes an amino acid sequence encoded by SEQ ID NO:3 or SEQ ID NO:4 which exhibit sequence homology with the NGF receptor family of protein tyrosine kinases.

î7. A protein of Claim 16 encoded by the nucleotide sequence (SEQ ID NO:11).

18. A protein of Claim 16 encoded by the amino acid sequence ( SEQ ID NO:12 ) .

19. A DNA expression vector containing a DNA sequence of human origin which hybridize? to SEQ ID NO:3 or SEQ
ID NO:4 which hybridize to DNA encoding an amino acid sequence present in the catalytic domain of a protein tyrosine kinase of the c-kit subgroup of protein kinases.

?UB?TITUTE ?HEET

20. The DNA expression vector of Claim 19 containing a DNA sequence selected from the group consisting of:
a) SAL-S1 (SEQ ID NOS:5 and 17);
b) SAL-D4 (SEQ ID NO:7);
c) LpTK 2 (SEQ ID NOS:9 and 19);
d) LpTK 3 (SEQ ID NO:11);
e) LpTK 4 (SEQ ID NOS:13 and 21);
f) LpTk 13 (SEQ ID NO:15);
g) LpTK 25 (SEQ ID NO:22); and h) HpTK 5 (SEQ ID NO:23).

21. A cell transformed by the expression vector of Claim 19.

22. Isolated DNA of claim 1 wherein the human origin is megakaryocytic origin.

23. Isolated DNA of claim 22 having a nucleotide sequence selected from the group of nucleotide sequences consisting of:
a) SAL-S1 (SEQ ID NOS:5 and 17);
b) SAL-D4 (SEQ ID NO:7);
c) LpTK 2 (SEQ ID NOS:9 and 19);
d) LpTk 3 (SEQ ID NO:11);
e) LpTK 4 (SEQ ID NOS:13 and 21);
f) LpTK 13 (SEQ ID NO:15); and g) LpTK 25 (SEQ ID NO:22).

24. Isolated DNA of Claim 22 which encodes an amino acid sequence selected from the group consisting of:
a) SAL-S1 (SEQ ID NOS:6 and 18);
b) SAL-D4 (SEQ ID NO:8);
c) LpTK 2 (SEQ ID NOS:10 and 20);
d) LpTK 3 (SEQ ID NO:12);
e) LpTK 4 (SEQ ID NO:14); and f) LpTK 13 (SEQ ID NO:16).

25. Isolated DNA of claim 4 wherein the human origin is megakaryocytic origin.

26. Isolated DNA of claim 25 which encodes an amino acid sequ?nce selected from the group consisting of:
a) SAL-S1 (SEQ ID NOS:6 and 18);
b) SAL-D4 (SEQ ID NO:8);
c) LpTK 2 (SEQ ID NOS:10 and 20);
d) LpTk 3 (SEQ ID No:12);
e) LpTk 4 (SEQ ID NO:14); and f) LpTk 13 (SEQ ID NO:16).

27. A homogeneous protein of Claim 6 wherein the human origin is megakaryo?ytic origin.

28. A homogeneous protein of claim 27 in which the amino acid sequence is selected from the group consisting of:
a) SAL-S1 (SEQ ID NOS:6 and 18);
b) SAL-D4 (SEQ ID NO:8);
c) LpTK 2 (SEQ ID NO:10 and 20);
d) LpTK 3 (SEQ ID NO:12);
e) LpTk 4 (SEQ ID NO:14); and f) LpTK 13 (SEQ ID NO:16).

?UB?TITUTE ?HEET

29. A DNA expression vector of Claim 19 wherein the human origin is megalcaryocytic origin.

30. The DNA expression vector of Claim 29 containing a DNA sequence selected from the group consisting of:
a) SAL-S1 (SEQ ID NOS:5 and 17);
b) SAL-D4 (SEQ ID NO:7);
c) LpTk 2 (SEQ ID NOS:9 and 19);
d) LpTK 3 (SEQ ID NO:11);
e) LpTK 4 (SEQ ID NOS:13 and 21);
f) LpTK 13 (SEQ ID NO:15); and g) LpTK 25 (SEQ ID NO:22).

31. A cell transformed by the expression vector of Claim 29.

32. An isolated DNA of Claim 1 wherein the human origin is hepatic origin.

33. Isolated DNA of Claim 32 having a nucleotide sequence consisting of SEQ ID NO:23.

34. Isolated DNA of Claim 32 which encodes an amino acid sequence consisting of SEQ ID NO:24.

35. Isolated DNA of Claim 4 wherein the human origin is hepatic origin.

36. Isolated DNA of Claim 35 which encodes an?amino acid sequence consisting of SEQ ID NO:24.

.37. A holaogeneous pxotein of Claim wherein the human origin is hepatic origin.

?UB?TITUTE ?HEET

38. A homogenous protein of Claim 37 consisting of SEQ ID
NO:24.

39. A DNA expression vector of Claim ?9 wherein the human origin is hepatic origin.

40. The ONA expression vector of Claim 39 containing a DNA sequence consisting of SEQ ID NO:23.

41. A cell transformed by the expression vector of Claim 40.

42. Isolated DNA of Claim 1 wherein the human origin is brain origin.

43. Isolated DNA of Claim 42 which encodes an amino ?cid sequence selected from the group consisting of:
a) bpTK 1 (SEQ ID NO:25);
b) bpTK 2 (SEQ ID NO:26);
c) bpTK 3 (SEQ ID NO:Z7);
d) bpTK 4 (SEQ ID NO:28);
e) bpTK 5 (SEQ ID No;29); and f) bpTK 7 (SEQ ID NO:30).

44. Isolated DNA of Claim 4 wherein the human orisin is brain origin.

?UB?TITUTE ?HEET

45. Isolated DNA of Claim 44 which encodes an amin? acid sequence selected from the group consisting of:
a) bpTK 1 (SEQ ID NO:25);
b) bpTK 2 (SEQ ID NO:26);
c) bpTK 3 (SEQ ID NO:27);
d) bpTK 4 (SEQ ID NO:28);
e) bpTK 5 (SEQ ID NO: 29); and f) bpTK 7 (SEQ ID NO:30).

46. A homogeneous protein of Claim 6 wherein the human origin is brain origin.

47. A homogeneous protein of Claim 46 in which the amino acid sequence is selected fro? the group consisting of:
a) bpTK 1 (SEQ ID NO:25);
b) bpTk 2 (SEQ ID NO:26);
c) bpTK 3 (SEQ ID NO:27);
d) bpTK 4 (SEQ ID NO:28);
e) bpTk 5 (SEQ ID NO: 29); and f) bpTk 7 (SEQ ID NO:30).

?UB?TITUTE ?HEET