US20040259247A1 - Rna interference mediating small rna molecules - Google Patents

Rna interference mediating small rna molecules Download PDF


Publication number
US20040259247A1 US10/433,050 US43305004A US2004259247A1 US 20040259247 A1 US20040259247 A1 US 20040259247A1 US 43305004 A US43305004 A US 43305004A US 2004259247 A1 US2004259247 A1 US 2004259247A1
United States
Prior art keywords
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Application number
Thomas Tuschl
Sayda Elbashir
Winfried Lendeckel
Matthias Wilm
Reinhard Luhrmann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Massachusetts Institute of Technology
Original Assignee
Europaisches Laboratorium fur Molekularbiologie (EMBL)
Max-Planck-Gesellschaft zur Forderung der Wissenschaften
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
Priority to EP00126325 priority Critical
Priority to EP00126325.0 priority
Priority to US27966101P priority
Priority to WOPCT/US01/10188 priority
Priority to PCT/US2001/010188 priority patent/WO2001075164A2/en
Priority to US10/433,050 priority patent/US20040259247A1/en
Priority to PCT/EP2001/013968 priority patent/WO2002044321A2/en
Application filed by Europaisches Laboratorium fur Molekularbiologie (EMBL), Max-Planck-Gesellschaft zur Forderung der Wissenschaften filed Critical Europaisches Laboratorium fur Molekularbiologie (EMBL)
Publication of US20040259247A1 publication Critical patent/US20040259247A1/en
First worldwide family litigation filed litigation Critical "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application status is Abandoned legal-status Critical




    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1079Screening libraries by altering the phenotype or phenotypic trait of the host
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A61K38/00Medicinal preparations containing peptides
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2330/00Production
    • C12N2330/30Production chemically synthesised


Double-stranded RNA (dsRNA) induces sequence-specific post-transcriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a Drosophila in vitro system, we demonstrate that 19-23 nt short RNA fragments are the sequence-specific mediators of RNAi. The short interfering RNAs (siRNAs) are generated by an RNase III-like processing reaction from long dsRNA. Chemically synthesized siRNA duplexes with overhanging 3′ ends mediate efficient target RNA cleavage in the lysate, and the cleavage site is located near the center of the region spanned by the guiding siRNA. Furthermore, we provide evidence that the direction of dsRNA processing determines whether sense or antisense target RNA can be cleaved by the produced siRNP complex.


  • The present invention relates to sequence and structural features of double-stranded (ds)RNA molecules required to mediate target-specific nucleic acid modifications such as RNA-interference and/or DNA methylation. [0001]
  • The term “RNA interference” (RNAi) was coined after the discovery that injection of dsRNA into the nematode [0002] C. elegans leads to specific silencing of genes highly homologous in sequence to the delivered dsRNA (Fire et al., 1998). RNAi was subsequently also observed in insects, frogs (Oelgeschlager et al., 2000), and other animals including mice (Svoboda et al., 2000; Wianny and Zernicka-Goetz, 2000) and is likely to also exist in human. RNAi is closely linked to the post-transcriptional gene-silencing (PTGS) mechanism of co-suppression in plants and quelling in fungi (Catalanotto et al., 2000; Cogoni and Macino, 1999; Dalmay et al., 2000; Ketting and Plasterk, 2000; Mourrain et al., 2000; Smardon et al., 2000) and some components of the RNAi machinery are also necessary for post-transcriptional silencing by co-suppression (Catalanotto et al., 2000; Dernburg et al., 2000; Ketting and Plasterk, 2000). The topic has also been reviewed recently (Bass, 2000; Bosher and Labouesse, 2000; Fire, 1999; Plasterk and Ketting, 2000; Sharp, 1999; Sijen and Kooter, 2000), see also the entire issue of Plant Molecular Biology, vol. 43, issue 2/3, (2000).
  • In plants, in addition to PTGS, introduced transgenes can also lead to transcriptional gene silencing via RNA-directed DNA methylation of cytosines (see references in Wassenegger, 2000). Genomic targets as short as 30 bp are methylated in plants in an RNA-directed manner (Pelissier, 2000). DNA methylation is also present in mammals. [0003]
  • The natural function of RNAi and co-suppression appears to be protection of the genome against invasion by mobile genetic elements such as retro-transposons and viruses which produce aberrant RNA or dsRNA in the host cell when they become active (Jensen et al, 1999; Ketting et al., 1999; Ratcliff et al., 1999; Tabara et al., 1999). Specific mRNA degradation prevents transposon and virus replication although some viruses are able to overcome or prevent this process by expressing proteins that suppress PTGS (Lucy et al., 2000; Voinnet et al., 2000). [0004]
  • DsRNA triggers the specific degradation of homologous RNAs only within the region of identity with the dsRNA (Zamore et al., 2000). The dsRNA is processed to 21-23 nt RNA fragments and the target RNA cleavage sites are regularly spaced 21-23 nt apart. It has therefore been suggested that the 21-23 nt fragments are the guide RNAs for target recognition (Zamore et al., 2000). These short RNAs were also detected in extracts prepared from [0005] D. melanogaster Schneider 2 cells which were transfected with dsRNA prior to cell lysis (Hammond et al., 2000), however, the fractions that displayed sequence-specific nuclease activity also contained a large fraction of residual dsRNA. The role of the 21-23 nt fragments in guiding mRNA cleavage is further supported by the observation that 21-23 nt fragments isolated from processed dsRNA are able, to some extent, to mediate specific mRNA degradation (Zamore et al., 2000). RNA molecules of similar size also accumulate in plant tissue that exhibits PTGS (Hamilton and Baulcombe, 1999).
  • Here, we use the established [0006] Drosophila in vitro system (Tuschl et al., 1999; Zamore et al., 2000) to further explore the mechanism of RNAi. We demonstrate that short 21 and 22 nt RNAs, when base-paired with 3′ overhanging ends, act as the guide RNAs for sequence-specific mRNA degradation. Short 30 bp dsRNAs are unable to mediate RNAi in this system because they are no longer processed to 21 and 22 nt RNAs. Furthermore, we defined the target RNA cleavage sites relative to the 21 and 22 nt short interfering RNAs (siRNAs) and provide evidence that the direction of dsRNA processing determines whether a sense or an antisense target RNA can be cleaved- by the produced siRNP endonuclease complex. Further, the siRNAs may also be important tools for transcriptional modulating, e.g. silencing of mammalian genes by guiding DNA methylation.
  • Further experiments in human in vivo cell culture systems (HeLa cells) show that double-stranded RNA molecules having a length of preferably from 19-25 nucleotides have RNAi activity. Thus, in contrast to the results from [0007] Drosophila also 24 and 25 nt long double-stranded RNA molecules are efficient for RNAi.
  • The object underlying the present invention is to provide novel agents capable of mediating target-specific RNA interference or other target-specific nucleic acid modifications such as DNA methylation, said agents having an improved efficacy and safety compared to prior art agents. [0008]
  • The solution of this problem is provided by an isolated double-stranded RNA molecule, wherein each RNA strand has a length from 19-25, particularly from 19-23 nucleotides, wherein said RNA molecule is capable of mediating target-specific nucleic acid modifications, particularly RNA interference and/or DNA methylation. Preferably at least one strand has a 3′-overhang from 1-5 nucleotides, more preferably from 1-3 nucleotides and most preferably 2 nucleotides. The other strand may be blunt-ended or has up to 6 nucleotides 3′ overhang. Also, if both strands of the dsRNA are exactly 21 or 22 nt, it is possible to observe some RNA interference when both ends are blunt (0 nt overhang). The RNA molecule is preferably a synthetic RNA molecule which is substantially free from contaminants occurring in cell extracts, e.g. from [0009] Drosophila embryos. Further, the RNA molecule is preferably substantially free from any non-target-specific contaminants, particularly non-target-specific RNA molecules e.g. from contaminants occuring in cell extracts.
  • Further, the invention relates to the use of isolated double-stranded RNA molecules, wherein each RNA strand has a length from 19-25 nucleotides, for mediating, target-specific nucleic acid modifications, particularly RNAi, in mammalian cells, particularly in human cells. [0010]
  • Surprisingly, it was found that synthetic short double-stranded RNA molecules particularly with overhanging 3′-ends are sequence-specific mediators of RNAi and mediate efficient target-RNA cleavage, wherein the cleavage site is located near the center of the region spanned by the guiding short RNA. [0011]
  • Preferably, each strand of the RNA molecule has a length from 20-22 nucleotides (or 20-25 nucleotides in mammalian cells), wherein the length of each strand may be the same or different. Preferably, the length of the 3′-overhang reaches from 1-3 nucleotides, wherein the length of the overhang may be the same or different for each strand. The RNA-strands preferably have 3′-hydroxyl groups. The 5′-terminus preferably comprises a phosphate, diphosphate, triphosphate or hydroxyl group. The most effective dsRNAs are composed of two 21 nt strands which are paired such that 1-3, particularly 2 nt 3′ overhangs are present on both ends of the dsRNA. [0012]
  • The target RNA cleavage reaction guided by siRNAs is highly sequence-specific. However, not all positions of a siRNA contribute equally to target recognition. Mismatches in the center of the siRNA duplex are most critical and essentially abolish target RNA cleavage. In contrast, the 3′ nucleotide of the siRNA strand (e.g. position 21) that is complementary to the single-stranded target RNA, does not contribute to specificity of the target recognition. Further, the sequence of the unpaired 2-nt 3′ overhang of the siRNA strand with the same polarity as the target RNA is not critical for target RNA cleavage as only the antisense siRNA strand guides target recognition. Thus, from the single-stranded overhanging nucleotides only the penultimate position of the antisense siRNA (e.g. position 20) needs to match the targeted sense mRNA. [0013]
  • Surprisingly, the double-stranded RNA molecules of the present invention exhibit a high in vivo stability in serum or in growth medium for cell cultures. In order to further enhance the stability, the 3′-overhangs may be stablized against degradation, e.g. they may be selected such that they consist of purine nucleotides, particularly adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g. substitution of uridine 2 nt 3′ overhangs by 2′-deoxythymidine is tolerated and does not affect the efficiency of RNA interference. The absence of a 2′ hydroxyl significantly enhances the nuclease resistance of the overhang in tissue culture medium. [0014]
  • In an especially preferred embodiment of the present invention the RNA molecule may contain at least one modified nucleotide analogue. The nucleotide analogues may be located at positions where the target-specific activity, e.g. the RNAi mediating activity is not substantially effected, e.g. in a region at the 5′-end and/or the 3′-end of the double-stranded RNA molecule. Particularly, the overhangs may be stabilized by incorporating modified nucleotide analogues. [0015]
  • Preferred nucleotide analogues are selected from sugar- or backbone-modified ribonucleotides. It should be noted, however, that also nucleobase-modified ribonucleotides, i.e. ribonucleotides, containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase such as uridines or cytidines modified at the 5-position, e.g. 5-(2-amino)propyl uridine, 5-bromo uridine; adenosines and guanosines modified at the 8-position, e.g. 8-bromo guanosine; deaza nucleotides, e.g. 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g. N6-methyl adenosine are suitable. In preferred sugar-modified ribonucleotides the 2′OH-group is replaced by a group selected from H, OR, R, halo, SH, SR, NH[0016] 2, NHR, NR2 or CN, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I. In preferred backbone-modified ribonucleotides the phosphoester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g. of phosphothioate group. It should be noted that the above modifications may be combined.
  • The sequence of the double-stranded RNA molecule of the present invention has to have a sufficient identity to a nucleic acid target molecule in order to mediate target-specific RNAi and/or DNA methylation. Preferably, the sequence has an identity of at least 50%, particularly of at least 70% to the desired target molecule in the double-stranded portion of the RNA molecule. More preferably, the identity is at least 85% and most preferably 100% in the double-stranded portion of the RNA molecule. The identity of a double-stranded RNA molecule to a predetermined nucleic acid target molecule, e.g. an mRNA target molecule may be determined as follows: [0017] I = n L × 100
    Figure US20040259247A1-20041223-M00001
  • wherein I is the identity in percent, n is the number of identical nucleotides in the double-stranded portion of the ds RNA and the target and L is the length of the sequence overlap of the double-stranded portion of the dsRNA and the target. [0018]
  • Alternatively, the identity of the double-stranded RNA molecule to the target sequence may also be defined including the 3′ overhang, particularly an overhang having a length from 1-3 nucleotides. In this case the sequence identity is preferably at least 50%, more preferably at least 70% and most preferably at least 85% to the target sequence. For example, the nucleotides from the 3′ overhang and up to 2 nucleotides from the 5′ and/or 3′ terminus of the double strand may be modified without significant loss of activity. [0019]
  • The double-stranded RNA molecule of the invention may be prepared by a method comprising the steps: [0020]
  • (a) synthesizing two RNA strands each having a length from 19-25, e.g. from 19-23 nucleotides, wherein said RNA strands are capable of forming a double-stranded RNA molecule, wherein preferably at least one strand has a 3′-overhang from 1-5 nucleotides, [0021]
  • (b) combining the synthesized RNA strands under conditions, wherein a double-stranded RNA molecule is formed, which is capable of mediating target-specific nucleic acid modifications, particularly RNA interference and/or DNA methylation. [0022]
  • Methods of synthesizing RNA molecules are known in the art. In this context, it is particularly referred to chemical synthesis methods as described in Verma and Eckstein (1998). [0023]
  • The single-stranded RNAs can also be prepared by enzymatic transcription from synthetic DNA templates or from DNA plasmids isolated from recombinant bacteria. Typically, phage RNA polymerases are used such as T7, T3 or SP6 RNA polymerase (Milligan and Uhlenbeck (1989)). [0024]
  • A further aspect of the present invention relates to a method of mediating target-specific nucleic acid modifications, particularly RNA interference and/or DNA methylation in a cell or an organism comprising the steps: [0025]
  • (a) contacting the cell or organism with the double-stranded RNA molecule of the invention under conditions wherein target-specific nucleic acid modifications may occur and [0026]
  • (b) mediating a target-specific nucleic acid modificiation effected by the double-stranded RNA towards a target nucleic acid having a sequence portion substantially corresponding to the double-stranded RNA. [0027]
  • Preferably the contacting step (a) comprises introducing the double-stranded RNA molecule into a target cell, e.g. an isolated target cell, e.g. in cell culture, a unicellular microorganism or a target cell or a plurality of target cells within a multicellular organism. More preferably, the introducing step comprises a carrier-mediated delivery, e.g. by liposomal carriers or by injection. [0028]
  • The method of the invention may be used for determining the function of a gene in a cell or an organism or even for modulating the function of a gene in a cell or an organism, being capable of mediating RNA interference. The cell is preferably a eukaryotic cell or a cell line, e.g. a plant cell or an animal cell, such as a mammalian cell, e.g. an embryonic cell, a pluripotent stem cell, a tumor cell, e.g. a teratocarcinoma cell or a virus-infected cell. The organism is preferably a eukaryotic organism, e.g. a plant or an animal, such as a mammal, particularly a human. [0029]
  • The target gene to which the RNA molecule of the invention is directed may be associated with a pathological condition. For example, the gene may be a pathogen-associated gene, e.g. a viral gene, a tumor-associated gene or an autoimmune disease-associated gene. The target gene may also be a heterologous gene expressed in a recombinant cell or a genetically altered organism. By determinating or modulating, particularly, inhibiting the function of such a gene valuable information and therapeutic benefits in the agricultural field or in the medicine or veterinary medicine field may be obtained. [0030]
  • The dsRNA is usually administered as a pharmaceutical composition. The administration may be carried out by known methods, wherein a nucleic acid is introduced into a desired target cell in vitro or in vivo. Commonly used gene transfer techniques include calcium phosphate, DEAE-dextran, electroporation and microinjection and viral methods (Graham, F. L. and van der Eb, A. J. (1973) Virol. 52, 456; McCutchan, J. H. and Pagano, J. S. (1968), J. Natl. Cancer Inst. 41, 351; Chu, G. et al (1987), Nucl. Acids Res. 15, 1311; Fraley, R. et al. (1980), J. Biol. Chem. 255, 10431; Capecchi, M. R. (1980), Cell 22, 479). A recent addition to this arsenal of techniques for the introduction of DNA into cells is the use of cationic liposomes (Feigner, P. L. et al. (1987), Proc. Natl. Acad. Sci USA 84, 7413). Commercially available cationic lipid formulations are e.g. Tfx 50 (Promega) or Lipofectamin 2000 (Life Technologies). [0031]
  • Thus, the invention also relates to a pharmaceutical composition containing as an active agent at least one double-stranded RNA molecule as described above and a pharmaceutical carrier. The composition may be used for diagnostic and for therapeutic applications in human medicine or in veterinary medicine. [0032]
  • For diagnostic or therapeutic applications, the composition may be in form of a solution, e.g. an injectable solution, a cream, ointment, tablet, suspension or the like. The composition may be administered in any suitable way, e.g. by injection, by oral, topical, nasal, rectal application etc. The carrier may be any suitable pharmaceutical carrier. Preferably, a carrier is used, which is capable of increasing the efficacy of the RNA molecules to enter the target-cells. Suitable examples of such carriers are liposomes, particularly cationic liposomes. A further preferred administration method is injection. [0033]
  • A further preferred application of the RNAi method is a functional analysis of eukaryotic cells, or eukaryotic non-human organisms, preferably mammalian cells or organisms and most preferably human cells, e.g. cell lines such as HeLa or 293 or rodents, e.g. rats and mice. By transfection with suitable double-stranded RNA molecules which are homologous to a predetermined target gene or DNA molecules encoding a suitable double-stranded RNA molecule a specific knockout phenotype can be obtained in a target cell, e.g. in cell culture or in a target organism. Surprisingly it was found that the presence of short double-stranded RNA molecules does not result in an interferon response from the host cell or host organism. [0034]
  • Thus, a further subject matter of the invention is a eukaryotic cell or a eukaryotic non-human organism exhibiting a target gene-specific knockout phenotype comprising an at least partially deficient expression of at least one endogeneous target gene wherein said cell or organism is transfected with at least one double-stranded RNA molecule capable of inhibiting the expression of at least one endogeneous target gene or with a DNA encoding at least one double stranded RNA molecule capable of inhibiting the expression of at least one endogeneous target gene. It should be noted that the present invention allows a target-specific knockout of several different endogeneous genes due to the specificity of RNAi. [0035]
  • Gene-specific knockout phenotypes of cells or non-human organisms, particularly of human cells or non-human mammals may be used in analytic procedures, e.g. in the functional and/or phenotypical analysis of complex physiological processes such as analysis of gene expression profiles and/or proteomes. For example, one may prepare the knock-out phenotypes of human genes in cultured cells which are assumed to be regulators of alternative splicing processes. Among these genes are particularly the members of the SR splicing factor family, e.g. ASF/SF2, SC35, SRp20, SRp40 or SRp55. Further, the effect of SR proteins on the mRNA profiles of predetermined alternatively spliced genes such as CD44 may be analysed. Preferably the analysis is carried out by high-throughput methods using oligonucleotide based chips. [0036]
  • Using RNAi based knockout technologies, the expression of an endogeneous target gene may be inhibited in a target cell or a target organism. [0037]
  • The endogeneous gene may be complemented by an exogeneous target nucleic acid coding for the target protein or a variant or mutated form of the target protein, e.g. a gene or a cDNA, which may optionally be fused to a further nucleic acid sequence encoding a detectable peptide or polypeptide, e.g. an affinity tag, particularly a multiple affinity tag. Variants or mutated forms of the target gene differ from the endogeneous target gene in that they encode a gene product which differs from the endogeneous gene product on the amino acid level by substitutions, insertions and/or deletions of single or multiple amino acids. The variants or mutated forms may have the same biological activity as the endogeneous target gene. On the other hand, the variant or mutated target gene may also have a biological activity, which differs from the biological activity of the endogeneous target gene, e.g. a partially deleted activity, a completely deleted activity, an enhanced activity etc. [0038]
  • The complementation may be accomplished by coexpressing the polypeptide encoded by the exogeneous nucleic acid, e.g. a fusion protein comprising the target protein and the affinity tag and the double stranded RNA molecule for knocking out the endogeneous gene in the target cell. This coexpression may be accomplished by using a suitable expression vector expressing both the polypeptide encoded by the exogeneous nucleic acid, e.g. the tag-modified target protein and the double stranded RNA molecule or alternatively by using a combination of expression vectors. Proteins and protein complexes which are synthesized de novo in the target cell will contain the exogeneous gene product, e.g. the modified fusion protein. In order to avoid suppression of the exogeneous gene product expression by the RNAi duplex molecule, the nucleotide sequence encoding the exogeneous nucleic acid may be altered on the DNA level (with or without causing mutations on the amino acid level) in the part of the sequence which is homologous to the double stranded RNA molecule. Alternatively, the endogeneous target gene may be complemented by corresponding nucleotide sequences from other species, e.g. from mouse. [0039]
  • Preferred applications for the cell or organism of the invention is the analysis of gene expression profiles and/or proteomes. In an especially preferred embodiment an analysis of a variant or mutant form of one or several target proteins is carried out, wherein said variant or mutant forms are reintroduced into the cell or organism by an exogeneous target nucleic acid as described above. The combination of knockout of an endogeneous gene and rescue by using mutated, e.g. partially deleted exogeneous target has advantages compared to the use of a knockout cell. Further, this method is particularly suitable for identifying functional domains of the target protein. In a further preferred embodiment a comparison, e.g. of gene expression profiles and/or proteomes and/or phenotypic characteristics of at least two cells or organisms is carried out. These organisms are selected from: [0040]
  • (i) a control cell or control organism without target gene inhibition, [0041]
  • (ii) a cell or organism with target gene inhibition and [0042]
  • (iii) a cell or organism with target gene inhibition plus target gene complementation by an exogeneous target nucleic acid. [0043]
  • The method and cell of the invention are also suitable in a procedure for identifying and/or characterizing pharmacological agents, e.g. identifying new pharmacological agents from a collection of test substances and/or characterizing mechanisms of action and/or side effects of known pharmacological agents. [0044]
  • Thus, the present invention also relates to a system for identifying and/or characterizing pharmacological agents acting on at least one target protein comprising: [0045]
  • (a) a eukaryotic cell or a eukaryotic non-human organism capable of expressing at least one endogeneous target gene coding for said target protein, [0046]
  • (b) at least one double-stranded RNA molecule capable of inhibiting the expression of said at least one endogeneous target gene, and [0047]
  • (c) a test substance or a collection of test substances wherein pharmacological properties of said test substance or said collection are to be identified and/or characterized. [0048]
  • Further, the system as described above preferably comprises: [0049]
  • (d) at least one exogeneous target nucleic acid coding for the target protein or a variant or mutated form of the target protein wherein said exogeneous target nucleic acid differs from the endogeneous target gene on the nucleic acid level such that the expression of the exogeneous target nucleic acid is substantially less inhibited by the double stranded RNA molecule than the expression of the endogeneous target gene. [0050]
  • Furthermore, the RNA knockout complementation method may be used for preparative purposes, e.g. for the affinity purification of proteins or protein complexes from eukaryotic cells, particularly mammalian cells and more particularly human cells. In this embodiment of the invention, the exogeneous target nucleic acid preferably codes for a target protein which is fused to an affinity tag. [0051]
  • The preparative method may be employed for the purification of high molecular weight protein complexes which preferably have a mass of ≧150 kD and more preferably of ≧500 kD and which optionally may contain nucleic acids such as RNA. Specific examples are the heterotrimeric protein complex consisting of the 20 kD, 60 kD and 90 kD proteins of the U4/U6 snRNP particle, the splicing factor SF3b from the 17S U2 snRNP consisting of 5 proteins having molecular weights of 14, 49, 1 20, 145 and 155 kD and the 25S U41U6/U5 tri-snRNP particle containing the U4, U5 and U6 snRNA molecules and about 30 proteins, which has a molecular weight of about 1.7 MD. [0052]
  • This method is suitable for functional proteome analysis in mammalian cells, particularly human cells. [0053]
  • Further, the present invention is explained in more detail in the following figures and examples.[0054]
  • FIG. 1: Double-stranded RNA as short as 38 bp can mediate RNAi. [0055]
  • (A) Graphic representation of dsRNAs used for targeting Pp-luc mRNA. Three series of blunt-ended dsRNAs covering a range of 29 to 504 bp were prepared. The position of the first nucleotide of the sense strand of the dsRNA is indicated relative to the start codon of Pp-luc mRNA (p1). (B) RNA interference assay (Tuschl et al., 1999). Ratios of target Pp-luc to control Rr-luc activity were normalized to a buffer control (black bar). DsRNAs (5 nM) were preincubated in [0056] Drosophila lysate for 15 min at 25° C. prior to the addition of 7-methyl-guanosine-capped Pp-luc and Rr-luc mRNAs (˜50 pM). The incubation was continued for another hour and then analyzed by the dual luciferase assay (Promega). The data are the average from at least four independent experiments ± standard deviation.
  • FIG. 2: A 29 bp dsRNA is no longer processed to 21-23 nt fragments. [0057]
  • Time course of 21-23 mer formation from processing of internally [0058] 32p-labeled dsRNAs (5 nM) in the Drosophila lysate. The length and source of the dsRNA are indicated. An RNA size marker (M) has been loaded in the left lane and the fragment sizes are indicated. Double bands at time zero are due to incompletely denatured dsRNA.
  • FIG. 3: Short dsRNAs cleave the mRNA target only once. [0059]
  • (A) Denaturing gel electrophoreses of the stable 5′ cleavage products produced by 1 h incubation of 10 nM sense or antisense RNA [0060] 32P-labeled at the cap with 10 nM dsRNAs of the p133 series in Drosophila lysate. Length markers were generated by partial nuclease T1 digestion and partial alkaline hydrolysis (OH) of the cap-labeled target RNA. The regions targeted by the dsRNAs are indicated as black bars on both sides. The 20-23 nt spacing between the predominant cleavage sites for the 111 bp long dsRNA is shown. The horizontal arrow indicates unspecific cleavage not due to RNAi. (B) Position of the cleavage sites on sense and antisense target RNAs. The sequences of the capped 177 nt sense and 180 nt antisense target RNAs are represented in antiparallel orientation such that complementary sequence are opposing each other. The region targeted by the different dsRNAs are indicated by differently colored bars positioned between sense and antisense target sequences. Cleavage sites are indicated by circles: large circle for strong cleavage, small circle for weak cleavage. The 32P-radiolabeled phosphate group is marked by an asterisk.
  • FIG. 4: 21 and 22 nt RNA fragments are generated by an RNase III-like mechanism. [0061]
  • (A) Sequences of ˜21 nt RNAs after dsRNA processing. The ˜21 nt RNA fragments generated by dsRNA processing were directionally cloned and sequenced. Oligoribonucleotides originating from the sense strand of the dsRNA are indicated as blue lines, those originating from the antisense strand as red lines. Thick bars are used if the same sequence was present in multiple clones, the number at the right indicating the frequency. The target-RNA cleavage sites mediated by the dsRNA are indicated as orange circles, large circle for strong cleavage, small circle for weak cleavage (see FIG. 3B). Circles on top of the sense strand indicated cleavage sites within the sense target and circles at the bottom of the dsRNA indicate cleavage site in the antisense target. Up to five additional nucleotides were identified in ˜21 nt fragments derived from the 3′ ends of the dsRNA. These nucleotides are random combinations of predominantly C, G, or A residues and were most likely added in an untemplated fashion during T7 transcription of the dsRNA-constituting strands. (B) Two-dimensional TLC analysis of the nucleotide composition of ˜21 nt RNAs. The ˜21 nt RNAs were generated by incubation of internally radiolabeled 504 bp Pp-luc dsRNA in [0062] Drosophila lysate, gel-purified, and then digested to mononucleotides with nuclease P1 (top row) or ribonuclease T2 (bottom row). The dsRNA was internally radiolabeled by transcription in the presence of one of the indicated α-32P nucleoside triphosphates. Radioactivity was detected by phosphorimaging. Nucleoside 5′-monophosphates, nucleoside 3′-mono-phosphates, nucleoside 5′,3′-diphosphates, and inorganic phosphate are indicated as pN, Np, pNp, and pi, respectively. Black circles indicate UV-absorbing spots from non-radioactive carrier nucleotides. The 3′,5′-bis-phosphates (red circles) were identified by co-migration with radiolabeled standards prepared by 5′-phosphorylation of nucleoside 3′-mono-phosphates with T4 polynucleotide kinase and γ-32P-ATP.
  • FIG. 5: Synthetic 21 and 22 nt RNAs Mediate Target RNA Cleavage. [0063]
  • (A) Graphic representation of control 52 bp dsRNA and synthetic 21 and 22 nt dsRNAs. The sense strand of 21 and 22 nt short interfering RNAs (siRNAs) is shown blue, the antisense strand in red. The sequences of the siRNAs were derived from the cloned fragments of 52 and 111 bp dsRNAs (FIG. 4A), except for the 22 nt antisense strand of duplex 5. The siRNAs in duplex 6 and 7 were unique to the 111 bp dsRNA processing reaction. The two 3′ overhanging nucleotides indicated in green are present in the sequence of the synthetic antisense strand of duplexes 1 and 3. Both strands of the control 52 bp dsRNA were prepared by in vitro transcription and a fraction of transcripts may contain untemplated 3′ nucleotide addition. The target RNA cleavage sites directed by the siRNA duplexes are indicated as orange circles (see legend to FIG. 4A) and were determined as shown in FIG. 5B. (B) Position of the cleavage sites on sense and antisense target RNAs. The target RNA sequences are as described in FIG. 3B. Control 52 bp dsRNA (10 nM) or 21 and 22 nt RNA duplexes 1-7 (100 nM) were incubated with target RNA for 2.5 h at 25° C. in [0064] Drosophila lysate. The stable 5′ cleavage products were resolved on the gel. The cleavage sites are indicated in FIG. 5A. The region targeted by the 52 bp dsRNA or the sense (s) or antisense (as) strands are indicated by the black bars to the side of the gel. The cleavage sites are all located within the region of identity of the dsRNAs. For precise determination of the cleavage sites of the antisense strand, a lower percentage gel was used.
  • FIG. 6: Long 3′ overhangs on short dsRNAs inhibit RNAi. [0065]
  • (A) Graphic representation of 52 bp dsRNA constructs. The 3′ extensions of sense and antisense strand are indicated in blue and red, respectively. The observed cleavage sites on the target RNAs are represented as orange circles analogous to FIG. 4A and were determined as shown in FIG. 6B. (B) Position of the cleavage sites on sense and antisense target RNAs. The-target RNA sequences are as described in FIG. 3B. DsRNA (10 nM) was incubated with target RNA for 2.5 h at 25° C. in [0066] Drosophila lysate. The stable 5′ cleavage products were resolved on the gel. The major cleavage sites are indicated with a-horizontal arrow and also represented in FIG. 6A. The region targeted by the 52 bp dsRNA is represented as black bar at both sides of the gel.
  • FIG. 7: Proposed Model for RNAi. [0067]
  • RNAi is predicted to begin with processing of dsRNA (sense strand in black, antisense strand in red) to predominantly 21 and 22 nt short interfering RNAs (siRNAs). Short overhanging 3′ nucleotides, if present on the dsRNA, may be beneficial for processing of short dsRNAs. The dsRNA-processing proteins, which remain to be characterized, are represented as green and blue ovals, and assembled on the dsRNA in asymmetric fashion. In our model, this is illustrated by binding of a hypothetical blue protein or protein domain with the siRNA strand in 3′ to 5′ direction while the hypothetical green protein or protein domain is always bound to the opposing siRNA strand. These proteins or a subset remain associated with the siRNA duplex and preserve its orientation as determined by the direction of the dsRNA processing reaction. Only the siRNA sequence associated with the blue protein is able to guide target RNA cleavage. The endonuclease complex is referred to as small interfering ribonucleoprotein complex or siRNP. It is presumed here, that the endonuclease that cleaves the dsRNA may also cleave the target RNA, probably by temporarily displacing the passive siRNA strand not used for target recognition. The target RNA is then cleaved in the center of the region recognized by the sequence-complementary guide siRNA. [0068]
  • FIG. 8: Reporter constructs and siRNA duplexes. [0069]
  • (a) The firefly. (Pp-luc) and sea pansy (Rr-luc) luciferase reporter gene regions from plasmids pGL2-Control, pGL-3-Control and pRL-TK (Promega) are illustrated. SV40 regulatory elements, the HSV thymidine kinase promoter and two introns (lines) are indicated. The sequence of GL3 luciferase is 95% identical to GL2, but RL. is completely unrelated to both. Luciferase expression from pGL2 is approx. 10-fold lower than from pGL3 in transfected mammalian cells. The region targeted by the siRNA duplexes is indicated as black bar below the coding region of the luciferase genes. (b) The sense (top) and antisense (bottom) sequences of the siRNA duplexes targeting GL2, GL3 and RL luciferase are shown. The GL2 and GL3 siRNA duplexes differ by only 3 single nucleotide substitutions (boxed in gray). As unspecific control, a duplex with the inverted GL2 sequence, invGL2, was synthesized. The 2 nt 3′ overhang of 2′-deoxythymidine is indicated as TT; uGL2 is similar to GL2 siRNA but contains ribo-uridine 3′ overhangs. [0070]
  • FIG. 9: RNA interference by siRNA duplexes. [0071]
  • Ratios of target control luciferase were normalized to a buffer control (bu, black bars); gray bars indicate ratios of [0072] Photinus pyralis (Pp-luc) GL2 or GL3 luciferase to Renilla reniformis (Rr-luc) RL luciferase (left axis), white bars indicate RL to GL2 or GL3 ratios (right axis). Panels a, c, e, g and i describe experiments performed with the combination of pGL2-Control and pRL-TK reporter plasmids, panels b, d, f, h and j with pGL3-Control and pRL-TK reporter plasmids. The cell line used for the interference experiment is indicated at the top of each plot. The ratios of Pp-luc/Rr-luc for the buffer control (bu) varied between 0.5 and 10 for pGL2/pRL and between 0.03 and 1 for pGL3/pRL, respectively, before normalization and between the various cell lines tested. The plotted data were averaged from three independent experiments ±S.D.
  • FIG. 10: Effects of 21 nt siRNA, 50 bp and 500 bp dsRNAs on luciferase expression in HeLa cells. [0073]
  • The exact length of the long dsRNAs is indicated below the bars. Panels a, c and e describe experiments performed with pGL2-Control and pRL-TK reporter plasmids, panels b, d and f with pGL3-Control and pRL-TK reporter plasmids. The data were averaged from two independent experiments ±S.D. (a), (b) Absolute Pp-luc expression, plotted in arbitrary luminescence units. (c), (d) Rr-luc expression, plotted in arbitrary luminescence units. (e), (f) Ratios of normalized target to control luciferase. The ratios of luciferase activity for siRNA duplexes were normalized to a buffer control (bu, black bars); the luminescence ratios for 50 or 500 bp dsRNAs were normalized to the respective ratios observed for 50 and 500 bp dsRNA from humanized GFP (hG, black bars). It should be noted that the overall differences in sequences between the 49 and 484 bp dsRNAs targeting GL2 and GL3 are not sufficient to confer specificity between GL2 and GL3 targets (43 nt uninterrupted identity in 49 bp segment, 239 nt longest uninterrupted identity in 484 bp segment). [0074]
  • FIG. 11: Variation of the 3′ overhang of duplexes of 21-nt siRNAs. [0075]
  • (A) Outline of the experimental strategy. The capped and polyadenylated sense target mRNA is depicted and the relative positions of sense and antisense siRNAs are shown. Eight series of duplexes, according to the eight different antisense strands were prepared. The siRNA sequences and the number of overhanging nucleotides were changed in 1-nt steps. (B) Normalized relative luminescence of target luciferase ([0076] Photinus pyralis, Pp-luc) to control luciferase (Renilla reniformis, Rr-luc) in D. melanogaster embryo lysate in the presence of 5 nM blunt-ended dsRNAs. The luminescence ratios determined in the presence of dsRNA were normalized to the ratio obtained for a buffer control (bu, black bar). Normalized ratios less than 1 indicate specific interference. (C-J) Normalized interference ratios for eight series of 21-nt siRNA duplexes. The sequences of siRNA duplexes are depicted above the bar graphs. Each panel shows the interference ratio for a set of duplexes formed with a given antisense guide siRNA and 5 different sense siRNAs. The number of overhanging nucleotides (3′ overhang, positive numbers; 5′ overhangs, negative numbers) is indicated on the x-axis. Data points were averaged from at least 3 independent experiments, error bars represent standard deviations.
  • FIG. 12: Variation of the length of the sense strand of siRNA duplexes. [0077]
  • (A) Graphic representation of the experiment. Three 21-nt antisense strands were paired with eight sense siRNAs. The siRNAs were changed in length at their 3′ end. The 3′ overhang of the antisense siRNA was 1-nt (B), 2-nt (C), or 3-nt (D) while the sense siRNA overhang was varied for each series. The sequences of the siRNA duplexes and the corresponding interference ratios are indicated. [0078]
  • FIG. 13: Variation of the length of siRNA duplexes with preserved 2-nt 3′ overhangs. [0079]
  • (A) Graphic representation of the experiment. The 21-nt siRNA duplex is identical in sequence to the one shown in FIG. 11H or [0080] 12C. The siRNA duplexes were extended to the 3′ side of the sense siRNA (B) or the 5′ side of the sense siRNA (C). The siRNA duplex sequences and the respective interference ratios are indicated.
  • FIG. 14: Substitution of the 2′-hydroxyl groups of the siRNA ribose residues. [0081]
  • The 2′-hydroxyl groups (OH) in the strands of siRNA duplexes were replaced by 2′-deoxy (d) or 2′-O-methyl (Me). 2-nt and 4-nt 2′-deoxy substitutions at the 3′-ends are indicated as 2-nt d and 4-nt d, respectively. Uridine residues were replaced by 2′-deoxy thymidine. [0082]
  • FIG. 15: Mapping of sense and antisense target RNA cleavage by 21-nt siRNA duplexes with 2-nt 3′ overhangs. [0083]
  • (A) Graphic representation of 32P (asterisk) cap-labelled sense and antisense target RNAs and siRNA duplexes. The position of sense and antisense target RNA cleavage is indicated by triangles on top and below the siRNA duplexes, respectively. (B) Mapping of target RNA cleavage sites. After 2 h incubation of 10 nM target with 100 nM siRNA duplex in [0084] D. melanogaster embryo lysate, the 5′ cap-labelled substrate and the 5′ cleavage products were resolved on sequencing gels. Length markers were generated by partial RNase T1 digestion (T1) and partial alkaline hydrolysis (OH—) of the target RNAs. The bold lines to the left of the images indicate the region covered by the siRNA strands 1 and 5 of the same orientation as the target.
  • FIG. 16: The 5′ end of a guide siRNA defines the position of target RNA cleavage. [0085]
  • (A, B) Graphic representation of the experimental strategy. The antisense siRNA was the same in all siRNA duplexes, but the sense strand was varied between 18 to 25 nt by changing the 3′ end (A) or 18 to 23 nt by changing the 5′ end (B). The position of sense and antisense target RNA cleavage is indicated by triangles on top and below the siRNA duplexes, respectively. (C, D) Analysis of target RNA cleavage using cap-labelled sense (top panel) or antisense (bottom panel) target RNAs. Only the cap-labelled 5′ cleavage products are shown. The sequences of the siRNA duplexes are indicated, and the length of the sense siRNA strands is marked on top of the panel. The control lane marked with a dash in panel (C) shows target RNA incubated in absence of siRNAs. Markers were as described in FIG. 15. The arrows in (D), bottom panel, indicate the target RNA cleavage sites that differ by 1 nt. [0086]
  • FIG. 17: Sequence variation of the 3′ overhang of siRNA duplexes. The 2-nt 3′ overhang (NN, in gray) was changed in sequence and composition as indicated (T, 2′-deoxythymidine, dG, 2′-deoxyguanosine; asterisk, wild-type siRNA duplex). Normalized interference ratios were determined as described in FIG. 11. The wild-type sequence is the same as depicted in FIG. 14. [0087]
  • FIG. 18: Sequence specificity of target recognition. [0088]
  • The sequences of the mismatched siRNA duplexes are shown, modified sequence segments or single nucleotides are underlayed in gray. The reference duplex (ref) and the siRNA duplexes 1 to 7 contain 2′-deoxythymidine 2-nt overhangs. The silencing efficiency of the thymidine-modified reference duplex was comparable to the wild-type sequence (FIG. 17). Normnalized interference ratios were determined as described in FIG. 11. [0089]
  • FIG. 19: Variation of the length of siRNA duplexes with preserved 2-nt 3′ overhangs. [0090]
  • The siRNA duplexes were extended to the 3′ side of the sense siRNA (A) or the 5′ side of the sense siRNA (B). The siRNA duplex sequences and the respective interference ratios are indicated. For HeLa SS6 cells, siRNA duplexes (0.84 μg) targeting GL2 luciferase were transfected together with pGL2-Control and pRL-TK plasmids. For comparison, the in vitro RNAi activities of siRNA duplexes tested in [0091] D. melanogaster lysate are indicated.
  • RNA Interference Mediated by Small Synthetic RNAs [0092]
  • 1.1. Experimental Procedures [0093]
  • 1.1.1 In Vitro RNAi [0094]
  • In vitro RNAi and lysate preparations were performed as described previously (Tuschl et al., 1999; Zamore et al., 2000). It is critical to use freshly dissolved creatine kinase (Roche) for optimal ATP regeneration. The RNAi translation assays (FIG. 1) were performed with dsRNA concentrations of 5 nM and an-extended pre-incubation period of 15 min at 25° C. prior to the addition of in vitro transcribed, capped and polyadenylated Pp-luc and Rr-luc reporter mRNAs. The incubation was continued for 1 h and the relative amount of Pp-luc and Rr-luc protein was analyzed using the dual luciferase assay (Promega) and a Monolight 3010C luminometer (PharMingen). [0095]
  • 1.1.2 RNA Synthesis [0096]
  • Standard procedures were used for in vitro transcription of RNA from PCR templates carrying T7 or SP6 promoter sequences, see for example (Tuschl et al., 1998). Synthetic RNA was prepared using Expedite RNA phosphoramidites (Proligo). The 3′ adapter oligonucleotide was synthesized using dimethoxytrityl-1,4-benzenedimethanol-succinyl-aminopropyl-CPG. The oligoribonucleotides were deprotected in 3 ml of 32% ammonia/ethanol (3/1) for 4 h at 55° C. (Expedite RNA) or 16 h at 55° C. (3′ and 5′ adapter DNA/RNA chimeric oligonucleotides) and then desilylated and gel-purified as described previously (Tuschl et al., 1993). RNA transcripts for dsRNA preparation including long 3′ overhangs were generated from PCR templates that contained a T7 promoter in sense and an SP6 promoter in antisense direction. The transcription template for sense and antisense target RNA was PCR-amplified with GCG[0097] TAATACGACTCACTATAGAACAATTGCTTTTACAG (underlined, T7 promoter) as 5′ primer and ATTTAGGTGACACTATAGGCATAAAGAATTGAAGA (underlined, SP6 promoter) as 3′ primer and the linearized Pp-luc plasmid (pGEM-luc sequence) (Tuschl et al., 1999) as template; the T7-transcribed sense RNA was 177 nt long with the Pp-luc sequence between pos. 113-273 relative to the start codon and followed by 17 nt of the complement of the SP6 promoter sequence at the 3′ end. Transcripts for blunt-ended dsRNA formation were prepared by transcription from two different PCR products which only contained a single promoter sequence.
  • DsRNA annealing was carried out using a phenol/chloroform extraction. Equimolar concentration of sense and antisense RNA (50 nM to 10 μM, depending on the length and amount available) in 0.3 M NaOAc (pH 6) were incubated for 30 s at 90° C. and then extracted at room temperature with an equal volume of phenol/chloroform, and followed by a chloroform extraction to remove residual phenol. The resulting dsRNA was precipitated by addition of 2.5-3 volumes of ethanol. The pellet was dissolved in lysis buffer (100 mM KCl, 30 mM HEPES-KOH, pH 7.4, 2 mM Mg(OAc)[0098] 2) and the quality of the dsRNA was verified by standard agarose gel electrophoreses in 1×TAE-buffer. The 52 bp dsRNAs with the 17 nt and 20 nt 3′ overhangs (FIG. 6) were annealed by incubating for 1 min at 95 ° C., then rapidly cooled to 70° C. and followed by slow cooling to room temperature over a 3 h period (50 μl annealing reaction, 1 μM strand concentration, 300 mM NaCl, 10 mM Tris-HCl, pH 7.5). The dsRNAs were then phenol/chloroform extracted, ethanol-precipitated and dissolved in lysis buffer.
  • Transcription of internally [0099] 32P-radiolabeled RNA used for dsRNA preparation (FIGS. 2 and 4) was performed using 1 mM ATP, CTP, GTP, 0.1 or 0.2 mM UTP, and 0.2-0.3 μM-32P-UTP (3000 Ci/mmol), or the respective ratio for radiolabeled nucleoside triphosphates other than UTP. Labeling of the cap of the target RNAs was performed as described previously. The target RNAs were gel-purified after cap-labeling.
  • 1.1.3 Cleavage Site Mapping [0100]
  • Standard RNAi reactions were performed by pre-incubating 10 nM dsRNA for 15 min followed by addition of 10 nM cap-labeled target RNA. The reaction was stopped after a further 2 h (FIG. 2A) or 2.5 h incubation (FIGS. 5B and 6B) by proteinase K treatment (Tuschl et al., 1999). The samples were then analyzed on 8 or 10% sequencing gels. The 21 and 22 nt synthetic RNA duplexes were used at 100 nM final concentration (FIG. 5B). [0101]
  • 1.1.4 Cloning of ˜21 nt RNAs [0102]
  • The 21 nt RNAs were produced by incubation of radiolabeled dsRNA in [0103] Drosophila lysate in absence of target RNA (200 μl reaction, 1 h incubation, 50 nM dsP111, or 100 nM dsP52 or dsP39). The reaction mixture was subsequently treated with proteinase K (Tuschl et al., 1999) and the dsRNA-processing products were separated on a denaturing 15% polyacrylamide gel. A-band, including a size range of at least 18 to 24 nt, was excised, eluted into 0.3 M NaCl overnight at 4° C. and in siliconized tubes. The RNA was recovered by ethanol-precipitation and dephosphorylated (30 μl reaction, 30 min, 50° C., 10 U alkaline phosphatase, Roche). The reaction was stopped by phenol/chloroform extraction and the RNA was ethanol-precipitated. The 3′ adapter oligonucleotide (pUUUaaccgcatccttctcx: uppercase, RNA; lowercase, DNA; p, phosphate; x, 4-hydroxymethylbenzyl) was then ligated to the dephosphorylated ˜21 nt RNA (20 μl reaction, 30 min, 37° C., 5 μM 3′ adapter, 50 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 0.2 mM ATP, 0.1 mg/ml acetylated BSA, 15% DMSO, 25 U T4 RNA ligase, Amersham-Pharmacia) (Pan and Uhlenbeck, 1992). The ligation reaction was stopped by the addition of an equal volume of 8 M urea/50 mM EDTA stopmix and directly loaded on a 15% gel. Ligation yields were greater 50%. The ligation product was recovered from the gel and 5′-phosphorylated (20 μl reaction, 30 min, 37° C., 2 mM ATP, 5 U T4 polynucleotide kinase, NEB). The phosphorylation reaction was stopped by phenol/chloroform extraction and RNA was recovered by ethanol-precipitation. Next, the 5′ adapter (tactaatacgactcactAAA: uppercase, RNA; lowercase, DNA) was ligated to the phosphorylated ligation product as described above. The new ligation product was gel-purified and eluted from the gel slice in the presence of reverse transcription primer (GACTAGCTGGAATTCAAGGATGCGGTTAAA: bold, Eco RI site) used as carrier. Reverse transcription (15 μl reaction, 30 min, 42° C., 150 U Superscript 11 reverse transcriptase, Life Technologies) was followed by PCR using as 5′ primer CAGCCAACGGAATTCATACGACTCACTAAA (bold, Eco RI site) and the 3′ RT primer. The PCR product was purified by phenol/chloroform extraction and ethanol-precipitated. The PCR product was then digested with Eco RI (NEB) and concatamerized using T4 DNA ligase (high conc., NEB). Concatamers of a size range of 200 to 800 bp were separated on a low-melt agarose gel, recovered from the gel by a standard melting and phenol extraction procedure, and ethanol-precipitated. The unpaired ends were filled in by incubation with Taq polymerase under standard conditions for 1 5 min at 72° C. and the DNA product was directly ligated into the pCR2.1-TOPO vector using the TOPO TA cloning kit (Invitrogen). Colonies were screened using PCR and M13-20 and M13 Reverse sequencing primers. PCR products were directly submitted for custom sequencing (Sequence Laboratories Göttingen GmbH, Germany). On average, four to five 21 mer sequences were obtained per clone.
  • 1.1.5 2D-TLC Analysis [0104]
  • Nuclease P1 digestion of radiolabeled, gel-purified siRNAs and 2D-TLC was carried out as described (Zamore et al., 2000). Nuclease T2 digestion was performed in 10 μl reactions for 3 h at 50° C. in 10 mM ammonium acetate (pH 4.5) using 2 μg/μl carrier tRNA and 30 U ribonuclease T2 (Life Technologies). The migration of non-radioactive standards was determined by UV shadowing. The identity of nucleoside-3′,5′-disphosphates was confirmed by co-migration of the T2 digestion products with standards prepared by 5′-[0105] 32P-phosphorylation of commercial nucleoside 3′-monophosphates using γ-32P-ATP and T4 polynucleotide kinase (data not shown).
  • 1.2 Results and Discussion [0106]
  • 1.2.1 Length Requirements for Processing of dsRNA to 21 and 22 nt RNA Fragments [0107]
  • Lysate prepared from [0108] D. melanogaster syncytial embryos recapitulates RNAi in vitro providing a novel tool for biochemical analysis of the mechanism of RNAi (Tuschl et al., 1999; Zamore et al., 2000). In vitro and in vivo analysis of the length requirements of dsRNA for RNAi has revealed that short dsRNA (<1 50 bp) are less effective than longer dsRNAs in degrading target mRNA (Caplen et al., 2000; Hammond et al., 2000; Ngo et al., 1998); Tuschl et al., 1999). The reasons for reduction in mRNA degrading efficiency are not understood. We therefore examined the precise length requirement of dsRNA for target RNA degradation under optimized conditions in the Drosophila lysate (Zamore et al., 2000). Several series of dsRNAs were synthesized and directed against firefly luciferase (Pp-luc) reporter RNA. The specific suppression of target RNA expression was monitored by the dual luciferase assay (Tuschl et al., 1 999) (FIGS. 1A and 1B). We detected specific inhibition of target RNA expression for dsRNAs as short as 38 bp, but dsRNAs of 29 to 36 bp were not effective in this process. The effect was independent of the target position and the degree of inhibition of Pp-luc mRNA expression correlated with the length of the dsRNA, i.e. long dsRNAs were more effective than short dsRNAs.
  • It has been suggested that the 21-23 nt RNA fragments generated by processing of dsRNAs are the mediators of RNA interference and co-suppression (Hamilton and Baulcombe, 1999; Hammond et al., 2000; Zamore et al., 2000). We therefore analyzed the rate of 21-23 nt fragment formation for a subset of dsRNAs ranging in size between 501 to 29 bp. Formation of 21-23 nt fragments in [0109] Drosophila lysate (FIG. 2) was readily detectable for 39 to 501 bp long dsRNAs but was significantly delayed for the 29 bp dsRNA. This observation is consistent with a role of 21-23 nt fragments in guiding mRNA cleavage and provides an explanation for the lack of RNAi by 30 bp dsRNAs. The length dependence of 21-23 mer formation is likely to reflect a biologically relevant control mechanism to prevent the undesired activation of RNAi by short intramolecular base-paired structures of regular cellular RNAs.
  • 1.2.2 39 bp dsRNA Mediates Target RNA Cleavage at a Single Site [0110]
  • Addition of dsRNA and 5′-capped target RNA to the [0111] Drosophila lysate results in sequence-specific degradation of the target RNA (Tuschl et al., 1999). The target mRNA is only cleaved within the region of identity with the dsRNA and many of the target cleavage sites were separated by 21-23 nt (Zamore et al., 2000). Thus, the number of cleavage sites for a given dsRNA was expected to roughly correspond to the length of the dsRNA divided by 21. We mapped the target cleavage sites on a sense and an antisense target RNA which was 5′ radiolabeled at the cap (Zamore et al., 2000) (FIGS. 3A and 3B). Stable 5′ cleavage products were separated on a sequencing gel and the position of cleavage was determined by comparison with a partial RNase T1 and an alkaline hydrolysis ladder from the target RNA.
  • Consistent with the previous observation (Zamore et al., 2000), all target RNA cleavage sites were located within the region of identity to the dsRNA. The sense or the antisense traget was only cleaved once by 39 bp dsRNA. Each cleavage site was located 10 nt from the 5′ end of the region covered by the dsRNA (FIG. 3B). The 52 bp dsRNA, which shares the same 5′ end with the 39 bp dsRNA, produces the same cleavage site on the sense target, located 10 nt from the 5′ end of the region of identity with the dsRNA, in addition to two weaker cleavage sites 23 and 24 nt downstream of the first site. The antisense target was only cleaved once, again 10 nt from the 5′ end of the region covered by its respective dsRNA. Mapping of the cleavage sites for the 38 to 49 bp dsRNAs shown in FIG. 1 showed that the first and predominant cleavage site was always located 7 to 10 nt downstream of the region covered by the dsRNA (data not shown). This suggests that the point of target RNA cleavage is determined by the end of the dsRNA and could imply that processing to 21-23 mers starts from the ends of the duplex. [0112]
  • Cleavage sites on sense and antisense target for the longer 111 bp dsRNA were much more frequent than anticipated and most of them appear in clusters separated by 20 to 23 nt (FIGS. 3A and 3B). As for the shorter dsRNAs, the first cleavage site on the sense target is 10 nt from the 5′ end of the region spanned by the dsRNA, and the first cleavage site on the antisense target is located 9 nt from the 5′ end of region covered by the dsRNA. It is unclear what causes this disordered cleavage, but one possibility could be that longer dsRNAs may not only get processed from the ends but also internally, or there are some specificity determinants for dsRNA processing which we do not yet understand. Some irregularities to the 21-23 nt spacing were also previously noted (Zamore et al., 2000). To better understand the molecular basis of dsRNA processing and target RNA recognition, we decided to analyze the sequences of the 21-23 nt fragments generated by processing of 39, 52, and 111 bp dsRNAs in the [0113] Drosophila lysate.
  • 1.2.3 dsRNA is Processed to 21 and 22 nt RNAs by an RNase III-Like Mechanism [0114]
  • In order to characterize the 21-23 nt RNA fragments we examined the 5′ and 3′ termini of the RNA fragments. Periodate oxidation of gel-purified 21-23 nt RNAs followed by β-elimination indicated the presence of a terminal 2′ and 3′ hydroxyl groups. The 21-23 mers were also responsive to alkaline phosphatase treatment indicating the presence of a 5′ terminal phosphate group. The presence of 5′ phosphate and 3′ hydroxyl termini suggests that the dsRNA could be processed by an enzymatic activity similar to [0115] E. coli RNase III (for reviews, see (Dunn, 1982; Nicholson, 1999; Robertson, 1990; Robertson, 1982)).
  • Directional cloning of 21-23 nt RNA fragments was performed by ligation of a 3′ and 5′ adapter oligonucleotide to the purified 21-23 mers using T4 RNA ligase. The ligation products were reverse transcribed, PCR-amplified, concatamerized, cloned, and sequenced. Over 220 short RNAs were sequenced from dsRNA processing reactions of the 39, 52 and 111 bp dsRNAs (FIG. 4A). We found the following length distribution: 1% 18 nt, 5% 19 nt, 12% 20 nt, 45% 21 nt, 28% 22 nt, 6% 23 nt, and 2% 24 nt. Sequence analysis of the 5′ terminal nucleotide of the processed fragments indicated that oligonucleotides with a 5′ guanosine were underrepresented. This bias was most likely introduced by T4 RNA ligase which discriminates against 5′ phosphorylated guanosine as donor oligonucleotide; no significant sequence bias was seen at the 3′ end. Many of the ˜21 nt fragments derived from the 3′ ends of the sense or antisense strand of the duplexes include 3′ nucleotides that are derived from untemplated addition of nucleotides during RNA synthesis using T7 RNA polymerase. Interestingly, a significant number of endogenous [0116] Drosophila ˜21 nt RNAs were also cloned, some of them from LTR and non-LTR retrotransposons (data not shown). This is consistent with a possible role for RNAi in transposon silencing.
  • The ˜21 nt RNAs appear in clustered groups (FIG. 4A) which cover the entire dsRNA sequences. Apparently, the processing reaction cuts the dsRNA by leaving staggered 3′ ends, another characteristic of RNase III cleavage. For the 39 bp dsRNA, two clusters of ˜21 nt RNAs were found from each dsRNA-constituting strand including overhanging 3′ ends, yet only one cleavage site was detected on the sense and antisense target (FIGS. 3A and 3B). If the ˜21 nt fragments were present as single-stranded guide RNAs in a complex that mediates mRNA degradation, it could be assumed that at least two target cleavage sites exist, but this was not the case. This suggests that the ˜21 nt RNAs may be present in double-stranded form in the endonuclease complex but that only one of the strands can be used for target RNA recognition and cleavage. The use of only one of the ˜21 nt strands for target cleavage may simply be determined by the orientation in which the ˜21 nt duplex is bound to the nuclease complex. This orientation is defined by the direction in which the original dsRNA was processed. [0117]
  • The ˜21 mer clusters for the 52 bp and 111 bp dsRNA are less well defined when compared to the 39 bp dsRNA. The clusters are spread over regions of 25 to 30 nt most likely representing several distinct subpopulations of ˜21 nt duplexes and therefore guiding target cleavage at several nearby sites. These cleavage regions are still predominantly separated by 20 to. 23 nt intervals. The rules determining how regular dsRNA can be processed to ˜21 nt fragments are not yet understood, but it was previously observed that the approx. 21-23 nt spacing of cleavage sites could be altered by a run of uridines (Zamore et al., 2000). The specificity of dsRNA cleavage by [0118] E. coli RNase III appears to be mainly controlled by antideterminants, i.e. excluding some specific base-pairs at given positions relative to the cleavage site (Zhang and Nicholson, 1997).
  • To test whether sugar-, base- or cap-modification were present in processed ˜21 nt RNA fragments, we incubated radiolabeled 505 bp Pp-luc dsRNA in lysate for 1 h, isolated the ˜21 nt products, and digested it with P1 or T2 nuclease to mononucleotides. The nucleotide mixture was then analyzed by 2D thin-layer chromatography (FIG. 4B). None of the four natural ribonucleotides were modified as indicated by P1 or T2 digestion. We have previously analyzed adenosine to inosine conversion in the ˜21 nt fragments (after a 2 h incubation) and detected a small extent (<0.7%) deamination (Zamore et al., 2000); shorter incubation in lysate (1 h) reduced this inosine fraction to barely detectable levels. RNase T2, which cleaves 3′ of the phosphodiester linkage, produced nucleoside 3′-phosphate and nucleoside 3′,5′-diphosphate, thereby indicating the presence of a 5′-terminal monophosphate. All four nucleoside 3′,5′-diphosphates were detected and suggest that the internucleotidic linkage was cleaved with little or no sequence-specificity. In summary, the ˜21 nt fragments are unmodified and were generated from dsRNA such that 5′-monophosphates and 3′-hydroxyls were present at the 5′-end. [0119]
  • 1.2.4 Synthetic 21 and 22 nt RNAs Mediate Target RNA Cleavage [0120]
  • Analysis of the products of dsRNA processing indicated that the ˜21 nt fragments are generated by a reaction with all the characteristics of an RNase III cleavage reaction (Dunn, 1982; Nicholson, 1999; Robertson, 1990; Robertson, 1982). RNase III makes two staggered cuts in both strands of the dsRNA, leaving a 3′ overhang of about 2 nt. We chemically synthesized 21 and 22 nt RNAs, identical in sequence to some of the cloned ˜21 nt fragments, and tested them for their ability to mediate target RNA degradation (FIGS. 5A and 5B). The 21 and 22 nt RNA duplexes were incubated at 100 nM concentrations in the lysate, a 10-fold higher concentrations-than the 52 bp control dsRNA. Under these conditions, target RNA cleavage is readily detectable. Reducing the concentration of 21 and 22 nt duplexes from 100 to 10 nM does still cause target RNA cleavage. Increasing the duplex concentration from 100 nM to 1000 nM however does not further increase target cleavage, probably due to a limiting protein factor within the lysate. [0121]
  • In contrast to 29 or 30 bp dsRNAs that did not mediate RNAi, the 21 and 22 nt dsRNAs with overhanging 3′ ends of 2 to 4 nt mediated efficient degradation of target RNA (duplexes 1, 3, 4, 6, FIGS. 5A and 5B). Blunt-ended 21 or 22 nt dsRNAs (duplexes 2, 5, and 7, FIGS. 5A and 5B) were reduced in their ability to degrade the target and indicate that overhanging 3′ ends are critical for reconstitution of the RNA-protein nuclease complex. The single-stranded overhangs may be required for high affinity binding of the ˜21 nt duplex to the protein components. A 5′ terminal phosphate, although present after dsRNA processing, was not required to mediate target RNA cleavage and was absent from the short synthetic RNAs. [0122]
  • The synthetic 21 and 22 nt duplexes guided cleavage of sense as well as antisense targets within the region covered by the short duplex. This is an important result considering that a 39 bp dsRNA, which forms two pairs of clusters of ˜21 nt fragments (FIG. 2), cleaved sense or antisense target only once and not twice. We interpret this result by suggesting that only one of two strands present in the ˜21 nt duplex is able to guide target RNA cleavage and that the orientation of the ˜21 nt duplex in the nuclease complex is determined by the initial direction of dsRNA processing. The presentation of an already perfectly processed ˜21 nt duplex to the in vitro system however does allow formation of the active sequence-specific nuclease complex with two possible orientations of the symmetric RNA duplex. This results in cleavage of sense as well as antisense target within the region of identity with the 21 nt RNA duplex. [0123]
  • The target cleavage site is located 11 or 1 2 nt downstream of the first nucleotide that is complementary to the 21 or 22 nt guide sequence, i.e. the cleavage site is near center of the region covered by the 21 or 22 nt RNAs (FIGS. 4A and 4B). Displacing the sense strand of a 22 nt duplex by two nucleotides (compare duplexes 1 and 3 in FIG. 5A) displaced the cleavage site of only the antisense target by two nucleotides. Displacing both sense and antisense strand by two nucleotides shifted both cleavage sites by two nucleotides (compare duplexes 1 and 4). We predict that it will be possible to design a pair of 21 or 22 nt RNAs to cleave a target RNA at almost any given position. [0124]
  • The specificity of target RNA cleavage guided by 21 and 22 nt RNAs appears exquisite as no aberrant cleavage sites are detected (FIG. 5B). It should however be noted, that the nucleotides present in the 3′ overhang of the 21 and 22 nt RNA duplex may contribute less to substrate recognition than the nucleotides near the cleavage site. This is based on the observation that the 3′ most nucleotide in the 3′ overhang of the active duplexes 1 or 3 (FIG. 5A) is not complementary to the target. A detailed analysis of the specificity of RNAi can now be readily undertaken using synthetic 21 and 22 nt RNAs. [0125]
  • Based on the evidence that synthetic 21 and 22 nt RNAs with overhanging 3′ ends mediate RNA interference, we propose to name the ˜21 nt RNAs “short interfering RNAs” or siRNAs and the respective RNA-protein complex a “small interfering ribonucleoprotein particle” or siRNP. [0126]
  • 1.2.5 3′ Overhangs of 20 nt on Short dsRNAs Inhibit RNAi [0127]
  • We have shown that short blunt-ended dsRNAs appear to be processed from the ends of the dsRNA. During our study of the length dependence of dsRNA in RNAi, we have also analyzed dsRNAs with 17 to 20 nt overhanging 3′ ends and found to our surprise that they were less potent than blunt-ended dsRNAs. The inhibitory effect of long 3′ ends was particularly pronounced for dsRNAs up to 100 bp but was less dramatic for longer dsRNAs. The effect was not due to imperfect dsRNA formation based on native gel analysis (data not shown). We tested if the inhibitory effect of long overhanging 3′ ends could be used as a tool to direct dsRNA processing to only one of the two ends of a short RNA duplex. [0128]
  • We synthesized four combinations of the 52 bp model dsRNA, blunt-ended, 3′ extension on only the sense strand, 3′-extension on only the antisense strand, and double 3′ extension on both strands, and mapped the target RNA cleavage sites after incubation in lysate (FIGS. 6A and 6B). The first and predominant cleavage site of the sense target was lost when the 3′ end of the antisense strand of the duplex was extended, and vice versa, the strong cleavage site of the antisense target was lost when the 3′ end of sense strand of the duplex was extended. 3′ Extensions on both strands rendered the 52 bp dsRNA virtually inactive. One explanation for the dsRNA inactivation by ˜20 nt 3′ extensions could be the association of single-stranded RNA-binding proteins which could interfere with the association of one of the dsRNA-processing factors at this end. This result is also consistent with our model where only one of the strands of the siRNA duplex in the assembled siRNP is able to guide target RNA cleavage. The orientation of the strand that guides RNA cleavage is defined by the direction of the dsRNA processing reaction. It is likely that the presence of 3′ staggered ends may facilitate the assembly of the processing complex. A block at the 3′ end of the sense strand will only permit dsRNA processing from the opposing 3′ end of the antisense strand. This in turn generates siRNP complexes in which only the antisense strand of the siRNA duplex is able to guide sense target RNA cleavage. The same is true for the reciprocal situation. [0129]
  • The less pronounced inhibitory effect of long 3′ extensions in the case of longer dsRNAs (≧2500 bp, data not shown) suggests to us that long dsRNAs may also contain internal dsRNA-processing signals or may get processed cooperatively due to the association of multiple cleavage factors. [0130]
  • 1.2.6 A Model for dsRNA-Directed mRNA Cleavage [0131]
  • The new biochemical data update the model for how dsRNA targets mRNA for destruction (FIG. 7). Double-stranded RNA is first processed to short RNA duplexes of predominantly 21 and 22 nt in length and with staggered 3′ ends similar to an RNase III-like reaction (Dunn, 1982; Nicholson, 1999; Robertson, 1982). Based on the 21-23 nt length of the processed RNA fragments it has already been speculated that an RNase III-like activity may be involved in RNAi (Bass, 2000). This hypothesis is further supported by the presence of 5′ phosphates and 3′ hydroxyls at the termini of the siRNAs as observed in RNase III reaction products (Dunn, 1 982; Nicholson, 1 999). Bacterial RNase III and the eukaryotic homologs Rnt1p in [0132] S. cerevisiae and Pac1p in S. pombe have been shown to function in processing of ribosomal RNA as well as snRNA and snoRNAs (see for example Chanfreau et al., 2000).
  • Little is known about the biochemistry of RNase III homologs from plants, animals or human. Two families of RNase III enzymes have been identified predominantly by database-guided sequence analysis or cloning of cDNAs. The first RNase-III family is represented by the 1327 amino acid long [0133] D. melanogaster protein drosha (Acc. AF116572). The C-terminus is composed of two RNase III and one dsRNA-binding domain and the N-terminus is of unknown function. Close homologs are also found in C. elegans (Acc. AF160248) and human (Acc. AF18901 1) (Filippov et al., 2000; Wu et al., 2000). The drosha-like human RNase III was recently cloned and characterized (Wu et al., 2000). The gene is ubiquitously expressed in human tissues and cell lines, and the protein is localized in the nucleus and the nucleolus of the cell. Based on results inferred from antisense inhibition studies, a role of this protein for rRNA processing was suggested. The second class is represented by the C. elegans gene K12H4.8 (Acc. S44849) coding for a 1822 amino acid long protein. This protein has an N-terminal RNA helicase motif which is followed by 2 RNase III catalytic domains and a dsRNA-binding motif, similar to the drosha RNase III family. There are close homologs in S. pombe (Acc. Q09884), A. thaliana (Acc. AF187317), D. melanogaster (Acc. AE003740), and human (Acc. AB028449) (Filippov et al., 2000; Jacobsen et al., 1 999; Matsuda et al., 2000). Possibly the K12H4.8 RNase III/helicase is the likely candidate to be involved in RNAi.
  • Genetic screens in [0134] C. elegans identified rde-1 and rde-4 as essential for activation of RNAi without an effect on transposon mobilization or co-suppression (Dernburg et al., 2000; Grishok et al., 2000; Ketting and Plasterk, 2000; Tabara et al., 1999). This led to the hypothesis that these genes are important for dsRNA processing but are not involved in mRNA target degradation. The function of both genes is as yet unknown, the rde-1 gene product is a member of a family of proteins similar to the rabbit protein elF2C (Tabara et al., 1999), and the sequence of rde-4 has not yet been described. Future biochemical characterization of these proteins should reveal their molecular function.
  • Processing to the siRNA duplexes appears to start from the ends of both blunt-ended dsRNAs or dsRNAs with short (1-5 nt) 3′ overhangs, and proceeds in approximately 21-23 nt steps. Long (˜20 nt) 3′ staggered ends on short dsRNAs suppress RNAi, possibly through interaction with single-stranded RNA-binding proteins. The suppression of RNAi by single-stranded regions flanking short dsRNA and the lack of siRNA formation from short 30 bp dsRNAs may explain why structured regions frequently encountered in mRNAs do not lead to activation of RNAi. [0135]
  • Without wishing to be bound by theory, we presume that the dsRNA-processing proteins or a subset of these remain associated with the siRNA duplex after the processing reaction. The orientation of the siRNA duplex relative to these proteins determines which of the two complementary strands functions in guiding, target RNA degradation. Chemically synthesized siRNA duplexes guide cleavage of sense as well as antisense target RNA as they are able to associate with the protein components in either of the two possible orientation. [0136]
  • The remarkable finding that synthetic 21 and 22 nt siRNA duplexes can be used for efficient mRNA degradation provides new tools for sequence-specific regulation of gene expression in functional genomics as well as biomedical studies. The siRNAs may be effective in mammalian systems where long dsRNAs cannot be used due to the activation of the PKR response (Clemens, 1997). As such, the siRNA duplexes represent a new alternative to antisense or ribozyme therapeutics. [0137]
  • RNA Interference in Human Tissue Cultures [0138]
  • 2.1 Methods [0139]
  • 2.1.1 RNA Preparation [0140]
  • 21 nt RNAs were chemically synthesized using Expedite RNA phosphoramidites and thymidine phosphoramidite (Proligo, Germany). Synthetic oligonucleotides were deprotected and gel-purified (Example 1), followed by Sep-Pak C18 cartridge (Waters, Milford, Mass., USA) purification (Tuschl, 1993). The siRNA sequences targeting GL2 (Acc. X65324) and GL3 luciferase (Acc. U47296) corresponded to the coding regions 153-173 relative to the first nucleotide of the start codon, siRNAs targeting RL (Acc. AF025846) corresponded to region 119-129 after the start codon. Longer RNAs were transcribed with T7 RNA polymerase from PCR products, followed by gel and Sep-Pak purification. The 49 and 484 bp GL2 or GL3 dsRNAs corresponded to position 113-161 and 113-596, respectively, relative to the start of translation; the 50 and 501 bp RL dsRNAs corresponded to position 118-167 and 118-618, respectively. PCR templates for dsRNA synthesis targeting humanized GFP (hG) were amplified from pAD3 (Kehlenbach, 1998), whereby 50 and 501 bp hG dsRNA corresponded to position 118-167 and 118-618, respectively, to the start codon. [0141]
  • For annealing of siRNAs, 20 μM single strands were incubated in annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium acetate) for 1 min at 90° C. followed by 1 h at 37° C. The 37° C. incubation step was extended overnight for the 50 and 500 bp dsRNAs and these annealing reactions were performed at 8.4 μM and 0.84 μM strand concentrations, respectively. [0142]
  • 2.1.2 Cell Culture [0143]
  • S2 cells were propagated in Schneider's [0144] Drosophila medium (Life Technologies) supplemented with 10% FBS, 100 units/ml penicillin and 100 μg/ml streptomycin at 25° C. 293, NIH/3T3, HeLa S3, COS-7 cells were grown at 37° C. in Dulbecco's modified Eagle's medium supplemented with 10% FBS, 100 units/ml penicillin and 100 μg/ml streptomycin. Cells were regularly passaged to maintain exponential growth. 24 h before transfection at approx. 80% confluency, mammalian cells were trypsinized and diluted 1:5 with fresh medium without antibiotics (1-3×105 cells/ml) and transferred to 24-well plates (500 μl/well). S2 cells were not trypsinized before splitting. Transfection was carried out with Lipofectamine 2000 reagent (Life Technologies) as described by the manufacturer for adherent cell lines. Per well, 1.0 μg pGL2-Control (Promega) or pGL3-Control (Promega), 0.1 μg pRL-TK (Promega) and 0.28 μg siRNA duplex or dsRNA, formulated into liposomes, were applied; the final volume was 600 μl per well. Cells were incubated 20 h after transfection and appeared healthy thereafter. Luciferase expression was subsequently monitored with the Dual luciferase assay (Promega). Transfection efficiencies were determined by fluorescence microscopy for mammalian cell lines after co-transfection of 1.1 μg hGFP-encoding pAD3 and 0.28 μg invGL2 inGL2 siRNA and were 70-90%. Reporter plasmids were amplified in XL-1 Blue (Stratagene) and purified using the Qiagen EndoFree Maxi Plasmid Kit.
  • 2.2 Results and Discussion [0145]
  • To test whether siRNAs are also capable of mediating RNAi in tissue culture, we synthesized 21 nt siRNA duplexes with symmetric 2 nt 3′ overhangs directed against reporter genes coding for sea pansy ([0146] Renilla reniformis) and two sequence variants of firefly (Photinus pyralis, GL2 and GL3) luciferases (FIG. 8a, b). The siRNA duplexes were co-transfected with the reporter plasmid combinations pGL2/pRL or pGL3/pRL into D. melanogaster Schneider S2 cells or mammalian cells using cationic liposomes. Luciferase activities were determined 20 h after transfection. In all cell lines tested, we observed specific reduction of the expression of the reporter genes in the presence of cognate siRNA duplexes (FIG. 9a-j). Remarkably, the absolute luciferase expression levels were unaffected by non-cognate siRNAs, indicating the absence of harmful side effects by 21 nt RNA duplexes (e.g. FIG. 10a-d for HeLa cells). In D. melanogaster S2 cells (FIG. 9a, b), the specific inhibition of luciferases was complete. In mammalian cells, where the reporter genes were 50- to 100-fold stronger expressed, the specific suppression was less complete (FIG. 9c-j). GL2 expression was reduced 3- to 12-fold, GL3 expression 9- to 25-fold and RL expression 1- to 3-fold, in response to the cognate siRNAs. For 293 cells, targeting of RL luciferase by RL siRNAs was ineffective, although GL2 and GL3 targets responded specifically (FIG. 9i, j). The lack of reduction of RL expression in 293 cells may be due to its 5- to 20-fold higher expression compared to any other mammalian cell line tested and/or to limited accessibility of the target sequence due to RNA secondary structure or associated proteins. Nevertheless, specific targeting of GL2 and GL3 luciferase by the cognate siRNA duplexes indicated that RNAi is also functioning in 293 cells.
  • The 2 nt 3′ overhang in all siRNA duplexes, except for uGL2, was composed of (2′-deoxy)thymidine. Substituion of uridine by thymidine in the 3′ overhang was well tolerated in the [0147] D. melanogaster in vitro sytem and the sequence of the overhang was uncritical for target recognition. The thymidine overhang was chosen, because it is supposed to enhance nuclease resistance of siRNAs in the tissue culture medium and within transfected cells. Indeed, the thymidine-modified GL2 siRNA was slightly more potent than the unmodified uGL2 siRNA in all cell lines tested (FIG. 9a, c, e, g, i). It is conceivable that further modifications of the 3′ overhanging nucleotides may provide additional benefits to the delivery and stability of siRNA duplexes.
  • In co-transfection experiments, 25 nM siRNA duplexes with respect to the final volume of tissue culture medium were used (FIG. 9, 10). Increasing the siRNA concentration to 100 nM did not enhance the specific silencing effects, but started to affect transfection efficiencies due to competition for liposome encapsulation between plasmid DNA and siRNA (data not shown). Decreasing the siRNA concentration to 1.5 nM did not reduce the specific silencing effect (data not shown), even though the siRNAs were now only 2- to 20-fold more concentrated than the DNA plasmids. This indicates that siRNAs are extraordinarily powerful reagents for mediating gene silencing and that siRNAs are effective at concentrations that are several orders of magnitude below the concentrations applied in conventional antisense or ribozyme gene targeting experiments. [0148]
  • In order to monitor the effect of longer dsRNAs on mammalian cells, 50 and 500 bp dsRNAs cognate to the reporter genes were prepared. As non-specific control, dsRNAs from humanized GFP (hG) (Kehlenbach, 1998) was used. When dsRNAs were co-transfected, in identical amounts (not concentrations) to the siRNA duplexes, the reporter gene expression was strongly and unspecifically reduced. This effect is illustrated for HeLa cells as a representative example (FIG. 10[0149] a-d). The absolute luciferase activities were decreased unspecifically 10- to 20-fold by 50 bp dsRNA and 20- to 200-fold by 500 bp dsRNA co-transfection, respectively. Similar unspecific effects were observed for COS-7 and NIH/3T3 cells. For 293 cells, a 10- to 20-fold unspecific reduction was observed only for 500 bp dsRNAs. Unspecific reduction in reporter gene expression by dsRNA >30 bp was expected as part of the interferon response.
  • Surprisingly, despite the strong unspecific decrease in reporter gene expression, we reproducibly detected additional sequence-specific, dsRNA-mediated silencing. The specific silencing effects, however, were only apparent when the relative reporter gene activities were normalized to the hG dsRNA controls (FIG. 10[0150] e, f). A 2- to 10-fold specific reduction in response to cognate dsRNA was observed, also in the other three mammalian cell lines tested (data not shown). Specific silencing effects with dsRNAs (356-1662 bp) were previously reported in CHO-K1 cells, but the amounts of dsRNA required to detect a 2- to 4-fold specific reduction were about 20-fold higher than in our experiments (Ui-Tei, 2000). Also CHO-K1 cells appear to be deficient in the interferon response. In another report, 293, NIH/3T3 and BHK-21 cells were tested for RNAi using luciferase/lacZ reporter combinations and 829 bp specific lacZ or 717 bp unspecific GFP dsRNA (Caplen, 2000). The failure of detecting RNAi in this case may be due to the less sensitive luciferase/lacZ reporter assay and the length differences of target and control dsRNA. Taken together, our results indicate that RNAi is active in mammalian cells, but that the silencing effect is difficult to detect, if the interferon system is activated by dsRNA >30 bp.
  • In summary, we have demonstrated for the first time siRNA-mediated gene silencing in mammalian cells. The use of short siRNAs holds great promise for inactivation of gene function in human tissue culture and the development of gene-specific therapeutics. [0151]
  • Specific Inhibition of Gene Expression by RNA Interference [0152]
  • 3.1 Materials and Methods [0153]
  • 3.1.1 RNA Preparation and RNAi Assay [0154]
  • Chemical RNA synthesis, annealing, and luciferase-based RNAi assays were performed as described in Examples 1 or 2 or in previous publications (Tuschl et al., 1999; Zamore et al., 2000). All siRNA duplexes were directed against firefly luciferase, and the luciferase mRNA sequence was derived from pGEM-luc (GenBank acc. X65316) as described (Tuschl et al., 1999). The siRNA duplexes were incubated in [0155] D. melanogaster RNAi/translation reaction for 15 min prior to addition of mRNAs. Translation-based RNAi assays were performed at least in triplicates.
  • For mapping of sense target RNA cleavage, a 177-nt transcript was generated, corresponding to the firefly luciferase sequence between positions 113-273 relative to the start codon, followed by the 17-nt complement of the SP6 promoter sequence. For mapping of antisense target RNA cleavage, a 166-nt transcript was produced from a template, which was amplified from plasmid sequence by PCR using 5′ primer [0156] TAATACGACTCACTATAGAGCCCATATCGTTTCATA (T7 promoter underlined) and 3! primer AGAGGATGGAACCGCTGG. The target sequence corresponds to the complement of the firefly luciferase sequence between positions 50-215 relative to the start codon. Guanylyl transferase labelling was performed as previously described (Zamore et al., 2000). For mapping of target RNA cleavage, 100 nM siRNA duplex was incubated with 5 to 10 nM target RNA in D. melanogaster embryo lysate under standard conditions (Zamore et al., 2000) for 2 h at 25° C. The reaction was stopped by the addition of 8 volumes of proteinase K buffer (200 mM Tris-HCl pH 7.5, 25 mM EDTA, 300 mM NaCl, 2% w/v sodium dodecyl sulfate). Proteinase K (E.M. Merck, dissolved in water) was added to a final concentration of 0.6 mg/ml. The reactions were then incubated for 15 min at 65° C., extracted with phenol/chloroform/isoamyl alcohol (25:24:1) and precipitated with 3 volumes of ethanol. Samples were located on 6% sequencing gels. Length standards were generated by partial RNase T1 digestion and partial base hydrolysis of the cap-labelled sense or antisense target RNAs.
  • 3.2 Results [0157]
  • 3.2.1 Variation of the 3′ Overhang in Duplexes of 21-nt siRNAs [0158]
  • As described above, 2 or 3 unpaired nucleotides at the 3′ end of siRNA duplexes were more efficient in target RNA degradation than the respective blunt-ended duplexes. To perform a more comprehensive analysis of the function of the terminal nucleotides, we synthesized five 21-nt sense siRNAs, each displayed by one nucleotide relative to the target RNA, and eight 21-nt antisense siRNAs, each displaced by one nucleotide relative to the target (FIG. 11A). By combining sense and antisense siRNAs, eight series of siRNA duplexes with synthetic overhanging ends were generated covering a range of 7-nt 3′ overhang to 4-nt 5′ overhang. The interference of siRNA duplexes was measured using the dual luciferase assay system (Tuschl et al., 1999; Zamore et al., 2000). siRNA duplexes were directed against firefly luciferase mRNA, and sea pansy luciferase mRNA was used as internal control. The luminescence ratio of target to control luciferase activity was determined in the presence of siRNA duplex and was normalized to the ratio observed in the absence of dsRNA. For comparison, the interference ratios of long dsRNAs (39 to 504 pb) are shown in FIG. 11B. The interference ratios were determined at concentrations of 5 nM for long dsRNAs (FIG. 11A) and at 100 nM for siRNA duplexes (FIG. 11C-J). The 100 nM concentrations of siRNAs was chosen, because complete processing of 5 nM 504 bp dsRNA would result in 120 nM total siRNA duplexes. [0159]
  • The ability of 21-nt siRNA duplexes to mediate RNAi is dependent on the number of overhanging nucleotides or base pairs formed. Duplexes with four to six 3′ overhanging nucleotides were unable to mediate RNAi (FIG. 11C-F), as were duplexes with two or more 5′ overhanging nucleotides (FIG. 11G-J). The duplexes with 2-nt 3′ overhangs were most efficient in mediating RNA interference, though the efficiency of silencing was also sequence-dependent, and up to 12-fold differences were observed for different siRNA duplexes with 2-nt 3′ overhangs (compare FIG. 11D-H). Duplexes with blunted ends, 1-nt 5′ overhang or 1 - to 3-nt 3′ overhangs were sometimes functional. The small silencing effect observed for the siRNA duplex with 7-nt 3′ overhang (FIG. 11C) may be due to an antisense effect of the long 3′ overhang rather than due to RNAi. Comparison of the efficiency of RNAi between long dsRNAs (FIG. 11B) and the most effective 21-nt siRNA duplexes (FIG. 11E, G, H) indicates that a single siRNA duplex at 100 nM concentration can be as effective as 5 nM 504 bp dsRNA. [0160]
  • 3.2.2 Length Variation of the Sense siRNA Paired to an Invariant 21-nt Antisense siRNA [0161]
  • In order to investigate the effect of length of siRNA on RNAi, we prepared 3 series of siRNA duplexes, combining three 21-nt antisense strands with eight, 1 8- to 25-nt sense strands. The 3′ overhang of the antisense siRNA was fixed to 1, 2, or 3 nt in each siRNA duplex series, while the sense siRNA was varied at its 3′ end (FIG. 12A). Independent of the lenght of the sense siRNA, we found that duplexes with 2-nt 3′ overhang of anti-sense siRNA (FIG. 12C) were more active than those with 1- or 3-nt 3′ overhang (FIG. 12B, D). In the first series, with 1-nt 3′ overhang of antisense siRNA, duplexes with a 21- and 22-nt sense siRNAs, carrying a 1- and 2-nt 3′ overhang of sense siRNA, respectively, were most active. Duplexes with 19- to 25-nt sense siRNAs were also able to mediate RNA, but to a lesser extent. Similarly, in the second series, with 2-nt overhang of antisense siRNA, the 21-nt siRNA duplex with 2-nt 3′ overhang was most active, and any other combination with the 18- to 25-nt sense siRNAs was active to a significant degree. In the last series, with 3-nt anti-sense siRNA 3′ overhang, only the duplex with a 20-nt sense siRNA and the 2-nt sense 3′ overhang was able to reduce target RNA expression. Together, these results indicate that the length of the siRNA as well as the length of the 3′ overhang are important, and that duplexes of 21-nt siRNAs with 2-nt 3′ overhang are optimal for RNAi. [0162]
  • 3.2.3 Length Variation of siRNA Duplexes with a Constant 2-nt 3′ Overhang [0163]
  • We then examined the effect of simultaneously changing the length of both siRNA strands by maintaining symmetric 2-nt 3′ overhangs (FIG. 13A). Two series of siRNA duplexes were prepared including the 21-nt siRNA duplex of FIG. 11H as reference. The length of the duplexes was varied between 20 to 25 bp by extending the base-paired segment at the 3′ end of the sense siRNA (FIG. 13B) or at the 3′ end of the antisense siRNA (FIG. 13C). Duplexes of 20 to 23 bp caused specific repression of target luciferase activity, but the 21-nt siRNA duplex was at least 8-fold more efficient than any of the other duplexes. 24- and 25-nt siRNA duplexes did not result in any detectable interference. Sequence-specific effects were minor as variations on both ends of the duplex produced similar effects. [0164]
  • 3.2.4 2′-Deoxy and 2′-O-methyl-Modified siRNA Duplexes [0165]
  • To assess the importance of the siRNA ribose residues for RNAi, duplexes with 21-nt siRNAs and 2-nt 3′ overhangs with 2′-deoxy- or 2′-O-methyl-modified strands were examined (FIG. 14). Substitution of the 2-nt 3′ overhangs by 2′-deoxy nucleotides had no effect, and even the replacement of two additional riboncleotides adjacent to the overhangs in the paired region, produced significantly active siRNAs. Thus, 8 out of 42 nt of a siRNA duplex were replaced by DNA residues without loss of activity. Complete substitution of one or both siRNA strands by 2′-deoxy residues, however, abolished RNAi, as did substitution by 2′-O-methyl residues. [0166]
  • 3.2.5 Definition of Target RNA Cleavage Sites [0167]
  • Target RNA cleavage positions-were previously determined for 22-nt siRNA duplexes and for a 21-nt/22-nt duplex. It was found that the position of the target RNA cleavage was located in the centre of the region covered by the siRNA duplex, 11 or 12 nt downstream of the first nucleotide that was complementary to the 21- or 22-nt siRNA guide sequence. Five distinct 21-nt siRNA duplexes with 2-nt 3′ overhang (FIG. 1 [0168] 5A) were incubated with 5′ cap-labelled sense or antisense target RNA in D. melanogaster lysate (Tuschl et al., 1999; Zamore et al., 2000). The 5′ cleavage products were resolved on sequencing gels (FIG. 15B). The amount of sense target RNA cleaved correlates with the efficiency of siRNA duplexes determined in the translation-based assay, and siRNA duplexes 1, 2 and 4 (FIGS. 15B and 11H, G, E) cleave target RNA faster than duplexes 3 and 5 (FIGS. 15B and 11F, D). Notably, the sum of radioactivity of the 5′ cleavage product and the input target RNA were not constant over time, and the 5′ cleavage products did not accumulate. Presumably, the cleavage products, once released from the siRNA-endonuclease complex, are rapidly degraded due to the lack of either of the poly(A) tail of the 5′-cap.
  • The cleavage sites for both, sense and antisense target RNAs were located in the middle of the region spanned by the siRNA duplexes. The cleavage sites for each target produced by the 5 different duplexes varied by 1-nt according to the 1-nt displacement of the duplexes along the target sequences. The targets were cleaved precisely 11 nt downstream of the target position complementary to the 3′-most nucleotide of the sequence-complementary guide siRNA (FIG. 15A, B). [0169]
  • In order to determine, whether the 5′ or the 3′ end of the guide siRNA sets the ruler for target RNA cleavage, we devised the experimental strategy outlined in FIGS. 16A and B. A 21-nt antisense siRNA, which was kept invariant for this study, was paired with sense siRNAs that were modified at either of their 5′ or 3′ ends. The position of sense and antisense target RNA cleavage was determined as described above. Changes in the 3′ end of the sense siRNA, monitored for 1-nt 5′ overhang to 6-nt 3′ overhang, did neither effect the position of sense nor antisense target RNA cleavage (FIG. 16C). Changes in the 5′ end of the sense siRNA did no affect the sense target RNA cleavage (FIG. 16D, top panel), which was expected because the antisense siRNA was unchanged. However, the antisense target RNA cleavage was affected and strongly dependent on the 5′ end of the sense siRNA (FIG. 16D, bottom panel). The antisense target was only cleaved, when the sense siRNA was 20 or 21 nt in size, and the position of cleavage different by 1-nt, suggesting that the 5′ end of the target-recognizing siRNA sets the ruler for target RNA cleavage. The position is located between nucleotide 10 and 11 when counting in upstream direction from the target nucleotide paired to the 5′-most nucleotide of the guide siRNA (see also FIG. 15A). [0170]
  • 3.2.6 Sequence Effects and 2′-deoxy Substitutions in the 3′ Overhang [0171]
  • A 2-nt 3′ overhang is preferred for siRNA function. We wanted to know, if the sequence of the overhanging nucleotides contributes to target recognition, or if it is only a feature required for reconstitution of the endonuclease complex (RISC or siRNP). We synthesized sense and antisense siRNAs with AA, CC, GG, UU, and UG 3′ overhangs and included the 2′-deoxy modifications TdG and TT. The wild-type siRNAs contained AA in the sense 3′ overhang and UG in the antisense 3′ overhang (AA/UG). All siRNA duplexes were functional in the interference assay and reduced target expression at least 5-fold (FIG. 17). The most efficient siRNA duplexes that reduced target expression more than 10-fold, were of the sequence type NN/UG, NN/UU, NN/TdG, and NN/TT (N, any nucleotide). siRNA duplexes with an antisense siRNA 3′ overhang of AA, CC or GG were less active by a factor 2 to 4 when compared to the wild-type sequence UG or the mutant UU. This reduction in RNAi efficiency is likely due to the contribution of the penultimate 3′ nucleotide to sequence-specific target recognition, as the 3′ terminal nucleotide was changed from G to U without effect. [0172]
  • Changes in the sequence of the 3′ overhang of the sense siRNA did not reveal any sequence-dependent effects, which was expected, because the sense siRNA must not contribute to sense target mRNA recognition. [0173]
  • 3.2.7 Sequence Specifity of Target Recognition [0174]
  • In order to examine the sequence-specifity of target recognition, we introduced sequence changes into the paired segments of siRNA duplexes and determined the efficiency of silencing. Sequence changes were introduced by inverting short segments of 3- or 4-nt length or as point mutations (FIG. 18). The sequence changes in one siRNA strand were compensated in the complementary siRNA strand to avoid pertubing the base-paired siRNA duplex structure. The sequence of all 2-nt 3′ overhangs was TT (T, 2′-deoxythymidine) to reduce costs of synthesis. The TT/TT reference siRNA duplex was comparable in RNAi to the wild-type siRNA duplex AA/UG (FIG. 17). The ability to mediate reporter mRNA destruction was quantified using the translation-based luminescence assay. Duplexes of siRNAs with inverted sequence segments showed dramatically reduced ability for targeting the firefly luciferase reporter (FIG. 18). The sequence changes located between the 3′ end and the middle of the antisense siRNA completely abolished target RNA recognition, but mutations near the 5′ end of the antisense siRNA exhibit a small degree of silencing. Transversion of the A/U base pair located directly opposite of the predicted target RNA cleavage site, or one nucleotide further away from the predicted site, prevented target RNA cleavage, therefore indicating that single mutation within the centre of a siRNA duplex discriminate between mismatched targets. [0175]
  • 3.3 Discussion [0176]
  • siRNAs are valuable reagents for inactivation of gene expression, not only in insect cells, but also in mammalian cells, with a great potential for therapeutic application. We have systematically analysed the structural determinants of siRNA duplexes required to promote efficient target RNA degradation in [0177] D. melanogaster embryo lysate, thus providing rules for the design of most potent siRNA duplexes. A perfect siRNA duplex is able to silence gene expression with an efficiency comparable to a 500 bp dsRNA, given that comparable quantities of total RNA are used.
  • 3.4 The siRNA User Guide [0178]
  • Efficiently silencing siRNA duplexes are preferably composed of 21-nt antisense siRNAs, and should be selected to form a 19 bp double helix with 2-nt 3′ overhanging ends. 2′-deoxy substitutions of the 2-nt 3′ overhanging ribonucleotides do not affect RNAi, but help to reduce the costs of RNA synthesis and may enhance RNAse resistance of siRNA duplexes. More extensive 2′-deoxy or 2′-O-methyl modifications, however, reduce the ability of siRNAs to mediate RNAi, probably by interfering with protein association for siRNAP assembly. [0179]
  • Target recognition is a highly sequence-specific process, mediated by the siRNA complementary to the target. The 3′-most nucleotide of the guide siRNA does not contribute to specificity of target recognition, while the penultimate nucleotide of the 3′ overhang affects target RNA cleavage, and a mismatch reduces RNAi 2- to 4-fold. The 5′ end of a guide siRNA also appears more permissive for mismatched target RNA recognition when compared to the 3′ end. Nucleotides in the centre of the siRNA, located opposite the target RNA cleavage site, are important specificity determinants and even single nucleotide changes reduce RNAi to undetectable level. This suggests that siRNA duplexes may be able to discriminate mutant or polymorphic alleles in gene targeting experiments, which may become an important feature for future therapeutic developments. [0180]
  • Sense and antisense siRNAs, when associated with the protein components of the endonclease complex or its commitment complex, were suggested to play distinct roles; the relative orientation of the siRNA duplex in this complex defines which strand can be used for target recognition. Synthetic siRNA duplexes have dyad symmetry with respect to the double-helical structure, but not with respect to sequence. The association of siRNA duplexes with the RNAi proteins in the [0181] D. melanogaster lysate will lead to formation of two asymmetric complexes. In such hypothetical complexes, the chiral environment is distinct for sense and antisense siRNA, hence their function. The prediction obviously does not apply to palindromic siRNA sequences, or to RNAi proteins that could associate as homodimers. To minimize sequence effects, which may affect the ratio of sense and antisense-targeting siRNPs, we suggest to use siRNA sequences with identical 3′ overhanging sequences. We recommend to adjust the sequence of the overhang of the sense siRNA to that of the antisense 3′ overhang, because the sense siRNA does not have a target in typical knock-down experiments. Asymmetry in reconstitution of sense and antisense-cleaving siRNPs could be (partially) responsible for the variation in RNAi efficiency observed for various 21-nt siRNA duplexes with 2-nt 3′ overhangs used in this study (FIG. 14). Alternatively, the nucleotide sequence at the target site and/or the accessibility of the target RNA structure may be responsible for the variation in efficiency for these siRNA duplexes.
  • References [0182]
  • Bass, B. L. (2000). Double-stranded RNA as a template for gene silencing. Cell 101, 235-238. [0183]
  • Bosher, J. M., and Labouesse, M. (2000). RNA interference: genetic wand and genetic watchdog. Nat. Cell Biol. 2, E31-36. [0184]
  • Caplen, N. J., Fleenor, J., Fire, A., and Morgan, R. A. (2000). dsRNA-mediated gene silencing in cultured [0185] Drosophila cells: a tissue culture model for the analysis of RNA interference. Gene 252, 95-105.
  • Catalanotto, C., Azzalin, G., Macino, G., and Cogoni, C. (2000). Gene silencing in worms and fungi. Nature 404, 245. [0186]
  • Chanfreau, G., Buckle, M., and Jacquier, A. (2000). Recognition of a conserved class of RNA tetraloops by [0187] Saccharomyces cerevisiae RNase III. Proc. Natl. Acad. Sci. USA 97, 3142-3147.
  • Clemens, M. J. (1997). PKR—a protein kinase regulated by double-stranded RNA. Int. J. Biochem. Cell Biol. 29, 945-949. [0188]
  • Cogoni, C., and Macino, G. (1999). Homology-dependent gene silencing in plants and fungi: a number of variations on the same theme. Curr. Opin. Microbiol. 2, 657-662. [0189]
  • Dalmay, T., Hamilton, A., Rudd, S., Angell, S., and Baulcombe, D. C. (2000). An RNA-dependent RNA polymerase gene in [0190] Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell 101, 543-553.
  • Dernburg, A. F., Zalevsky, J., Colaiacovo, M. P., and Villeneuve, A. M. (2000). Transgene-mediated cosuppression in the [0191] C. elegans germ line. Genes & Dev. 14, 1578-1583.
  • Dunn, J. J. (1982). Ribonuclease III. In The enzymes, vol 15, part B, P. D. Boyer, ed. (New York: Academic Press), pp. 485-499. [0192]
  • Filippov, V., Solovyev, V., Filippova, M., and Gill, S. S. (2000). A novel type-of RNase III family proteins in eukaryotes. Gene 245, 213-221. [0193]
  • Fire, A. (1999). RNA-triggered gene silencing. Trends Genet. 15, 358-363. [0194]
  • Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811. [0195]
  • Grishok, A., Tabara, H., and Mello, C. C. (2000). Genetic requirements for inheritance of RNAi in [0196] C. elegans. Science 287, 2494-2497.
  • Hamilton, A. J., and Baulcombe, D. C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286, 950-952. [0197]
  • Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J. (2000). An RNA-directed nuclease mediates post-transcriptional gene silencing in [0198] Drosophila cells. Nature 404, 293-296.
  • Jacobsen, S. E., Running, M. P., and M., M. E. (1999). Disruption of an RNA helicase/RNase III gene in Arabidopsis causes unregulated cell division in floral meristems. Development 126, 5231-5243. [0199]
  • Jensen, S., Gassama, M. P., and Heidmann, T. (1999). Taming of transposable elements by homology-dependent gene silencing. Nat. Genet. 21, 209-212. [0200]
  • Kehlenbach, R. H., Dickmanns, A. & Gerace, L. (1998). Nucleocytoplasmic shuttling factors including Ran and CRM1 mediate nuclear export of NFAT In vitro. J. Cell Biol. 141, 863-874. [0201]
  • Kennerdell, J. R., and Carthew, R. W. (1998). Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 95, 1017-1026. [0202]
  • Ketting, R. F., Haverkamp, T. H., van Luenen, H. G., and Plasterk, R. H. (1999). Mut-7 of [0203] C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. Cell 99, 133-141.
  • Ketting, R. F., and Plasterk, R. H. (2000). A genetic link between co-suppression and RNA interference in [0204] C. elegans. Nature 404, 296-298.
  • Lucy, A. P., Guo, H. S., Li, W. X., and Ding, S. W. (2000). Suppression of post-transcriptional gene silencing by a plant viral protein localized in the nucleus. EMBO J. 19, 1672-1680. [0205]
  • Matsuda, S., Ichigotani, Y., Okuda, T., Irimura, T., Nakatsugawa, S., and Hamaguchi, M. (2000). Molecular cloning and characterization of a novel human gene (HERNA) which encodes a putative RNA-helicase. Biochim. Biophys. Acta 31, 1-2. [0206]
  • Milligan, J. F., and Uhlenbeck, O. C. (1989). Synthesis of small RNAs using T7 RNA polymerase. Methods Enzymol. 180, 51-62. [0207]
  • Mourrain, P., Beclin, C., Elmayan, T., Feuerbach, F., Godon, C., Morel, J. B., Jouette, D., Lacombe, A. M., Nikic, S., Picault, N., Remoue, K., Sanial, M., Vo, T. A., and Vaucheret, H. (2000). Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 101, 533-542. [0208]
  • Ngo, H., Tschudi, C., Gull, K., and Ullu, E. (1998). Double-stranded RNA induces mRNA degradation in Trypanosoma brucei. Proc. Natl. Acad. Sci. USA 95, 14687-14692. [0209]
  • Nicholson, A. W. (1999). Function, mechanism and regulation of bacterial ribonucleases. FEMS Microbiol. Rev. 23, 371-390. [0210]
  • Oelgeschlager, M., Larrain, J., Geissert, D., and De Robertis, E. M. (2000). The evolutionarily conserved BMP-binding protein Twisted gastrulation promotes BMP signalling. Nature 405, 757-763. [0211]
  • Pan, T., and Uhlenbeck, O. C. (1992). In vitro selection of RNAs that undergo autolytic cleavage with Pb[0212] 2+. Biochemistry 31, 3887-3895.
  • Pelissier, T., and Wassenegger, M. (2000). A DNA target of 30 bp is sufficient for RNA-directed methylation. RNA 6, 55-65. [0213]
  • Plasterk, R. H., and Ketting, R. F. (2000). The silence of the genes. Curr. Opin. Genet. Dev. 10, 562-567. [0214]
  • Ratcliff, F. G., MacFarlane, S. A., and Baulcombe, D. C. (1999). Gene Silencing without DNA. RNA-mediated cross-protection between viruses. Plant Cell 11, 1207-1216. [0215]
  • Robertson, H. D. (1990). [0216] Escherichia coli ribonuclease III. Methods Enzymol. 181, 189-202.
  • Robertson, H. D. (1982). [0217] Escherichia coli ribonuclease III cleavage sites. Cell 30, 669-672.
  • Romaniuk, E., McLaughlin, L. W., Neilson, T., and Romaniuk, P. J. (1982). The effect of acceptor oligoribonucleotide sequence on the T4 RNA ligase reaction. Eur J Biochem 125, 639-643. [0218]
  • Sharp, P. A. (1999). RNAi and double-strand RNA. Genes & Dev. 13, 139-141. [0219]
  • Sijen, T., and Kooter, J. M. (2000). Post-transcriptional gene-silencing: RNAs on the attack or on the defense? Bioessays 22, 520-531. [0220]
  • Smardon, A., Spoerke, J., Stacey, S., Klein, M., Mackin, N., and Maine, E. (2000). EGO-1 is related to RNA-directed RNA polymerase and functions in germ-line development and RNA interference in [0221] C. elegans. Curr. Biol. 10, 169-178.
  • Svoboda, P., Stein, P., Hayashi, H., and Schultz, R. M. (2000). Selective reduction of dormant-maternal mRNAs in mouse oocytes by RNA interference. Development 127, 4147-4156. [0222]
  • Tabara, H., Sarkissian, M., Kelly, W. G., Fleenor, J., Grishok, A., Timmons, L., Fire, A., and Mello, C. C. (1999). The rde-1 gene, RNA interference, and transposon silencing in [0223] C. elegans. Cell 99, 123-132.
  • Tuschl, T., Ng, M. M., Pieken, W., Benseler, F., and Eckstein, F. (1993). Importance of exocyclic base functional groups of central core guanosines for hammerhead ribozyme activity. Biochemistry 32, 11658-11668. [0224]
  • Tuschl, T., Sharp, P. A., and Bartel, D. P. (1998). Selection in vitro of novel ribozymes from a partially randomized U2 and U6 snRNA library. EMBO J. 17, 2637-2650. [0225]
  • Tuschl, T., Zamore, P. D., Lehmann, R., Bartel, D. P., and Sharp, P. A. (1999). Targeted mRNA degradation by double-stranded RNA in vitro. Genes & Dev. 13, 3191-3197. [0226]
  • Ui-Tei, K., Zenno, S., Miyata, Y. & Saigo, K. (2000). Sensitive assay of RNA interference in [0227] Drosophila and Chinese hamster cultured cells using firefly luciferase gene as target. FEBS Letters 479, 79-82.
  • Verma, S., and Eckstein, F. (1999). Modified oligonucleotides: Synthesis and strategy for users. Annu. Rev. Biochem. 67, 99-134. [0228]
  • Voinnet, O., Lederer, C., and Baulcombe, D. C. (2000). A viral movement protein prevents spread of the gene silencing signal in [0229] Nicotiana benthamiana. Cell 103, 157-167.
  • Wassenegger, M. (2000). RNA-directed DNA methylation. Plant Mol. Biol. 43, 203-220. [0230]
  • Wianny, F., and Zernicka-Goetz, M. (2000). Specific interference with gene function by double-stranded RNA in early mouse development. Nat. Cell Biol. 2, 70-75. [0231]
  • Wu, H., Xu, H., Miraglia, L. J., and Crooke, S. T. (2000). Human RNase III is a 160 kDa Protein Involved in Preribosomal RNA Processing. J. Biol. Chem. 17, 17. [0232]
  • Yang, D., Lu, H. and Erickson, J. W. (2000) Evidence that processed small dsRNAs may mediate sequence-specific mRNA degradation during RNAi in [0233] drosophilia embryos. Curr. Biol., 10, 1191-1200.
  • Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. (2000). RNAi: Double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101, 25-33. [0234]
  • Zhang, K., and Nicholson, A. W. (1997). Regulation of ribonuclease III processing by double-helical sequence antideterminants. Proc. Natl. Acad. Sci. USA 94, 13437-13441. [0235]
  • 1 96 1 38 DNA Artificial Sequence Description of Artificial Sequence 5′Primer 1 gcgtaatacg actcactata gaacaattgc ttttacag 38 2 35 DNA Artificial Sequence Description of Artificial Sequence3′Primer 2 atttaggtga cactataggc ataaagaatt gaaga 35 3 30 DNA Artificial Sequence Description of Artificial SequenceReverse transcription primer 3 gactagctgg aattcaagga tgcggttaaa 30 4 30 DNA Artificial Sequence Description of Artificial Sequence 5′Primer 4 cagccaacgg aattcatacg actcactaaa 30 5 36 DNA Artificial Sequence Description of Artificial Sequence 5′Primer 5 taatacgact cactatagag cccatatcgt ttcata 36 6 18 DNA Artificial Sequence Description of Artificial Sequence dsRNA, Figure 5A 6 agaggatgga accgctgg 18 7 177 RNA Drosophila 7 gaacaauugc uuuuacagau gcacauaucg aggugaacau cacguacgcg gaauacuucg 60 aaauguccgu ucgguuggca gaagcuauga aacgauaugg gcugaauaca aaucacagaa 120 ucgucguaug cagugaaaac ucucuucaau ucuuuaugcc uauaguguca ccuaaau 177 8 180 RNA Drosophila Description of Artificial Sequence siRNA duplex, antisense 8 ggcauaaaga auugaagaga guuuucacug cauacgacga uucugugauu uguauucagc 60 ccauaucguu ucauagcuuc ugccaaccga acggacauuu cgaaguauuc cgcguacgug 120 auguucaccu cgauaugugc aucuguaaaa gcaauuguuc uauagugagu cguauuacgc 180 9 39 RNA Drosophila 9 gcacauaucg aggugaacau cacguacgcg gaauacuuc 39 10 52 RNA Drosophila 10 gcacauaucg aggugaacau cacguacgcg gaauacuucg aaauguccgu uc 52 11 111 RNA Drosophila 11 gcacauaucg aggugaacau cacguacgcg gaauacuucg aaauguccgu ucgguuggca 60 gaagcuauga aacgauaugg gcugaauaca aaucacagaa ucgucguaug c 111 12 52 RNA Artificial Sequence Description of Artificial Sequence dsRNA, Figure 5A 12 gcacauaucg aggugaacau cacguacgcg gaauacuucg aaauguccgu uc 52 13 54 RNA Artificial Sequence Description of Artificial Sequence dsRNA, Figure 5A 13 gaacggacau uucgaaguau uccgcguacg ugauguucac cucgauaugu gcac 54 14 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 8b, uGL2 14 cguacgcgga auacuucgau u 21 15 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 8b, uGL2 15 ucgaaguauu ccgcguacgu u 21 16 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule siRNA duplex GL2 16 cguacgcgga auacuucgat t 21 17 21 DNA Artificial Sequence Description of Combined DNA/RNA MoleculesiRNA duplex GL2 17 ucgaaguauu ccgcguacgt t 21 18 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule siRNA duplex GL3 18 cuuacgcuga guacuucgat t 21 19 21 DNA Artificial Sequence Description of Combined DNA/RNA MoleculesiRNA duplex GL3 19 ucgaaguacu cagcguaagt t 21 20 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule siRNA duplex invGL2 20 agcuucauaa ggcgcaugct t 21 21 21 DNA Artificial Sequence Description of Combined DNA/RNA MoleculesiRNA duplex invGL2 21 gcaugcgccu uaugaagcut t 21 22 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule siRNA duplex RL 22 aaacaugcag aaaaugcugt t 21 23 21 DNA Artificial Sequence Description of Combined DNA/RNA MoleculesiRNA duplex RL 23 cagcauuuuc ugcauguuut t 21 24 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 24 aucacguacg cggaauacuu c 21 25 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 25 guauuccgcg uacgugaugu u 21 26 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 26 ucacguacgc ggaauacuuc g 21 27 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 27 cacguacgcg gaauacuucg a 21 28 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 28 acguacgcgg aauacuucga a 21 29 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 29 cguacgcgga auacuucgaa a 21 30 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 D 30 aguauuccgc guacgugaug u 21 31 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 E 31 aaguauuccg cguacgugau g 21 32 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 F 32 gaaguauucc gcguacguga u 21 33 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 G 33 cgaaguauuc cgcguacgug a 21 34 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 H 34 ucgaaguauu ccgcguacgu g 21 35 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 I 35 uucgaaguau uccgcguacg u 21 36 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 J 36 uuucgaagua uuccgcguac g 21 37 18 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 37 cguacgcgga auacuucg 18 38 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, antisense 38 uucgaaguau uccgcguacg u 21 39 19 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 39 cguacgcgga auacuucga 19 40 20 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 40 cguacgcgga auacuucgaa 20 41 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 41 cguacgcgga auacuucgaa a 21 42 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 42 cguacgcgga auacuucgaa au 22 43 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 43 cguacgcgga auacuucgaa aug 23 44 24 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 44 cguacgcgga auacuucgaa augu 24 45 25 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 45 cguacgcgga auacuucgaa auguc 25 46 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 C, antisense 46 ucgaaguauu ccgcguacgu g 21 47 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 D, antisense 47 cgaaguauuc cgcguacgug a 21 48 20 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 48 cguacgcgga auacuucgaa 20 49 20 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 49 cgaaguauuc cgcguacgug 20 50 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 50 cguacgcgga auacuucgaa a 21 51 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 51 ucgaaguauu ccgcguacgu g 21 52 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 52 cguacgcgga auacuucgaa au 22 53 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 53 uucgaaguau uccgcguacg ug 22 54 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 54 cguacgcgga auacuucgaa aug 23 55 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 55 uuucgaagua uuccgcguac gug 23 56 24 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 56 cguacgcgga auacuucgaa augu 24 57 24 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 57 auuucgaagu auuccgcgua cgug 24 58 25 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 58 cguacgcgga auacuucgaa auguc 25 59 25 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 59 cauuucgaag uauuccgcgu acgug 25 60 19 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 C, sense 60 guacgcggaa uacuucgaa 19 61 20 RNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 13 C 61 ucgaaguauu ccgcguacgu 20 62 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 C, sense 62 acguacgcgg aauacuucga aa 22 63 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 C, antisense 63 ucgaaguauu ccgcguacgu ga 22 64 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 C, sense 64 cacguacgcg gaauacuucg aaa 23 65 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 C, antisense 65 ucgaaguauu ccgcguacgu gau 23 66 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-2, sense 66 acguacgcgg aauacuucga a 21 67 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-2, antisense 67 cgaaguauuc cgcguacgug a 21 68 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-3, sense 68 cacguacgcg gaauacuucg a 21 69 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-3, antisense 69 gaaguauucc gcguacguga u 21 70 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-4, sense 70 ucacguacgc ggaauacuuc g 21 71 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-4, antisense 71 aaguauuccg cguacgugau g 21 72 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-5, sense 72 aucacguacg cggaauacuu c 21 73 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-5, antisense 73 aguauuccgc guacgugaug u 21 74 18 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, sense 74 acgcggaaua cuucgaaa 18 75 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, antisense 75 ucgaaguauu ccgcguacgu g 21 76 19 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, sense 76 uacgcggaau acuucgaaa 19 77 20 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 D, sense 77 guacgcggaa uacuucgaaa 20 78 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, sense 78 cguacgcgga auacuucgaa a 21 79 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, sense 79 acguacgcgg aauacuucga aa 22 80 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, sense 80 cacguacgcg gaauacuucg aaa 23 81 21 DNA Artificial Sequence Description of Combined DNA/RNA MoleculeReference 81 cguacgcgga auacuucgat t 21 82 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Reference 82 ucgaaguauu ccgcguacgt t 21 83 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 13 C 83 augccgcgga auacuucgat t 21 84 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-1 84 ucgaaguauu ccgcggcaut t 21 85 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-2 85 cguagcgcga auacuucgat t 21 86 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-2 86 ucgaaguauu cgcgcuacgt t 21 87 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-3 87 cguacgcgag uaacuucgat t 21 88 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-3 88 ucgaaguuac ucgcguacgt t 21 89 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-4 89 cguacgcgga auuucacgat t 21 90 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-4 90 ucgugaaauu ccgcguacgt t 21 91 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-5 91 cguacgcgga auacuuagct t 21 92 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-5 92 gcuaaguauu ccgcguacgt t 21 93 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-6 93 cguacgcggu auacuucgat t 21 94 21 DNA Artificial Sequence Description of Artificial Sequence siRNA duplex, antisense 94 ucgaaguaua ccgcguacgt t 21 95 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-7 95 cguacgcgga uuacuucgat t 21 96 21 DNA Artificial Sequence Description of Artificial Sequence siRNA duplex, antisense 96 ucgaaguaau ccgcguacgt t 21

Claims (47)

1. Isolated double-stranded RNA molecule, wherein each RNA strand has a length from 19-25 nucleotides, wherein said RNA molecule is capable of target-specific nucleic acid modifications.
2. The RNA molecule of claim 1 wherein at least one strand has a 3′-overhang from 1-5 nucleotides.
3. The RNA molecule of claim 1 or 2 capable of target-specific RNA interference and/or DNA methylation.
4. The RNA molecule of any one of claims 1-3, wherein each strand has a length from 19-23, particularly from 20-22 nucleotides.
5. The RNA molecule of any one of claims 2-4, wherein the 3′-overhang is from 1-3 nucleotides.
6. The RNA molecule of any one of claims 2-5, wherein the 3′-overhang is stabilized against degradation.
7. The RNA molecule of any one of claims 1-6, which contains at least one modified nucleotide analogue.
8. The RNA molecule of claim 7, wherein the modified nucleotide analogue is selected from sugar- or backbone modified ribonucleotides.
9. The RNA molecule according to claim 7 or 8, wherein the nucleotide analogue is a sugar-modified ribonucleotide, wherein the 2′-OH group is replaced by a group selected from H, OR, R, halo, SH, SR1, NH2, NHR, NR2 or CN, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I.
10. The RNA molecule of claim 7 or 8, wherein the nucleotide analogue is a backbone-modified ribonucleotide containing a phosphothioate group.
11. The RNA molecule of any one of claims 1-10, which has a sequence having an identity of at least 50 percent to a predetermined mRNA target molecule.
12. The RNA molecule of claim 1 1, wherein the identity is at least 70 percent.
13. A method of preparing a double-stranded RNA molecule of any one of claims 1-12 comprising the steps:
(a) synthesizing two RNA strands each having a length from 19-25 nucleotides, wherein said RNA strands are capable of forming a double-stranded RNA molecule,
(b) combining the synthesized RNA strands under conditions, wherein a double-stranded RNA molecule is formed, which is capable of target-specific nucleic acid modifications.
14. The method of claim 13, wherein the RNA strands are chemically synthesized.
15. The method of claim 13, wherein the RNA strands are enzymatically synthesized.
16. A method of mediating target-specific nucleic acid modifications in a cell or an organism comprising the steps:
(a) contacting said cell or organism with the double-stranded RNA molecule of any one of claims 1-12 under conditions wherein target-specific nucleic acid modifications can occur, and
(b) mediating a target-specific nucleic acid modification effected by the double-stranded RNA towards a target nucleic acid having a sequence portion substantially corresponding to the double-stranded RNA.
17. The method of claim 16, wherein the nucleic acid modification is RNA interference and/or DNA methylation.
18. The method of claim 16 and 17 wherein said contacting comprises introducing said double-stranded RNA molecule into a target cell in which the target-specific nucleic acid modification can occur.
19. The method of claim 18 wherein the introducing comprises a carrier-mediated delivery or injection.
20. Use of the method of any one of claims 16-19 for determining the function of a gene in a cell or an organism.
21. Use of the method of any one of claims 16-19 for modulating the function of a gene in a cell or an organism.
22. The use of claim 20 or 21, wherein the gene is associated with a pathological condition.
23. The use of claim 22, wherein the gene is a pathogen-associated gene.
24. The use of claim 23, wherein the gene is a viral gene.
25. The use of claim 22, wherein the gene is a tumor-associated gene.
26. The use of claim 22, wherein the gene is an autoimmune disease-associated gene.
27. Pharmaceutical composition containing as an active agent at least one double-stranded RNA molecule of any one of claims 1-12 and a pharmaceutical carrier.
28. The composition of claim 27 for diagnostic applications.
29. The composition of claim 27 for therapeutic applications.
30. A eukaryotic cell or a eukaryotic non-human organism exhibiting a target gene-specific knockout phenotype wherein said cell or organism is transfected with at least one double-stranded RNA molecule capable of inhibiting the expression of an endogeneous target gene or with a DNA encoding at least one double-stranded RNA molecule capable of inhibiting the expression of at least one endogeneous target gene.
31. The cell or organism of claim 30 which is a mammalian cell.
32. The cell or organism of claim 31 which is a human cell.
33. The cell or organism of any one of claims 30-32 which is further transfected with at least one exogeneous target nucleic acid coding for the target protein or a variant or mutated form of the target protein, wherein said exogeneous target nucleic acid differs from the endogeneous target gene on the nucleic acid level such that the expression of the exogeneous target nucleic acid is substantially less inhibited by the double stranded RNA molecule than the expression of the endogeneous target gene.
34. The cell or organism of claim 33 wherein the exogeneous target nucleic acid is fused to a further nucleic acid sequence encoding a detectable peptide or polypeptide.
35. Use of the cell or organism of any of claims 30-34 for analytic procedures.
36. The use of claim 35 for the analysis of gene expression profiles.
37. The use of claim 35 for a proteome analysis.
38. The use of any one of claims 35-37 wherein an analysis of a variant or mutant form of the target protein encoded by an exogeneous target nucleic acid is carried out.
39. The use of claim 38 for identifying functional domains of the target protein.
40. The use of any one of claims 35-39 wherein a comparison of at least two cells or organisms is carried out selected from:
(i) a control cell or control organism without target gene inhibition,
(ii) a cell or organism with target gene inhibition and
(iii) a cell or organism with target gene inhibition plus target gene complementation by an exogeneous target nucleic acid.
41. The use of any one of claims 35-40 wherein the analysis comprises a functional and/or phenotypic analysis.
42. Use of a cell of any one of claims 30-34 for preparative procedures.
43. The use of claim 41 for the isolation of proteins or protein complexes from eukaryotic cells.
44. The use of claim 43 for the isolation of high molecular weight protein complexes which may optionally contain nucleic acids.
45. The use of any one of claims 35-44 in a procedure for identifying and/or characterizing pharmacological agents.
46. A system for identifying and/or characterizing a pharmacological agent acting on at least one target protein comprising:
(a) a eukaryotic cell or a eukaryotic non-human organism capable of expressing at least one target gene coding for said at least one target protein,
(b) at least one double-stranded RNA molecule capable of inhibiting the expression of said at least one endogeneous target gene, and
(c) a test substance or a collection of test substances wherein pharmacological properties of said test substance or said collection are to be identified and/or characterized.
47. The system of claim 46 further comprising:
(d) at least one exogeneous target nucleic acid coding for the target protein or a variant or mutated from of the target protein wherein said exogeneous target nucleic acid differs from the endogeneous target gene on the nucleic acid level such that the expression of the exogeneous target nucleic acid is substantially less inhibited by the double stranded RNA molecule than the expression of the endogeneous target gene.
US10/433,050 2000-03-30 2001-11-29 Rna interference mediating small rna molecules Abandoned US20040259247A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP00126325 2000-12-01
EP00126325.0 2000-12-01
US27966101P true 2001-03-30 2001-03-30
WOPCT/US01/10188 2001-03-30
PCT/US2001/010188 WO2001075164A2 (en) 2000-03-30 2001-03-30 Rna sequence-specific mediators of rna interference
US10/433,050 US20040259247A1 (en) 2000-12-01 2001-11-29 Rna interference mediating small rna molecules
PCT/EP2001/013968 WO2002044321A2 (en) 2000-12-01 2001-11-29 Rna interference mediating small rna molecules

Applications Claiming Priority (22)

Application Number Priority Date Filing Date Title
US10/433,050 US20040259247A1 (en) 2000-12-01 2001-11-29 Rna interference mediating small rna molecules
US10/832,257 US20050026278A1 (en) 2000-12-01 2004-04-27 RNA interference mediating small RNA molecules
US11/142,866 US20050234007A1 (en) 2000-12-01 2005-06-02 RNA interference mediating small RNA molecules
US11/142,865 US20050234006A1 (en) 2000-12-01 2005-06-02 RNA interference mediating small RNA molecules
US11/634,138 US20080269147A1 (en) 2000-12-01 2006-12-06 RNA interference mediating small RNA molecules
US11/634,129 US20070093445A1 (en) 2000-12-01 2006-12-06 RNA interference mediating small RNA molecules
US12/260,443 US20090155174A1 (en) 2000-12-01 2008-10-29 RNA Interference Mediating Small RNA Molecules
US12/537,602 US8372968B2 (en) 2000-12-01 2009-08-07 RNA interference mediating small RNA molecules
US12/537,632 US20100010207A1 (en) 2000-12-01 2009-08-07 Rna interference mediating small rna molecules
US12/591,829 US8853384B2 (en) 2000-12-01 2009-12-02 RNA interference mediating small RNA molecules
US12/683,070 US8933044B2 (en) 2000-12-01 2010-01-06 RNA interference mediating small RNA molecules
US12/683,081 US8362231B2 (en) 2000-12-01 2010-01-06 RNA interference mediating small RNA molecules
US12/794,071 US8765930B2 (en) 2000-12-01 2010-06-04 RNA interference mediating small RNA molecules
US12/819,444 US8796016B2 (en) 2000-12-01 2010-06-21 RNA interference mediating small RNA molecules
US12/834,311 US8445237B2 (en) 2000-12-01 2010-07-12 RNA interference mediating small RNA molecules
US12/835,086 US8778902B2 (en) 2000-12-01 2010-07-13 RNA interference mediating small RNA molecules
US12/838,786 US8329463B2 (en) 2000-12-01 2010-07-19 RNA interference mediating small RNA molecules
US12/879,300 US8993745B2 (en) 2000-12-01 2010-09-10 RNA interference mediating small RNA molecules
US12/897,374 US8895718B2 (en) 2000-12-01 2010-10-04 RNA interference mediating small RNA molecules
US13/725,262 US8895721B2 (en) 2000-12-01 2012-12-21 RNA interference mediating small RNA molecules
US14/476,465 US9567582B2 (en) 2000-12-01 2014-09-03 RNA interference mediating small RNA molecules
US15/388,681 US20170327822A1 (en) 2000-12-01 2016-12-22 Rna interference mediating small rna molecules

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2001/013968 A-371-Of-International WO2002044321A2 (en) 2000-03-30 2001-11-29 Rna interference mediating small rna molecules

Related Child Applications (13)

Application Number Title Priority Date Filing Date
US10/832,432 Division US7056704B2 (en) 2000-03-30 2004-04-27 RNA interference mediating small RNA molecules
US10/832,257 Division US20050026278A1 (en) 2000-03-30 2004-04-27 RNA interference mediating small RNA molecules
US10/832,248 Division US7078196B2 (en) 2000-03-30 2004-04-27 RNA interference mediating small RNA molecules
US11/142,866 Division US20050234007A1 (en) 2000-03-30 2005-06-02 RNA interference mediating small RNA molecules
US11/142,865 Division US20050234006A1 (en) 2000-03-30 2005-06-02 RNA interference mediating small RNA molecules
US11/634,129 Division US20070093445A1 (en) 2000-03-30 2006-12-06 RNA interference mediating small RNA molecules
US11/634,138 Division US20080269147A1 (en) 2000-03-30 2006-12-06 RNA interference mediating small RNA molecules
US12/260,443 Division US20090155174A1 (en) 2000-12-01 2008-10-29 RNA Interference Mediating Small RNA Molecules
US12/537,632 Division US20100010207A1 (en) 2000-12-01 2009-08-07 Rna interference mediating small rna molecules
US12/537,602 Division US8372968B2 (en) 2000-12-01 2009-08-07 RNA interference mediating small RNA molecules
US12/683,070 Division US8933044B2 (en) 2000-12-01 2010-01-06 RNA interference mediating small RNA molecules
US12/683,081 Division US8362231B2 (en) 2000-12-01 2010-01-06 RNA interference mediating small RNA molecules
US12/897,374 Continuation US8895718B2 (en) 2000-12-01 2010-10-04 RNA interference mediating small RNA molecules

Publications (1)

Publication Number Publication Date
US20040259247A1 true US20040259247A1 (en) 2004-12-23



Family Applications (24)

Application Number Title Priority Date Filing Date
US10/433,050 Abandoned US20040259247A1 (en) 2000-03-30 2001-11-29 Rna interference mediating small rna molecules
US10/832,257 Abandoned US20050026278A1 (en) 2000-03-30 2004-04-27 RNA interference mediating small RNA molecules
US10/832,248 Active US7078196B2 (en) 2000-03-30 2004-04-27 RNA interference mediating small RNA molecules
US10/832,432 Active US7056704B2 (en) 2000-03-30 2004-04-27 RNA interference mediating small RNA molecules
US11/142,866 Abandoned US20050234007A1 (en) 2000-03-30 2005-06-02 RNA interference mediating small RNA molecules
US11/142,865 Abandoned US20050234006A1 (en) 2000-03-30 2005-06-02 RNA interference mediating small RNA molecules
US11/634,129 Abandoned US20070093445A1 (en) 2000-03-30 2006-12-06 RNA interference mediating small RNA molecules
US11/634,138 Abandoned US20080269147A1 (en) 2000-03-30 2006-12-06 RNA interference mediating small RNA molecules
US12/260,443 Abandoned US20090155174A1 (en) 2000-12-01 2008-10-29 RNA Interference Mediating Small RNA Molecules
US12/537,632 Abandoned US20100010207A1 (en) 2000-12-01 2009-08-07 Rna interference mediating small rna molecules
US12/537,602 Active 2022-06-24 US8372968B2 (en) 2000-12-01 2009-08-07 RNA interference mediating small RNA molecules
US12/591,829 Active 2022-06-04 US8853384B2 (en) 2000-12-01 2009-12-02 RNA interference mediating small RNA molecules
US12/683,081 Active 2022-07-27 US8362231B2 (en) 2000-12-01 2010-01-06 RNA interference mediating small RNA molecules
US12/683,070 Active 2023-04-11 US8933044B2 (en) 2000-12-01 2010-01-06 RNA interference mediating small RNA molecules
US12/794,071 Active 2022-03-08 US8765930B2 (en) 2000-12-01 2010-06-04 RNA interference mediating small RNA molecules
US12/819,444 Active 2023-07-16 US8796016B2 (en) 2000-12-01 2010-06-21 RNA interference mediating small RNA molecules
US12/834,311 Active 2022-01-09 US8445237B2 (en) 2000-12-01 2010-07-12 RNA interference mediating small RNA molecules
US12/835,086 Active 2023-06-09 US8778902B2 (en) 2000-12-01 2010-07-13 RNA interference mediating small RNA molecules
US12/838,786 Active US8329463B2 (en) 2000-12-01 2010-07-19 RNA interference mediating small RNA molecules
US12/879,300 Active 2023-08-18 US8993745B2 (en) 2000-12-01 2010-09-10 RNA interference mediating small RNA molecules
US12/897,374 Active 2024-06-17 US8895718B2 (en) 2000-12-01 2010-10-04 RNA interference mediating small RNA molecules
US13/725,262 Active US8895721B2 (en) 2000-12-01 2012-12-21 RNA interference mediating small RNA molecules
US14/476,465 Active US9567582B2 (en) 2000-12-01 2014-09-03 RNA interference mediating small RNA molecules
US15/388,681 Pending US20170327822A1 (en) 2000-12-01 2016-12-22 Rna interference mediating small rna molecules

Family Applications After (23)

Application Number Title Priority Date Filing Date
US10/832,257 Abandoned US20050026278A1 (en) 2000-03-30 2004-04-27 RNA interference mediating small RNA molecules
US10/832,248 Active US7078196B2 (en) 2000-03-30 2004-04-27 RNA interference mediating small RNA molecules
US10/832,432 Active US7056704B2 (en) 2000-03-30 2004-04-27 RNA interference mediating small RNA molecules
US11/142,866 Abandoned US20050234007A1 (en) 2000-03-30 2005-06-02 RNA interference mediating small RNA molecules
US11/142,865 Abandoned US20050234006A1 (en) 2000-03-30 2005-06-02 RNA interference mediating small RNA molecules
US11/634,129 Abandoned US20070093445A1 (en) 2000-03-30 2006-12-06 RNA interference mediating small RNA molecules
US11/634,138 Abandoned US20080269147A1 (en) 2000-03-30 2006-12-06 RNA interference mediating small RNA molecules
US12/260,443 Abandoned US20090155174A1 (en) 2000-12-01 2008-10-29 RNA Interference Mediating Small RNA Molecules
US12/537,632 Abandoned US20100010207A1 (en) 2000-12-01 2009-08-07 Rna interference mediating small rna molecules
US12/537,602 Active 2022-06-24 US8372968B2 (en) 2000-12-01 2009-08-07 RNA interference mediating small RNA molecules
US12/591,829 Active 2022-06-04 US8853384B2 (en) 2000-12-01 2009-12-02 RNA interference mediating small RNA molecules
US12/683,081 Active 2022-07-27 US8362231B2 (en) 2000-12-01 2010-01-06 RNA interference mediating small RNA molecules
US12/683,070 Active 2023-04-11 US8933044B2 (en) 2000-12-01 2010-01-06 RNA interference mediating small RNA molecules
US12/794,071 Active 2022-03-08 US8765930B2 (en) 2000-12-01 2010-06-04 RNA interference mediating small RNA molecules
US12/819,444 Active 2023-07-16 US8796016B2 (en) 2000-12-01 2010-06-21 RNA interference mediating small RNA molecules
US12/834,311 Active 2022-01-09 US8445237B2 (en) 2000-12-01 2010-07-12 RNA interference mediating small RNA molecules
US12/835,086 Active 2023-06-09 US8778902B2 (en) 2000-12-01 2010-07-13 RNA interference mediating small RNA molecules
US12/838,786 Active US8329463B2 (en) 2000-12-01 2010-07-19 RNA interference mediating small RNA molecules
US12/879,300 Active 2023-08-18 US8993745B2 (en) 2000-12-01 2010-09-10 RNA interference mediating small RNA molecules
US12/897,374 Active 2024-06-17 US8895718B2 (en) 2000-12-01 2010-10-04 RNA interference mediating small RNA molecules
US13/725,262 Active US8895721B2 (en) 2000-12-01 2012-12-21 RNA interference mediating small RNA molecules
US14/476,465 Active US9567582B2 (en) 2000-12-01 2014-09-03 RNA interference mediating small RNA molecules
US15/388,681 Pending US20170327822A1 (en) 2000-12-01 2016-12-22 Rna interference mediating small rna molecules

Country Status (27)

Country Link
US (24) US20040259247A1 (en)
EP (3) EP2348133B1 (en)
JP (5) JP4095895B2 (en)
KR (2) KR100909681B1 (en)
CN (1) CN100523215C (en)
AT (1) AT373724T (en)
AU (3) AU2002235744B8 (en)
BR (1) BR0115814A (en)
CA (1) CA2429814C (en)
CY (1) CY1119062T1 (en)
CZ (1) CZ302719B6 (en)
DE (1) DE60130583T3 (en)
DK (2) DK1407044T4 (en)
ES (1) ES2215494T5 (en)
HK (4) HK1110631A1 (en)
HU (1) HU230458B1 (en)
IL (3) IL155991D0 (en)
MX (1) MXPA03004836A (en)
NO (2) NO333713B1 (en)
NZ (1) NZ525888A (en)
PL (1) PL218876B1 (en)
PT (1) PT1407044E (en)
RU (2) RU2322500C2 (en)
SI (1) SI1407044T2 (en)
TR (1) TR200401292T3 (en)
WO (1) WO2002044321A2 (en)
ZA (1) ZA200303929B (en)

Cited By (427)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020086356A1 (en) * 2000-03-30 2002-07-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20030139585A1 (en) * 2001-07-12 2003-07-24 Eugen Uhlmann Synthetic double-stranded oligonucleotides for specific inhibition of gene expression
US20030139363A1 (en) * 2001-07-23 2003-07-24 Kay Mark A. Methods and compositions for RNAi mediated inhibition of viral gene expression in mammals
US20030153519A1 (en) * 2001-07-23 2003-08-14 Kay Mark A. Methods and compositions for RNAi mediated inhibition of gene expression in mammals
US20030157030A1 (en) * 2001-11-02 2003-08-21 Insert Therapeutics, Inc. Methods and compositions for therapeutic use of rna interference
US20040005593A1 (en) * 2002-03-06 2004-01-08 Rigel Pharmaceuticals, Inc. Novel method for delivery and intracellular synthesis of siRNA molecules
US20040014956A1 (en) * 2002-02-01 2004-01-22 Sequitur, Inc. Double-stranded oligonucleotides
US20040053411A1 (en) * 2002-05-03 2004-03-18 Duke University Method of regulating gene expression
US20040063654A1 (en) * 2001-11-02 2004-04-01 Davis Mark E. Methods and compositions for therapeutic use of RNA interference
US20040086845A1 (en) * 1999-10-20 2004-05-06 Tzyy-Choou Wu Superior molecular vaccine linking the translocation domain of a bacterial toxin to an antigen
US20040091457A1 (en) * 2001-10-12 2004-05-13 Ribopharma Ag Compositions and methods for inhibiting viral replication
US20040096843A1 (en) * 2002-02-14 2004-05-20 Rossi John J. Methods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US20040096882A1 (en) * 2002-08-21 2004-05-20 Martin Gleave RNAi probes targeting cancer-related proteins
US20040147027A1 (en) * 2003-01-28 2004-07-29 Troy Carol M. Complex for facilitating delivery of dsRNA into a cell and uses thereof
US20040180357A1 (en) * 2002-11-01 2004-09-16 The Trustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of HIF-1 alpha
US20040191905A1 (en) * 2002-11-22 2004-09-30 University Of Massachusetts Modulation of HIV replication by RNA interference
US20040192626A1 (en) * 2002-02-20 2004-09-30 Mcswiggen James RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20040203145A1 (en) * 2002-08-07 2004-10-14 University Of Massachusetts Compositions for RNA interference and methods of use thereof
US20040221337A1 (en) * 1999-10-27 2004-11-04 Baulcombe David C. Gene silencing
US20040219671A1 (en) * 2002-02-20 2004-11-04 Sirna Therapeutics, Inc. RNA interference mediated treatment of parkinson disease using short interfering nucleic acid (siNA)
US20040242518A1 (en) * 2002-09-28 2004-12-02 Massachusetts Institute Of Technology Influenza therapeutic
US20040248174A1 (en) * 2003-04-18 2004-12-09 Thetrustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of angiopoietin 1and 2 and their receptor Tie2
US20040248296A1 (en) * 2002-03-20 2004-12-09 Beresford Paul J. HIV therapeutic
US20050004064A1 (en) * 2001-11-21 2005-01-06 Mitsubishi Chemical Corporation Method of inhibiting gene expression
US20050009042A1 (en) * 2003-02-10 2005-01-13 Aventis Pharma S.A. Oligonucleotides which inhibit expression of the OB-RGRP protein and method for detecting compounds which modify the interaction between proteins of the OB-RGRP family and the leptin receptor
US20050019918A1 (en) * 2003-06-03 2005-01-27 Hidetoshi Sumimoto Treatment of cancer by inhibiting BRAF expression
US20050037988A1 (en) * 2003-06-02 2005-02-17 University Of Massachusetts Methods and compositions for controlling efficacy of RNA silencing
US20050043524A1 (en) * 2003-08-18 2005-02-24 Isis Pharmaceuticals, Inc. Modulation of diacylglycerol acyltransferase 2 expression
US20050096289A1 (en) * 2002-02-07 2005-05-05 Hans Prydz Methods and compositions for modulating tissue factor
US20050136430A1 (en) * 2003-07-15 2005-06-23 California Institute Of Technology Inhibitor nucleic acids
US20050136437A1 (en) * 2003-08-25 2005-06-23 Nastech Pharmaceutical Company Inc. Nanoparticles for delivery of nucleic acids and stable double-stranded RNA
US20050142578A1 (en) * 2002-02-20 2005-06-30 Sirn Therapeutics, Inc. RNA interference mediated target discovery and target validation using short interfering nucleic acid (siNA)
US20050148526A1 (en) * 2002-01-23 2005-07-07 Kisielow Malgorzata A. Methods of obtaining isoform specific expression in mammalian cells
US20050159381A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of chromosome translocation gene expression using short interfering nucleic acid (siNA)
US20050164212A1 (en) * 2003-03-06 2005-07-28 Todd Hauser Modulation of gene expression using DNA-RNA hybrids
US20050176024A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of epidermal growth factor receptor (EGFR) gene expression using short interfering nucleic acid (siNA)
US20050176025A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of B-cell CLL/Lymphoma-2 (BCL-2) gene expression using short interfering nucleic acid (siNA)
US20050181382A1 (en) * 2003-06-02 2005-08-18 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNAi
US20050202075A1 (en) * 2004-03-12 2005-09-15 Pardridge William M. Delivery of genes encoding short hairpin RNA using receptor-specific nanocontainers
US20050208658A1 (en) * 2003-11-21 2005-09-22 The University Of Maryland RNA interference mediated inhibition of 11beta hydroxysteriod dehydrogenase-1 (11beta HSD-1) gene expression
US20050227256A1 (en) * 2003-11-26 2005-10-13 Gyorgy Hutvagner Sequence-specific inhibition of small RNA function
US20050234000A1 (en) * 2003-12-12 2005-10-20 Mitchell Gordon S SiRNA delivery into mammalian nerve cells
US20050239731A1 (en) * 2001-05-18 2005-10-27 Sirna Therapeutics, Inc. RNA interference mediated inhibition of MAP kinase gene expression using short interfering nucleic acid (siNA)
US20050245475A1 (en) * 2002-11-14 2005-11-03 Dharmacon, Inc. Functional and hyperfunctional siRNA directed against Bcl-2
US20050256076A1 (en) * 2004-03-26 2005-11-17 Curis, Inc. RNA interference modulators of hedgehog signaling and uses thereof
US20050256071A1 (en) * 2003-07-15 2005-11-17 California Institute Of Technology Inhibitor nucleic acids
US20050260214A1 (en) * 2004-05-12 2005-11-24 Simon Michael R Composition and method for introduction of RNA interference sequences into targeted cells and tissues
US20050273868A1 (en) * 2004-02-17 2005-12-08 University Of Massachusetts Methods and compositions for enhancing RISC activity in vitro and in vivo
US20050272682A1 (en) * 2004-03-22 2005-12-08 Evers Bernard M SiRNA targeting PI3K signal transduction pathway and siRNA-based therapy
US20050277610A1 (en) * 2004-03-15 2005-12-15 City Of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
US20060003915A1 (en) * 2002-04-18 2006-01-05 Karina Drumm Means and methods for the specific modulation of target genes in the cns and the eye and methods for their identification
US20060008907A1 (en) * 2004-06-09 2006-01-12 The Curators Of The University Of Missouri Control of gene expression via light activated RNA interference
US20060009409A1 (en) * 2002-02-01 2006-01-12 Woolf Tod M Double-stranded oligonucleotides
US20060008910A1 (en) * 2004-06-07 2006-01-12 Protiva Biotherapeuties, Inc. Lipid encapsulated interfering RNA
US20060014289A1 (en) * 2004-04-20 2006-01-19 Nastech Pharmaceutical Company Inc. Methods and compositions for enhancing delivery of double-stranded RNA or a double-stranded hybrid nucleic acid to regulate gene expression in mammalian cells
US20060025366A1 (en) * 2004-07-02 2006-02-02 Protiva Biotherapeutics, Inc. Immunostimulatory siRNA molecules and uses therefor
US20060030003A1 (en) * 2004-05-12 2006-02-09 Simon Michael R Composition and method for introduction of RNA interference sequences into targeted cells and tissues
WO2005044976A3 (en) * 2003-06-20 2006-02-23 Isis Pharmaceuticals Inc Oligomeric compounds for use in gene modulation
WO2006020557A2 (en) * 2004-08-10 2006-02-23 Immusol, Inc. Methods of using or identifying agents that inhibit cancer growth
US20060040882A1 (en) * 2004-05-04 2006-02-23 Lishan Chen Compostions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells
US20060051815A1 (en) * 2004-06-25 2006-03-09 The J. David Gladstone Institutes Methods of treating smooth muscle cell disorders
US20060058252A1 (en) * 2002-06-26 2006-03-16 Clawson Gary A Methods and materials for treating human papillomavirus infections
US20060063181A1 (en) * 2004-08-13 2006-03-23 Green Pamela J Method for identification and quantification of short or small RNA molecules
US20060069050A1 (en) * 2004-02-17 2006-03-30 University Of Massachusetts Methods and compositions for mediating gene silencing
WO2006033965A2 (en) * 2004-09-16 2006-03-30 The Trustees Of The University Of Pennsylvania Nadph oxidase inhibition pharmacotherapies for obstructive sleep apnea syndrome and its associated morbidities
US20060078902A1 (en) * 2004-04-15 2006-04-13 Michaeline Bunting Method and compositions for RNA interference
US20060083780A1 (en) * 2004-06-07 2006-04-20 Protiva Biotherapeutics, Inc. Cationic lipids and methods of use
US20060089324A1 (en) * 2004-10-22 2006-04-27 Sailen Barik RNAi modulation of RSV, PIV and other respiratory viruses and uses thereof
US20060094676A1 (en) * 2004-10-29 2006-05-04 Ronit Lahav Compositions and methods for treating cancer using compositions comprising an inhibitor of endothelin receptor activity
US20060128650A1 (en) * 2002-11-04 2006-06-15 University Of Massachusetts Allele-specific RNA interference
US20060134787A1 (en) * 2004-12-22 2006-06-22 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of single and double blunt-ended siRNA
US20060134189A1 (en) * 2004-11-17 2006-06-22 Protiva Biotherapeutics, Inc siRNA silencing of apolipoprotein B
US20060166921A1 (en) * 2005-01-07 2006-07-27 Rachel Meyers RNAi modulation of RSV and therapeutic uses thereof
US20060172965A1 (en) * 2005-02-01 2006-08-03 Alcon, Inc. RNAi-mediated inhibition of ocular targets
US20060178297A1 (en) * 2003-01-28 2006-08-10 Troy Carol M Systems and methods for silencing expression of a gene in a cell and uses thereof
US20060178328A1 (en) * 2002-11-26 2006-08-10 Medtronic Inc. Devices, systems and methods for improving memory and/or cognitive function through brain delivery of siRNA
US20060189564A1 (en) * 2004-10-22 2006-08-24 Medtronic, Inc. Methods and sequences to suppress pro-inflamatory cytokine actions locally to treat pain
US20060205635A1 (en) * 2005-03-14 2006-09-14 Board Of Regents, The University Of Texas System Antigene oligomers inhibit transcription
US20060211637A1 (en) * 2002-08-06 2006-09-21 Intradigm Corporation Methods of down regulating target gene expression in vivo by introduction of interfering rna
US20060217324A1 (en) * 2005-01-24 2006-09-28 Juergen Soutschek RNAi modulation of the Nogo-L or Nogo-R gene and uses thereof
US20060223749A1 (en) * 2001-09-19 2006-10-05 University Of South Florida Inhibition of SHIP to enhance stem cell harvest and transplantation
US20060223773A1 (en) * 2005-03-11 2006-10-05 Alcon, Inc. RNAi-mediated inhibition of Frizzled Related Protein-1 for treatment of glaucoma
US20060240093A1 (en) * 2003-07-16 2006-10-26 Protiva Biotherapeutics, Inc. Lipid encapsulated interfering rna
US20060239971A1 (en) * 2003-02-21 2006-10-26 Mohapatra Shyam S Vectors for regulating gene expression
US20060240425A1 (en) * 2002-09-30 2006-10-26 Oncotherapy Science, Inc Genes and polypeptides relating to myeloid leukemia
US20060257380A1 (en) * 2002-09-19 2006-11-16 Inst.Nat. De La Sante Et De La Recherche MED Use of sirnas for gene silencing in antigen presenting cells
US20060269530A1 (en) * 2003-02-21 2006-11-30 The Penn State Research Foundation RNA interference compositions and methods
US20060269519A1 (en) * 2004-07-19 2006-11-30 Baylor College Of Medicine Modulation of cytokine signaling regulators and applications for immunotherapy
US20060276635A1 (en) * 2002-09-05 2006-12-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20060287259A1 (en) * 2003-12-23 2006-12-21 The Trustees Of The University Of Pennsylvania Compositions and methods for combined therapy of disease
US20060287269A1 (en) * 2002-09-09 2006-12-21 The Regents Of The University Of California Short interfering nucleic acid hybrids and methods thereof
US20060292119A1 (en) * 2005-06-23 2006-12-28 Baylor College Of Medicine Modulation of negative immune regulators and applications for immunotherapy
US20060293256A1 (en) * 2002-08-06 2006-12-28 Masateru Yamada Remedy or preventive for kidney disease and method of diagnosing kidney disease
US20070003575A1 (en) * 2004-05-26 2007-01-04 Itzhak Bentwich Viral and viral associated MiRNAs and uses thereof
US20070010468A1 (en) * 2003-04-23 2007-01-11 Georgetown University Methods and compositions for the inhibition of stat5 in prostate cancer cells
US20070037762A1 (en) * 2002-07-24 2007-02-15 Tolentino Michael J COMPOSITIONS AND METHODS FOR siRNA INHIBITION OF ANGIOGENESIS
US20070054873A1 (en) * 2005-08-26 2007-03-08 Protiva Biotherapeutics, Inc. Glucocorticoid modulation of nucleic acid-mediated immune stimulation
US20070087991A1 (en) * 2002-02-13 2007-04-19 Axordia Limited Pluripotential stem cells
US20070111963A1 (en) * 2005-11-17 2007-05-17 Board Of Regents, The University Of Texas System Modulation of gene expression by oligomers targeted to chromosomal DNA
US20070111227A1 (en) * 2005-07-28 2007-05-17 Green Pamela J Small regulatory RNAs and methods of use
US20070128640A1 (en) * 2002-11-14 2007-06-07 Dharmacon, Inc. siRNA targeting ras-related nuclear protein
US20070135370A1 (en) * 2005-10-20 2007-06-14 Protiva Biotherapeutics, Inc. siRNA silencing of filovirus gene expression
US20070135372A1 (en) * 2005-11-02 2007-06-14 Protiva Biotherapeutics, Inc. Modified siRNA molecules and uses thereof
US20070141601A1 (en) * 2004-05-12 2007-06-21 Dharmacon, Inc. siRNA targeting cAMP-specific phosphodiesterase 4D
US20070141009A1 (en) * 2003-01-03 2007-06-21 Shaharyar Khan Sirna mediated post-transriptional gene silencing of genes involved in alopecia
US20070149468A1 (en) * 2003-05-16 2007-06-28 Jackson Aimee L Methods and compositions for rna interference
US20070149470A1 (en) * 2004-09-10 2007-06-28 Kaspar Roger L Inhibition of viral gene expression using small interfering RNA
US20070160586A1 (en) * 2005-06-15 2007-07-12 Children's Medical Center Corporation Methods for extending the replicative lifespan of cells
US20070161547A1 (en) * 2003-06-03 2007-07-12 Balkrishen Bhat Modulation of survivin expression
US20070161586A1 (en) * 2004-01-16 2007-07-12 Takeda Pharmaceutical Company Limited Drug for preventing and treating atherosclerosis
US20070180242A1 (en) * 2006-01-30 2007-08-02 Nagaraj Thadi M GSM authentication in a CDMA network
US20070202134A1 (en) * 2004-02-23 2007-08-30 Kufe Donald W Muc1 Antagonist Enhancement of Death Receptor Ligand-Induced Apoptosis
US20070232555A1 (en) * 2004-03-26 2007-10-04 Nariyoshi Shinomiya C-Met Sirna Adenovirus Vectors Inhibit Cancer Cell Growth, Invasion and Tumorigenicity
US20070238691A1 (en) * 2006-03-29 2007-10-11 Senesco Technologies, Inc. Inhibition of HIV replication and expression of p24 with eIF-5A
US20070238676A1 (en) * 2003-12-04 2007-10-11 Mohapatra Shyam S Polynucleotides for Reducing Respiratory Syncytial Virus Gene Expression
US20070244311A1 (en) * 2002-11-14 2007-10-18 Dharmacon, Inc. siRNA targeting coatomer protein complex, subunit beta 2 (CPOB2)
US20070243570A1 (en) * 2003-05-19 2007-10-18 Genecare Research Institute Co., Ltd Apoptosis Inducer for Cancer Cell
US20070259827A1 (en) * 2006-01-25 2007-11-08 University Of Massachusetts Compositions and methods for enhancing discriminatory RNA interference
US20070258993A1 (en) * 2003-11-12 2007-11-08 The Austin Research Institute Dna-Carrier Conjugate
US20070265220A1 (en) * 2004-03-15 2007-11-15 City Of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
US20070270369A1 (en) * 2002-09-18 2007-11-22 The Burnham Institute Use of hepatitis b x-interacting protein (hbxip) in modulation of apoptosis
US20070269892A1 (en) * 2006-05-18 2007-11-22 Nastech Pharmaceutical Company Inc. FORMULATIONS FOR INTRACELLULAR DELIVERY dsRNA
US20070275923A1 (en) * 2006-05-25 2007-11-29 Nastech Pharmaceutical Company Inc. CATIONIC PEPTIDES FOR siRNA INTRACELLULAR DELIVERY
US20070275913A1 (en) * 2006-04-12 2007-11-29 Monia Brett P Compositions and their uses directed to hepcidin
US20080014191A1 (en) * 2006-05-19 2008-01-17 The Scripps Research Institute Treatment of Protein Misfolding
US20080039415A1 (en) * 2006-08-11 2008-02-14 Gregory Robert Stewart Retrograde transport of sirna and therapeutic uses to treat neurologic disorders
US20080039411A1 (en) * 2004-02-23 2008-02-14 Ulf Smith Use Of Resistin Antisense Oligonucleotides And/Or Sirna Molecules In The Treatment Of Rheumatoid Arthritis
US20080039412A1 (en) * 2004-02-10 2008-02-14 Sirna Therapeutics, Inc. Rna Interference Mediated Inhibition of Gene Expression Using Multifunctional Short Interfering Nucleic Acid (Multifunctional Sina)
US20080057062A1 (en) * 2006-07-18 2008-03-06 National Institute Of Advanced Industrial Science And Technology Agent for Inducing senescence and apoptosis of cancer cell
US20080069840A1 (en) * 2005-01-06 2008-03-20 Tzyy-Choou Wu RNA Interference That Blocks Expression of Pro-Apoptotic Proteins Potentiates Immunity Induced by DNA and Transfected Dendritic Cell Vaccines
US20080070857A1 (en) * 2005-02-14 2008-03-20 Jun Nishihira Pharmaceutical Agents for Preventing Metastasis of Cancer
US20080076731A1 (en) * 2000-09-19 2008-03-27 University Of South Florida Control of NK cell function and survival by modulation of ship activity
US20080102084A1 (en) * 2005-01-26 2008-05-01 Tzyy-Choou Wu Anti-cancer DNA Vaccine Employing Plasmids Encoding Mutant Oncoprotein Antigen and Calreticulin
US20080108584A1 (en) * 2006-05-22 2008-05-08 De Fougerolles Antonin Compositions and methods for inhibiting expression of ikk-b gene
US20080125384A1 (en) * 2005-11-21 2008-05-29 Shuewi Yang Simultaneous silencing and restoration of gene function
US20080152654A1 (en) * 2006-06-12 2008-06-26 Exegenics, Inc., D/B/A Opko Health, Inc. COMPOSITIONS AND METHODS FOR siRNA INHIBITION OF ANGIOGENESIS
US20080153765A1 (en) * 2004-03-22 2008-06-26 Gewirtz Alan M Methods of Use of Bcl-6-Derived Nucleotides to Induce Apoptosis
US20080167265A1 (en) * 2007-01-09 2008-07-10 Isis Pharmaceuticals Inc Modulation of fr-alpha expression
US20080167256A1 (en) * 2004-03-31 2008-07-10 Hidetoshi Sumimoto Cancer Therapy Via the Inhibition of Skp-2 Expression
US20080171906A1 (en) * 2007-01-16 2008-07-17 Everaerts Frank J L Tissue performance via hydrolysis and cross-linking
US20080171715A1 (en) * 2004-11-12 2008-07-17 David Brown Methods and compositions involving mirna and mirna inhibitor molecules
US20080171051A1 (en) * 2003-11-26 2008-07-17 Patrick Gerard Johnston Cancer Treatment
US20080171719A1 (en) * 2006-11-28 2008-07-17 Alcon Manufacturing, Ltd. RNAi-MEDIATED INHIBITION OF AQUAPORIN 1 FOR TREATMENT OF IOP-RELATED CONDITIONS
US20080177051A1 (en) * 2002-11-14 2008-07-24 Dharmacon, Inc. siRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B)
US20080176293A1 (en) * 2005-07-25 2008-07-24 Jacques Rohayem RNA-Dependent RNA Polymerase, Methods And Kits For The Amplification And/Or Labelling Of RNA
US7422853B1 (en) * 2002-10-04 2008-09-09 Myriad Genetics, Inc. RNA interference using a universal target
US20080221059A1 (en) * 2008-04-03 2008-09-11 National Taiwan University Novel treatment tool for cancer: rna interference of bcas2
US20080227967A1 (en) * 2002-11-14 2008-09-18 Dharmacon, Inc. siRNA targeting ribonucleotide reductase M2 polypeptide (RRM2 or RNR-R2)
US20080242627A1 (en) * 2000-08-02 2008-10-02 University Of Southern California Novel rna interference methods using dna-rna duplex constructs
US20080249046A1 (en) * 2006-06-09 2008-10-09 Protiva Biotherapeutics, Inc. MODIFIED siRNA MOLECULES AND USES THEREOF
US20080249038A1 (en) * 2003-10-07 2008-10-09 Quark Biotech, Inc. Bone Morphogenetic Protein (Bmp) 2A and Uses Thereof
WO2008088836A3 (en) * 2007-01-16 2008-10-16 Burnham Inst Medical Research Compositions and methods for treatment of colorectal cancer
US20080253989A1 (en) * 2004-10-22 2008-10-16 Neuregenix Limited Neuron Regeneration
WO2008002678A3 (en) * 2006-06-29 2008-10-16 Kota V Ramana Structural-based inhibitors of the glutathione binding site in aldose reductase, methods of screening therefor and methods of use
US20080255345A1 (en) * 2006-11-21 2008-10-16 Alnylam Pharmaceuticals, Inc. IRNA Agents Targeting CCR5 Expressing Cells And Uses Thereof
US20080260765A1 (en) * 2007-03-15 2008-10-23 Johns Hopkins University HPV DNA Vaccines and Methods of Use Thereof
US20080268457A1 (en) * 2002-11-14 2008-10-30 Dharmacon, Inc. siRNA targeting forkhead box P3 (FOXP3)
WO2007127919A3 (en) * 2006-04-28 2008-10-30 Alnylam Pharmaceuticals Inc Compositions and methods for inhibiting expression of a gene from the jc virus
US20080279844A1 (en) * 2006-10-18 2008-11-13 Kapil Mehta Methods for Treating Cancer Targeting Transglutaminase
US20080287386A1 (en) * 2004-01-30 2008-11-20 Quark Biotech, Inc. Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US20080299659A1 (en) * 2007-03-02 2008-12-04 Nastech Pharmaceutical Company Inc. Nucleic acid compounds for inhibiting apob gene expression and uses thereof
US20080319180A1 (en) * 2002-11-14 2008-12-25 Dharmacon, Inc. siRNA targeting protein kinase N-3 (PKN-3)
US20090005548A1 (en) * 2002-11-14 2009-01-01 Dharmacon, Inc. siRNA targeting nuclear receptor interacting protein 1 (NRIP1)
US20090005330A1 (en) * 2004-08-31 2009-01-01 Sylentis S.A. Methods and Compositions to Inhibit P2x7 Receptor Expression
US20090022667A1 (en) * 2007-05-15 2009-01-22 Marco Peters METHODS OF TREATING COGNITIVE DISORDERS BY INHIBITION OF Gpr12
US20090023675A1 (en) * 2002-02-20 2009-01-22 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition of Gene Expression Using Chemically Modified Short Interfering Nucleic Acid (siNA)
US20090028862A1 (en) * 2004-09-30 2009-01-29 Arndt Gregory M Emmprin antagonists and uses thereof
US20090042826A1 (en) * 2002-02-12 2009-02-12 Quark Pharmaceuticals, Inc. Use of the AXL receptor for diagnosis and treatment of renal disease
US20090053298A1 (en) * 2007-07-31 2009-02-26 Sumitomo Chemical Company, Limited Compositions and methods for inhibiting car gene expression by rna interference
US20090061487A1 (en) * 2006-09-08 2009-03-05 Samuel Jotham Reich Sirna and methods of manufacture
US20090081789A1 (en) * 2007-08-31 2009-03-26 Greenville Hospital System Activation of nuclear factor kappa B
US20090092988A1 (en) * 2007-10-04 2009-04-09 Schwartz Jacob C Modulating Gene Expression with agRNA and Gapmers Targeting Antisense Transcripts
US20090098127A1 (en) * 2004-07-12 2009-04-16 Medical Research Fund Of Tel Aviv Sourasky Medical Center Agents Capable of Downregulating an MSF-A DEPENDENT HIF-1ALPHA and Use Thereof in Cancer Treatment
US20090099114A1 (en) * 2004-08-23 2009-04-16 Sylentis S.A.U. Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure
US20090118214A1 (en) * 2007-11-07 2009-05-07 Beeologics, Llc Compositions for conferring tolerance to viral disease in social insects, and the use thereof
US20090118206A1 (en) * 2003-09-12 2009-05-07 University Of Massachusetts Rna interference for the treatment of gain-of-function disorders
US20090118489A1 (en) * 2002-11-14 2009-05-07 Dharmacon, Inc. siRNA targeting nucleoporin 62kDa (Nup62)
US20090123572A1 (en) * 2005-03-18 2009-05-14 Shiseido Company, Ltd. Method and Pharmaceutical Composition for Treating Psoriasis, Squamous Cell Carcinoma and/or Parakeratosis by Inhibiting Expression of Squamous Cell Carcinoma-Related Antigen
US20090130212A1 (en) * 2006-05-15 2009-05-21 Physical Pharmaceutica, Llc Composition and improved method for preparation of small particles
US20090143321A1 (en) * 2005-07-07 2009-06-04 Avraham Hochberg Nucleic acid agents for downregulating h19 and methods of using same
US20090149377A1 (en) * 2005-09-30 2009-06-11 St. Jude Children's Research Hospital METHODS FOR REGULATION OF p53 TRANSLATION AND FUNCTION
US20090149403A1 (en) * 2006-05-26 2009-06-11 Protiva Biotherapeutics, Inc. siRNA silencing of genes expressed in cancer
US20090148471A1 (en) * 2000-08-03 2009-06-11 The Johns Hopkins University Molecular Vaccine Linking an Endoplasmic Reticulum Chaperone Polypeptide to an Antigen
US20090156531A1 (en) * 2005-12-30 2009-06-18 Institut Gustave Roussy Use of Inhibitors of Scinderin and/or Ephrin-A1 for Treating Tumors
US20090163407A1 (en) * 2004-11-15 2009-06-25 Mount Sinai School Of Medicine Of New York University Compositions and methods for altering wnt autocrine signaling
US20090192113A1 (en) * 2003-08-28 2009-07-30 Jan Weiler Interfering RNA Duplex Having Blunt-Ends and 3`-Modifications
US20090203138A1 (en) * 2008-02-12 2009-08-13 University Of Tennessee Research Foundation, Inc. Small Interfering RNAs Targeting Feline Herpes Virus
US20090203135A1 (en) * 2007-04-23 2009-08-13 Alnylam Pharmaceuticals, Inc. Glycoconjugates of RNA Interference Agents
US20090203055A1 (en) * 2005-04-18 2009-08-13 Massachusetts Institute Of Technology Compositions and methods for RNA interference with sialidase expression and uses thereof
US7579451B2 (en) 2004-07-21 2009-08-25 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a modified or non-natural nucleobase
US20090227780A1 (en) * 2002-11-14 2009-09-10 Dharmacon, Inc. siRNA targeting connexin 43
US20090226446A1 (en) * 2006-04-06 2009-09-10 Deutsches Krebsforschungszentrum Stiftung Des Offentilchen Rechts Method to Inhibit the Propagation of an Undesired Cell Population
US20090233983A1 (en) * 2002-02-20 2009-09-17 Sirna Therapeutics Inc. RNA Interference Mediated Inhibition of Protein Tyrosine Phosphatase-1B (PTP-1B) Gene Expression Using Short Interfering RNA
US20090238772A1 (en) * 2007-12-13 2009-09-24 Alnylam Pharmaceuticals, Inc. Methods and compositions for prevention or treatment of rsv infection
US20090239814A1 (en) * 2007-12-04 2009-09-24 Alnylam Pharmaceuticals, Inc. Carbohydrate Conjugates as Delivery Agents for Oligonucleotides
US20090247606A1 (en) * 2001-08-28 2009-10-01 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition of Adenosine A1 Receptor (ADORA1) Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20090247614A1 (en) * 2007-12-04 2009-10-01 Alnylam Pharmaceuticals, Inc. Folate Conjugates
US20090247607A1 (en) * 2006-03-24 2009-10-01 John Benson dsRNA COMPOSITIONS AND METHODS FOR TREATING HPV INFECTION
US20090258934A1 (en) * 2005-11-04 2009-10-15 Alnylam Pharmaceuticals, Inc. COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Nav1.8 GENE
US7605249B2 (en) 2002-11-26 2009-10-20 Medtronic, Inc. Treatment of neurodegenerative disease through intracranial delivery of siRNA
US20090275635A1 (en) * 2006-05-26 2009-11-05 Medical Research Council Screening method
US20090275638A1 (en) * 2008-04-17 2009-11-05 Kevin Fitzgerald Compositions and Methods for Inhibiting Expression of XBP-1 Gene
US7615618B2 (en) 2004-06-30 2009-11-10 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a non-phosphate backbone linkage
US20090285861A1 (en) * 2008-04-17 2009-11-19 Tzyy-Choou Wu Tumor cell-based cancer immunotherapeutic compositions and methods
US7626014B2 (en) 2004-04-27 2009-12-01 Alnylam Pharmaceuticals Single-stranded and double-stranded oligonucleotides comprising a 2-arylpropyl moiety
US20090306356A1 (en) * 2002-11-14 2009-12-10 Dharmacon,Inc. siRNA Targeting TNFalpha
US7632932B2 (en) 2004-08-04 2009-12-15 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a ligand tethered to a modified or non-natural nucleobase
US20100003317A1 (en) * 2008-03-27 2010-01-07 Akin Akinc Compositions and methods for mediating rnai in vivo
US20100010066A1 (en) * 2008-01-31 2010-01-14 Kevin Fitzgerald Optimized Methods For Delivery Of DSRNA Targeting The PCSK9 Gene
US20100016405A1 (en) * 2006-07-10 2010-01-21 Alnylam Pharmaceuticals, Inc Compositions and Methods for Inhibiting Expression of the MYC Gene
US20100015707A1 (en) * 2006-05-04 2010-01-21 Francois Jean-Charles Natt SHORT INTERFERING RIBONUCLEIC ACID (siRNA) FOR ORAL ADMINISTRATION
US20100035966A1 (en) * 2006-06-14 2010-02-11 Rosetta Inpharmatics Llc Methods and compositions for regulating cell cycle progression
US7674778B2 (en) 2004-04-30 2010-03-09 Alnylam Pharmaceuticals Oligonucleotides comprising a conjugate group linked through a C5-modified pyrimidine
US20100069461A1 (en) * 2005-11-09 2010-03-18 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of factor v leiden mutant gene
US20100087508A1 (en) * 2008-03-05 2010-04-08 David Bumcrot Compositions and Methods for Inhibiting Expression of Eg5 and VEGF Genes
US7695902B2 (en) 1996-06-06 2010-04-13 Isis Pharmaceuticals, Inc. Oligoribonucleotides and ribonucleases for cleaving RNA
US20100093831A1 (en) * 2003-03-12 2010-04-15 Vasgene Therapeutics, Inc. Nucleic acid compounds for inhibiting angiogenesis and tumor growth
US20100098664A1 (en) * 2007-11-28 2010-04-22 Mathieu Jean-Francois Desclaux Lentiviral vectors allowing RNAi mediated inhibition of GFAP and vimentin expression
US20100105759A1 (en) * 2007-01-16 2010-04-29 Abraham Hochberg H19 silencing nucleic acid agents for treating rheumatoid arthritis
US7709616B2 (en) 2004-05-14 2010-05-04 Rosetta Genomics Inc. Micrornas and uses thereof
US20100112686A1 (en) * 2008-10-15 2010-05-06 Qing Ge Short hairpin rnas for inhibition of gene expression
US20100113307A1 (en) * 2002-11-14 2010-05-06 Dharmacon, Inc. siRNA targeting vascular endothelial growth factor (VEGF)
US20100113564A1 (en) * 2002-02-20 2010-05-06 Mcswiggen James RNA Interference Mediated Inhibition of Interleukin and Interleukin Receptor Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20100120893A1 (en) * 2008-10-20 2010-05-13 Dinah Wen-Yee Sah Compositions and Methods for Inhibiting Expression of Transthyretin
US20100130595A1 (en) * 2008-08-25 2010-05-27 Dean Nicholas M Antisense oligonucleotides directed against connective tissue growth factor and uses thereof
US20100129429A1 (en) * 2005-11-07 2010-05-27 British Columbia Cancer Agency Inhibition of autophagy genes in cancer chemotherapy
US20100136026A1 (en) * 2007-09-26 2010-06-03 Kerr William G Ship Inhibition to Direct Hematopoietic Stem Cells and Induce Extramedullary Hematopoiesis
US7732591B2 (en) 2003-11-25 2010-06-08 Medtronic, Inc. Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of sirna
US20100144851A1 (en) * 2002-02-20 2010-06-10 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition of Platelet-Derived Endothelial Cell Growth Factor (ECGF1) Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20100144833A1 (en) * 2004-10-22 2010-06-10 Sailen Barik RNAi Modulation Of RSV, PIV And Other Respiratory Viruses And Uses Thereof
US20100144842A1 (en) * 2002-02-20 2010-06-10 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition of NOGO and NOGO Receptor Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20100151470A1 (en) * 2007-05-01 2010-06-17 University Of Massachusetts Methods and compositions for locating snp heterozygosity for allele specific diagnosis and therapy
US7745418B2 (en) 2001-10-12 2010-06-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting viral replication
US20100168206A1 (en) * 2008-12-10 2010-07-01 Jared Gollob GNAQ Targeted dsRNA Compositions And Methods For Inhibiting Expression
US20100168205A1 (en) * 2008-10-23 2010-07-01 Alnylam Pharmaceuticals, Inc. Methods and Compositions for Prevention or Treatment of RSV Infection Using Modified Duplex RNA Molecules
US7750144B2 (en) 2003-06-02 2010-07-06 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNA silencing
US20100184825A1 (en) * 2002-02-20 2010-07-22 Merck Sharp & Dohme Corp. RNA Interference Mediated Inhibition of Protein Tyrosine Phosphatase-1B (PTP-1B) Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20100183696A1 (en) * 2007-01-30 2010-07-22 Allergan, Inc Treating Ocular Diseases Using Peroxisome Proliferator-Activated Receptor Delta Antagonists
US20100184824A1 (en) * 2002-02-20 2010-07-22 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition of Interleukin and Interleukin Receptor Gene Expression Using Short Interfering Nucleic Acid (siNA)
US7763592B1 (en) 2003-11-20 2010-07-27 University Of South Florida SHIP-deficiency to increase megakaryocyte progenitor production
US20100190714A1 (en) * 2007-06-15 2010-07-29 Novatis Ag RNAi Inhibition of Alpha-ENaC Expression
US20100197773A1 (en) * 2009-02-03 2010-08-05 Birgit Bramlage Compositions and methods for inhibiting expression of ptp1b genes
US20100196403A1 (en) * 2007-01-29 2010-08-05 Jacob Hochman Antibody conjugates for circumventing multi-drug resistance
US20100204307A1 (en) * 2006-09-21 2010-08-12 Tomoko Nakayama Compositions And Methods For Inhibiting Expression Of The HAMP Gene
US20100204306A1 (en) * 2007-12-14 2010-08-12 Alnylam Pharmaceuticals, Inc. Method of Treating Neurodegenerative Disease
US7781575B2 (en) 2002-11-14 2010-08-24 Dharmacon, Inc. siRNA targeting tumor protein 53 (p53)
US20100216866A1 (en) * 2004-09-24 2010-08-26 Alnylam Pharmaceuticals, Inc. RNAi Modulation of APOB and Uses Thereof
US20100234446A1 (en) * 2004-11-24 2010-09-16 Philipp Hadwiger RNAi Modulation of the BCR-ABL Fusion Gene and Uses Thereof
US20100240730A1 (en) * 2002-02-20 2010-09-23 Merck Sharp And Dohme Corp. RNA Interference Mediated Inhibition of Gene Expression Using Chemically Modified Short Interfering Nucleic Acid (siNA)
US20100240441A1 (en) * 2007-09-14 2010-09-23 Konami Digital Entertainment Co., Ltd Game system, and game apparatus and challenge notifying apparatus constituting the game system
US20100249212A1 (en) * 2000-08-02 2010-09-30 University Of Southern California Gene Silencing Using mRNA-cDNA Hybrids
US20100249052A1 (en) * 2007-03-26 2010-09-30 Alnylam Pharmaceuticals, Inc. Dsrna compositions and methods for treating hpv infections
US7807646B1 (en) 2003-11-20 2010-10-05 University Of South Florida SHIP-deficiency to increase megakaryocyte progenitor production
US20100256218A1 (en) * 2004-12-14 2010-10-07 Olaf Heidenreich RNAi MODULATION OF MLL-AF4 AND USES THEREOF
US20100255023A1 (en) * 2007-11-30 2010-10-07 Si-Yi Chen Dendritic cell vaccine compositions and uses of same
US7812149B2 (en) 1996-06-06 2010-10-12 Isis Pharmaceuticals, Inc. 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations
US20100267810A1 (en) * 2005-08-18 2010-10-21 University Of Massachusetts Methods and compositions for treating neurological disease
US7819842B2 (en) 2006-11-21 2010-10-26 Medtronic, Inc. Chronically implantable guide tube for repeated intermittent delivery of materials or fluids to targeted tissue sites
US20100273863A1 (en) * 2009-04-24 2010-10-28 Board Of Regents, The University Of Texas System Modulation of Gene Expression Using Oligomers That Target Gene Regions Downstream of 3' Untranslated Regions
US20100278871A1 (en) * 2003-05-05 2010-11-04 Johns Hopkins University Anti-cancer dna vaccine employing plasmids encoding signal sequence, mutant oncoprotein antigen, and heat shock protein
US20100280102A1 (en) * 2003-06-13 2010-11-04 Alnylam Pharmaceuticals Double-stranded ribonucleic acid with increased effectiveness in an organism
US7829694B2 (en) 2002-11-26 2010-11-09 Medtronic, Inc. Treatment of neurodegenerative disease through intracranial delivery of siRNA
US20100286230A1 (en) * 2005-10-20 2010-11-11 Sylentis S.A.U. Modulation of trpv expression levels
US20100292305A1 (en) * 2005-06-27 2010-11-18 Akin Akinc RNAi MODULATION OF HIF-1 AND THERAPUTIC USES THEREOF
US20100291188A1 (en) * 2008-12-04 2010-11-18 Musc Foundation For Research Development Periostin Inhibitory Compositions for Myocardial Regeneration, Methods of Delivery, and Methods of Using Same
US20100298405A1 (en) * 2005-10-28 2010-11-25 Dinah Wen-Yee Sah Compositions And Methods For Inhibiting Expression Of Huntingtin Gene
US20100316703A1 (en) * 2000-12-01 2010-12-16 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Rna interference mediating small rna molecules
US20100330105A1 (en) * 2006-08-22 2010-12-30 John Hopkins University Anticancer Combination Therapies
US20110003882A1 (en) * 2006-05-19 2011-01-06 Alnylam Pharmaceuticals, Inc. RNAi Modulation of AHA and Therapeutic Uses Thereof
US20110003879A1 (en) * 2005-03-11 2011-01-06 Vincent Mark D Antisense oligonucleotides targeted to the coding region of thymidylate synthase and uses thereof
US20110015252A1 (en) * 2009-06-15 2011-01-20 Kevin Fitzgerald Lipid formulated dsrna targeting the pcsk9 gene
US20110020300A1 (en) * 2009-05-15 2011-01-27 Genentech, Inc. Compositions and methods for inhibiting expression of glucocorticoid receptor (gcr) genes
US7884086B2 (en) * 2004-09-08 2011-02-08 Isis Pharmaceuticals, Inc. Conjugates for use in hepatocyte free uptake assays
US20110034537A1 (en) * 2008-02-12 2011-02-10 De Fougerolles Antonin Compositions and methods for inhibiting expression of cd45 gene
US7888010B2 (en) 2004-05-28 2011-02-15 Asuragen, Inc. Methods and compositions involving microRNA
US20110038922A1 (en) * 2005-06-16 2011-02-17 Faron Pharmaceuticals Oy (A Finnish Company) Compounds for treating or preventing amine oxidase related diseases or disorders
US20110053226A1 (en) * 2008-06-13 2011-03-03 Riboxx Gmbh Method for enzymatic synthesis of chemically modified rna
US7902352B2 (en) 2005-05-06 2011-03-08 Medtronic, Inc. Isolated nucleic acid duplex for reducing huntington gene expression
US20110060031A1 (en) * 2007-03-29 2011-03-10 Alnylam Pharmaceuticals, Inc. Compositions And Methods For Inhibiting Expression Of A Gene From The Ebola Virus
WO2011035065A1 (en) 2009-09-17 2011-03-24 Nektar Therapeutics Monoconjugated chitosans as delivery agents for small interfering nucleic acids
US7923206B2 (en) * 2004-11-22 2011-04-12 Dharmacon, Inc. Method of determining a cellular response to a biological agent
US20110092565A1 (en) * 2003-06-09 2011-04-21 Alnylam Pharmaceuticals, Inc. Method of treating neurodegenerative disease
US20110098460A1 (en) * 2001-07-23 2011-04-28 Senesco Technologies, Inc. SiRNA Useful to Suppress expression of eIF-5A1
US7935811B2 (en) 2004-11-22 2011-05-03 Dharmacon, Inc. Apparatus and system having dry gene silencing compositions
US20110110483A1 (en) * 2009-11-06 2011-05-12 Searete Llc, A Limited Liability Corporation Of The State Of Delaware Methods and systems for migrating fuel assemblies in a nuclear fission reactor
US20110117088A1 (en) * 2004-05-12 2011-05-19 Simon Michael R Composition and method for introduction of rna interference sequences into targeted cells and tissues
US7951935B2 (en) 2002-11-14 2011-05-31 Dharmacon, Inc. siRNA targeting v-myc myelocytomatosis viral oncogene homolog (MYC)
US20110142917A1 (en) * 2008-06-06 2011-06-16 Egvenia Alpert Compositions and methods for treatment of ear disorders
US20110150897A1 (en) * 2006-10-11 2011-06-23 Meyer Thomas F Influenza targets
US20110160277A1 (en) * 2005-10-25 2011-06-30 Sylentis S.A.U. Modulation of 11 beta-hydroxysteriod dehydrogenase 1 expression for the treatment of ocular diseases
US20110166199A1 (en) * 2010-01-07 2011-07-07 National Cheng Kung University RNAi COMPOUND TARGETED TO THROMBOSPONDIN-1 AND APPLICATIONS THEREOF
US20110172291A1 (en) * 2003-09-12 2011-07-14 University Of Massachusetts Rna interference for the treatment of gain-of-function disorders
US20110172286A1 (en) * 2007-07-10 2011-07-14 Neurim Pharmaceuticals (1991) Ltd. Cd44 splice variants in neurodegenerative diseases
US20110184046A1 (en) * 2008-07-11 2011-07-28 Dinah Wen-Yee Sah Compositions And Methods For Inhibiting Expression Of GSK-3 Genes
US7988668B2 (en) 2006-11-21 2011-08-02 Medtronic, Inc. Microsyringe for pre-packaged delivery of pharmaceuticals
US20110190380A1 (en) * 2008-10-23 2011-08-04 Elena Feinstein Methods for delivery of sirna to bone marrow cells and uses thereof
US20110201667A1 (en) * 2009-07-20 2011-08-18 Protiva Biotherapeutics, Inc. Compositions and methods for silencing ebola virus gene expression
US20110207796A1 (en) * 2008-02-13 2011-08-25 Elan Pharma International Limited Alpha-synuclein kinase
US20110213328A1 (en) * 2004-03-18 2011-09-01 Medtronic, Inc. Methods and Systems for Treatment of Neurological Diseases of the Central Nervous System
US20110230542A1 (en) * 2006-05-11 2011-09-22 Pamela Tan Compositions and Methods for Inhibiting Expression of the PCSK9 Gene
US20110245325A1 (en) * 2008-12-12 2011-10-06 Kureha Corporation Pharmaceutical composition for treatment of cancer and asthma
US8058255B2 (en) 2004-12-23 2011-11-15 Applied Biosystems, Llc Methods and compositions concerning siRNA's as mediators of RNA interference
US8058448B2 (en) 2004-04-05 2011-11-15 Alnylam Pharmaceuticals, Inc. Processes and reagents for sulfurization of oligonucleotides
US8058069B2 (en) 2008-04-15 2011-11-15 Protiva Biotherapeutics, Inc. Lipid formulations for nucleic acid delivery
US8071562B2 (en) 2007-12-01 2011-12-06 Mirna Therapeutics, Inc. MiR-124 regulated genes and pathways as targets for therapeutic intervention
US8198427B1 (en) 2002-11-14 2012-06-12 Dharmacon, Inc. SiRNA targeting catenin, beta-1 (CTNNB1)
US8222221B2 (en) 2008-06-04 2012-07-17 The Board Of Regents Of The University Of Texas System Modulation of gene expression through endogenous small RNA targeting of gene promoters
US20120202215A1 (en) * 2005-11-24 2012-08-09 Jichi Medical University Mitochondrial function of prohibitin 2 (phb2)
US8258112B2 (en) 2005-05-06 2012-09-04 Medtronic, Inc Methods and sequences to suppress primate huntington gene Expression
US8258111B2 (en) 2008-05-08 2012-09-04 The Johns Hopkins University Compositions and methods related to miRNA modulation of neovascularization or angiogenesis
US8283333B2 (en) 2009-07-01 2012-10-09 Protiva Biotherapeutics, Inc. Lipid formulations for nucleic acid delivery
US8288354B2 (en) * 2005-12-28 2012-10-16 The Scripps Research Institute Natural antisense and non-coding RNA transcripts as drug targets
US8293719B2 (en) 2004-03-12 2012-10-23 Alnylam Pharmaceuticals, Inc. iRNA agents targeting VEGF
US8324367B2 (en) 2006-11-03 2012-12-04 Medtronic, Inc. Compositions and methods for making therapies delivered by viral vectors reversible for safety and allele-specificity
US8324366B2 (en) 2008-04-29 2012-12-04 Alnylam Pharmaceuticals, Inc. Compositions and methods for delivering RNAI using lipoproteins
US8334273B2 (en) 2007-12-10 2012-12-18 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of factor VII gene
US8361714B2 (en) 2007-09-14 2013-01-29 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
DE102011118024A1 (en) 2011-08-01 2013-02-07 Technische Universität Dresden New procaspase 1 expression inhibitor, useful for preventing and/or treating inflammatory diseases, which are autoinflammatory diseases
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
US20130065939A1 (en) * 2009-09-23 2013-03-14 Protiva Biotherapeutics, Inc. Compositions and methods for silencing genes expressed in cancer
US8444983B2 (en) 2009-03-23 2013-05-21 Quark Pharmaceuticals, Inc. Composition of anti-ENDO180 antibodies and methods of use for the treatment of cancer and fibrotic diseases
US20130131331A1 (en) * 2004-11-19 2013-05-23 Genecare Research Institute Co., Ltd. Cancer-cell-specific cytostatic agent
US8455455B1 (en) 2010-03-31 2013-06-04 Protiva Biotherapeutics, Inc. Compositions and methods for silencing genes involved in hemorrhagic fever
US8470792B2 (en) 2008-12-04 2013-06-25 Opko Pharmaceuticals, Llc. Compositions and methods for selective inhibition of VEGF
US20130224311A1 (en) * 2010-03-19 2013-08-29 University Of South Alabama Methods and compositions for the treatment of cancer
US8524680B2 (en) * 2002-02-01 2013-09-03 Applied Biosystems, Llc High potency siRNAS for reducing the expression of target genes
US8546554B2 (en) 2008-09-25 2013-10-01 Alnylam Pharmaceuticals, Inc. Lipid formulated compositions and methods for inhibiting expression of Serum Amyloid A gene
US8569474B2 (en) 2004-03-09 2013-10-29 Isis Pharmaceuticals, Inc. Double stranded constructs comprising one or more short strands hybridized to a longer strand
US8569256B2 (en) 2009-07-01 2013-10-29 Protiva Biotherapeutics, Inc. Cationic lipids and methods for the delivery of therapeutic agents
US8592570B2 (en) 2008-10-06 2013-11-26 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of an RNA from West Nile virus
US8604183B2 (en) 2002-11-05 2013-12-10 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
US20130331435A1 (en) * 2002-05-23 2013-12-12 Isis Pharmaceuticals, Inc. Antisense modulation of kinesin-like 1 expression
US8618277B2 (en) 2002-02-20 2013-12-31 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20140010893A1 (en) * 2010-05-12 2014-01-09 University Of South Carolina Methods for Affecting Homology-Directed DNA Double Stranded Break Repair
US8648185B2 (en) 2002-02-20 2014-02-11 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20140057962A1 (en) * 2011-03-11 2014-02-27 Surinder K. Batra Compositions and Methods for the Treatment of Cancer
US20140057960A1 (en) * 2009-05-05 2014-02-27 Medical Diagnostic Laboratories, Llc Novel repressor on ifn-lambda promoter and sirna against zeb1 and blimp-1 to increase ifn-lambda gene activity
US8664189B2 (en) 2008-09-22 2014-03-04 Rxi Pharmaceuticals Corporation RNA interference in skin indications
US8703930B2 (en) 2004-04-09 2014-04-22 Genecare Research Institute Co., Ltd. Cancer cell-specific apoptosis-inducing agents that target chromosome stabilization-associated genes
US8722641B2 (en) 2010-01-29 2014-05-13 St. Jude Children's Research Hospital Oligonucleotides which inhibit p53 induction in response to cellular stress
US20140135379A1 (en) * 2007-06-29 2014-05-15 Niigata University Method of fixing and expressing physiologically active substance
US20140179768A1 (en) * 2011-06-21 2014-06-26 Alnylam Pharmaceuticals, Inc. ANGIOPOIETIN-LIKE 3 (ANGPTL3) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
US8815818B2 (en) 2008-07-18 2014-08-26 Rxi Pharmaceuticals Corporation Phagocytic cell delivery of RNAI
US8822426B2 (en) 2009-05-05 2014-09-02 Beeologics Inc. Prevention and treatment of nosema disease in bees
US8859516B2 (en) 2009-09-15 2014-10-14 Alnylam Pharmaceuticals, Inc. Lipid formulated compositions and methods for inhibiting expression of Eg5 and VEGF genes
US20140315973A1 (en) * 2010-10-07 2014-10-23 Agency For Science, Technology And Research Parp-1 inhibitors
US8871730B2 (en) 2009-07-13 2014-10-28 Somagenics Inc. Chemical modification of short small hairpin RNAs for inhibition of gene expression
US20140364485A1 (en) * 2012-01-06 2014-12-11 University Of South Alabama Methods and compositions for the treatment of cancer
US8957198B2 (en) 2003-02-03 2015-02-17 Medtronic, Inc. Compositions, devices and methods for treatment of Huntington's disease through intracranial delivery of sirna
US8962584B2 (en) 2009-10-14 2015-02-24 Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd. Compositions for controlling Varroa mites in bees
US9006417B2 (en) 2010-06-30 2015-04-14 Protiva Biotherapeutics, Inc. Non-liposomal systems for nucleic acid delivery
US9018187B2 (en) 2009-07-01 2015-04-28 Protiva Biotherapeutics, Inc. Cationic lipids and methods for the delivery of therapeutic agents
US9023820B2 (en) 2009-01-26 2015-05-05 Protiva Biotherapeutics, Inc. Compositions and methods for silencing apolipoprotein C-III expression
US9029338B2 (en) 2009-08-14 2015-05-12 Alnylam Pharmaceuticals, Inc. Lipid formulated compositions and methods for inhibiting expression of a gene from the ebola virus
US9051567B2 (en) 2009-06-15 2015-06-09 Tekmira Pharmaceuticals Corporation Methods for increasing efficacy of lipid formulated siRNA
US9051570B2 (en) 2007-05-22 2015-06-09 Arcturus Therapeutics, Inc. UNA oligomers for therapeutics
US9057069B2 (en) 2006-03-31 2015-06-16 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of Eg5 gene
US9068184B2 (en) 2011-06-21 2015-06-30 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibition of expression of protein C (PROC) genes
US9074211B2 (en) 2008-11-19 2015-07-07 Rxi Pharmaceuticals Corporation Inhibition of MAP4K4 through RNAI
US9080171B2 (en) 2010-03-24 2015-07-14 RXi Parmaceuticals Corporation Reduced size self-delivering RNAi compounds
US9085638B2 (en) 2007-03-07 2015-07-21 The Johns Hopkins University DNA vaccine enhancement with MHC class II activators
US20150202223A1 (en) * 2012-10-02 2015-07-23 The General Hospital Corporation Methods relating to dna-sensing pathway related conditions
US9089610B2 (en) 2008-08-19 2015-07-28 Nektar Therapeutics Complexes of small-interfering nucleic acids
US9096636B2 (en) 1996-06-06 2015-08-04 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
US9095504B2 (en) 2010-03-24 2015-08-04 Rxi Pharmaceuticals Corporation RNA interference in ocular indications
US9101643B2 (en) 2009-11-03 2015-08-11 Alnylam Pharmaceuticals, Inc. Lipid formulated compositions and methods for inhibiting expression of transthyretin (TTR)
US9133517B2 (en) 2005-06-28 2015-09-15 Medtronics, Inc. Methods and sequences to preferentially suppress expression of mutated huntingtin
US9139554B2 (en) 2008-10-09 2015-09-22 Tekmira Pharmaceuticals Corporation Amino lipids and methods for the delivery of nucleic acids
US9173894B2 (en) 2011-02-02 2015-11-03 Excaliard Pharamaceuticals, Inc. Method of treating keloids or hypertrophic scars using antisense compounds targeting connective tissue growth factor (CTGF)
US9181546B2 (en) 2004-12-17 2015-11-10 Beth Israel Deaconess Medical Center Compositions for bacterial mediated gene silencing and methods of using same
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9187746B2 (en) 2009-09-22 2015-11-17 Alnylam Pharmaceuticals, Inc. Dual targeting siRNA agents
US9200276B2 (en) 2009-06-01 2015-12-01 Halo-Bio Rnai Therapeutics, Inc. Polynucleotides for multivalent RNA interference, compositions and methods of use thereof
US9228186B2 (en) 2002-11-14 2016-01-05 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9228188B2 (en) 2011-06-21 2016-01-05 Alnylam Pharmaceuticals, Inc. Compositions and method for inhibiting hepcidin antimicrobial peptide (HAMP) or HAMP-related gene expression
US20160024504A1 (en) * 2013-03-15 2016-01-28 Constellation Pharmaceuticals, Inc. Treating th2-mediated diseases by inhibition of bromodomains
US20160032402A1 (en) * 2013-03-15 2016-02-04 Novartis Ag Biomarkers associated with brm inhibition
US9260715B2 (en) 2007-01-16 2016-02-16 The University Of Queensland Method of inducing an immune response
US9260471B2 (en) 2010-10-29 2016-02-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US9273356B2 (en) 2006-05-24 2016-03-01 Medtronic, Inc. Methods and kits for linking polymorphic sequences to expanded repeat mutations
US9315813B2 (en) 2011-06-21 2016-04-19 Alnylam Pharmaceuticals, Inc Compositions and methods for inhibition of expression of apolipoprotein C-III (APOC3) genes
US9340786B2 (en) 2010-03-24 2016-05-17 Rxi Pharmaceuticals Corporation RNA interference in dermal and fibrotic indications
US9375440B2 (en) 2006-11-03 2016-06-28 Medtronic, Inc. Compositions and methods for making therapies delivered by viral vectors reversible for safety and allele-specificity
US9399775B2 (en) 2011-11-18 2016-07-26 Alnylam Pharmaceuticals, Inc. RNAi agents, compositions and methods of use thereof for treating transthyretin (TTR) associated diseases
US20160215285A1 (en) * 2012-12-30 2016-07-28 The Regents Of The University Of California Methods of modulating compliance of the trabecular meshwork
US9493774B2 (en) 2009-01-05 2016-11-15 Rxi Pharmaceuticals Corporation Inhibition of PCSK9 through RNAi
US9492386B2 (en) 2002-06-28 2016-11-15 Protiva Biotherapeutics, Inc. Liposomal apparatus and manufacturing methods
US9587240B2 (en) 2001-01-09 2017-03-07 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
WO2017050848A1 (en) * 2015-09-21 2017-03-30 Oommen Oommen P Nucleic acid molecules with enhanced activity
US9611478B2 (en) 2011-02-03 2017-04-04 Mirna Therapeutics, Inc. Synthetic mimics of miR-124
US9642872B2 (en) 2010-09-30 2017-05-09 University Of Zurich Treatment of B-cell lymphoma with microRNA
US9644241B2 (en) 2011-09-13 2017-05-09 Interpace Diagnostics, Llc Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20170152513A1 (en) * 2008-09-15 2017-06-01 Children's Medical Center Corporation Modulation of bcl11a for treatment of hemoglobinopathies
US9719092B2 (en) 2002-11-14 2017-08-01 Thermo Fisher Scientific Inc. RNAi targeting CNTD2
US9719094B2 (en) 2002-11-14 2017-08-01 Thermo Fisher Scientific Inc. RNAi targeting SEC61G
US9745574B2 (en) 2009-02-04 2017-08-29 Rxi Pharmaceuticals Corporation RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
US9771586B2 (en) 2002-11-14 2017-09-26 Thermo Fisher Scientific Inc. RNAi targeting ZNF205
US9808479B2 (en) 2012-09-05 2017-11-07 Sylentis Sau SiRNA and their use in methods and compositions for the treatment and / or prevention of eye conditions
US9839649B2 (en) 2002-11-14 2017-12-12 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9856475B2 (en) 2014-03-25 2018-01-02 Arcturus Therapeutics, Inc. Formulations for treating amyloidosis
US9879266B2 (en) 2002-11-14 2018-01-30 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9982259B2 (en) 2014-03-25 2018-05-29 Arcturus Therapeutics, Inc. Transthyretin allele selective UNA oligomers for gene silencing
US10011832B2 (en) 2012-09-05 2018-07-03 Sylentis Sau SiRNA and their use in methods and compositions for the treatment and/or prevention of eye conditions
US10011837B2 (en) 2014-03-04 2018-07-03 Sylentis Sau SiRNAs and their use in methods and compositions for the treatment and/or prevention of eye conditions
US10011836B2 (en) 2002-11-14 2018-07-03 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US10060921B2 (en) 2014-08-29 2018-08-28 Alnylam Pharmaceuticals, Inc. Methods of treating transthyretin (TTR) mediated amyloidosis
US10131904B2 (en) 2008-02-11 2018-11-20 Rxi Pharmaceuticals Corporation Modified RNAi polynucleotides and uses thereof
US10208307B2 (en) 2015-07-31 2019-02-19 Alnylam Pharmaceuticals, Inc. Transthyretin (TTR) iRNA compositions and methods of use thereof for treating or preventing TTR-associated diseases
US10214745B2 (en) 2012-03-15 2019-02-26 The Scripps Research Institute Treatment of brain derived neurotrophic factor (BDNF) related diseases by inhibition of natural antisense transcript to BDNF
US10246709B2 (en) 2016-03-07 2019-04-02 Arrowhead Pharmaceuticals, Inc. Targeting ligands for therapeutic compounds
US10287588B2 (en) 2014-04-25 2019-05-14 The Childrens's Medical Center Corporation Compositions and methods to treating hemoglobinopathies
US10294474B2 (en) 2016-09-02 2019-05-21 Arrowhead Pharmaceuticals, Inc. Targeting ligands
US10364429B2 (en) 2013-06-13 2019-07-30 University Of Massachusetts Methods and compositions for controlling efficacy of RNA silencing

Families Citing this family (588)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH08500481A (en) * 1992-05-11 1996-01-23 リボザイム・ファーマシューティカルズ・インコーポレーテッド Methods and agents for inhibiting the replication of the virus
US20030206887A1 (en) * 1992-05-14 2003-11-06 David Morrissey RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)
US5639647A (en) * 1994-03-29 1997-06-17 Ribozyme Pharmaceuticals, Inc. 2'-deoxy-2'alkylnucleotide containing nucleic acid
US20050075304A1 (en) * 2001-11-30 2005-04-07 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050054596A1 (en) * 2001-11-30 2005-03-10 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20070203333A1 (en) * 2001-11-30 2007-08-30 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20040198682A1 (en) * 2001-11-30 2004-10-07 Mcswiggen James RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (siNA)
US20050267058A1 (en) * 2001-05-18 2005-12-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (sINA)
US20050148530A1 (en) 2002-02-20 2005-07-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20040219569A1 (en) * 1999-07-06 2004-11-04 Fruma Yehiely Gene identification method
JP2005517437A (en) * 2002-02-20 2005-06-16 サーナ・セラピューティクス・インコーポレイテッドSirna Therapeutics,Inc. Inhibition RNA interference mediated epidermal growth factor receptor gene expression using short interfering nucleic acid (siNA)
BRPI9908967B1 (en) 1998-03-20 2017-05-30 Benitec Australia Ltd Methods for suppressing, delaying or otherwise reducing the expression of a target gene in a plant cell
AUPP249298A0 (en) 1998-03-20 1998-04-23 Ag-Gene Australia Limited Synthetic genes and genetic constructs comprising same I
AU3751299A (en) * 1998-04-20 1999-11-08 Ribozyme Pharmaceuticals, Inc. Nucleic acid molecules with novel chemical compositions capable of modulating gene expression
AU776150B2 (en) 1999-01-28 2004-08-26 Medical College Of Georgia Research Institute, Inc. Composition and method for (in vivo) and (in vitro) attenuation of gene expression using double stranded RNA
US7829693B2 (en) * 1999-11-24 2010-11-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
DE19956568A1 (en) * 1999-01-30 2000-08-17 Roland Kreutzer Method and medicament for the inhibition of expression of a given gene
US7601494B2 (en) 1999-03-17 2009-10-13 The University Of North Carolina At Chapel Hill Method of screening candidate compounds for susceptibility to biliary excretion
ES2418360T3 (en) 1999-04-09 2013-08-13 Kyowa Hakko Kirin Co., Ltd. Method for controlling the activity of a molecule immunofunctional
US6656698B1 (en) * 1999-06-30 2003-12-02 Millennium Pharmaceuticals, Inc. 12832, a novel human kinase-like molecule and uses thereof
US6423885B1 (en) 1999-08-13 2002-07-23 Commonwealth Scientific And Industrial Research Organization (Csiro) Methods for obtaining modified phenotypes in plant cells
US7179796B2 (en) * 2000-01-18 2007-02-20 Isis Pharmaceuticals, Inc. Antisense modulation of PTP1B expression
WO2002081628A2 (en) * 2001-04-05 2002-10-17 Ribozyme Pharmaceuticals, Incorporated Modulation of gene expression associated with inflammation proliferation and neurite outgrowth, using nucleic acid based technologies
US8202846B2 (en) 2000-03-16 2012-06-19 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US20030084471A1 (en) * 2000-03-16 2003-05-01 David Beach Methods and compositions for RNA interference
CA2403397A1 (en) * 2000-03-16 2001-09-20 Genetica, Inc. Methods and compositions for rna interference
DK2361981T4 (en) * 2000-03-30 2019-05-13 The Whitehead Institute For Biomedical Res Rna sequence specific mediators of rna interference
US20080188430A1 (en) * 2001-05-18 2008-08-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hypoxia inducible factor 1 (HIF1) gene expression using short interfering nucleic acid (siNA)
US20050032733A1 (en) * 2001-05-18 2005-02-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SiNA)
US7795422B2 (en) 2002-02-20 2010-09-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hypoxia inducible factor 1 (HIF1) gene expression using short interfering nucleic acid (siNA)
US6946292B2 (en) 2000-10-06 2005-09-20 Kyowa Hakko Kogyo Co., Ltd. Cells producing antibody compositions with increased antibody dependent cytotoxic activity
DE10230996A1 (en) * 2001-10-26 2003-07-17 Ribopharma Ag Method for inhibiting viral replication, useful particularly for treating hepatitis C infection, by altering the 3'-untranslated region of the virus
CN1604783A (en) * 2001-10-26 2005-04-06 里伯药品公司 Drug for treating a fibrotic disease through rna interfence
DE10160151A1 (en) * 2001-01-09 2003-06-26 Ribopharma Ag Inhibiting expression of target gene, useful e.g. for inhibiting oncogenes, by administering double-stranded RNA complementary to the target and having an overhang
US7767802B2 (en) 2001-01-09 2010-08-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
WO2003035870A1 (en) * 2001-10-26 2003-05-01 Ribopharma Ag Drug for treating a carcinoma of the pancreas
DE10100586C1 (en) 2001-01-09 2002-04-11 Ribopharma Ag Inhibiting gene expression in cells, useful for e.g. treating tumors, by introducing double-stranded complementary oligoRNA having unpaired terminal bases
JP2005506087A (en) * 2001-10-26 2005-03-03 リボファーマ アーゲー Use of double-stranded ribonucleic acid for treating an infection with positive stranded rna virus
CA2369944A1 (en) 2001-01-31 2002-07-31 Nucleonics Inc. Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
US20060211642A1 (en) * 2001-05-18 2006-09-21 Sirna Therapeutics, Inc. RNA inteference mediated inhibition of hepatitis C virus (HVC) gene expression using short interfering nucleic acid (siNA)
US7935812B2 (en) 2002-02-20 2011-05-03 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of hepatitis C virus (HCV) expression using short interfering nucleic acid (siNA)
US20050209180A1 (en) * 2001-05-18 2005-09-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hepatitis C virus (HCV) expression using short interfering nucleic acid (siNA)
AU2003219817B2 (en) 2002-02-20 2006-08-31 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hepatitis C virus
US20050176663A1 (en) * 2001-05-18 2005-08-11 Sima Therapeutics, Inc. RNA interference mediated inhibition of protein tyrosine phosphatase type IVA (PRL3) gene expression using short interfering nucleic acid (siNA)
US20050287128A1 (en) * 2001-05-18 2005-12-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of TGF-beta and TGF-beta receptor gene expression using short interfering nucleic acid (siNA)
US20050256068A1 (en) 2001-05-18 2005-11-17 Sirna Therapeutics, Inc. RNA interference mediated inhibition of stearoyl-CoA desaturase (SCD) gene expression using short interfering nucleic acid (siNA)
US20050203040A1 (en) * 2001-05-18 2005-09-15 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA)
US20060142225A1 (en) * 2001-05-18 2006-06-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cyclin dependent kinase-2 (CDK2) gene expression using short interfering nucleic acid (siNA)
US7700760B2 (en) 2002-02-20 2010-04-20 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA)
US20070042983A1 (en) * 2001-05-18 2007-02-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050288242A1 (en) * 2001-05-18 2005-12-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of RAS gene expression using short interfering nucleic acid (siNA)
US20050158735A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of proliferating cell nuclear antigen (PCNA) gene expression using short interfering nucleic acid (siNA)
CA2541643A1 (en) * 2002-02-20 2005-05-19 Sirna Therapeutics, Inc. Rna interference mediated inhibition of hairless (hr) gene expression using short interfering nucleic acid (sina)
US20050222066A1 (en) * 2001-05-18 2005-10-06 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20070093437A1 (en) * 2001-05-18 2007-04-26 Sirna Therapeutics, Inc. Rna interference mediated inhibition of xiap gene expression using short interfering nucleic acid (sina)
US20050096284A1 (en) * 2002-02-20 2005-05-05 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US7109165B2 (en) * 2001-05-18 2006-09-19 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US7897752B2 (en) 2002-02-20 2011-03-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of telomerase gene expression using short interfering nucleic acid (siNA)
US20050233997A1 (en) * 2001-05-18 2005-10-20 Sirna Therapeutics, Inc. RNA interference mediated inhibition of matrix metalloproteinase 13 (MMP13) gene expression using short interfering nucleic acid (siNA)
US20050136436A1 (en) * 2001-05-18 2005-06-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of G72 and D-amino acid oxidase (DAAO) gene expression using short interfering nucleic acid (siNA)
US20050164224A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cyclin D1 gene expression using short interfering nucleic acid (siNA)
US20050124566A1 (en) * 2001-05-18 2005-06-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of myostatin gene expression using short interfering nucleic acid (siNA)
US20050176666A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GPRA and AAA1 gene expression using short interfering nucleic acid (siNA)
US20080039414A1 (en) * 2002-02-20 2008-02-14 Sima Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20050159379A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc RNA interference mediated inhibition of gastric inhibitory polypeptide (GIP) and gastric inhibitory polypeptide receptor (GIPR) gene expression using short interfering nucleic acid (siNA)
US20080161256A1 (en) * 2001-05-18 2008-07-03 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050143333A1 (en) * 2001-05-18 2005-06-30 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (SINA)
US20050119212A1 (en) * 2001-05-18 2005-06-02 Sirna Therapeutics, Inc. RNA interference mediated inhibition of FAS and FASL gene expression using short interfering nucleic acid (siNA)
US20050182007A1 (en) * 2001-05-18 2005-08-18 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (SINA)
US7893248B2 (en) 2002-02-20 2011-02-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Myc and/or Myb gene expression using short interfering nucleic acid (siNA)
JP2007525206A (en) * 2003-10-23 2007-09-06 サーナ・セラピューティクス・インコーポレイテッドSirna Therapeutics,Inc. Using short interfering nucleic acid (siNA), inhibition of cholinergic muscarinic receptors via RNA interference (CHRM3) gene expression
US9994853B2 (en) 2001-05-18 2018-06-12 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US7897753B2 (en) 2002-02-20 2011-03-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of XIAP gene expression using short interfering nucleic acid (siNA)
US20060148743A1 (en) * 2001-05-18 2006-07-06 Vasant Jadhav RNA interference mediated inhibition of histone deacetylase (HDAC) gene expression using short interfering nucleic acid (siNA)
US20050233344A1 (en) * 2001-05-18 2005-10-20 Sirna Therapeutics, Inc. RNA interference mediated inhibition of platelet derived growth factor (PDGF) and platelet derived growth factor receptor (PDGFR) gene expression using short interfering nucleic acid (siNA)
US7928219B2 (en) 2002-02-20 2011-04-19 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (SINA)
US7928220B2 (en) 2002-02-20 2011-04-19 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of stromal cell-derived factor-1 (SDF-1) gene expression using short interfering nucleic acid (siNA)
US20050079610A1 (en) * 2001-05-18 2005-04-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Fos gene expression using short interfering nucleic acid (siNA)
US8258288B2 (en) 2002-02-20 2012-09-04 Sirna Therapeutics, Inc. RNA interference mediated inhibition of respiratory syncytial virus (RSV) expression using short interfering nucleic acid (siNA)
CA2543013A1 (en) * 2003-10-23 2005-05-19 Sirna Therapeutics, Inc. Rna interference mediated inhibition of nogo and nogo receptor gene expression using short interfering nucleic acid (sina)
US20050196767A1 (en) * 2001-05-18 2005-09-08 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acis (siNA)
US20050137155A1 (en) * 2001-05-18 2005-06-23 Sirna Therapeutics, Inc. RNA interference mediated treatment of Parkinson disease using short interfering nucleic acid (siNA)
US20050153914A1 (en) * 2001-05-18 2005-07-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of MDR P-glycoprotein gene expression using short interfering nucleic acid (siNA)
US7517864B2 (en) 2001-05-18 2009-04-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050014172A1 (en) 2002-02-20 2005-01-20 Ivan Richards RNA interference mediated inhibition of muscarinic cholinergic receptor gene expression using short interfering nucleic acid (siNA)
US20050196781A1 (en) * 2001-05-18 2005-09-08 Sirna Therapeutics, Inc. RNA interference mediated inhibition of STAT3 gene expression using short interfering nucleic acid (siNA)
US20050048529A1 (en) * 2002-02-20 2005-03-03 Sirna Therapeutics, Inc. RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA)
US20070270579A1 (en) * 2001-05-18 2007-11-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20090299045A1 (en) * 2001-05-18 2009-12-03 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition Of Interleukin and Interleukin Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20050282188A1 (en) * 2001-05-18 2005-12-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050164968A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of ADAM33 gene expression using short interfering nucleic acid (siNA)
US7667030B2 (en) 2002-02-20 2010-02-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of matrix metalloproteinase 13 (MMP13) gene expression using short interfering nucleic acid (siNA)
US20050164967A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US20050159382A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA)
US20050159378A1 (en) 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Myc and/or Myb gene expression using short interfering nucleic acid (siNA)
US8008472B2 (en) 2001-05-29 2011-08-30 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA)
US20070270360A1 (en) * 2003-04-15 2007-11-22 Sirna Therapeutics, Inc. Rna Interference Mediated Inhibition of Severe Acute Respiratory Syndrome (Sars) Gene Expression Using Short Interfering Nucleic Acid
US20050124569A1 (en) * 2001-05-18 2005-06-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of CXCR4 gene expression using short interfering nucleic acid (siNA)
US20050159380A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of angiopoietin gene expression using short interfering nucleic acid (siNA)
US8067575B2 (en) 2002-02-20 2011-11-29 Merck, Sharp & Dohme Corp. RNA interference mediated inhibition of cyclin D1 gene expression using short interfering nucleic acid (siNA)
US20050187174A1 (en) * 2001-05-18 2005-08-25 Sirna Therapeutics, Inc. RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA)
US20050196765A1 (en) * 2001-05-18 2005-09-08 Sirna Therapeutics, Inc. RNA interference mediated inhibition of checkpoint Kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA)
US20050191618A1 (en) * 2001-05-18 2005-09-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA)
US20050261219A1 (en) * 2001-05-18 2005-11-24 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA)
WO2002097114A2 (en) * 2001-05-29 2002-12-05 Sirna Therapeutics, Inc. Nucleic acid treatment of diseases or conditions related to levels of ras, her2 and hiv
US20030175950A1 (en) * 2001-05-29 2003-09-18 Mcswiggen James A. RNA interference mediated inhibition of HIV gene expression using short interfering RNA
US20040138163A1 (en) * 2002-05-29 2004-07-15 Mcswiggen James RNA interference mediated inhibition of vascular edothelial growth factor and vascular edothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
EP2270024B1 (en) 2001-06-21 2018-10-24 Ionis Pharmaceuticals, Inc. Antisense modulation of superoxide dismutase 1, soluble expression
US20050019915A1 (en) 2001-06-21 2005-01-27 Bennett C. Frank Antisense modulation of superoxide dismutase 1, soluble expression
WO2003006477A1 (en) 2001-07-12 2003-01-23 University Of Massachusetts IN VIVO PRODUCTION OF SMALL INTERFERING RNAs THAT MEDIATE GENE SILENCING
US20030198627A1 (en) * 2001-09-01 2003-10-23 Gert-Jan Arts siRNA knockout assay method and constructs
AU2002348163A1 (en) * 2001-11-02 2003-05-19 Intradigm Corporation Therapeutic methods for nucleic acid delivery vehicles
US7294504B1 (en) 2001-12-27 2007-11-13 Allele Biotechnology & Pharmaceuticals, Inc. Methods and compositions for DNA mediated gene silencing
DE60322509D1 (en) * 2002-01-17 2008-09-11 Univ British Columbia Bispecific antisense oligonucleotides inhibit IGFBP-2 and IGFBP-5, and their use
DE10202419A1 (en) 2002-01-22 2003-08-07 Ribopharma Ag A method for inhibiting the expression of a caused by a chromosome aberration target gene
EP1499631A4 (en) * 2002-02-20 2006-01-25 Sirna Therapeutics Inc Rna interference mediated inhibition of tgf-beta and tgf-beta receptor gene expression using short interfering nucleic acid (sina)
WO2003106476A1 (en) * 2002-02-20 2003-12-24 Sirna Therapeutics, Inc Nucleic acid mediated inhibition of enterococcus infection and cytolysin toxin activity
US20030190635A1 (en) * 2002-02-20 2003-10-09 Mcswiggen James A. RNA interference mediated treatment of Alzheimer's disease using short interfering RNA
US20040019001A1 (en) * 2002-02-20 2004-01-29 Mcswiggen James A. RNA interference mediated inhibition of protein typrosine phosphatase-1B (PTP-1B) gene expression using short interfering RNA
WO2003072745A2 (en) * 2002-02-22 2003-09-04 Eshleman James R Antigene locks and therapeutic uses thereof
EP1575481A4 (en) * 2002-03-01 2010-01-06 Celltech R & D Inc Methods to increase or decrease bone density
US7274703B2 (en) * 2002-03-11 2007-09-25 3Com Corporation Stackable network units with resiliency facility
US7357928B2 (en) 2002-04-08 2008-04-15 University Of Louisville Research Foundation, Inc. Method for the diagnosis and prognosis of malignant diseases
US20040009946A1 (en) 2002-05-23 2004-01-15 Ceptyr, Inc. Modulation of PTP1B expression and signal transduction by RNA interference
AU2003237686A1 (en) * 2002-05-24 2003-12-12 Max-Planck Gesellschaft Zur Forderung Der Wissenschaften E.V. Rna interference mediating small rna molecules
US20100075423A1 (en) * 2002-06-12 2010-03-25 Life Technologies Corporation Methods and compositions relating to polypeptides with rnase iii domains that mediate rna interference
US20040248094A1 (en) * 2002-06-12 2004-12-09 Ford Lance P. Methods and compositions relating to labeled RNA molecules that reduce gene expression
EP1532271A4 (en) * 2002-06-12 2006-10-18 Ambion Inc Methods and compositions relating to polypeptides with rnase iii domains that mediate rna interference
EP1513538A4 (en) * 2002-06-14 2007-08-22 Mirus Bio Corp Novel methods for the delivery of polynucleotides to cells
US20100009856A1 (en) * 2002-06-21 2010-01-14 Sinogenomax Sompany LTD. Randomized dna libraries and double-stranded rna libraries, use and method of production thereof
AU2003254334A1 (en) 2002-07-10 2004-02-02 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Rna-interference by single-stranded rna molecules
AU2012216354B2 (en) * 2002-08-05 2016-01-14 Silence Therapeutics Gmbh Further novel forms of interfering RNA molecules
AU2015264957B2 (en) * 2002-08-05 2017-10-26 Silence Therapeutics Gmbh Further novel forms of interfering rna molecules
US20050042646A1 (en) 2002-08-05 2005-02-24 Davidson Beverly L. RNA interference suppresion of neurodegenerative diseases and methods of use thereof
ES2280826T5 (en) * 2002-08-05 2017-08-03 Silence Therapeutics Gmbh Additional new forms of interfering RNA molecules
US20080274989A1 (en) 2002-08-05 2008-11-06 University Of Iowa Research Foundation Rna Interference Suppression of Neurodegenerative Diseases and Methods of Use Thereof
KR20120029002A (en) * 2002-08-05 2012-03-23 사일런스 테라퓨틱스 아게 Further novel forms of interfeing rna molecules
ES2389024T3 (en) 2002-08-05 2012-10-22 Silence Therapeutics Aktiengesellschaft Interfering RNA molecules blunting
US20040241854A1 (en) 2002-08-05 2004-12-02 Davidson Beverly L. siRNA-mediated gene silencing
US20040029275A1 (en) * 2002-08-10 2004-02-12 David Brown Methods and compositions for reducing target gene expression using cocktails of siRNAs or constructs expressing siRNAs
AU2003260399B2 (en) * 2002-08-14 2009-12-03 Silence Therapeutics Gmbh Use of protein kinase N beta
US20080260744A1 (en) 2002-09-09 2008-10-23 Omeros Corporation G protein coupled receptors and uses thereof
CA2881743A1 (en) 2002-09-25 2004-04-08 University Of Massachusetts In vivo gene silencing by chemically modified and stable sirna
US20060160759A1 (en) * 2002-09-28 2006-07-20 Jianzhu Chen Influenza therapeutic
AU2003279004B2 (en) * 2002-09-28 2009-10-08 Massachusetts Institute Of Technology Influenza therapeutic
EP1562971B1 (en) 2002-11-05 2014-02-12 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US9150606B2 (en) 2002-11-05 2015-10-06 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2'-modified nucleosides for use in gene modulation
CA2504554A1 (en) * 2002-11-05 2004-05-27 Isis Pharmaceuticals, Inc. 2'-substituted oligomeric compounds and compositions for use in gene modulations
US9150605B2 (en) 2002-11-05 2015-10-06 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
DE10322662A1 (en) * 2002-11-06 2004-10-07 Grünenthal GmbH New DNA type 10-23 enzyme, useful for treating e.g. pain, and related short interfering RNA, directed against the vanillin receptor or picorna viruses, contains specific nucleotide modifications for improved stability
US8163896B1 (en) 2002-11-14 2012-04-24 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
US7217807B2 (en) 2002-11-26 2007-05-15 Rosetta Genomics Ltd Bioinformatically detectable group of novel HIV regulatory genes and uses thereof
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
US7888497B2 (en) 2003-08-13 2011-02-15 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
US7655785B1 (en) 2002-11-14 2010-02-02 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
WO2004070002A2 (en) 2002-11-18 2004-08-19 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention Cell lines and host nucleic acid sequences related to infectious disease
US7064337B2 (en) 2002-11-19 2006-06-20 The Regents Of The University Of California Radiation detection system for portable gamma-ray spectroscopy
DE10254214A1 (en) * 2002-11-20 2004-06-09 Beiersdorf Ag Oligoribonucleotides for the treatment of degenerative skin by RNA interference
WO2004048566A1 (en) * 2002-11-22 2004-06-10 Bio-Think Tank Co., Ltd. Method of detecting target base sequence of rna interference, method of designing polynucleotide base sequence causing rna interference, method of constructing double-stranded polynucleotide, method of regulating gene expression, base sequence processing apparatus, program for running base sequence processing method on comp
JP4526228B2 (en) * 2002-11-22 2010-08-18 隆 森田 Novel therapies and therapeutic agents according to the RNAi
CA2506714A1 (en) * 2002-11-26 2004-06-10 University Of Massachusetts Delivery of sirnas
US20130130231A1 (en) 2002-11-26 2013-05-23 Isaac Bentwich Bioinformatically detectable group of novel viral regulatory genes and uses thereof
US7696334B1 (en) 2002-12-05 2010-04-13 Rosetta Genomics, Ltd. Bioinformatically detectable human herpesvirus 5 regulatory gene
CN1301263C (en) 2002-12-18 2007-02-21 北京昭衍新药研究中心 Nucleotide sequence for anti HIV infection and preventing AIDS and use thereof
US9498530B2 (en) 2002-12-24 2016-11-22 Rinat Neuroscience Corp. Methods for treating osteoarthritis pain by administering a nerve growth factor antagonist and compositions containing the same
CA2936742A1 (en) 2002-12-24 2004-07-15 Rinat Neuroscience Corp. Anti-ngf antibodies and methods using same
WO2004065546A2 (en) 2003-01-16 2004-08-05 The Trustees Of The University Of Pennsylvania COMPOSITIONS AND METHODS FOR siRNA INHIBITION OF ICAM-1
US7629323B2 (en) * 2003-01-21 2009-12-08 Northwestern University Manipulation of neuronal ion channels
EP1589931A2 (en) * 2003-02-05 2005-11-02 University of Massachusetts RNAi TARGETING OF VIRUSES
US20070104688A1 (en) 2003-02-13 2007-05-10 City Of Hope Small interfering RNA mediated transcriptional gene silencing in mammalian cells
US20040162235A1 (en) * 2003-02-18 2004-08-19 Trubetskoy Vladimir S. Delivery of siRNA to cells using polyampholytes
JP2006525960A (en) 2003-02-19 2006-11-16 ライナット ニューロサイエンス コーポレイション Methods for treating pain by administration of nerve growth factor agonists and NSAID, and compositions containing them
AT554185T (en) * 2003-02-27 2012-05-15 Alnylam Pharmaceuticals Inc Methods and constructs for the evaluation of RNAi targets and effector
WO2004076663A1 (en) * 2003-02-27 2004-09-10 National Institute Of Advanced Industrial Science And Technology INDUCTION OF METHYLATION OF CpG SEQUENCE BY dsRNA IN MAMMALIAN CELL
ES2702942T3 (en) 2003-04-17 2019-03-06 Alnylam Pharmaceuticals Inc Modified RNAi agents
US7723509B2 (en) 2003-04-17 2010-05-25 Alnylam Pharmaceuticals IRNA agents with biocleavable tethers
EP2239329A1 (en) 2003-03-07 2010-10-13 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
US8017762B2 (en) 2003-04-17 2011-09-13 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
EP1625138A4 (en) 2003-04-17 2010-06-23 Alnylam Pharmaceuticals Inc Protected monomers
US7851615B2 (en) 2003-04-17 2010-12-14 Alnylam Pharmaceuticals, Inc. Lipophilic conjugated iRNA agents
US20080249039A1 (en) * 2004-01-30 2008-10-09 Santaris Pharma A/S Modified Short Interfering Rna (Modified Sirna)
EP1606406B2 (en) 2003-03-21 2013-11-27 Santaris Pharma A/S SHORT INTERFERING RNA (siRNA) ANALOGUES
US20070167384A1 (en) * 2003-04-02 2007-07-19 Dharmacon, Inc. Modified polynucleotides for use in rna interference
US20040198640A1 (en) * 2003-04-02 2004-10-07 Dharmacon, Inc. Stabilized polynucleotides for use in RNA interference
JP4605799B2 (en) * 2003-04-02 2011-01-05 ダーマコン, インコーポレイテッド Modified polynucleotide for use in Rna interference
AT536408T (en) * 2003-04-02 2011-12-15 Dharmacon Inc Modified polynucleotides for use in RNA interference
CA2521464C (en) 2003-04-09 2013-02-05 Alnylam Pharmaceuticals, Inc. Irna conjugates
WO2004091572A2 (en) 2003-04-09 2004-10-28 Biodelivery Sciences International, Inc. Cochleate compositions directed against expression of proteins
US8796436B2 (en) 2003-04-17 2014-08-05 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
WO2004101756A2 (en) 2003-05-09 2004-11-25 Diadexus, Inc. Ovr110 antibody compositions and methods of use
WO2004101788A2 (en) 2003-05-09 2004-11-25 University Of Pittsburgh Of The Commonwealth System Of Higher Education Small interfering rna libraries and methods of synthesis and use
AU2003241409A1 (en) * 2003-05-12 2005-01-21 Potomac Pharmaceuticals, Inc. Gene expression suppression agents
US20050148531A1 (en) * 2003-05-15 2005-07-07 Todd Hauser Modulation of gene expression using DNA-DNA hybrids
CA2527301A1 (en) * 2003-05-30 2004-12-09 Nippon Shinyaku Co., Ltd. Oligonucleic acid-bearing composite and pharmaceutical composition containing the composite
KR20060013426A (en) 2003-05-30 2006-02-09 니뽄 신야쿠 가부시키가이샤 Oligo double-stranded rna inhibiting the expression of bcl-2 and medicinal composition containing the same
EP1486564A1 (en) * 2003-06-13 2004-12-15 Ribopharma AG SiRNA with increased stability in serum
WO2004113496A2 (en) * 2003-06-20 2004-12-29 Isis Pharmaceuticals, Inc. Double stranded compositions comprising a 3’-endo modified strand for use in gene modulation
CA2531069A1 (en) * 2003-07-03 2005-01-27 The Trustees Of The University Of Pennsylvania Inhibition of syk kinase expression
WO2005010188A2 (en) * 2003-07-21 2005-02-03 Whitehead Institute For Biomedical Research Rnas able to modulate chromatin silencing
EP2530157B1 (en) 2003-07-31 2016-09-28 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of miRNAs
AU2004267425B2 (en) * 2003-08-13 2010-10-21 The Board Of Trustees Of The University Of Illinois Silencing of TGF-beta receptor type II expression by sIRNA
US20090018097A1 (en) * 2005-09-02 2009-01-15 Mdrna, Inc Modification of double-stranded ribonucleic acid molecules
US8501705B2 (en) * 2003-09-11 2013-08-06 The Board Of Regents Of The University Of Texas System Methods and materials for treating autoimmune and/or complement mediated diseases and conditions
CN100558893C (en) 2003-09-18 2009-11-11 Isis 药物公司;伊莱利利公司 Modulation of eIF4E expression
WO2005031002A2 (en) * 2003-09-22 2005-04-07 Rosetta Inpharmatics Llc Synthetic lethal screen using rna interference
WO2005033310A1 (en) * 2003-10-01 2005-04-14 Grünenthal GmbH Pim-1 specific dsrna compounds
EP2361984A1 (en) 2003-10-09 2011-08-31 E. I. du Pont de Nemours and Company Gene silencing by using modified micro-RNA molecules
EP1692262B1 (en) 2003-10-27 2018-08-15 Merck Sharp & Dohme Corp. Method of designing sirnas for gene silencing
US8227434B1 (en) 2003-11-04 2012-07-24 H. Lee Moffitt Cancer Center & Research Institute, Inc. Materials and methods for treating oncological disorders
US20070275918A1 (en) * 2003-11-07 2007-11-29 The Board Of Trustees Of The University Of Illinois Induction of Cellular Senescence by Cdk4 Disruption for Tumor Suppression and Regression
JP2005168485A (en) * 2003-11-20 2005-06-30 Tsutomu Suzuki METHOD FOR DESIGNING siRNA
WO2005068630A1 (en) * 2003-12-16 2005-07-28 National Institute Of Advanced Industrial Science And Technology Double-stranded rna for interference
EP1718747B1 (en) * 2004-02-06 2009-10-28 Dharmacon, Inc. Stabilized rnas as transfection controls and silencing reagents
US20060019914A1 (en) 2004-02-11 2006-01-26 University Of Tennessee Research Foundation Inhibition of tumor growth and invasion by anti-matrix metalloproteinase DNAzymes
EP1958964A3 (en) 2004-02-24 2009-01-07 The United States of America, represented by The Department of Health and Human Services RAB9A, RAB11A, and modulators thereof related to infectious disease
US7691823B2 (en) * 2004-03-05 2010-04-06 University Of Massachusetts RIP140 regulation of glucose transport
JPWO2005095647A1 (en) * 2004-03-31 2008-02-21 タカラバイオ株式会社 The screening method of siRNA
AU2005238034A1 (en) 2004-04-23 2005-11-10 The Trustees Of Columbia University In The City Of New York Inhibition of hairless protein mRNA
EP1744761A4 (en) 2004-04-28 2010-01-13 Molecules For Health Inc Methods for treating or preventing restenosis and other vascular proliferative disorders
US7687616B1 (en) 2004-05-14 2010-03-30 Rosetta Genomics Ltd Small molecules modulating activity of micro RNA oligonucleotides and micro RNA targets and uses thereof
WO2005110464A2 (en) * 2004-05-14 2005-11-24 Oregon Health & Science University Irx5 inhibition as treatment for hyperproliferative disorders
EP1773303A2 (en) * 2004-05-25 2007-04-18 Chimeracore, Inc. Self-assembling nanoparticle drug delivery system
EP1602926A1 (en) * 2004-06-04 2005-12-07 University of Geneva Novel means and methods for the treatment of hearing loss and phantom hearing
US20090215860A1 (en) * 2004-06-17 2009-08-27 The Regents Of The University Of California Compositions and methods for regulating gene transcription
JP2008507341A (en) * 2004-07-21 2008-03-13 メドトロニック,インコーポレイティド Medical devices and methods for reducing localized fibrosis
US20060030538A1 (en) * 2004-07-21 2006-02-09 Medtronic, Inc. Methods for reducing or preventing localized fibrosis using SiRNA
EP1782321A4 (en) 2004-07-23 2009-11-04 Univ North Carolina Methods and materials for determining pain sensitivity and predicting and treating related disorders
WO2006020768A2 (en) 2004-08-10 2006-02-23 Alnylam Pharmaceuticals, Inc. Chemically modified oligonucleotides
EP1791568B1 (en) 2004-08-16 2012-08-15 Quark Pharmaceuticals, Inc. Therapeutic uses of inhibitors of rtp801
WO2006026738A2 (en) 2004-08-31 2006-03-09 Qiagen North American Holdings, Inc. Methods and compositions for rna amplification and detection using an rna-dependent rna-polymerase
FI20041204A0 (en) 2004-09-16 2004-09-16 Riikka Lund Methods to exploit new target genes associated with immune-mediated diseases
MX2007003795A (en) 2004-09-28 2007-07-11 Quark Biotech Inc Oligoribonucleotides and methods of use thereof for treatment of alopecia, acute renal failure and other diseases.
NZ582988A (en) 2004-10-21 2011-07-29 Venganza Inc Methods and materials for conferring resistance to pests and pathogens of plants
US20060110440A1 (en) * 2004-10-22 2006-05-25 Kiminobu Sugaya Method and system for biasing cellular development
SG158921A1 (en) * 2004-10-27 2010-02-26 Schering Corp Compositions and methods for short interfering nucleic acid inhibition of nav1.8
US7964346B2 (en) 2004-10-27 2011-06-21 Rubin Donald H Mammalian genes involved in infection
WO2006050002A2 (en) * 2004-10-28 2006-05-11 Idexx Laboratories, Inc. Compositions for controlled delivery of pharmaceutically active compounds
US9492400B2 (en) 2004-11-04 2016-11-15 Massachusetts Institute Of Technology Coated controlled release polymer particles as efficient oral delivery vehicles for biopharmaceuticals
US20060105052A1 (en) * 2004-11-15 2006-05-18 Acar Havva Y Cationic nanoparticle having an inorganic core
AU2005307737C1 (en) * 2004-11-18 2013-08-29 The Board Of Trustees Of The University Of Illinois Multicistronic siRNA constructs to inhibit tumors
US7923207B2 (en) 2004-11-22 2011-04-12 Dharmacon, Inc. Apparatus and system having dry gene silencing pools
JP2008521909A (en) * 2004-12-02 2008-06-26 ビー−ブリッジ インターナショナル,インコーポレーテッド Short interfering rna, method of designing antisense polynucleotides, and other hybridization of polynucleotides
WO2006060779A2 (en) * 2004-12-03 2006-06-08 Case Western Reserve University Novel methods, compositions and devices for inducing neovascularization
GB0427916D0 (en) * 2004-12-21 2005-01-19 Astrazeneca Ab Method
TWI386225B (en) 2004-12-23 2013-02-21 Alcon Inc Rnai inhibition of ctgf for treatment of ocular disorders
BRPI0519468A2 (en) 2004-12-27 2009-01-27 Silence Therapeutics Ag coated lipid complexes and their use
US20090005332A1 (en) * 2004-12-30 2009-01-01 Hauser Todd M Compositions and Methods for Modulating Gene Expression Using Self-Protected Oligonucleotides
EP1841793B1 (en) 2005-01-07 2010-03-31 Diadexus, Inc. Ovr110 antibody compositions and methods of use
KR20070112801A (en) 2005-02-14 2007-11-27 유니버시티 오브 아이오와 리써치 파운데이션 Methods and reagents for treatment and diagnosis of age-related macular degeneration
US8859749B2 (en) 2005-03-08 2014-10-14 Qiagen Gmbh Modified short interfering RNA
GB0505081D0 (en) * 2005-03-14 2005-04-20 Genomica Sau Downregulation of interleukin-12 expression by means of rnai technology
ES2381201T3 (en) * 2005-03-31 2012-05-24 Calando Pharmaceuticals, Inc. Inhibitors subunit 2 of ribonucleotide reductase and uses thereof
US20070048293A1 (en) * 2005-05-31 2007-03-01 The Trustees Of The University Of Pennsylvania Manipulation of PTEN in T cells as a strategy to modulate immune responses
US9505867B2 (en) * 2005-05-31 2016-11-29 Ecole Polytechmique Fédérale De Lausanne Triblock copolymers for cytoplasmic delivery of gene-based drugs
US20100286228A1 (en) * 2005-06-01 2010-11-11 Duke University Method of inhibiting intimal hyperplasia
DK1888749T3 (en) 2005-06-01 2015-01-05 Polyplus Transfection Oligonucleotides for RNA interference as well as biological applications thereof
CN100445381C (en) 2005-06-10 2008-12-24 中国人民解放军军事医学科学院基础医学研究所 Preparation method for siRNA molecule with single chain polyA tail and application thereof
WO2006131925A2 (en) * 2005-06-10 2006-12-14 Quark Pharmaceuticals, Inc. Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US9506056B2 (en) 2006-06-08 2016-11-29 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
US8252756B2 (en) 2005-06-14 2012-08-28 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
WO2007011702A2 (en) 2005-07-15 2007-01-25 The University Of North Carolina At Chapel Hill Use of egfr inhibitors to prevent or treat obesity
US7919583B2 (en) 2005-08-08 2011-04-05 Discovery Genomics, Inc. Integration-site directed vector systems
US20070213257A1 (en) * 2005-08-12 2007-09-13 Nastech Pharmaceutical Company Inc. Compositions and methods for complexes of nucleic acids and peptides
US8501703B2 (en) 2005-08-30 2013-08-06 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds for modulation of splicing
WO2007033058A2 (en) * 2005-09-13 2007-03-22 Trustees Of Dartmouth College Compositions and methods for regulating rna translation via cd154 ca-dinucleotide repeat
AU2006298844B2 (en) 2005-09-20 2012-01-12 Basf Plant Science Gmbh Methods for controlling gene expression using ta-siRAN
FR2890859B1 (en) * 2005-09-21 2012-12-21 Oreal Oligonucleotide double-stranded RNA inhibiting the expression of tyrosinase
US8168584B2 (en) 2005-10-08 2012-05-01 Potentia Pharmaceuticals, Inc. Methods of treating age-related macular degeneration by compstatin and analogs thereof
CN102481379A (en) 2009-08-24 2012-05-30 菲吉尼克斯公司 Targeting pax2 for the treatment of breast cancer
US8076307B2 (en) * 2005-10-27 2011-12-13 National University Corporation NARA Institute of Science and Technology Formation/elongation of axon by inhibiting the expression or function of Singar and application to nerve regeneration
US8916530B2 (en) 2005-11-18 2014-12-23 Gradalis, Inc. Individualized cancer therapy
US8906874B2 (en) 2006-11-09 2014-12-09 Gradalis, Inc. Bi-functional shRNA targeting Stathmin 1 and uses thereof
US8758998B2 (en) 2006-11-09 2014-06-24 Gradalis, Inc. Construction of bifunctional short hairpin RNA
US8603991B2 (en) 2005-11-18 2013-12-10 Gradalis, Inc. Individualized cancer therapy
US8252526B2 (en) * 2006-11-09 2012-08-28 Gradalis, Inc. ShRNA molecules and methods of use thereof
WO2007070682A2 (en) 2005-12-15 2007-06-21 Massachusetts Institute Of Technology System for screening particles
MX2008008302A (en) * 2005-12-22 2009-01-21 Exegenics Inc Compositions and methods for regulating complement system.
AR057252A1 (en) * 2005-12-27 2007-11-21 Alcon Mfg Ltd Rho kinase inhibition mediated RNAi for treating eye disorders
US8673873B1 (en) * 2005-12-28 2014-03-18 Alcon Research, Ltd. RNAi-mediated inhibition of phosphodiesterase type 4 for treatment of cAMP-related ocular disorders
ES2395842T3 (en) 2006-01-17 2013-02-15 Synthon Biopharmaceuticals B.V. Compositions and methods for the humanization and optimization N-glycan in plants
US20090060921A1 (en) * 2006-01-17 2009-03-05 Biolex Therapeutics, Inc. Glycan-optimized anti-cd20 antibodies
US20120208824A1 (en) 2006-01-20 2012-08-16 Cell Signaling Technology, Inc. ROS Kinase in Lung Cancer
US7825099B2 (en) 2006-01-20 2010-11-02 Quark Pharmaceuticals, Inc. Treatment or prevention of oto-pathologies by inhibition of pro-apoptotic genes
HUE039085T2 (en) 2006-01-20 2018-12-28 Cell Signaling Technology Inc Translocation and mutant ROS kinase in human non-small cell lung carcinoma
DOP2007000015A (en) 2006-01-20 2007-08-31 Quark Biotech Inc Therapeutic Uses of RTP801 inhibitors
US7910566B2 (en) 2006-03-09 2011-03-22 Quark Pharmaceuticals Inc. Prevention and treatment of acute renal failure and other kidney diseases by inhibition of p53 by siRNA
JP2009524419A (en) * 2006-01-27 2009-07-02 サンタリス ファーマ アー/エスSantaris Pharma A/S Lna modified phosphorothioate thiolated oligonucleotide
US8362229B2 (en) * 2006-02-08 2013-01-29 Quark Pharmaceuticals, Inc. Tandem siRNAS
FI20060246A0 (en) 2006-03-16 2006-03-16 Jukka Westermarck New growth stimulating protein and its use
US20100056441A1 (en) * 2006-03-17 2010-03-04 Costa Robert H Method for Inhibiting Angiogenesis
AU2007229161B2 (en) 2006-03-23 2012-07-12 Roche Innovation Center Copenhagen A/S Small internally segmented interfering RNA
FR2898908A1 (en) 2006-03-24 2007-09-28 Agronomique Inst Nat Rech Process, useful to prepare differentiated avian cells from avian stem cells grown in culture medium, comprises induction of stem cells differentiation by inhibiting expression/activity of gene expressed in the stem cells e.g. Nanog gene
WO2008105773A2 (en) 2006-03-31 2008-09-04 Massachusetts Institute Of Technology System for targeted delivery of therapeutic agents
CA2648581A1 (en) * 2006-04-07 2008-09-12 Chimeros, Inc. Compositions and methods for treating b- cell malignancies
US9044461B2 (en) 2006-04-07 2015-06-02 The Research Foundation Of State University Of New York Transcobalamin receptor polypeptides, nucleic acids, and modulators thereof, and related methods of use in modulating cell growth and treating cancer and cobalamin deficiency
CA2648718A1 (en) 2006-04-07 2007-10-18 The Research Foundation Of State University Of New York Transcobalamin receptor polypeptides, nucleic acids, and modulators thereof, and related methods of use in modulating cell growth and treating cancer and cobalamin deficiency
EP2010225A4 (en) * 2006-04-13 2010-04-21 Cornell Res Foundation Inc Methods and compositions for targeting c-rel
EP2450437B1 (en) 2006-04-14 2017-05-17 Cell Signaling Technology, Inc. Gene defects and mutant ALK kinase in human solid tumors
JP2009533458A (en) 2006-04-14 2009-09-17 マサチューセッツ インスティテュート オブ テクノロジー Identification and modulation of the molecular pathways that mediate plasticity of the nervous system
WO2007133807A2 (en) 2006-05-15 2007-11-22 Massachusetts Institute Of Technology Polymers for functional particles
WO2007141796A2 (en) 2006-06-09 2007-12-13 Quark Pharmaceuticals, Inc. Therapeutic uses of inhibitors of rtp801l
WO2007150030A2 (en) 2006-06-23 2007-12-27 Massachusetts Institute Of Technology Microfluidic synthesis of organic nanoparticles
GB0613753D0 (en) * 2006-07-11 2006-08-23 Norwegian Radium Hospital Res Method
EP2479284B1 (en) 2006-07-13 2017-09-20 University of Iowa Research Foundation Methods and reagents for treatment and diagnosis of vascular disorders and age-related macular degeneration
EP2546337A1 (en) 2006-07-21 2013-01-16 Silence Therapeutics AG Means for inhibiting the expression of protein kinase 3
DE102006039479A1 (en) 2006-08-23 2008-03-06 Febit Biotech Gmbh programmable oligonucleotide
CA2663962A1 (en) * 2006-09-19 2008-03-27 Asuragen, Inc. Mir-15, mir-26, mir-31,mir-145, mir-147, mir-188, mir-215, mir-216, mir-331, mmu-mir-292-3p regulated genes and pathways as targets for therapeutic intervention
AU2007299804A1 (en) * 2006-09-19 2008-03-27 Asuragen, Inc. MiR-200 regulated genes and pathways as targets for therapeutic intervention
CA2663601C (en) 2006-09-22 2014-11-25 Dharmacon, Inc. Duplex oligonucleotide complexes and methods for gene silencing by rna interference
JP2010507387A (en) 2006-10-25 2010-03-11 クアーク・ファーマスーティカルス、インコーポレイテッドQuark Pharmaceuticals,Inc. New siRNA and methods of use thereof
EP2061901A2 (en) 2006-10-31 2009-05-27 Noxxon Pharma AG Methods for detection of a single- or double-stranded nucleic acid molecule
EP2078079B1 (en) 2006-11-01 2011-05-04 The Medical Research and Infrastructure Fund of the Tel-Aviv Sourasky Medical Center Adipocyte-specific constructs and methods for inhibiting platelet-type 12 lipoxygenase expression
JP5271715B2 (en) * 2006-11-22 2013-08-21 国立大学法人 東京大学 Environmentally-responsive siRNA carrier using a disulfide cross-linked polymer micelle
EP2431053A1 (en) 2006-11-27 2012-03-21 Patrys Limited Novel glycosylated peptide target in neoplastic cells
AU2007325283B2 (en) 2006-11-27 2012-08-30 Diadexus, Inc. Ovr110 antibody compositions and methods of use
US20090048195A1 (en) * 2006-11-30 2009-02-19 University Of Southern California Compositions and methods of sphingosine kinase inhibitors for use thereof in cancer therapy
CA2671270A1 (en) * 2006-12-29 2008-07-17 Asuragen, Inc. Mir-16 regulated genes and pathways as targets for therapeutic intervention
US20090131354A1 (en) * 2007-05-22 2009-05-21 Bader Andreas G miR-126 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
CA2671299A1 (en) * 2006-12-08 2008-06-19 Asuragen, Inc. Functions and targets of let-7 micro rnas
EP2104735A2 (en) * 2006-12-08 2009-09-30 Asuragen, INC. Mir-21 regulated genes and pathways as targets for therapeutic intervention
BRPI0719995A2 (en) * 2006-12-14 2014-03-18 Novartis Ag Compositions and methods for treating muscular & cardiovascular disorders
US9896511B2 (en) 2007-01-10 2018-02-20 The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services Antibodies that bind to TL1A and methods of treating inflammatory or autoimmune disease comprising administering such antibodies
US8361988B2 (en) * 2007-01-17 2013-01-29 Institut De Recherches Cliniques De Montreal Nucleoside and nucleotide analogues with quaternary carbon centers and methods of use
CA2676143A1 (en) 2007-01-26 2008-07-31 University Of Louisville Research Foundation, Inc. Modification of exosomal components for use as a vaccine
US9217129B2 (en) 2007-02-09 2015-12-22 Massachusetts Institute Of Technology Oscillating cell culture bioreactor
AU2008212820B2 (en) 2007-02-09 2014-01-30 Northwestern University Particles for detecting intracellular targets
DE102007008596B4 (en) * 2007-02-15 2010-09-02 Friedrich-Schiller-Universität Jena Biologically active molecules on the basis of PNA and siRNA, methods for their cell-specific activation and application kit for administration
AU2008218813B2 (en) * 2007-02-20 2014-04-17 Monsanto Technology, Llc Invertebrate microRNAs
EP2137205A2 (en) 2007-02-26 2009-12-30 Quark Pharmaceuticals, Inc. Inhibitors of rtp801 and their use in disease treatment
US20100292301A1 (en) * 2007-02-28 2010-11-18 Elena Feinstein Novel sirna structures
EP2121926A1 (en) * 2007-03-02 2009-11-25 MDRNA, Inc. Nucleic acid compounds for inhibiting wnt gene expression and uses thereof
WO2008109034A2 (en) * 2007-03-02 2008-09-12 The Trustees Of The University Of Pennsylvania Modulating pdx-1 with pcif1, methods and uses thereof
US7812002B2 (en) 2007-03-21 2010-10-12 Quark Pharmaceuticals, Inc. Oligoribonucleotide inhibitors of NRF2 and methods of use thereof for treatment of cancer
US8796442B2 (en) 2007-03-21 2014-08-05 Brookhaven Science Associates, Llc. Combined hairpin-antisense compositions and methods for modulating expression
WO2008124634A1 (en) 2007-04-04 2008-10-16 Massachusetts Institute Of Technology Polymer-encapsulated reverse micelles
EP2144600A4 (en) * 2007-04-04 2011-03-16 Massachusetts Inst Technology Poly (amino acid) targeting moieties
CA2683063A1 (en) * 2007-04-09 2008-10-16 Chimeros, Inc. Self-assembling nanoparticle drug delivery system
JP5258874B2 (en) 2007-04-10 2013-08-07 キアゲン ゲゼルシャフト ミット ベシュレンクテル ハフツング Rna interference tag
CN101686939B (en) * 2007-04-17 2013-03-27 巴克斯特国际公司 Nucleic acid microparticles for pulmonary delivery
US20100291042A1 (en) 2007-05-03 2010-11-18 The Brigham And Women's Hospital, Inc. Multipotent stem cells and uses thereof
JP5296328B2 (en) * 2007-05-09 2013-09-25 独立行政法人理化学研究所 1 stranded circular rna and manufacturing method thereof
CA2684879A1 (en) * 2007-05-15 2008-11-27 Helicon Therapeutics, Inc. Methods of identifying genes involved in memory formation using small interfering rna (sirna)
EP2581081A3 (en) 2007-06-01 2013-07-31 The Trustees Of Princeton University Treatment of viral infections by modulation of host cell metabolic pathways
CN101815785B (en) 2007-06-11 2013-06-19 宝生物工程株式会社 Method for expression of specific gene
US20100273854A1 (en) * 2007-06-15 2010-10-28 Hagar Kalinski Compositions and methods for inhibiting nadph oxidase expression
ES2474176T3 (en) 2007-06-27 2014-07-08 Quark Pharmaceuticals, Inc. Compositions and methods for inhibiting gene expression pro-apoptticos
EP2316943B1 (en) * 2007-07-05 2013-06-19 Novartis AG DSRNA for treating viral infection
US8828960B2 (en) * 2007-07-17 2014-09-09 Idexx Laboratories, Inc. Amino acid vitamin ester compositions for controlled delivery of pharmaceutically active compounds
US9526707B2 (en) 2007-08-13 2016-12-27 Howard L. Elford