CN103387982A - Application of miR1156f in regulating rice root and tiller growth - Google Patents
Application of miR1156f in regulating rice root and tiller growth Download PDFInfo
- Publication number
- CN103387982A CN103387982A CN2012101415968A CN201210141596A CN103387982A CN 103387982 A CN103387982 A CN 103387982A CN 2012101415968 A CN2012101415968 A CN 2012101415968A CN 201210141596 A CN201210141596 A CN 201210141596A CN 103387982 A CN103387982 A CN 103387982A
- Authority
- CN
- China
- Prior art keywords
- mir156f
- rice
- adjusting
- mim156f
- purposes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to an application of miR1156f in regulating rice root and tiller growth. Specifically, miR1156f can not only regulate rice root growth and/or control rice tiller but also regulate characters such as rice panicle type, grain shape, output, etc. Not only are applications of miR1156f, or miR1156f active segments, or miR1156f antagonist, or miR1156f agonist provided by the invention, but also a method for improving the rice crop is provided.
Description
Technical field
The invention belongs to the crop genetics field, particularly, the present invention relates to the application of miR156f in regulating rice root and tiller development.
Background technology
Paddy rice is most important food crop, and the population more than 1/3rd is take paddy rice as staple food in the world.Because paddy rice has advantages of that genome is little, heredity and physical map is meticulous, transgenic technology relatively easily and with the collinearity of other gramineous crop, paddy rice is also always as good model plant.Along with completing of Sequencing of Rice Genome, the mankind start to enter the genome times afterwards comprehensively, and carry out paddy rice functional genome research and gene annotation oneself becomes the Disciplinary Frontiers of life science comprehensively.Therefore the research of paddy rice functional gene is significant to socio-economic development and biological study.
For solving the contradiction of population growth and Cultivated Land Area Decrease, improving rice quality (, as improving the Rice Drought Resistence ability, improving paddy rice yield per unit) is the significant challenge that people face.Although it is twice revolution of rice science that the breeding wheat for semidwarfness of 20th century 50, the sixties and the hybrid rice of the seventies are cultivated, the quality of paddy rice raising in recent years starts to hover.
International paddy rice institute (CIRRI) proposition Breeding Rice for Ideotype in 1994, be based on and reduce the guiding theory of tillering sum, improving the percentage of earbearing tiller, moulding big panicle many grains per panicle one class novel strain type (NPT)." the Rice Super-yield Breeding plan " of China also be unable to do without the problem that improves Rice Drought Resistence and plant type transformation.Aspect the drought resisting of paddy rice, the rice root improvement mainly is conceived to root overstriking, the increase of root branch etc.; And aspect the plant type transformation, during spike number, grain number per spike and grain were heavy, what of spike number were limited by the generating capacity of tillering to a great extent.Thereby Analysing Root Characters is the Main Agronomic Characters that affects the staple crops qualities such as paddy rice with a minute evil.
MicroRNA (miR or miRNA, Microrna) is that a class extensively exists in more high most eukaryotes, and length is the single stranded RNA molecule of 18-26 base approximately.It can combine with the target site on some mRNA specifically by basepairing rule, causes that said target mrna degraded or translation suppress, and then at post-transcriptional level, target gene is regulated and controled.
MicroRNA derives from the approximately initial transcription product of long-chain RNA (Pri-miRNA) of 1000bp of length, and the Pri-miRNA molecule is sheared and formed the approximately miRNA precursor with loop-stem structure of 60-80nt of length through the Drosha enzyme in nucleus.After prerequisite miRNA is transported to kytoplasm, further cut into the double-stranded miRNA that is about 18-26nt.After double-stranded miRNA untied, ripe miRNA entered the reticent mixture (RNA-induced silencing complex, RISC) of RNA induced gene, with complementary mRNA fully or incomplete pairing, degraded said target mrna or check its expression.Although microRNA shared proportion in cell total rna is very little, because it can produce regulating and controlling effect to all mRNA with target site efficiently, microRNA role in the crops quality improvement can't neglect.
Up to now, this area is very few for affecting the rice root microRNA understanding relevant with the proterties of tillering, so the developmental effect of rice quality and application thereof are being regulated in the urgent need to research microRNA in this area.
Summary of the invention
The purpose of this invention is to provide effect and the application thereof of miR156f in regulating rice root and tillering.
First aspect at this aspect, provide the purposes of the agonist of the antagonist of a kind of miR156f or miR156f active fragments or miR156f or miR156f, and they are used to adjusting and controlling rice root development and/or adjusting and controlling rice tillering.
In another preference, described adjusting and controlling rice root development refers to: adjusting and controlling rice base diameter and/or adjusting and controlling rice root water-retaining capacity.
In another preference, described adjusting and controlling rice tillering refers to: the number of the number of adjusting and controlling rice tillering and/or adjusting and controlling rice one-level and/or secondary branch stalk.
In another preference, described miR156f has the described sequence as SEQ ID NO.:1.
In another preference, described miR156f derives from paddy rice.
In another preference, described purposes also is selected from lower group: adjusting and controlling rice fringe type, adjusting and controlling rice grain type, adjusting and controlling rice output or its combination.
In another preference, the antagonist of described miR156f is MIM156f, or contains the expression vector of MIM156f, and described MIM156f is the competitive little RNA of miR156f.
In another preference, described MIM156f has the described sequence as SEQ ID NO.:2.
In another preference, the agonist of described miR156f is for promoting the material of miR156f overexpression.
In a second aspect of the present invention, a kind of method that improves rice crop is provided, described improvement comprises: increase the rice root diameter and/or increase the rice root water-retaining capacity and/or increase the lodging resistance in rice ability, described method comprises step: expression or the activity of miR156f or miR156f active fragments in the reduction rice crop.
In another preference, in described reduction rice crop, the expression of miR156f or miR156f active fragments or activity are to realize in the following manner: the antagonist of expressing miR156f in described crop.
In another preference, the antagonist of described expression miR156f comprises: express MIM156f, express and contain the expression vector of MIM156f or the sponge (sponge) that expression is combined with miR156f.
In another preference, described MIM156f has the described sequence as SEQ ID NO.:2.
In should be understood that within the scope of the present invention, above-mentioned each technical characterictic of the present invention and can making up mutually between specifically described each technical characterictic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tire out and state no longer one by one at this.
Description of drawings
Following accompanying drawing is used for explanation specific embodiment of the invention scheme, and be not used in, limits the scope of the invention that is defined by claims.
Fig. 1 has shown in the short mutant of clump and wild-type the expression of results of spending No. 11 (for ZH11) phenotypes and miR156f gene, wherein, Figure 1A demonstration, the short mutant of clump is tillered a lot, plant is downgraded, plant height is in about 65-70cm, and spending 11 plant height in wild-type is the 110cm left and right; Figure 1B demonstration, in the short mutant of clump, the expression of miR156f is raised.
Fig. 2 shows the positive detection of the target mimicry transfer-gen plant of miR156f, and competitive little RNA, by overexpression significantly, and spends in 11 and there is no the little RNA of endogenic this competitiveness in contrast in transfer-gen plant.
Fig. 3 shows the phenotype of MIM156f, and wherein, the root of MIM156f increases thick obviously (Fig. 3 A and Fig. 3 B); Fig. 3 C shows is the comparison of the root photo in transgenosis T1 generation with wild-type ZH11, and showing that root increases thick phenotype can genetic stability; Fig. 3 D is the root resin slicer, shows that increasing of root slightly may be relevant with increasing of root parenchyma cell.
Fig. 4 has shown transfer-gen plant (MIM156f) proterties of tillering, and wherein, Fig. 4 A shows that MIM156f tillers seldom, almost just only has single tillering; Fig. 4 B demonstration, MIM156f presents the minimizing of firsts and seconds branch stalk number, thus the rare fringe phenotype that causes.
Fig. 5 shows rare fringe phenotype of transfer-gen plant MIM156f, shows that the seed of MIM156f is obviously elongated.
Fig. 6 shows that the short mutant of clump shows late flowering phenotype, and Zuo Weizhong spends 11, and the right side is the short mutant of clump; Little figure shows the size of fringe and the degree of extraction.
Fig. 7 has shown the structure of carrier p1301-35sNOs.
Fig. 8 has shown the structure of carrier PBSK carrier.
Embodiment
The inventor, through extensive and deep research, is surprised to find that first, and miR156f can regulate rice root and grow and/or adjusting and controlling rice tillering, can also adjusting and controlling rice fringe type, the proterties such as grain type, output.The present invention not only provides the purposes of the agonist of the antagonist of miR156f or miR156f active fragments or miR156f or miR156f, and a kind of method that improves rice crop also is provided.Completed on this basis the present invention.
MiRNA and precursor thereof
The invention provides a class relates to rice root and relevant miRNA in tillering.As used herein, described " miRNA " refers to a class RNA molecule, from forming the transcript processing of miRNA precursor.Ripe miRNA has 18-26 Nucleotide (nt) (more particularly approximately 19-22nt) usually, does not also get rid of the miRNA molecule with other number Nucleotide.MiRNA can be detected by the Northern trace usually.
The miRNA in paddy rice source can be separated from rice cell or tissue.As used herein, " separation " refers to that material separates (if natural substance, primal environment is namely natural surroundings) from its primal environment.There is no separation and purification as the polynucleotide under the native state in active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, for separation and purification.
MiRNA can be from precursor miRNA (Precursor miRNA, Pre-miRNA) processing, and described precursor miRNA can be folded into a kind of stable stem ring (hair clip) structure, and described loop-stem structure length is generally between 50-100bp.Described precursor miRNA can be folded into stable loop-stem structure, and the stem both sides of loop-stem structure comprise basically complementary two sequences.Described precursor miRNA can be natural or synthetic.
Precursor miRNA can be sheared and generate miRNA, and described miRNA can be basically complementary with at least a portion sequence of the mRNA of encoding gene.As used herein, " basically complementary " refers to that the sequence of Nucleotide is enough complementary, can interact in a kind of foreseeable mode, as forming secondary structure (as loop-stem structure).It is complementary that the nucleotide sequence of two usually, " basically complementary " has 70% Nucleotide between mutually at least; Preferably, it is complementary having 80% Nucleotide at least; Preferred, it is complementary having 90% Nucleotide at least; Further preferred, it is complementary having 95% Nucleotide at least; As 98%, 99% or 100%.Usually, two enough can have maximum 40 unmatched Nucleotide between complementary molecule; Preferably, have maximum 30 unmatched Nucleotide; Preferred, have maximum 20 unmatched Nucleotide; Further preferred, have maximum 10 unmatched Nucleotide, as have 1,2,3,4,5,8,11 unmatched Nucleotide.
As used herein, " stem ring " structure also is known as " hair clip " structure, refer to a kind of nucleic acid molecule, it can form a kind of secondary structure that comprises double-stranded region (stem), described double-stranded region is formed by two zones (being positioned on same a part) of this nucleic acid molecule, the both sides of two double-stranded parts of regional apportion; It also comprises at least one " ring " structure, comprises non-complementary nucleic acid molecule, i.e. the strand zone.Even two zones of this nucleic acid molecule are not complete complementaries, the double-stranded part of Nucleotide also can keep double-stranded state.For example, insertion, disappearance, replacement etc. can cause not complementary or this zonule self formation loop-stem structure of a zonule or the secondary structure of other form, yet these two zones still can be basically complementary, and interact in foreseeable mode, form the double-stranded region of loop-stem structure.Loop-stem structure is well-known to those skilled in the art, and after the nucleic acid that has obtained a nucleotide sequence with primary structure, those skilled in the art can determine whether this nucleic acid can form loop-stem structure usually.
MiRNA of the present invention is miR156f, and in paddy rice, its sequence is: UGACAGAAGAGAGUGAGCAC(SEQ ID NO.:1).The present invention also comprises variant and the derivative of miR156f, those of ordinary skill in the art can use general method to modify miRNA-23, and the modification mode includes, but is not limited to: alkyl modifies, glycosylation modified, nucleination modification, the modification of peptide section, lipid modification, halogen modification etc.Wherein, glycosylated modification group comprises: 2-methoxyl group-glycosyl, alkyl-glycosyl, sugared cyclic group etc., for stability or other character that improves miRNA, also can add at least one end of described miRNA at least one protectiveness base, as " TT " etc.
The polynucleotide construction
According to miRNA sequence provided by the present invention, can design the polynucleotide construction of the miRNA that can be processed to affect corresponding mrna expression after being imported into, be also the amount that described polynucleotide construction can raise corresponding miRNA in vivo.Therefore, the invention provides a kind of polynucleotide (construction) of separation, described polynucleotide (construction) can be become precursor miRNA by people's cell transcription, and described miRNA can be sheared and be expressed as by host cell to described precursor miRNA.
As a kind of optimal way of the present invention, described polynucleotide construction contains the structure shown in formula II:
Seq
Forward-X-Seq
Oppositely
Formula II
In formula II,
The Seq forward be for can become at cells the nucleotide sequence of described miR156f, Seq
OppositelyFor with Seq
Just ToBasically complementary nucleotide sequence; Perhaps, Seq
OppositelyFor becoming at cells the nucleotide sequence of described miRNA, Seq
ForwardFor with Seq
ForwardBasically complementary nucleotide sequence;
X is for being positioned at Seq
ForwardAnd Seq
OppositelyBetween intervening sequence, and described intervening sequence and Seq
ForwardAnd Seq
OppositelyNot complementary;
Structure shown in formula I after changing host cell over to, forms the secondary structure shown in formula III:
Formula III
In formula III, Seq
Forward, Seq
OppositelyWith stating as defined above of X;
|| be illustrated in Seq
ForwardAnd Seq
OppositelyBetween the base complementrity pair relationhip that forms.
Usually, described polynucleotide construction is positioned on expression vector.Therefore, the present invention also comprises a kind of carrier, and it contains described miRNA, or described polynucleotide construction.Described expression vector also contains promotor, replication orgin and/or marker gene etc. usually.Method well-known to those having ordinary skill in the art can be used for building expression vector required for the present invention.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of the host cell that transforms, as kalamycin, gentamicin, Totomycin, amicillin resistance.
MIM156f
The present invention also provides a kind of MIM156f for miR156f, and described MIM156f suppresses the effect of miR156f competitively, contains the expression vector of MIM156f by structure, and MIM156f is carried out overexpression, thereby the effect of miR156f is disturbed.In a specific embodiment of the present invention, the sequence of MIM156f is: UGACAGAAGAuagaAGUGAGCAU(SEQ ID NO.:2).Those of ordinary skill in the art can use general method to build the MIM156f overexpression vector.
Purposes
The present invention also provides the purposes of the agonist of the antagonist of miR156f or miR156f active fragments or miR156f or miR156f, and they are used to adjusting and controlling rice root development and/or adjusting and controlling rice tillering.Described adjusting and controlling rice root development refers to: adjusting and controlling rice base diameter and/or adjusting and controlling rice root water-retaining capacity and/or adjusting and controlling rice lodging tolerance; Described adjusting and controlling rice tillering refers to: adjusting and controlling rice one-level and/or secondary branch stalk number; MiR156f has the described sequence as SEQ ID NO.:1, derives from paddy rice.
In a preference of the present invention, the antagonist of described miR156f is MIM156f, or contains the expression vector of MIM156f, and described MIM156f is the competitive little RNA of miR156f; Preferably MIM156f has the described sequence as SEQ ID NO.:2.
Rice modification
The present invention also provides a kind of method that improves rice crop, described improvement comprises: increase the rice root diameter and/or increase the rice root water-retaining capacity and/or increase the lodging resistance in rice ability, comprising step: the antagonist of the expression of reduction miR156f or miR156f active fragments or activity, interpolation miR156f; Preferably the antagonist of described miR156f is MIM156f, or contains the expression vector of MIM156f, and described MIM156f is the competitive little RNA of miR156f; More preferably, described MIM156f has the described sequence as SEQ ID NO.:2.
Major advantage of the present invention comprises:
(1) the invention provides the microRNA-miR156f family relevant to rice root and tiller development;
(2) the present invention also provides the application of MIM156 in suppressing miR156f effect and crop quality improvement.
, below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only are not used in and limit the scope of the invention for explanation the present invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
The rice mutant that embodiment 1miR156f raises
The preparation of paddy rice T-DNA insertion mutation colony:
Transform and with paddy rice be: flower 11(Oryza Sativa L.subsp.Japonica cv.Zhonghua No.11 in japonica rice variety).
The plasmid that is used for transforming is commercially available pCAMBIA1300 carrier, in the T-DNA zone of pCAMBIA1300 carrier, inserts corn Ds transposable element, simultaneously, contains the bar gene of antiweed PPT in this Ds, obtains the pDsBar1300 plasmid.
Transform commercially available Agrobacterium EHA105 through freeze-thaw method, spend 11 immature embryos in infecting, screening obtains kanamycin-resistant callus tissue on the substratum that contains the 50mg/L Totomycin, and obtains seedling on division culture medium, thereby obtains paddy rice T-DNA insertion mutation colony.
Screening obtains downgrading More-tiller mutant (referred to as the short mutant of clump) from this colony,, through continuous three generations's isolation identification, obtains the short mutant of no mutant homozygote was clump.
Take the short mutant of clump as the parent, to hybridize with spending No. 11 (following referred to as ZH11) in wild-type, the hereditary separation case of dwarfing and the proterties of tillering in the observation filial generation, find that this sudden change is a single-gene dominant mutation; Analyze through PCR and Southern equimolecular, showing to control to downgrade inserts relevant with the sudden change of the epistasis shape of tillering with T-DNA, the on position of finding T-DNA is in 21575719 the position of NCBI sequence number NC-008401.2, and the coding region of miR156f is the position of same clone's 21566236-21566421, therefore, the on position of T-DNA in the short mutant of clump is apart from the about 9kb of miR156f gene, so on position is near the miR156f gene.
Analyzing and testing analysis discovery, in the short mutant of clump, the expression of miR156f is raised.Fig. 1 has shown the short mutant of clump and has given birth in wild type the expression of results of spending No. 11 (for ZH11) phenotypes and miR156f gene, the short mutant of clump is tillered a lot, plant is downgraded, under the planting conditions in land for growing field crops, Shanghai City in summer, the plant height of the short mutant of clump is in about 65-70cm, and spend 11 plant height in the contrast wild-type, is the 110cm left and right; The effective tillering fringe of the short mutant of clump reaches (Figure 1A) more than 20.Be separated to T-DNA tagging technology the adjacent DNA sequence dna in side that T-DNA inserts, with the method for little RNA Northern, detect, find that (Figure 1B) raised in the expression of miR156f in the short mutant of clump.
Result shows, in the short mutant of clump, the up-regulated expression of miR156f has caused the phenotype of downgrading and tillering more.
The transfer-gen plant that the competitive function of embodiment 2target mimicry technique construction miR156f is lowered
1. the method by PCR, with primer ipsF:GTGGATCCaagaaaaatggccatcccctagc(SEQ ID NO.:3) and ipsR:CTGGAGCTCgaggaattcactataaagagaatcg(SEQ ID NO.:4) amplification, obtaining length is the cDNA sequence of the Arabidopis thaliana IPS gene of 522bp
2. cut by BamHI and SacI enzyme, this fragment be cloned into PBSK(pBluescript II SK (+)) carrier, Fig. 8 has shown the structure of carrier PBSK carrier, the complete sequence of this carrier is seen SEQ ID NO.:7; Standby.
3. then by primer MIM156f-I:
CgaagctTGACAGAAGAtagaAGTGAGCATtttctagagggagataa(SEQ ID NO.:5) and ipsF coupling;
Primer MIM156f-II:
CctctagaaaATGCTCACTTCTATCTTCTGTCAagcttcggttcccctcg(SEQ ID NO.:6) and ipsR coupling;
4. method (method reference (the An et al. of overlapping extension (overlap extension) PCR, 2005)), with the competitive little RNA sequence MIM156f:UGACAGAAGAtagaAGUGAGCAT(SEQ ID NO.:2 of miR156f) be substituted in the cDNA sequence that above-mentioned amplification obtains the IPS gene;
5. obtain the purpose fragment with ipsF and ipsR amplification, cut by BamHI and SacI enzyme, the complete sequence that this fragment is building up to this carrier of overexpression vector pCAMBIA1301-35sNOs(is seen SEQ ID NO.:8, and Fig. 7 has shown the structure of carrier p1301-35sNOs) obtain plasmid p130135SNOS-MIM156f;
6. with plasmid p130135SNOS-MIM156f, by the mediation of commercially available agrobacterium strains EHA105, genetic transformation is spent in 11 in the wild-type paddy rice, and reach MIM156f is carried out overexpression, thus the purpose that the function of miR156f is disturbed.
7. result
7.1miR156f the positive detection of target mimicry transfer-gen plant
Choose the seedling leaf of the transfer-gen plant that presents obvious phenotype, take emulative little RNA---MIM156f as hybridization probe (sequence as: UGACAGAAGAtagaAGUGAGCAT SEQ ID NO.:7), detect the expression of competitive little RNA in transfer-gen plant MIM156f, find competitive little RNA in transfer-gen plant (MIM156f) by overexpression significantly, and spend in 11 and there is no the little RNA(Fig. 2 of endogenic this competitiveness in contrast).
7.2miR156f target mimicry transfer-gen plant (MIM156f) Analysing Root Characters
The phenotype of MIM156f shows many-sided: the root of MIM156f increases slightly very obviously (Fig. 3 A and Fig. 3 B); And root increases thick phenotype can genetic stability, and Fig. 3 C shows is the comparison of the root photo in transgenosis T1 generation with wild-type ZH11; The demonstration of root resin slicer, increasing of root slightly may be with increasing relevant (Fig. 3 D) of root parenchyma cell.
The proterties 7.3 transfer-gen plant (MIM156f) is tillered
MIM156f is tillered seldom, under the planting conditions of Shanghai plant physiology ecological Studies institute of Chinese Academy of Sciences phytotron, almost just only have single tillering (Fig. 4 A), with single tiller corresponding, MIM156f presents the minimizing of firsts and seconds branch stalk number, thus the rare fringe phenotype (Fig. 4 B) that causes.
7.4MIM156f rare fringe phenotype
The seed that selection is shelled, record middle colored 11(ZH11) thousand seed weight be 21.24g, the thousand seed weight of M156f is 23.4, increases by 10.2%, illustrates that the seed of MIM156f obviously increases; Select with batch the seed of shell MIM156f and ZH11, measure length and width, thick, the numerical value that records is as shown in table 1, the seed that MIM156f is described is elongated (Fig. 5) obviously.
Table 1
| Grain length | Grain is wide | Grain is thick | Length/width | Long/thick | |
| MIM156f | 5.3094 | 2.8354 | 2.0854 | 1.87 | 2.55 |
| ZH11 | 4.904 | 2.7812 | 2.078 | 1.76 | 2.36 |
7.5miR156f on the Rice Flowering impact of (heading) time
No matter be that miR156 shows the impact on flowering time under the planting conditions or the experiment condition in land for growing field crops that artificial climate is.Be specially the short mutant of clump (miR156f rise) and show as late blooming, and the target mimicry transfer-gen plant of miR156f shows as prematurity.
Fig. 6 shows that the short mutant of clump shows late flowering phenotype, and Zuo Weizhong spends 11, and the right side is the short mutant of clump; Little figure shows the size of fringe and the degree of extraction, and picture material is taken from plant physiology ecological Studies institute of Shanghai Sheng Ke institute of Chinese Academy of Sciences phytotron.
Reference:
An,Y.,Ji,J.,Wu,W.,Lv,A.,Huang,R.,and Wei,Y.(2005).A rapid and efficient method for multiple-site mutagenesis with a modified overlap extension PCR.Appl Microbiol Biotechnol 68,774-778.
Franco-Zorrilla,J.M.,Valli,A.,Todesco,M.,Mateos,I.,Puga,M.I.,Rubio-Somoza,I.,Leyva,A.,Weigel,D.,Garcia,J.A.,and Paz-Ares,J.(2007).Target mimicry provides a new mechanism for regulation of micro RNA activity.Nat Genet 39,1033-1037.
Wang,J.,Li,L.,Wan,X.,An,L.,and Zhang,J.(2004).Distribution of T-DNA carrying a Ds element on rice chromosomes.Sci China C Life Sci 47,322-331.
All quote in this application as a reference at all documents that the present invention mentions, just as each piece document is quoted separately as a reference.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. the purposes of the agonist of the antagonist of a miR156f or miR156f active fragments or miR156f or miR156f, is characterized in that, they are used to adjusting and controlling rice root development and/or adjusting and controlling rice tillering.
2. purposes as claimed in claim 1, is characterized in that, described adjusting and controlling rice root development refers to: adjusting and controlling rice base diameter and/or adjusting and controlling rice root water-retaining capacity.
3. purposes as claimed in claim 1, is characterized in that, described adjusting and controlling rice tillering refers to: the number of the number of adjusting and controlling rice tillering and/or adjusting and controlling rice one-level and/or secondary branch stalk.
4. purposes as claimed in claim 1, is characterized in that, described miR156f has the described sequence as SEQ ID NO.:1.
5. purposes as claimed in claim 1, is characterized in that, described purposes also is selected from lower group: adjusting and controlling rice fringe type, adjusting and controlling rice grain type, adjusting and controlling rice output or its combination.
6. purposes as claimed in claim 1, is characterized in that, the antagonist of described miR156f is MIM156f, or contain the expression vector of MIM156f, and described MIM156f is the competitive little RNA of miR156f.
7. purposes as claimed in claim 6, is characterized in that, described MIM156f has the described sequence as SEQ ID NO.:2.
8. purposes as claimed in claim 1, is characterized in that, the agonist of described miR156f is: the material that promotes the miR156f overexpression.
9. method that improves rice crop, described improvement comprises: increase the rice root diameter and/or increase the rice root water-retaining capacity and/or increase the lodging resistance in rice ability, it is characterized in that, described method comprises step: expression or the activity of miR156f or miR156f active fragments in the reduction rice crop.
10. method as claimed in claim 9, is characterized in that, in described reduction rice crop, the expression of miR156f or miR156f active fragments or activity are to realize in the following manner: the antagonist of expressing miR156f in described crop.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210141596.8A CN103387982B (en) | 2012-05-08 | 2012-05-08 | MiR156f is regulating the application in rice root and tiller development |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210141596.8A CN103387982B (en) | 2012-05-08 | 2012-05-08 | MiR156f is regulating the application in rice root and tiller development |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103387982A true CN103387982A (en) | 2013-11-13 |
| CN103387982B CN103387982B (en) | 2015-10-28 |
Family
ID=49532404
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210141596.8A Expired - Fee Related CN103387982B (en) | 2012-05-08 | 2012-05-08 | MiR156f is regulating the application in rice root and tiller development |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103387982B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667339A (en) * | 2013-11-29 | 2014-03-26 | 中国科学院遗传与发育生物学研究所 | Application of rice-derived protein OsMKK4 and related biological material thereof to regulation and control of plant panicle types |
| CN104450711A (en) * | 2014-12-31 | 2015-03-25 | 湖南农业大学 | Application of OsmiR156f gene in rice effective tillering increasing |
| CN105985954A (en) * | 2015-01-27 | 2016-10-05 | 华中农业大学 | Application of paddy rice miR160b gene in regulation and control on tillering angle |
| CN109679949A (en) * | 2018-08-30 | 2019-04-26 | 南京农业大学 | Regulation miR156 and its target gene IPA1 improves the breeding method of paddy disease-resistant and yield simultaneously |
| CN111662924A (en) * | 2019-03-07 | 2020-09-15 | 山东舜丰生物科技有限公司 | Gene editing method for regulating rice plant type and seed grain weight |
-
2012
- 2012-05-08 CN CN201210141596.8A patent/CN103387982B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| IGNACIO等: "MicroRNA networks and developmental plasticity in plants", 《TRANDS IN PLANT SCIENCE》 * |
| WANG等: "Molecular evolution and selection of a gene encoding two tandem microRNA in rice", 《FEBS LETTERS》 * |
| XIE等: "Genomic Organization,Differential expression, and interaction of SQUAMOSA Promoter-Binding-Like Transcription Factors and MicroRNA156 in Rice", 《PLANT PHYSIOLOGY》 * |
| XIE等: "gradual increase of miR156 regulates temporal expression changes of numerous genes during leaf development in rice", 《PLANT PHYSIOLOGY》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667339A (en) * | 2013-11-29 | 2014-03-26 | 中国科学院遗传与发育生物学研究所 | Application of rice-derived protein OsMKK4 and related biological material thereof to regulation and control of plant panicle types |
| CN103667339B (en) * | 2013-11-29 | 2015-06-24 | 中国科学院遗传与发育生物学研究所 | Application of rice-derived protein OsMKK4 and related biological material thereof to regulation and control of plant panicle types |
| CN104450711A (en) * | 2014-12-31 | 2015-03-25 | 湖南农业大学 | Application of OsmiR156f gene in rice effective tillering increasing |
| CN105985954A (en) * | 2015-01-27 | 2016-10-05 | 华中农业大学 | Application of paddy rice miR160b gene in regulation and control on tillering angle |
| CN105985954B (en) * | 2015-01-27 | 2018-07-31 | 华中农业大学 | Application of the rice miR160b genes in regulating and controlling tillering angle |
| CN109679949A (en) * | 2018-08-30 | 2019-04-26 | 南京农业大学 | Regulation miR156 and its target gene IPA1 improves the breeding method of paddy disease-resistant and yield simultaneously |
| CN109679949B (en) * | 2018-08-30 | 2022-05-17 | 南京农业大学 | Breeding method for regulating miR156 and target gene IPA1 thereof and simultaneously improving disease resistance and yield of rice |
| CN111662924A (en) * | 2019-03-07 | 2020-09-15 | 山东舜丰生物科技有限公司 | Gene editing method for regulating rice plant type and seed grain weight |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103387982B (en) | 2015-10-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106164272A (en) | The plant modified | |
| CN104293828A (en) | Site-specific modification method for plant genome | |
| CN107164401A (en) | A kind of method and application that rice Os PIL15 mutant is prepared based on CRISPR/Cas9 technologies | |
| CN103387982B (en) | MiR156f is regulating the application in rice root and tiller development | |
| CN108291234A (en) | Multiple sporinite forms gene | |
| BR112020010655A2 (en) | krn2 corn gene and uses of it | |
| CN111836895A (en) | Compositions and methods for increasing crop yield through trait stacking | |
| CN102432679A (en) | Rice extensin OsPEX1 and application thereof | |
| CN101747420B (en) | Dominant dwarf rice related protein, encoding gene thereof and application | |
| BR112020015033A2 (en) | COMPOSITIONS AND METHODS TO IMPROVE CULTURE INCOME BY STACKING TRACES | |
| US20220333214A1 (en) | Methods of determining sensitivity to photoperiod in cannabis | |
| CN103172715A (en) | Plant epidermal hair controlling gene and application thereof | |
| CN101921777B (en) | Application of rice leaf inclination control gene SAL1 | |
| CN109161551B (en) | Cabbage BoMS1 gene and application thereof in creating sterile materials | |
| CN110468128B (en) | Rice mutant miR393am with high brown planthopper resistance and salt tolerance and application thereof | |
| CN102584973B (en) | Rice plant type related protein LPA1 and coding gene and application thereof | |
| CN112351680A (en) | Plants with improved digestibility and marker haplotype | |
| CN109355296A (en) | Rice leaf roll gene URL1 and application | |
| US20230279418A1 (en) | Plant haploid induction | |
| CN111662924A (en) | Gene editing method for regulating rice plant type and seed grain weight | |
| JP6012016B2 (en) | Participatory outcome control genes and their use | |
| CN103361348B (en) | Relevant microRNA and coding nucleic acid molecule thereof and application is regulated and controled to rice leaf width | |
| US10538775B2 (en) | Terminator sequence for gene expression in plants | |
| CN104593369A (en) | Application of miR319a2 in adjustment of head shape of cabbage leaf | |
| CN104450739B (en) | A kind of paddy rice source anti insect related gene OsHR1 and coded product thereof and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20151028 Termination date: 20200508 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |