CN104120127B

CN104120127B - The oligonucleotide separated and application thereof

Info

Publication number: CN104120127B
Application number: CN201410310746.2A
Authority: CN
Inventors: 倪建泉; 刘鲁萍
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2014-07-01
Filing date: 2014-07-01
Publication date: 2016-09-21
Anticipated expiration: 2034-07-01
Also published as: CN104120127A

Abstract

The invention discloses oligonucleotide and the application thereof of separation, wherein this oligonucleotide has the nucleotide sequence shown in SEQ ID NO:1.When the construct that preparation knocks out for drosophila gene, two siRNA adjacent in multiple siRNA are connected by this oligonucleotide, the mechanism of shearing that transcription product can be made to pass through fruit bat self forms the most independent shRNA, thus the simultaneously respective target gene of RNAi, and then, multiple gene can be knocked out, it is achieved regulate and control fruit bat is polygenic simultaneously simultaneously.

Description

The oligonucleotide separated and application thereof

Technical field

The present invention relates to biological technical field, be specifically related to oligonucleotide and the application thereof separated, more particularly, to, The nucleotide of separation, construct and the method knocking out fruit bat genes of interest.

Background technology

That RNA interference (RNA interference, RNAi) refers to be highly conserved during evolution, by double-stranded RNA (double-stranded RNA, dsRNA) induce, the phenomenon of the efficient special degraded of homologous mRNA.RNAi technology can be special Property the expression reducing gene, and efficiency is high, it is easy to operation, thus this technology be widely used in fruit bat respectively study neck In territory.

In fruit bat is studied, RNAi technology is general and double base expression system combines, it is achieved tissue spy in transgenic fly The gene knockout of different in nature and specific developmental stage.In fruit bat, wide variety of double base expression system is GAL4-UAS system at present System, the yeast transcription factor gene GAL4 in this system is controlled by specific promoter.In turn, GAL4 can activate another The external source comprising upstream activating sequence (UAS) inserts the expression of gene.

The promoter that RNAi carrier is commonly used at present is Hsp70, and when being activated by GAL4, this promoter can start External source inserts the expression of gene.But, when there is not GAL4, this promoter remains able to that external source is inserted gene and plays startup Effect so that exogenous gene exists a certain amount of background expresses, the impact judgement to experimental result.

And third generation RNAi technology be transcribed by expression vector formed ShorthairpinRNA (short hairpin RNA, ShRNA), naturally occurring microRNA in simulating fruit bat body.ShRNA is produced by the microRNA approach in fruit bat body again SiRNA (siRNA), thus realize gene knockout (Ni et al., Nature Methods.2011May；8(5):405- 7.).But, this technology can only knock out individual gene.Therefore, when function and other gene of genes of interest exist redundancy, or When relating to the research of multiple gene function, this technology is not well positioned to meet the demand of researcher.

Summary of the invention

It is contemplated that at least solve one of technical problem present in prior art.To this end, one object of the present invention It is to propose the means of a kind of multiple genes of interest that can simultaneously knock out fruit bat.

Thus, according to an aspect of the present invention, the invention provides the oligonucleotide of a kind of separation.According to the present invention's Specific embodiment, this oligonucleotide has the nucleotide sequence shown in SEQ ID NO:1.Inventor finds, in preparation for fruit During the construct of fly gene knockout, it is used for connecting multiple shRNA template sequence by this oligonucleotide, will phase in multiple siRNA Two adjacent siRNA are connected by this oligonucleotide, it is possible to make transcription product be formed each by the shearing mechanism of fruit bat self Independent shRNA, thus the respective target gene of RNAi simultaneously, and then, it is possible to knock out multiple gene, it is achieved bases many to fruit bat simultaneously Regulate and control while cause.In this article, the most also the oligonucleotide shown in this SEQ ID NO:1 is referred to as " linker ".

According to a further aspect in the invention, present invention also offers a kind of construct.According to embodiments of the invention, this structure Building body and comprise multiple siRNA, two siRNA adjacent in the plurality of siRNA are connected by foregoing oligonucleotide, its Described in the target gene of multiple siRNA identical or different.It is surprisingly found by the inventors that, the construct of the present invention can not only be simultaneously High efficient expression is multiple for heterogeneic siRNA such that it is able to realize regulating and controlling polygenic, additionally it is possible to express multiple simultaneously For same gene siRNA, knock out efficiency with strengthen individual gene.And the structure of this construct is simple and convenient, express Efficient stable, it is adaptable to all of tissue of fruit bat and cell such that it is able to be effective to various drosophila gene functional study.

According to embodiments of the invention, described construct comprises further: 2 × QUAS sequence；And/or 10 × UAS sequence. Thus, both inhibitable types binary expression system can enrich transgene expression in fruit bat, pedigree is followed the trail of and gene function is embedding The fit means analyzed, the regulation and control making expression are more flexible.

According to embodiments of the invention, described construct comprises riddled basins further.Thus, it is simple to the screening positive Plasmid.According to some concrete examples of the present invention, described riddled basins is ampicillin resistance gene and/or screening mark Note vermilion gene.Thus, positive plasmid screening effect is good.

According to embodiments of the invention, described construct comprises promoter further.Inventor finds, U-promoter (i.e. U-promoter) background expression efficiency in each histoorgan of fruit bat is low, and when being induced, expression efficiency is high, thus, root According to one embodiment of the present of invention, described promoter is U-promoter.

According to embodiments of the invention, described construct comprises further: genome site-directed integration attB sequence；In ftz Containing subsequence；And SV40ployA sequence.Thereby, it is possible to make plasmid site-directed integration in drosophila gene group, translation efficiency increases By force, and beneficially regulatory transcription terminates.

According to embodiments of the invention, described construct comprises further: 2 LoxP sequences；And completely cut off sub-gypsy sequence Row, wherein, described isolation sub-gypsy sequence is between 2 LoxP sequences.Thereby, it is possible to the effect at Cre recombinase is gone down Fall the gypsy sequence between LoxP, reach to regulate the purpose of siRNA expression, and gypsy sequence can turning with enhancing gene Record, and then make the regulation and control of gene expression more flexibly, the means of gene function analysis are more various.

Another aspect of the invention, present invention also offers a kind of method knocking out fruit bat genes of interest.According to the present invention Embodiment, the method utilize foregoing construct convert fruit bat.Inventor has surprisingly found that, utilizes the side of the present invention Method, can not only in fruit bat the highest efficient expression multiple for heterogeneic siRNA such that it is able to realize multiple gene Knock out, additionally it is possible to express multiple for same gene siRNA in fruit bat, thus realize efficiently striking of individual gene simultaneously Remove, pound out effective.Further, the method for the present invention is simple to operate, and result is stable, it is adaptable to all of tissue of fruit bat and cell, And utilize the method be prone to regulate and control fruit bat gene knockout efficiency, it is thus achieved that fruit bat phenotype obvious such that it is able to be effective to fruit Fly gene functional research.

According to embodiments of the invention, the method knocking out fruit bat genes of interest of the present invention utilizes GAL4-UAS double base to express Carrier system carries out described conversion, and wherein said construct comprises 2 × QUAS sequence；And/or 10 × UAS sequence.Thus, this two Plant inhibitable type binary expression system and can enrich what transgene expression in fruit bat, pedigree tracking and gene function chimera were analyzed Means, the expression regulation making the method is more flexible.

According to embodiments of the invention, described conversion farther includes: utilize described construct to convert the first fruit bat, in order to Obtain the first transgenic fly；There is provided the second transgenic fly, described second transgenic fly can express Gal4 albumen and/or Q albumen；And by described first transgenic fly and described second transgenic fly hybridization, in order to obtain progeny transgenic fruit Fly, described in described progeny transgenic fruit bat, genes of interest is knocked.

The additional aspect of the present invention and advantage will part be given in the following description, and part will become from the following description Obtain substantially, or recognized by the practice of the present invention.

Accompanying drawing explanation

Above-mentioned and/or the additional aspect of the present invention and advantage are from combining the accompanying drawings below description to embodiment and will become Substantially with easy to understand, wherein:

Fig. 1 shows the collection of illustrative plates of VADUM expression vector according to an embodiment of the invention；

Fig. 2 shows wild type and the picture of each transgenic male drosophila wing according to an embodiment of the invention, wherein

Fig. 2 A shows the picture of wild type male drosophila wing,

Fig. 2 B shows the picture of H1KD1 Yu ms1096-Gal4 filial generation male drosophila wing,

Fig. 2 C shows the picture of H1KD2 Yu ms1096-Gal4 filial generation male drosophila wing,

Fig. 2 D shows the picture of H1KD3 Yu ms1096-Gal4 filial generation male drosophila wing.

Detailed description of the invention

Below with reference to specific embodiment, the present invention will be described, it should be noted that these embodiments are only explanation Property, and be not considered as limiting the invention.

According to an aspect of the present invention, the invention provides the oligonucleotide of a kind of separation.Concrete according to the present invention Embodiment, this oligonucleotide has the nucleotide sequence shown in SEQ ID NO:1.Wherein, the nucleotide shown in SEQ ID NO:1 Sequence is as follows:

CGCGATGCTCAAGGCAAAAAAAAATCAATCAAAAAACAATTTGAAAATTCCAAAAAAAAAGCATAATTGAACA CAAAAAGTATAAAAACGGTAACAAGTGTCTGATTTTGTTTATATCATTACATGAGCATGAAAACCAAAATTGAAAAT TCTGAACTCCCGCAGTCAAGTATCCCGAAACCTCAATCAATAAAACTATATTGGCGCATTCATGCTG(SEQ ID NO:1).

Come from the intervening sequence of fruit bat Mir2 gene cluster it should be noted that this oligonucleotide sequence is one section, be fruit Sequence between mir-2a-1 and mir-2b-2 in fly genome, inventor finds, this oligonucleotide is with ribose in fruit bat body The recognition site of nuclease, is used for connecting multiple shRNA template sequence, two siRNA that will be adjacent in multiple siRNA It is connected by this oligonucleotide, it is possible to the mechanism of shearing making transcription product pass through fruit bat self forms the most independent shRNA, from And the simultaneously respective target gene of RNAi, and then, it is possible to knock out multiple gene, it is achieved regulate and control fruit bat is polygenic simultaneously simultaneously.

According to embodiments of the invention, described construct comprises further: 2 × QUAS sequence；And/or 10 × UAS sequence. Wherein it is desired to explanation, fruit bat has two kinds of binary expression systems, Gal4/UAS and QF/QUAS system at present.Their work Being the same as principle, as a example by QF/QUAS, QF is a kind of transcription regulatory factor, and QUAS is the site that on DNA, QF combines, 2 × QUAS refers to containing two QF binding sites.When QF combines QUAS, transcribing of QUAS downstream gene can be started.And the load of the present invention Comprise UAS and QUAS on body simultaneously, thus both can regulate and control with Gal4, it is also possible to use QF.Thus, both inhibitable types binary The means that expression system can enrich transgene expression in fruit bat, pedigree is followed the trail of and gene function chimera is analyzed, make expression Regulate and control more flexible.

According to embodiments of the invention, described construct comprises promoter further.Inventor finds, U-promoter exists Background expression efficiency in each histoorgan of fruit bat is low, and when being induced, expression efficiency is high, thus, according to one of the present invention Embodiment, described promoter is U-promoter.

Wherein, according to embodiments of the invention, the sequence of above-mentioned each element is as follows:

AttB:

GCTGCATCCAACGCGTTGGGAGCTCTCCGGATCAATTCGGCTTCACGTACCGTCGACGATGTAGGTCACGGTCTCGA AGCCGCGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATCTGGTCCATCATG ATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAACGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCT GGGCGCGGTGGTCACGGTGAGCACGGGACGTGCGACGGCGTCGGCTGGTGCGGATACGCGGGGCAGCGTCAGCGGGT TCTCGACGGTCACGGCGGGCATGTCGACAAGCCGAATTGATCCACTAGAAGGCCTA ATTC (SEQ ID NO:44)；

Ftz intron:

CTAGTTCTGATCTGCTAGACAATTGTTGGCATCAGGTAGGCATCACACACGATTAACAACCCCTAAAAATACACTTT GAAAATATTGAAAATATGTTTTTGTATACATTTTTGATATTTTCAAATAATACGCAGTTATAAAACTCATTAGCTAA CCCATTTTTTCTTTGCTTATGCTTACAGATTGCAAAGAACTAGAG (SEQ ID NO:45)；

SV40ployA:

GGATCTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAAG GTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCTAATTGTTTGTGTATTTTAGATTCCAACCTA TGGAACTGATGAATGGGAGCAGTGGTGGAATGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTA GTGATGATGAGGCTACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAAGGAC TTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCTTGCTTGCTTTGCTATTTACAC CACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTATGGAAAAATATTTGATGTATAGTGCCTTGACTAGAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACA TAAAATGAATGGAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAA ATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTC TGGTTCCA (SEQ ID NO:46)；

LoxP:

CTAGTATAACTTCGTATAATGTATGCTATACGAAGTTATG (SEQ ID NO:47)；

Gypsy:

TTGGCCACGTAATAAGTGTGCGTTGAATTTATTCGCAAAAACATTGCATATTTTCGGCAAAGTAAAATTTTGTTGCA TACCTTATCAAAAAATAAGTGCTGCATACTTTTTAGAGAAACCAAATAATTTTTTATTGCATACCCGTTTTTAATAA AATACATTGCATACCCTCTTTTAATAAAAAATATTGCATACTTTGACGAAACAAATTTTCGTTGCATACCCAATAAA AGATTATTATATTGCATACCCGTTTTTAATAAAATACATTGCATACCCTCTTTTAATAAAGAATATTGCATACGTTG ACGAAACAAATTTTCGTTGCATACCCAATAAAAGATTATTATATTGCATACCTTTTCTTGCCATACCATTTAGCCGA TCAATTCTGCTCGGCAACAGTATATTTGTGGTGTGCCAACCAACAAC (SEQ ID NO:48)；

2 × QUAS:

CGCTCGGGTAATCGCTTATCCTCGGGTAATCGCTTATCCTTAAGC (SEQ ID NO:49)；

10 × UAS:

GCAGGTCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCT CCGAGCGGAGTACTGTCCTCCGAGCGGAGACTCCCGCGGTCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGA GCGGAGTACTGTCCTCCGAGCGGAGTAC (SEQ ID NO:50).

Below in conjunction with embodiment, the solution of the present invention is explained.It will be understood to those of skill in the art that following Embodiment is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.Unreceipted concrete technology or bar in embodiment Part, according to the technology described by the document in this area or condition, (such as writing with reference to J. Pehanorm Brooker etc., yellow training hall etc. is translated " Molecular Cloning: A Laboratory guide ", the third edition, Science Press) or carry out according to product description.Agents useful for same or instrument Unreceipted production firm person, be can by city available from conventional products, such as can purchase from Illumina company.

Embodiment 1

Building RNAi expression vector VADUM, it specifically comprises the following steps that

1, the clone of vector gene element

1.1, the carrier used by clone gene element

Carrier pVALIUM20 Hind III and Sac I double digestion, is connected with the synthesis MCS fragment of annealing, converts large intestine bar Bacterium Top10, selects positive colony.Order-checking obtains correct plasmid and is designated as pV-MCS, clones each Genetic elements with this plasmid.

The MCS primer of annealing is respectively as follows:

MCS-F:AGCTTCAGCTAGCATGAGCTCAACTGCAGATCCGCGGAATCTAGAAGCT (SEQ ID NO:2)

MCS-R:TCTAGATTCCGCGGATCTGCAGTTGAGCTCATGCTAGCTGA (SEQ ID NO:3)

1.2, one LoxP of clone

Plasmid pV-MCS Nhe I and Sac I double digestion, is connected with the synthesis LoxP fragment of annealing, converts escherichia coli Top10, selects positive colony.Order-checking obtains correct plasmid and is designated as pV-LoxP.

The LoxP primer of annealing is respectively as follows:

LoxP-F1:ctagcATAACTTCGTATAATGTATGCTATACGAAGTTATGagct (SEQ ID NO:4)

LoxP-R1:CATAACTTCGTATAGCATACATTATACGAAGTTATg (SEQ ID NO:5)

1.3, clone Q-UAS

Plasmid pV-LoxP Pst I and Sac I double digestion, is connected with the synthesis Q-UAS fragment of annealing, converts escherichia coli Top10, selects positive colony.Order-checking obtains correct plasmid and is designated as pV-Q-LoxP.

The Q-UAS primer sequence of annealing is respectively as follows:

Q-F:CGCTCGGGTAATCGCTTATCCTCGGGTAATCGCTTATCCTTAAGCTGCA (SEQ ID NO:6)

Q-R:GCTTAAGGATAAGCGATTACCCGAGGATAAGCGATTACCCGAGCGagct (SEQ ID NO:7)

1.4, clone 5 × UAS

With pVALIUM20 as template, carrying out PCR amplification with primer UAS-F and UAS-R, primer sequence is as follows:

UAS-F:AACTGCAGGTCGGAGTACTGTCCTCC (SEQ ID NO:8)

UAS-R:AACCGCGGGAGTCTCCGCTCGGAG (SEQ ID NO:9)

Obtain 123 base PCR primer.PCR primer Pst I and Sac II double digestion, with through as the plasmid of double digestion PV-Q-LoxP connects, and converts escherichia coli Top10, selects positive colony.Order-checking obtains correct plasmid and is designated as pV-UAS-Q- LoxP。

1.5, other 5 × UAS and U-promoter is cloned

With pVALIUM3 as template, carrying out PCR amplification with primer promoter-F and promoter-R, primer sequence is such as Under:

Promoter-F:AACCGCGGTCGGAGTACTGTCCTCC (SEQ ID NO:10)

Promoter-R:AATCTAGACTTTGGTATGCGTCTTGTGAT (SEQ ID NO:11)

Obtain 282 base PCR primer.PCR primer Xba I and Sac II double digestion, with through as the plasmid of double digestion PV-UAS-Q-LoxP connects, and converts escherichia coli Top10, selects positive colony.Order-checking obtains correct plasmid and is designated as pV-U- promoter-UAS-Q-LoxP。

2, the structure of expression vector

2.1 construction of expression vector skeletons

Carrier pVALIUM20 Spe I enzyme action, is connected with the synthesis MCSb fragment of annealing, converts escherichia coli Top10, chooses Select positive colony.Order-checking obtains correct plasmid and is designated as pV-MCS2.

The MCSb primer of annealing is respectively as follows:

MCSb-F:CTAGGCTAGCTCAGATCTTGGAATTCATCTAGACAGTA (SEQ ID NO:12)

MCSb-R:CTAGTACTGTCTAGATGAATTCCAAGATCTGAGCTAGC(SEQ ID NO:13)

By the method for following sudden change, some restriction enzyme sites of plasmid pV-MCS2 are removed, facilitate later clone.Remove Restriction enzyme site is the EcoR V in vermilion, BamH I and Xho I respectively, the Xho I between vermilion and attB, attB In Kpn I, and the Mfe I in gypsy.

With plasmid pV-MCS2 as template, carry out PCR amplification with the mutant primer of a pair reverse complemental.PCR primer Dpn I Directly convert escherichia coli Top10 after enzyme action, select monoclonal and shake bacterium, extract plasmid enzyme restriction qualification and obtain correct sudden change matter Grain.The mutant primer used is as follows:

EcoR V-F:GGAGCGCAGATATTGATAACCAGACGAGCCACCAGTG (SEQ ID NO:14)

EcoR V-R:CACTGGTGGCTCGTCTGGTTATCAATATCTGCGCTCC (SEQ ID NO:15)

BamH I-F:CCAGTGCCCAACTGTTGCGATCCAATCATGCGTTG (SEQ ID NO:16)

BamH I-R:CAACGCATGATTGGATCGCAACAGTTGGGCACTGG (SEQ ID NO:17)

Xho I-F1:CAGATCGTGACTCCTCGACCGGCGGATGCTGGCGAAC (SEQ ID NO:18)

Xho I-R1:GTTCGCCAGCATCCGCCGGTCGAGGAGTCACGATCTG (SEQ ID NO:19)

Xho I-F2:GATATCATCGATCTCGACGCTGCATCCAACGCGTT (SEQ ID NO:20)

Xho I-R2:AACGCGTTGGATGCAGCGTCGAGATCGATGATATC (SEQ ID NO:21)

Kpn I-F:GGATCAATTCGGCTTCACGTACCGTCGACGATGTA (SEQ ID NO:22)

Kpn I-R:TACATCGTCGACGGTACGTGAAGCCGAATTGATCC (SEQ ID NO:23)

Mfe I-F:CCATTTAGCCGATCAATTCTGCTCGGCAACAGTATAT (SEQ ID NO:24)

Mfe I-R:ATATACTGTTGCCGAGCAGAATTGATCGGCTAAATGG (SEQ ID NO:25)

Plasmid after sudden change is designated as pVAM, as framework construction expression vector.

2.2, Expression element U-promoter, UAS, Q-UAS and LoxP are added

Plasmid pV-U-promoter-UAS-Q-LoxP Xba I and Nhe I double digestion, glue reclaims the sheet obtaining 473 bases Section, i.e. U-promoter-UAS-Q-LoxP, with as double digestion carrier pVAM connect, convert escherichia coli Top10, choose Select positive colony.Plasmid is designated as pVAM-U-promoter-UAS-Q-LoxP,

2.3, another LoxP is added

Plasmid pVAM-U-promoter-UAS-Q-LoxP Nhe I enzyme action, by alkaline phosphatase treatment, then with annealing Synthesis LoxP fragment connects, and converts escherichia coli Top10, selects positive colony.Order-checking obtains correct plasmid and is designated as pVAM-U- promoter-UAS-Q-LoxP2。

The LoxP primer sequence of annealing is respectively as follows:

LoxP-F2:CTAGTATAACTTCGTATAATGTATGCTATACGAAGTTATG (SEQ ID NO:26)

LoxP-R2:TAGCATAACTTCGTATAGCATACATTATACGAAGTTATA (SEQ ID NO:27)

2.4, between two LoxP, gypsy is added

With pVAM as template, carry out PCR amplification with primer gypsy-F and gypsy-R.

Gypsy-F:TTACTAGTTGGCCACGTAATAAGTGTGC (SEQ ID NO:28)

gypsy-R:TTACTAGTGTTGTTGGTTGGCACACCAC (SEQ ID NO:29)

Obtain 447 base PCR primer.PCR primer Spe I enzyme action, and through Nhe I enzyme action and alkaline phosphatase treatment Plasmid pVAM-U-promoter-UAS-Q-LoxP2 connects, and converts escherichia coli Top10, selects positive colony.Order-checking just obtains True plasmid is designated as pVAM-U-promoter-UAS-Q-LoxP2-gypsy.

2.5, the polyclone restriction enzyme site MCS1 of the single hairpin DNA of clone is added

Plasmid pVALIUM20 Xba I and Spe I double digestion, glue reclaims the fragment of 730 bases, with as double digestion Plasmid pVAM-U-promoter-UAS-Q-LoxP2-gypsy connects, and converts escherichia coli Top10, selects positive colony.Correctly Plasmid be designated as pVAM-U-promoter-UAS-Q-LoxP2-gypsy-MCS1.

2.6, the linker of the multiple hairpin DNA of connection is added

With drosophila gene group as template, carry out PCR amplification with primer linker-F and linker-R.

Linker-F:AATCTAGACGCGATGCTCAAGGCAAAAA (SEQ ID NO:30)

linker-R:AACCTAGGCAGCATGAATGCGCCAATAT (SEQ ID NO:31)

Obtain 233 base PCR primer.PCR primer Xba I and Avr II double digestion, with through Avr II enzyme action and alkalescence phosphorus The plasmid pVAM-U-promoter-UAS-Q-LoxP2-gypsy-MCS1 of acid ferment treatment connects, and converts escherichia coli Top10, chooses Select positive colony.Order-checking obtains correct plasmid and is designated as pVAM-U-promoter-UAS-Q-LoxP2-gypsy-MCS1- linker。

2.7, the polyclone restriction enzyme site MCS2 of the multiple hairpin DNA of clone is added

Plasmid pVAM-U-promoter-UAS-Q-LoxP2-gypsy-MCS1-linker Spe I enzyme action, with alkalescence phosphorus Acid ferment treatment, then be connected with the synthesis MCS2 fragment of annealing, convert escherichia coli Top10, select positive colony.Order-checking just obtains True plasmid, as expression vector, is designated as VADUM, as shown in Figure 1.

Embodiment 2

Polycomb Group (PcG) albumen is that the class found first in fruit bat can reinvent chromatin so that special Determine the protein families that gene remains reticent on epigenetic, growth course plays very important effect.PcG albumen Play a role by forming different protein complexes, including two kinds of suppression complexs, Polycomb repressive complexes1and2(PRC1and PRC2).Core PRC1 of fruit bat is made up of 4 kinds of albumen, Polycomb (Pc), Sex Combs extra (Sce), Polyhomeotic (Ph) and Posterior sex combs (Psc).Due to PRC1 complex group The complexity become and polytropy, its function and physiological action are also not very clear.The most individually knock out 4 kinds of groups of core PRC1 Dividing and often do not have obvious phenotype, this causes the biggest puzzlement to the research of PRC1 function.Utilize the present invention to suppress simultaneously The expression of these 4 kinds of albumen, obtains knocking out from individual gene different phenotypes, offers convenience to the research of PRC1 function.

According to the methods below, the construct utilizing the present invention suppresses each albumen in fruit bat PRC1 complex simultaneously:

1, the RNAi carrier of suppression core PRC1 each component gene expression builds

CDS sequence inputting DSIR website (the http://biodev.extra.cea.fr/ of Pc, Sce, Ph and Psc gene DSIR/DSIR.html), design is just for 21 nucleotide siRNA of each gene.21 nucleotide antisense nucleotide (anti- Sense oligo) sequence and reverse complementary sequence (sense oligo) thereof be individually placed to the relevant position of following primer, obtains 4 To the primer being respectively used to each gene.

F:ctagcagt sense oligo tagttatattcaagcata anti-sense oligo gcg

R:aattcgc sense oligo tatgcttgaatataacta anti-sense oligo actg

Pc-F:ctagcagtCTCATCGACATCTACGAACAAtagttatattcaagcataTTGTTCGTAGATGTCGA TGAGgcg (SEQ ID NO:32)

Pc-R:aattcgcCTCATCGACATCTACGAACAAtatgcttgaatataactaTTGTTCGTAGATGTCGAT GAGactg (SEQ ID NO:33)

Sce-F:ctagcagtCCGCAAGAAGCTCGTCTCCAAtagttatattcaagcataTTGGAGACGAGCTTCT TGCGGgcg (SEQ ID NO:34)

Sce-R:aattcgcCCGCAAGAAGCTCGTCTCCAAtatgcttgaatataactaTTGGAGACGAGCTTCTT GCGGactg (SEQ ID NO:35)

Ph-F:ctagcagtCCGGGTCAGCTGGTTCTCTTAtagttatattcaagcataTAAGAGAACCAGCTGAC CCGGgcg (SEQ ID NO:36)

Ph-R:aattcgcCCGGGTCAGCTGGTTCTCTTAtatgcttgaatataactaTAAGAGAACCAGCTGACC CGGactg (SEQ ID NO:37)

Psc-F:ctagcagtCCAGTCGAATATGATGTACAAtagttatattcaagcataTTGTACATCATATTCG ACTGGgcg (SEQ ID NO:38)

Psc-R:aattcgcCCAGTCGAATATGATGTACAAtatgcttgaatataactaTTGTACATCATATTCGA CTGGactg (SEQ ID NO:39)

4 pairs of primer annealings of synthesis, it is connected with the plasmid VADUM of Nhe I and EcoR I double digestion respectively, converts large intestine Bacillus Top10, selects positive colony.Order-checking obtains the recombiant plasmid of RNAi individual gene, is designated as VADUM-Pc, VADUM-respectively Sce, VADUM-Ph and VADUM-Psc.

Plasmid VADUM-Sce Xba I and Spe I double digestion, reclaims the small fragment of 407 bases, then with Spe I single endonuclease digestion Connect with the plasmid VADUM-Pc of alkaline phosphatase treatment, convert escherichia coli Top10, select positive colony.Correct plasmid It is designated as VADUM-Pc-Sce.Plasmid VADUM-Ph Xba I and Spe I double digestion, reclaims the small fragment of 407 bases, and with Spe I The plasmid VADUM-Pc-Sce of single endonuclease digestion and alkaline phosphatase treatment connects, and converts escherichia coli Top10, identified obtain correct Plasmid be designated as VADUM-Pc-Sce-Ph.Finally, plasmid VADUM-Psc Xba I and Spe I double digestion, reclaims 407 bases Small fragment, is connected with the plasmid VADUM-Pc-Sce-Ph of Spe I single endonuclease digestion and alkaline phosphatase treatment, converts escherichia coli Top10, selects positive colony, just obtains the recombiant plasmid of RNAi4 gene simultaneously, is designated as VADUM-Pc-Sce-Ph-Psc.

2, the acquisition of transgenic fly

(genotype is y with microinjection instrument, 5 kinds of RNAi carrier obtained in the previous step to be expelled to the fruit bat of 0-1h respectively sc v nanos-integrase；AttP2), in embryo, it is put in 25 degrees Celsius of cultivations.

Then, by the drosophila hybrid that the male drosophila hatched and genotype are y sc v, from offspring, eye color is selected It is the wine-colored male drosophila of wild type, is the transgenic fly being integrated into RNAi carrier.The male drosophila picked out and gene Type is y sc v；The drosophila hybrid of Dr, e/TM3, sb, selects the fruit bat selfing of dark red eye and short bristle from offspring, then from it Offspring selects dark red eye and the fruit bat of long bristle, just obtains the transgenic fly isozygotied.

3, the impact that fruit bat is grown by suppression core PRC1 each component gene expression

Transgenic fly the present embodiment step 2 obtained and nos-Gal4 drosophila hybrid, be put in 25 DEG C of cultivations, after observation The phenotype in generation.

Result is as follows: the fruit bat of the independent RNAi of Pc, Sce, Ph and Psc, compared with wild-type Drosophila, does not demonstrate substantially Difference；And 4 genes are simultaneously by after RNAi, the ovary of the female fruit bat of offspring substantially diminishes, and does not lays eggs.This shows core There is redundancy in the function of each component of PRC1, the effect being likely to be due to other components after independent RNAi does not demonstrate phenotype, simultaneously Obvious phenotype is just obtained after RNAi all components.

Embodiment 3

Histone h1 is the one in the composition chromatinic 5 kinds of histones of eukaryote, not only at Chromosome Foundation and maintenance aspect there is important function, at the aspect such as cell proliferation, gene expression regulation, also there is certain effect.Fruit bat In only a kind of histone h1 gene, be the favourable model studying its function.But owing to fruit bat histone h1 gene has 23 Copy, hardly results in its mutant, and tradition RNAi method does not often reach and preferably knocks out efficiency.Utilize the present invention can be square Just the efficiency that regulator gene knocks out, greatly facilitates the research of its function.

Utilize the present invention construct strengthen histone h1 knock out efficiency, concrete grammar is as follows:

1, the structure of histone h1 RNAi carrier

According to the method design two told in embodiment 2 to the primer for histone h1, sequence is as follows:

H1-F1:ctagcagtTTGGTACATGTTCGCAATTAAtagttatattcaagcataTTAATTGCGAACATGT ACCAAgcg (SEQ ID NO:40)

H1-R1:aattcgcTTGGTACATGTTCGCAATTAAtatgcttgaatataactaTTAATTGCGAACATGTA CCAAactg (SEQ ID NO:41)

H1-F2:ctagcagtACCAGCGACAGTTGAGAAGAAtagttatattcaagcataTTCTTCTCAACTGTCG CTGGTgcg (SEQ ID NO:42)

H1-R2:aattcgcACCAGCGACAGTTGAGAAGAAtatgcttgaatataactaTTCTTCTCAACTGTCGC TGGTactg (SEQ ID NO:43)

After two pairs of primer annealings, it is connected with the plasmid VADUM of Nhe I and EcoR I double digestion respectively, converts escherichia coli Top10, selects positive colony.Order-checking obtains the recombiant plasmid of RNAi histone h1, is designated as VADUM-H1-1 and VADUM-H1-2.

Plasmid VADUM-H1-2 Xba I and Spe I double digestion, reclaims the small fragment of 407 bases, then with Spe I single endonuclease digestion Connect with the plasmid VADUM-H1-1 of alkaline phosphatase treatment, convert escherichia coli Top10, select positive colony.Correct matter Grain is designated as VADUM-2 × H1.Plasmid VADUM-2 × H1, again with Xba I and Spe I double digestion, reclaims the fragment of 814 bases, then with Connect with the plasmid VADUM-2 of Spe I single endonuclease digestion and alkaline phosphatase treatment × H1, convert escherichia coli Top10, select the positive Clone.Correct plasmid is designated as VADUM-4 × H1.Finally, plasmid VADUM-4 × H1 Xba I and Spe I double digestion, reclaims The fragment of 1628 bases, is connected with the plasmid VADUM-4 × H1 of Spe I single endonuclease digestion and alkaline phosphatase treatment, converts large intestine bar Bacterium Top10, selects positive colony.Correct plasmid is designated as VADUM-8 × H1.

2, histone h1 knocks out the impact growing wing

Use RNAi carrier VADUM-H1-1 obtained in the previous step, VADUM-4 × H1 and VADUM-8 × H1, according to enforcement Method described in example 2 obtains transgenic RNAi fruit bat (i.e. with microinjection instrument by 5 kinds of RNAi carrier obtained in the previous step respectively (genotype is y sc v nanos-integrase to be expelled to the fruit bat of 0-1h；AttP2), in embryo, it is put in 25 degrees Celsius of trainings Support.Then, by the drosophila hybrid that the male drosophila hatched and genotype are y sc v, it is wild for selecting eye color from offspring The wine-colored male drosophila of type, is the transgenic fly being integrated into RNAi carrier), be designated as respectively H1KD1, H1KD2 and H1KD3。

3 kinds of transgenic RNAi fruit bats are hybridized with ms1096-Gal4 respectively, 25 degrees Celsius of cultivations, observe the wing of offspring Phenotype.Result is as shown in Figure 2: relative to the wing of wild type male drosophila (wt), H1KD1 Yu ms1096-Gal4 filial generation is male The wing no significant difference of fruit bat；The wing size of H1KD2 with ms1096-Gal4 filial generation male drosophila somewhat diminishes, venation Extremely and slightly crimp；The wing of H1KD3 with ms1096-Gal4 filial generation male drosophila substantially diminishes, venation serious diseases and It is curled into one.

Those skilled in the art all understand, and traditional RNAi carrier is extremely difficult to the effect that knocks out of H1KD3, and utilizes above-mentioned The present invention can the most from weak to strong regulator gene knock out efficiency.

In the description of this specification, reference term " embodiment ", " some embodiments ", " example ", " specifically show Example " or the description of " some examples " etc. means to combine this embodiment or example describes specific features, structure, material or spy Point is contained at least one embodiment or the example of the present invention.In this manual, to the schematic representation of above-mentioned term not Necessarily refer to identical embodiment or example.And, the specific features of description, structure, material or feature can be any One or more embodiments or example in combine in an appropriate manner.

Although an embodiment of the present invention has been shown and described, it will be understood by those skilled in the art that: not These embodiments can be carried out multiple change in the case of departing from the principle of the present invention and objective, revise, replace and modification, this The scope of invention is limited by claim and equivalent thereof.

Claims

Nucleotide sequence shown in 1.SEQ ID NO:1 knocks out the purposes in multiple fruit bat genes of interest at the same time, wherein, described Purposes shows as being used as to knock out the linker between two siRNA adjacent in multiple siRNA of construct, the plurality of The target gene of siRNA is identical or different.
2. a construct, it is characterised in that comprise multiple siRNA, two siRNA adjacent in the plurality of siRNA pass through Nucleotide sequence shown in SEQ ID NO:1 is connected, and the target gene of wherein said multiple siRNA is identical or different.
Construct the most according to claim 2, it is characterised in that comprise further:

2 × QUAS sequence；And/or

10 × UAS sequence.
Construct the most according to claim 2, it is characterised in that comprise riddled basins further,

Optionally, described riddled basins is ampicillin resistance gene and/or selection markers vermilion gene.
Construct the most according to claim 2, it is characterised in that comprise promoter further,

Optionally, described promoter is U-promoter.
Construct the most according to claim 2, it is characterised in that comprise further:

Genome site-directed integration attB sequence；

Ftz intron sequences；And

SV40ployA sequence.
Construct the most according to claim 2, it is characterised in that comprise further:

2 LoxP sequences；And

Completely cut off sub-gypsy sequence,

Wherein, described isolation sub-gypsy sequence is between 2 LoxP sequences.
8. the method knocking out fruit bat genes of interest, it is characterised in that

The construct described in claim 2-7 is utilized to convert fruit bat.
Method the most according to claim 8, it is characterised in that utilize GAL4-UAS binary expression vector system to carry out described Converting, wherein said construct comprises 2 × QUAS sequence；And/or 10 × UAS sequence.
Method the most according to claim 8, it is characterised in that described conversion farther includes:

Described construct is utilized to convert the first fruit bat, in order to obtain the first transgenic fly；

There is provided the second transgenic fly, described second transgenic fly can express Gal4 albumen and/or Q albumen；And

By described first transgenic fly and described second transgenic fly hybridization, in order to obtain progeny transgenic fruit bat, described Described in progeny transgenic fruit bat, genes of interest is knocked.