CN105985954B - Application of the rice miR160b genes in regulating and controlling tillering angle - Google Patents

Abstract

The invention belongs to plant genetic engineering fields, and in particular to a kind of application of rice miR160b genes in regulating and controlling tillering angle.By overexpression miR160b genes, normal rice plant is made the increased character mutation of tillering angle occur, inhibits miR160b genes that the mutant phenotype of overexpression miR160b plant can be made to restore.MiR160b genes have the function of controlling plant type of rice, the loop-stem structure DNA sequence dna such as SEQ ID NO of the gene:Shown in 1, the loop-stem structure precursor RNA sequence such as SEQ ID NO that are formed after transcription:Shown in 2, the ripe miR160b nucleus sequence such as SEQ ID NO that are formed after transcription and cutting:Shown in 3.It discloses and changes rice miR160b genes or the expression pattern of other member genes of family using technique for gene engineering, adjusting and controlling rice tillering angle forms ideotype, achievees the purpose that volume increase.

Description

Application of the rice miR160b genes in regulating and controlling tillering angle

Technical field

The invention belongs to plant genetic engineering fields.More particularly to a kind of adjusting and controlling rice tillering angle gene miR160b's Functional verification and application.The present invention makes normal rice plant tillering angle occur increased by overexpression miR160b genes Character mutation inhibits miR160b genes that the mutant phenotype of overexpression miR160b plant can be made to restore, further relates to pass through experiment Verify inhibition of the miRNA to target gene, and then the tillering angle of adjusting and controlling rice.The invention further relates to pass through technique for gene engineering Purposefully genetic improvement is carried out using the plant type of the gene pairs rice.

Background technology

Rice is one of main cereal crops in the world, is more than the staple food of half population as the whole world.Rice with its compared with Small genome (about 430Mbp), fine physics and genetic map, and planted with other grass family such as corn, barley, wheats Object has preferable synteny, relative maturity and maneuverable genetic conversion system in the genome, to be considered as unifacial leaf The model plant of plant gene function research.With the continuous reduction year by year increased with cultivated area of population in the world, grain peace Full problem has been to be concerned by more and more people, wherein the yield for improving rice unit area be solve the problems, such as this important measures it One.The fifties Dwarfing Gene application and the cultivation of the hybrid rice seventies so that China's rice yield is had occurred revolutionary twice Leap, but a very long time China's rice yield has been at the situation to fluctuate later.In recent years, breeder and heredity It is with ideotype and new to cultivate high-yield rice with the means that heterosis utilization is combined that scholars are expected that by selection and breeding, with reality The further promotion of existing rice yield.

Plant height, tiller number, tillering angle and fringe form are to influence the important factor of plant type of rice, and wherein tiller is rice reason Think one of plant type and the Main Agronomic Characters of high yield.Tiller is the fundamental characteristics of paddy growth, it includes tillering angle and divides Two aspects of tiller power, the former reflects the collecting and distributing degree of stem and tiller；The latter is demonstrated by the number of tiller number.Tillering angle is Refer to the angle of tiller and stem before plant heading, it is directly affected between rice plant and plant interior focusing, temperature, oxygen it is competing It strives, the final yield for influencing rice.Although loose plant type can occupy too many space, make to avoid the infringement of disease pest Photosynthetic efficiency reduces, lodging tolerance declines, and compact plant limits the infiltration of light and air, the humidity of adjacent plant Increase, make plant be easier to infect pest and disease damage (Wang etc., Rice rising.Nat Genet, 2008,40:1273-1275). Therefore, tillering angle is excessive or the too small raising for being all unfavorable for rice yield of tillering angle.

Currently, the important gene closely related with tillering angle cloned has：TAC1, PRGO1, LAZY1 and LPA1. TAC1 is the major gene resistance for control tillering angle this quantitative character being cloned for 2007, and the gene is in tiller base portion and stem It is specific expressed at section.Mutation in its 4th introne at 3 ' end shearing sites so that TAC1 expressions decline, with open country Raw type is in more obvious asymmetric growth pattern compared to its lateral bud base portion, to generate tillering angle close to 0 ° of mutant phenotype (Baisheng etc., TAC1, a major quantitative trait locus controlling tiller angle in rice.Plant J,2007,52:891-898).One C2H2 type zinc finger protein of PRGO1 gene codes of clone in 2008, The gene specific is expressed in lateral meristem and apical meristem.The transversion of a base in its open reading frame The change for causing coding protein sequence, to generate the increased phenotype of tillering angle.Histotomy observation display, in the mutant In, lateral bud base portion near the ground and privately face are in symmetric growth pattern so that lateral bud can not be bent and grow up and present and throw oneself on the ground Growth pattern (Lubin etc., Control of a key transition from prostrate to erect growth in rice domestication.Nat Genet,2008,40:1360-1364；Jian etc., Genetic control of rice plant architecture under domestication.Nat Genet,2008,40:1356-1369)。2007 The LAZY1 genes of year clone specifically expressing, polar translocation of auxin at depletion mutant lateral bud in stem and plumule It is destroyed, causes endogenous auxins abnormal distribution, to the increased mutant phenotype of tillering angle occur.Current research is shown Only angle gold lactone synthesis mutant can be such that the increased mutant phenotype of lazy1 tillering angles replys, and only angle gold lactone passes through inhibition The synthesis of auxin reduces tillering angle (Sang etc., Strigolactones of the content of IAA and then influence rice in lateral bud regulate rice tiller angle by attenuating shoot gravitropism through inhibiting auxin biosynthesis.Proc Natl Acad Sci U S A,2014,111:11199-11204), Show that only angle gold lactone may participate in the regulation and control of tillering angle in rice.LPA1 is that a coded plant just finding recently is peculiar Structural domain do not know the transcription inhibitory factor of (ID), there is mutant lpa1 loose plant type, tiller angle and leaf angle to increase, Internode is shortened, is thickened, stalk cell wall thickening, and grain and blade face shorten and broaden, and overground part weakens to principal characteristic.LPA1 has special Expression pattern, have compared with strongly expressed in the Leaf angle and internode of tender tissue and older tiller base portion.LPA1 passes through tune The rate of settling of amyloplaste regulates and controls gravity sensing and signal transduction in solution cell, it is final influence rice aerial part to gravity Property reaction to regulate and control the size Wu etc. at tiller angle and Leaf angle, Loose plant architecture1, an INDETERMINATE DOMAIN protein involved in shoot gravitropism,regulates plant architecture in rice.Plant Physiol,2013,161:317-329).Although being cloned at present The gene of rice tillering angle is controlled, but the molecular mechanism about rice tillering angle is still unclear.

ARF is a kind of special transcription factor family with B3DNA binding domain in plant, they are specific by being incorporated in On the AuxRE elements (TGTCTC) of gene promoter region, activation or the expression for inhibiting auxin-responsive gene.Typically There are three the intermediate regions that structural domain is respectively that N-terminal is not guarded than more conservative DNA binding domain (DBD), for ARF usually tools (MR), C-terminal is than more conservative dimerization body region (CTD).DBD structural domains mediation ARF and originally auxin-responsive gene (GH3, SAUR, Aux/IAA) promoter region AuxRE specific bonds, MR structural domains then determine the type of ARF transcription factors, and CTD structural domains are similar to III the and IV structural domains of Aux/IAA albumen, and the CTD structural domains of ARF can be with Aux/IAA albumen III and IV structural domains combine.Crystal structure analysis of the newest studies have shown that ARF5 and ARF7 in arabidopsis ARF families It was found that the regions CTD of ARF5 and ARF7 have the regions PB1, they can be formed the form of oligomer respectively with IAA17 and IAA21 interactions between protein, and then regulate and control inhibition (Korasick etc., Molecular basis for AUXIN of auxin response RESPONSE FACTOR protein interaction and the control of auxin response repression.Proc Natl Acad Sci USA,2014,111:5427-5432；Nanao etc., Structural basis for oligomerization of auxin transcriptional regulators.Nat Commun,2014,5: 3617).Have 25 members in rice ARF families, reported have OsARF1, OsARF12, OsARF16, OsARF19, OsARF23, OsARF24 and OsARF25, each participate in the different growth and development processes of rice.It is newest researches show that OsARF12 participates in influencing the balance of phosphorus in rice body, sufficient/scarce in Pi in osarf12 and osarf12osarf25 mutant Under conditions of weary, the expression quantity that relevant gene is responded with phosphorus is all increased (Wang etc., Auxin response factor (OsARF12),a novel regulator for phosphate homeostasis in rice(Oryza sativa) .New Phytologist,2014,201:91-103).OsARF23 and OsARF24 can form heterodimeric body protein, jointly The promoter region of RMD genes is acted on, the expression of RMD genes is directly adjusted, the growth of adjusting and controlling rice cell and form occur (Li et al., Rice actin-binding protein RMD is a key link in the auxin-actin regulatory loop that controls cell growth.Proc Natl Acad Sci U S A,2014,111: 10377-10382).The size of OsARF19 adjusting and controlling rice Leaf angles by the expression for adjusting OsGH3.5 and OsBRI1.But The research about OsARF and tillering angle relationship there is no to report in rice.

A kind of special small RNA molecular miRNA160 is formed after miR160b genetic transcriptions according to the present invention.miRNAs Be endogenic a kind of organism, about 22-24nt long, not coding protein small RNA molecular, it is widely present in each species In and it is upper highly conserved evolving, participate in the spatiotemporal database of organismal development, cell differentiation, signal transduction, disease, adverse circumstance and answer A variety of bioprocess such as answer.MiR-96 gene is as the gene of other coding albumen, all by promoter, transcriptional domain and termination Son composition.In plant, the pairing of miRNA and downstream target gene is almost to exactly match, and regulatory mechanism belongs to mostly The regulation and control of post-transcriptional level, that is, the AGO complexs for containing maturation miRNA can directly cut the mRNA of target gene, in turn Entire mRNA molecules are degraded.Result of study in arabidopsis shows that the target gene of miRNA160 is ARF gene families ARF6, ARF10 and ARF17.MiRNA160 direct regulations and controls ARF17 affects auxin in arabidopsis to further regulate and control GH3 Distribution in each histoorgan.When overexpressing one not by ARF17 genes (mARF17) of miRNA160 regulation and control, plant occurs Various mutations phenotype, including leaf rolling, development of floral organs is abnormal, bloom in advance, infertility etc., and make auxin early stage response The expression of gene GH3 gene families is abnormal (Mallory etc., MicroRNA-directed regulation of Arabidopsis AUXIN RESPONSE FACTOR 17is essential for proper development and modulates expression of early auxin response genes.Plant Cell,2005,17:1360- 1375).Arf10arf16 double-mutants and Pro35S:MIR160 plant show identical mutant phenotype, including main root length Reduction, lateral root number increase, lose gravity sensing.Although there are functional redundancy phenomenons by ARF10 and ARF16, they are right The development of arabidopsis root cap is indispensable Wang etc., Control of root cap formation by microRNA- targeted auxin response factors in Arabidopsis.Plant Cell,2005,17:2204-2216)。 When overexpressing one not by ARF10 genes (mARF10) of miRNA160 regulation and control, there is zigzag leaf, curling again in plant Silique, distortion the mutant phenotypes such as spend, miR160 affects the regulation and control of ARF10 sprout after seedling to the sensibility of ABA, table Bright IAA and ABA has potential contact (Liu et al., Repression of AUXIN RESPONSE in the germination process of seed FACTOR 10by microRNA160is critical for seed germination and post-germination stages.Plant J,2007,52:133-146).Mutant foc has one in 3 ' regulatory regions of arabidopsis MIR160a genes A Ds transposons is inserted into, which shows the mutation such as jagged leaf, irregular flower, abnormal seed, viviparous seedling Phenotype, further analysis find the mutant phenotype be due to caused by abnormal cell division during embry ogenesis, The accumulation of maturation miR160 is reduced in foc mutant and the expression pattern of target gene ARF10, ARF16 and ARF17 change, It can thus be appreciated that 3 ' regulatory regions are necessary ((Liu et al., The role of floral for the expression of miR160a genes organs in carpels,an Arabidopsis loss-of-function mutation in MicroRNA160a,in organogenesis and the mechanism regulating its expression.Plant J,2010,62: 416-428).Newest data show that miRNA160 can also influence in arabidopsis Process of in vitro the regulating and controlling effect of ARF10 Regeneration (Qiao etc., Proper regeneration fromin vitro the cultured Arabidopsis of bud thaliana requires the microRNA-directed action of an auxin response factor.Plant J,2012).But in rice, there are no the reports about miR160b gene regulation plant type of rice.

Invention content

It is an object of the invention to clone and identify a kind of gene miR160b of adjusting and controlling rice tillering angle, pass through control The expression pattern of miR160b genes in rice moulds Ideal Rice Plant Type, achievees the purpose that volume increase.

The miR160b gene loop-stem structures DNA sequence dna such as SEQ ID NO that the present invention identifies:Shown in 1, formed after transcription Loop-stem structure precursor RNA sequence such as SEQ ID NO:Shown in 2, the ripe miR160b core spaces that are formed after transcription and cutting Domain sequence such as SEQ ID NO:Shown in 3.

The miR160b gene overexpression transfer-gen plants that the present invention identifies are mainly shown as the increased plant type of tillering angle (see embodiment 4).The transgenic positive of overexpression miR160b makes plant all show tillering angle increasing from seedling stage to maturity period Big mutant phenotype, and the maturity period is more obvious, in addition to this has also appeared available tillering and slightly reduces, under setting percentage Drop.

The present invention by the expression pattern analysis (see embodiment 5) in transfer-gen plant of ripe miR160b, and The target mimicry overexpression vectors of miR160b genes can make the mutation of the transfer-gen plant of overexpression miR160b Phenotype is restored normal (see embodiment 6), it was confirmed that miR160b genes have the function of controlling plant type of rice.

OsARF13, OsARF18 and OsARF22 that the present invention has been experimentally confirmed rice ARF families are ripe miR160 Target gene (see embodiment 6).MiR160b shears the mRNA of target gene by way of base complementrity, to regulate and control The tillering angle of rice.

Realize that steps are as follows for particular technique of the invention：

1. by building overexpression vector, the overexpression of rice miR160b genes is realized, rice point as a result occurs The increased mutant phenotype of tiller angle (see embodiment 3,4).

2. confirming that OsARF13, OsARF18 and OsARF22 are the target bases of ripe miR160b using RLM-5 ' RACE methods Cause, miR160b genes pass through the mRNA of degrade OsARF13, OsARF18 and OsARF22, and then the tillering angle of adjusting and controlling rice (embodiment 6.1).

3. using quantitative RT-PCR technology analysis miR160b overexpress in positive and negative plant maturation miR160b and The expression of target gene OsARF13, OsARF18 and OsARF22, find maturation miR160b and target gene OsARF13, OsARF18 and OsARF22 is in opposite expression pattern (embodiment 5).

4. inhibiting the expression of rice miR160b genes using target mimicry technologies, it can make overexpression miR160b's The increased mutant phenotype of tillering angle is restored to wild-type status (embodiment 6.2).

More detailed technological invention details will be provided by following embodiments.

Advantages of the present invention

1. most gene has been cloned in arabidopsis miR160 gene families, which part member is proved to participate in quasi- south The regeneration etc. of bud in the development of mustard floral organ, the development of root cap and arabidopsis Process of in vitro.Currently, there is no pass in rice In the report of miR160 gene functions.The miR160b genes that the present invention identifies control rice tillering angle, parsing The biological function of miR160b gene regulation plant type of rice.

2. although cloned the gene of some control plant tillering angles in rice, rice tillering angle regulation and control divide Handset reason is still unclear.And the miR160b genes that the present invention identifies can control the tillering angle of rice, be conducive to further solve The molecule mechanism for analysing rice tillering angle regulation and control, convenient for cultivating the rice varieties of reasonable plant type.

3. the present invention demonstrates the target gene that ARF families are miR160b, miR160b inhibit target gene (OsARF13, OsARF18 and OsARF22) expression, and miR160b gene overexpressions make rice tillering angle improve, illustrate OsARF13, OsARF18 and OsARF22 has certain regulating and controlling effect to the tillering angle of rice, be conducive to further appreciate that ARF families with The relationship of tillering angle.

4. the present invention increases the size of rice tillering angle by overexpression miR160b genes.Pass through genetic engineering The tillering angle that technology raising or the expression for weakening miR160b genes can change rice reaches to improve plant type of rice Increase the purpose of rice yield.

The present invention is described in further detail below in conjunction with the accompanying drawings, but not limitation of the invention.

Description of the drawings

Sequence table SEQ .ID.NO:1 is the rice miR160b gene loop-stem structure DNA sequence dnas that the present invention identifies.

Sequence table SEQ .ID.NO:2 be the RNA loop-stem structure sequences that the rice miR160b genetic transcriptions that the present invention identifies are formed Row.

Sequence table SEQ .ID.NO:3 be that the maturation to be formed is sheared in the rice miR160b genetic transcriptions that the present invention identifies MiR160b core sequences.

Fig. 1：It is that rice miR160b genes spend expression pattern analysis in 11 in japonica rice variety.Reference sign：Horizontal seat Mark indicates root (R), stem (C), leaf (L), leaf sheath (LS), lateral bud (B) and young fringe (P) six tissue sites.

Fig. 2：It is the detection of rice miR160b overexpression plant copy numbers.Use I digest DNA of λ-EcoT14 Marker, reference sign：Black arrow indicates the follow-up study bill of materials copy plant 4-7 of selection.

Fig. 3：It is the phenotypic analysis of rice miR160b overexpression plant.Reference sign：Fig. 3 A：Seedling stage plant is shone Piece.Fig. 3 B：Maturity period plant photo.Fig. 3 C：The photo of right-angle view tillering angle.Fig. 3 D：Available tillering.Fig. 3 E：Tiller Angle.Fig. 3 F：Setting percentage.The left side in above-mentioned each figure represents miR160b gene overexpression feminine gender plant (WT)；The right generation Table miR160b gene overexpression positive plants (Ubi::miR160b).

Fig. 4：It is the expression analysis of miR160b and target gene.Reference sign：Fig. 4 A：It is ripe miR160b in excess Express the expression quantity in the miR160b transfer-gen plants positive and feminine gender.Fig. 4 B：It is OsARF13 in overexpression rice miR160b Expression quantity in the transfer-gen plant positive and feminine gender.Fig. 4 C：It is OsARF18 in overexpression rice miR160b transfer-gen plants Expression quantity in positive and negative.Fig. 4 D：It is OsARF22 positive and negative in overexpression rice miR160b transfer-gen plants In expression quantity.In figure：Black column represents miR160b gene overexpression negative control plant (WT), and grey column represents MiR160b gene overexpression positive plants (Ubi::miR160b).Abscissa indicates root (R), stem (S), leaf (L), leaf sheath (LS), lateral bud (B) and young fringe (P) six tissue sites.

Fig. 5：It is the position of RLM-5 ' RACE analysis miR160b shearing target genes.Reference sign：Fig. 5 A：It is rice The Multiple Sequence Alignment of middle miR160 families mature sequence.Fig. 5 B：Be RLM-RACE analysis miR160b cut-outs target gene OsARF13, The position of OsARF18 and OsARF22mRNA molecules.Fig. 5 C：It is that the mRNA of OsARF13, OsARF18 and OsARF22 is sheared Position view, arrow and digital representation terminate the ratio of RNA molecule in arrow corresponding position in figure.

Fig. 6：It is Ubi::MIM160b makes Ubi::MiR160b mutant phenotypes are restored.Reference sign：Fig. 6 A：It is The schematic diagram of MIM160b vector constructions.Fig. 6 B：It is Ubi::MIM160b spends 11 (ZH11) phenotype photos in turning.Fig. 6 C：It is Ubi::MIM160b turns Ubi::The phenotype photo of miR160b.Fig. 6 D：Be using QRT-PCR detection OsARF13, OsARF18 and Tri- target genes of OsARF22 are in ZH11, Ubi::MIM160b、Ubi::miR160b、Ubi::MIM160b/Ubi::In miR160b Expression analysis.

Fig. 7：It is related using QRT-PCR methods analysis tillering angle gene (LAZY1, TAC1, PROG1) and auxin Gene (GH3.1, GH3.4, GH3.8, PIN1, IAA4, IAA21) is in overexpression miR160b positive plants and negative plant Expression quantity.Using rice UBQ genes as internal reference, average value is derived from 3 secondary pollutants and repeats to repeat with 3 technologies.

Fig. 8：It is the pU1301 empty carrier collection of illustrative plates built used in rice miR160b overexpression vectors.

Fig. 9：It is the plasmid figure for building the MT375 plasmids used in rice MIM160b overexpression vectors.

Figure 10：It is the collection of illustrative plates of pU1301-miR160b overexpression carriers.

Figure 11：Be pU2301-MIM160b (i.e.：Ubi::MIM160b) carrier figure.

Figure 12：It is pEASY-T1 carriers schematic diagram (i.e. carrier T pEASY-T 1cloning vector；The full Shi Jinsheng in Beijing Object Technology Co., Ltd.).

Specific implementation mode

1 rice miR160 gene family members of embodiment analyze

According to miRBase (Release 21) (http://www.mirbase.org/index.shtml) database is newest It has been shown that, rice miR160 gene families one share 6 members, are named as miR160a successively to miR160f.The gene family is each Member is separately distributed, and in rice different chromosomes, each member's loop-stem structure length of miR160 gene families and sequence are different, warp It crosses the core miR160 sequences that shearing is formed and there was only 3 kinds.

1 each member of rice miR160 gene families of table distribution on chromosome and the analysis of stem ring size

2 miR160b gene expression spectrum analysis of embodiment

In order to analyze the expression pattern of miR160b genes, we extract the 30 days water for being in tiller animated period after rice transplanting This six root (R), stem (C), leaf (L), leaf sheath (LS), lateral bud (B), young fringe (P) tissues of 11 (ZH11) are spent in rice japonica rice variety The RNA sample at position passes through miRNA stem-loop RT-PCR (Chen etc., Real-time quantification of microRNAs by stem-loop RT-PCR.Nucleic Acids Res,2005,33:E179 method detection) The expression quantity of miR160b genes, 3 secondary pollutants of setting repeat, 2 technologies repeat.The primer is as follows：

MIR160b ST-RT primer:

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGCAT, MIR160b Forward Primer CAAATGCCTGGCTCCCTGTA, ST-R:5’GTGCAGGGTCCGAGGT3’.Using U6 as internal reference, corresponding primer is U6-L：5 ' TACAGATAAGATTAGCATGGCCCC3 ', U6-R：5’GGACCATTTCTCGATTTGTACGTG3’.Reverse transcription is adopted With TransScript First-Strand cDNA Synthesis SuperMix kits, system is 5.3 μ l：20ng/μl 2 μ l, 2 × TS Reaction Mix of RNA templates, 2.5 μ l, Trans Enzyme, 0.25 μ l, MIR160b ST-RT primer/ 0.25 0.3 μ l of μ l, DEPC of U6-R.It is reacted on ABI 9700, program is：16 DEG C of 15min, 42 DEG C of 50min, 72 DEG C 15min.Real-time PCR, real-time PCR are directly carried out in above-mentioned reverse transcription product uses SYBR Premix Ex Taq (Perfect Real Time) kit, reaction system are 25.3 μ l：5.3 μ l, SYBR Premix Ex of reverse transcription product 12.5 μ l, ROX Reference Dye of Taq, II 0.5 μ l, MIR160b Forward/U6-L 1 μ l, ST-R/U6-R 1 μ l, dd H₂O 7μl.It is reacted on ABI 7500, program is：95℃10s；95 DEG C of 5s, 60 DEG C of 34s, 40 cycles of coreaction.Knot Fruit in japonica rice variety as shown in Figure 1, spend in No. 11, expression quantity highests of the miR160b in young fringe, followed by lateral bud, in leaf In expression quantity it is minimum.

The acquisition of the structure and transfer-gen plant of 3 rice miR160b gene overexpression carriers of embodiment

1. the structure of rice miR160b gene overexpression vectors

Used carrier is the State Key Laboratory of Crop Genetic Improvent structure where the applicant PU1301 (see Fig. 8).PU1301 be in the world common Genetic Transformation in Higher Plants carrier pCAMBIA1301 (Sun etc., 2004, Xa26,a gene conferring resistance to Xanthomonas oryzae pv.oryzae in rice, encoding a LRR receptor kinase-like protein.Plant Journal.37:Change on the basis of 517-527) It makes, carries the Agrobacterium-mediated genetic transformation carrier of the maize ubiquitin promoter with composing type and overexpression feature. PCAMBIA1301 carriers are by the Australian laboratories CAMBIA (Center for the Application of Molecular Biology to International Agriculture) it give.It is right directly from rice genome using PCR method MiR160b loop-stem structure sequences are expanded, such as follows with primer

miR160b-L 5'AGAGGTACCTCCGGTCATGGATATGGATAG(KpnI)

miR160b-R 5'CAAGGATCCGGCACAATATGATGGGTGCT(BamHI)

The total volume of PCR reaction systems is 20 μ l, 1 μ l (about 50ng) of oryza sativa genomic dna template, 10 × PCR Buffer 2 μ l, 2mmol/L dNTP1.5 μ l, 10 μm of primers each 0.3 μ l, rTaq (purchased from precious bioengineering Dalian Co., Ltd) 0.3 μ l, dd H₂O 14.6μl.Response procedures are：94 DEG C of 5min, 94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 1min, 35cycles, 72 DEG C of 5min, 10 pipe of amplification, collects PCR product and is purified in 1.5ml centrifuge tubes, add isometric 24：1 chloroform isoamyl alcohol, jog 5 minutes, 12000rpm is centrifuged 15 minutes, is sucted clearly, and 2 times of 95% ethyl alcohol of volume, 1/10 volume 3M sodium acetates (PH5.2), -20 DEG C of placements are added 30 minutes, 12000rpm was centrifuged 20 minutes, abandons supernatant, and 500 μ l, 75% ethyl alcohol is added to place 5min, and 12000rpm is centrifuged 5 minutes, Supernatant is abandoned, is dried, 75 μ l ddH are added₂O dissolves.PCR product purifying and pU1301 carrier digestions, system：Total volume 100 μ l, PCR product or vector plasmid 75 μ l, restriction enzyme BamHI 30U, restriction enzyme KpnI30U, 10 × K Buffer 5 μ l, ddH₂O 16 μ l, 37 DEG C of digestions 4 hours.Digestion products are purified, method is same as above, and finally adds 10 μ l ddH₂O is molten Solution.Connection reaction：10 μ l PCR products are completely used for connection reaction, carrier 0.5 μ l, 2U T4Ligase, 5 × Ligase 3 μ l of Buffer, total 15 μ l volumes connect 24 hours.1 μ l connection products, voltage 18000V, electricity is taken to go to Escherichia coli DH10 β (being purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, i.e. U.S. Promega companies), adds 800 μ l LB culture mediums, recovers 45 minutes, 200 μ l is taken to be applied to the LA tablets containing kanamycins, 37 DEG C, overnight incubation.Monoclonal is chosen, expands culture and takes out plasmid, enzyme Verification is cut, enzymatic cleavage methods are same as above.Positive colony is chosen, the carrier electrotransformation Agrobacterium (Agrobacterium built Tumefaciens) EHA105 (is purchased from MBIA companies, http://www.cambia.org/daisy/cambia/materials/ Overview.html plasmid) is taken out, PCR verifications take the Agrobacterium bacterium solution of 750 μ l good vectors containing structure to add isometric 50% sweet Oily mixing, -70 DEG C of preservations.By the carrier pU1301-miR160b's (see Figure 10) containing rice miR160b gene overexpressions Agrobacterium strains are named as EHA105-pU1301-miR160b.

2. genetic transformation

Using agrobcterium-mediated transformation (Hiei etc., Efficient transformation of rice (Oryza sativa L.)mediated by Agrobacterium and sequence analysis of the Boundaries of the T-DNA, 1994, Plant J, 6:271-282) by overexpression bacterial strain EHA105-pU1301- Spent in miR160b Introduced into Rice japonica rice varieties in No. 11 callus, by preculture, infect, co-culture, screen it is anti-with hygromycin Property callus, break up, take root, hardening and transplanting crop field obtain transfer-gen plant and (Agrobacterium-mediated genetic transformation reagent and match Side is referring to the application for a patent for invention prospectus of applicant, publication number：CN1995346, patent name：Paddy lignin synthesizes Gene FC1 and application, application number：200610018105.5).

3. transfer-gen plant copy number detects

It will be spent in No. 11 callus in overexpression bacterial strain EHA105-pU1301-miR160b Introduced into Rice japonica rice varieties, 40 plants of transformation seedlings are obtained altogether, and using Southern hybridization, (concrete operations refer to：Wu etc., Development of enhancer trap lines for functional analysis of the rice genome.2003,Plant J,35:418- 427) copy number of these overexpression transfer-gen plants is analyzed.The results are shown in Figure 2, in 40 plants of transfer-gen plants of acquisition In, positive rate 90%, single copy plant shares 10 plants.It is follow-up study material to choose No. 4-7 single copy plant separation offspring.

The phenotypic analysis of 4 overexpression miR160b transfer-gen plants of embodiment

40 plants of transfer-gen plants are obtained by genetic transformation, and determine that single copy is planted using the method for southern hybridization Strain 4-7, copy transgenic progeny mono- to overexpression miR160b carry out phenotype investigation, find overexpression miR160b transgenosis The positive makes plant all show the increased mutant phenotype of tillering angle from seedling stage to maturity period, and the maturity period is more obvious.Point It is other that negative control plant (WT) and positive plant (Ubi are overexpressed to 30 plants of miR160b::MiR160b) tillering angle of plant, Available tillering and setting percentage are for statistical analysis.The tillering angle of the present invention is defined as rice maturity stem and most edge Angle between available tillering.The results are shown in Figure 3, compared with the negative plant (WT) of overexpression, overexpresses positive plant Tillering angle increases to 37.9 ° ± 6.2 from 22.0 ° ± 5.3, and available tillering is reduced to 9.2 ± 2.7 from 14.2 ± 5.5, solid Rate is reduced to 35.99% ± 0.05 from 75.11% ± 0.1, and the left side in each figure of Fig. 3, which is that miR160b overexpressions are negative, plants Strain (being marked with WT), the right in each figure of Fig. 3 are that miR160b overexpresses positive plant (with Ubi::MiR160b is marked).

Embodiment 5 overexpresses gene expression analysis in miR160b transfer-gen plants

Whether the expression quantity in order to verify maturation miR160b in overexpression miR160b transgenic positive plant is carried Height, we extract root (R), the stem of overexpression miR160b transgenic positives and negative plant in tiller animated period respectively (C), the RNA sample of leaf (L), leaf sheath (LS), lateral bud (B), young fringe (P) this six tissue sites, by using with 2 phase of embodiment The expression quantity of same method detection miR160b, 3 secondary pollutants of setting repeat, 2 technologies repeat.We are with same RNA later Sample, reverse transcription is at cDNA, using the expression quantity of these three target genes of QRT-PCR detection OsARF13, OsARF18 and OsARF22 (the QRT-PCR primer sequences of target gene are shown in Table 2).It is as follows：1. utilizing TransZol (the full formula gold biotechnologys in Beijing Co., Ltd) extracting RNA sample, concrete operation step is referring to TransZol specifications.2. reverse transcription is tried using M-MLV reverse transcriptions Agent box (is purchased from invitrogen companies), is as follows：(1) following system is placed in 37 DEG C of water-bath 15min：toal RNA 5μg,10×DNase buffer 1μl,DNase I 1μl,Add DEPC Water to 10μl；(2) 1 μ is added into system L 25mM EDTA, room temperature 2min；(3) 65 DEG C of water-bath 5min, are immediately placed in 5min on ice；(4) 1 μ l oli (dT) of addition, 65 DEG C Water-bath 10min is immediately placed in 5min on ice；(5) following system is added in the above-mentioned RNA sample handled well：5×First Strand buffer (be purchased from promega companies) 4 μ l, 0.1M DTT, 1 μ l, 10mM dNTP 1 μ l, RRI 1 μ l, DEPC 1 μ l of Water preheat 2min at 37 DEG C；(6) 1 μ l M-MLV (200U/ μ l) are added into preheated system, after careful mixing It is placed in 37 DEG C of reaction 50min；(7) 70 DEG C of inactivation 15min, -20 DEG C of preservations.3. quantitative RT-PCR is existed using 384 hole PCR plates It is carried out on ViiA7, the comparison of expression quantity is carried out using the method for 2- △ CT relative quantifications.10 μ l reaction systems include：3 μ l reversions Product is recorded, 5 μ lFastStart Universal SYBR Green Master (ROX) (are purchased from the limited public affairs of Roche Diagnistics' product Department), each 1.5 μ l of 0.25 μ l, Water of left and right primer.Response parameter setting is as follows：95℃/10min；95 DEG C/15sec, 60 DEG C/ 60sec, 40cycles.The results are shown in Figure 4, expression quantity of the ripe miR160b in the overexpression tissue of positive plant 6 with it is super The negative plant of expression compared to there is different degrees of raising, it can thus be appreciated that rice miR160b genes overexpression vector (carrier The detailed description that construction method is shown in embodiment 3) improve expressions of the ripe miR160b in plant body really, and this 3 The expression quantity of a target gene has in various degree in 6 tissues of overexpression positive plant, 6 tissues of plant more negative than overexpression Reduction, it was confirmed that miR160b is inhibited to the expression of target gene.

The functional analysis of 6 miR160b genes of embodiment

1..RLM--5 ' RACE analyzes the shearing site of target gene

Think that the target gene of miR160 belongs to rice ARF families by biological information prediction and document report.microRNA Target gene cut off by miRNA-RISC after can be stabilized a period of time, therefore can be analyzed by the method for RACR MiRNA-RISC cuts the position of RNA molecule.Then applicant have chosen in ARF families 3 genes (OsARF13, OsARF18 and OsARF22), the position that this 3 genes are sheared by ripe miR160b is detected using RLM-5 ' RACE technologies, if The primer of 3 target genes of meter, as follows：

GeneRacer^TM5’Primer:CGACTGGAGCACGAGGACACTGA

GeneRacer^TM5’Nested Primer:GGACACTGACATGGACTGAAGGAGTA

OsARF13-RACE:AACACCACATCCCGTCAAACTGCCG

OsARF13-RACE-Nested：CATCATCTACACCCTCTGGAACCTG

OsARF18-RACE:CCAGCCGCATCACGGTAGAAAACA

OsARF18-RACE-Nested：GTGGTGCCATTCTGATTGCTTCTC

OsARF22-RACE:GAACTATCACGCCTGCTCAACTAAG

OsARF22-RACE-Nested：CGTATGACCCAAAGACAGACAAATC

MiRNA target gene shearing sites use GeneRacer^TMKit (is purchased from invitrogen companies), specific steps It is as follows：

1, connection RNA oligo：(1) containing 0.25 μ g GeneRacer^TMIn the centrifuge tube of RNA oligo plus 5 μ g are young The total serum IgE of fringe is inhaled with rifle and beats mixing, suspension RNA oligo up and down；(2) 65 DEG C of dry bath 5min, discharge the secondary structure of RNA； (3) 2min, of short duration centrifugation are placed on ice；(4) following reaction system is added into centrifuge tube：10 × Ligase Buffer, 1 μ l, 1 μ l, RNase OUT of 10mM ATP^TM(40U/ μ l) 1 μ l, T4RNA Ligase (5U/ μ l) gently inhales and plays mixing, of short duration centrifugation； (5) 37 DEG C of dry bath 2h (6) are of short duration to place on ice after centrifugation.

2, purify and precipitate RNA：(1) add 90 μ lDEPC water, 100 μ l phenol：Chloroform overturns mixing 30s；(2) room temperature 12000rpm centrifuges 5min (3) and draws in supernatant to new centrifuge tube；(4) 2 μ l10mg/ml mussels glycogen, 10 μ l, 3M acetic acid is added Sodium (pH5.2) mixing continuously adds 220 μ l, 95% ethyl alcohol mixings；(5) 10min is placed on ice；(6) 4 DEG C of 12000rpm centrifugations 20min precipitates RNA；(7) supernatant is absorbed with pipette tips, pays attention to the direction of precipitation；(8) 500 μ l, 70% ethyl alcohol is added, overturns mixing； (9) 4 DEG C, 12000rpm centrifuges 2min；(10) supernatant is removed with pipette tips, remaining ethyl alcohol is removed after of short duration centrifugation；(11) ultra-clean Workbench dries up 1-2min；(12) add 10 μ l DEPC water.

3, reverse transcription (uses SuperScript^TMIII RT reaction)：(1) it is added into 10 μ l RNA samples following System：1 μ l, dNTP mix of primer, 1 μ l, sterile distilled water, 1 μ l；(2) 65 DEG C of dry bath 5min, release RNA secondary structures；(3) 1min, of short duration centrifugation are placed on ice；(4) serial response system is continuously added in the above centrifuge tube：5 4 μ l, 0.1M DTT of × First Strand Buffer 1 μ l, RNaseOUT^TM(40U/ μ l) 1 μ l, SuperScript^TMIII RT(200u/μl)1μl；(5) it is inhaled up and down with rifle and plays mixing, of short duration centrifugation；(6) 50 DEG C of dry bath 1h；(7) 70 DEG C of inactivation 15min, ice Upper placement 2min, of short duration centrifugation；(8) plus (9) 37 DEG C of 1 μ l RNaseH (2U) react 20min；(10) of short duration centrifugation, -20 DEG C of guarantors It deposits.

4, first round PCR, reaction system：CDNA 2 the μ l, GeneRacer for taking above-mentioned steps to obtain^TM5 ' Primer, 1 μ l, 25 μ l, LA Taq of Gene specific primer1 μ l, 10mM 1 μ l, 2 × GC buffer I of dNTP, 0.5 μ l mend sterilizing Ultra-pure water is to 50 μ l.Response procedures：94℃3min；94 DEG C of 30s, 68 DEG C of 2min repetitive cyclings 5 times；94 DEG C of 30s, 65 DEG C of 30s, 68 DEG C 2min repetitive cyclings 5 times；94 DEG C of 30s, 60 DEG C of 30s, 68 DEG C of 2min repetitive cyclings 10 times；94 DEG C of 30s, 55 DEG C of 30s, 68 DEG C 2min repetitive cyclings 15 times；68℃7min；25℃1min.

Second wheel PCR, reaction system：2 μ l, GeneRACE nest5 ' Primer of first round PCR product 1 μ l, Gene 25 μ l, LA Taq of specific nest primer1 μ l, 10mM 1 μ l, 2 × GC buffer I of dNTP, 0.5 μ l mend sterilizing Ultra-pure water is to 50 μ l.Response procedures are the same as first round PCR.The PCR product of second wheel is dug into glue and recycles rear clone in carrier T pEASY- On T1cloning vector (being purchased from Beijing Quanshijin Biotechnology Co., Ltd, the collection of illustrative plates of the carrier is shown in Figure 12), then survey Sequence is verified.The results are shown in Figure 5, the site that this 3 genes of OsARF13, OsARF18 and OsARF22 are sheared by miR160-RISC Positioned at the position of the 10th and the 11st nucleotide of miR160.Therefore applicant think OsARF13, OsARF18 and OsARF22 this 3 genes are the target genes of miR160b.

2, Ubi is expressed::MIM160b makes Ubi::The mutant phenotype of miR160b is restored

It is before applicant the study found that increase miR160b genes expression quantity, the tillering angle of plant can be made to increase Add, then, we wonder if inhibiting whether the expression of miR160b genes will appear the overexpression with miR160b genes The opposite phenotype of mutant phenotype.The application using German Ma Pu biological developments research institute Detlef professors Weigel carry for matter The natural target mimic genes OsIPS1 of the rice (bands on the mRNA of OsIPS1 genetic transcriptions carried on grain MT375 (see Fig. 9) Have the sequence of 24nt and rice miRNA osa-MIR399 complementations), with reference to target mimicry technologies (Franco- Zorrilla etc., Target mimicry provides a new mechanism for regulation of microRNA activity.Nat Genet,2007,39:1033-1037) design the primer of MIM160b, i.e. the 10th in ripe miR160b Increase the protrusion ring of 3 bases between the 11st base so that ripe miR160b cannot be combined with target gene, primer sequence As follows：

MIM-III：CCCTGCCTTCATACGCTATT

MIM-IV：ATTGCCAAATGTTTGAACGA

MIM160b–I：ATTGCCTGGCTCTAGACTGTATGCCACCTTAGTAGAGGTAAAAGTC

MIM160b–II：GGTGGCATACAGTCTAGAGCCAGGCAATTATTCGGTGGATGTCTGT

Applicant will be complementary with osa-MIR399 in OsIPS1 on MT375 plasmids using the method for Overlap extension PCR later Sequence replace with the sequences of MIM160b complementations, form artificial target mimic genes.It is as follows：Use primer It combines MIM160b-I+MIM-III and MIM160b-II+MIM-IV and carries out the reaction of first round PCR, reaction system is：5× 10 μ l, 10mM dNTPs of phusion HF Buffer, 1 μ l, 50ng/ μ l MT375 plasmids, 1 μ l, 10 μM of left and right primers each 0.3 μ l, phusion DNA polymerase (finnzymes) 0.5 μ l mend sterilizing ultra-pure water to 20 μ l.Reaction condition is：98℃ 30s；98 DEG C of 10s, 58 DEG C of 30s, 72 DEG C of 15s repetitive cyclings 35 times；72 DEG C of 7min, 25 DEG C of 10s.By PCR product in 0.8% agarose gel electrophoresis digs after glue and (gives birth to the limited public affairs of work bioengineering in Shanghai with SanPrep pillar DNA plastic recovery kits Department) recycling PCR product, finally it is dissolved in 20 μ l ultra-pure waters.The second wheel is carried out with two kinds of PCR products of the first round PCR of recycling PCR.Reaction system is：2 μ l, 10mM dNTPs of 10x ExTaqE Buffer 0.3 μ l, each 0.5 μ of two kinds of first round PCR products It is super to mend sterilizing by l, 10 μM of primer MIMIII and MIMIV 0.2 μ l of each 0.3 μ l, Ex Taq (precious bioengineering Dalian Co., Ltd) Pure water is to 20 μ l.Reaction condition is：94℃ 5min；94 DEG C of 45s, 60 DEG C of 45s, 72 DEG C of 1min repetitive cyclings 30 times；72℃ 7min, 25 DEG C of 10s.Final PCR product is cloned in carrier T pEASY-T1cloning vector (the full formula gold biotechnologys in Beijing Co., Ltd) on, then sequence verification.It (will by pU1301 empty carriers using pU2301 is connected to after BamH I and Kpn I digestions Hygromycin marker on carrier is changed to the transformation of G418 labels) on carrier, builds and obtain pU2301-MIM160b carriers (i.e. Ubi::MIM160b, the name of the two carriers is different, and the substantially same carrier is shown in Figure 11).By what is built PU2301-MIM160b carrier electricity is transferred to Agrobacterium (Agrobacterium tumefaciens) bacterial strain EHA105, converts respectively 11 (i.e. ZH11) and miR160b genes are spent to overexpress in rice japonica rice variety positive.As a result 36 and 35 plants of transgenosis are respectively obtained Plant, conversion ratio are respectively 80.6% and 77.8%, but Ubi::MIM160b, which is spent in turning in 11 (ZH11) positive plants, not to be had It was found that the change in plant type, and Ubi::MIM160b turns Ubi::Occurs mutant phenotype recovery in the positive plant of miR160b Plant detects tri- target genes of OsARF13, OsARF18 and OsARF22 in wild type (WT) ZH1, Ubi using QRT-PCR:: MIM160b、Ubi::miR160b、Ubi::MIM160b/Ubi::Expression quantity discovery in miR160b, Ubi::Target in MIM160b Expression quantity the ratio WT high, Ubi of gene::MIM160b/Ubi::The expression quantity ratio WT of miR160b target genes is low, but compares Ubi::MiR160b high (as shown in Figure 6).The expression that miR160b genes are inhibited according to result MIM160b, finally leads The expression quantity of target gene is caused to rise, to which the mutant phenotype for making miR160b overexpress is restored.

2.. the expression quantity of tillering angle and auxin related gene detects

The result of study of the application shows that overexpression miR160b genes show the increased mutant phenotype of tillering angle, And the target gene of miR160b belongs to rice ARF families, and ARF is a kind of auxin response factor in plant, they pass through combination On the AuxRE elements (TGTCTC) of specific gene promoter region, activation or the expression for inhibiting auxin-responsive gene.Cause , in order to further appreciate that the relationship of rice mi160b and tillering angle and auxin, the application has selected some to regulate and control tillers for this Exemplary gene (such as the LAZY1 (LOC_Os11g29840), LPA1 (LOC_Os03g13400), TAC1 (LOC_ of angle Os09g35980), and with the relevant gene of auxin (such as GH3.1 (LOC_Os01g57610), GH3.4 (LOC_ Os05g42150, GH3.8 (LOC_Os07g40290), PIN1 (LOC_Os02g50960), IAA4 (LOC_Os01g08320), IAA21(LOC_Os06g22870)).These genes are detected in the overexpression miR160b positives and negative plant using QRT-PCR Expression quantity in lateral bud (the quantitation RT-PCR primer sequence of design is shown in Table 2).

The QRT-PCR primers of the OsARF, tillering angle and the auxin related gene that are used in 2 present invention of table

The specific steps of QRT-PCR experiments are carried out with reference to the step of embodiment 5, and the results are shown in Figure 7.Experiments have shown that point Expression quantity of the tiller angle gene LAZY1 in overexpressing miR160b positive plants is less than negative plant, and LPA1 and TAC1 genes Expression quantity change unobvious in the overexpression miR160b positives and negative plant.The expression of GH3.4, IAA4 and IAA21 gene Amount is decreased obviously compared with negative plant, other gene variation unobvious.It follows that improving the expression quantity of miR160b genes The expression for changing tillering angle and auxin related gene illustrates that the inhibition for the OsARF that miR160b is mediated may take part in The regulation and control of the response process and rice tillering angle of auxin.

Claims (4)

1. Application of the 1.miR160b gene loop-stem structure DNA sequence dnas in adjusting and controlling rice tillering angle, it is characterised in that：Described MiR160b gene loop-stem structures DNA sequence dna such as sequence table SEQ ID NO：Shown in 1.
2. Application of the 2.miR160b gene loop-stem structure DNA sequence dnas in adjusting and controlling rice tillering angle, it is characterised in that：Transcription is cut The ripe core sequence such as SEQ ID NO formed after cutting：Shown in 3.
3. 3. application as claimed in claim 1 or 2, it is characterised in that：By overexpression or inhibit expression miR160b genes, Change the regulation and control model of miR160b gene pairs plant type of rice.
4. 4. application as claimed in claim 3, which is characterized in that the plant type of rice includes tillering angle.