CN107903312B

CN107903312B - Rice zinc finger protein and coding gene and application thereof

Info

Publication number: CN107903312B
Application number: CN201711449952.1A
Authority: CN
Inventors: 金永梅; 林秀峰; 陈莫军; 朴日花; 刘笑笑; 高星爱; 仲晓芳
Original assignee: Jilin Academy of Agricultural Sciences
Current assignee: Jilin Academy of Agricultural Sciences
Priority date: 2017-12-27
Filing date: 2017-12-27
Publication date: 2020-07-10
Anticipated expiration: 2037-12-27
Also published as: CN107903312A

Abstract

The invention relates to the technical field of biology, in particular to a rice zinc finger protein and a coding gene and application thereof. The amino acid sequence of the rice zinc finger protein is shown in SEQ ID NO. 1. It also relates to a rice zinc finger protein gene OsCTZFP8 for coding the rice zinc finger protein. It also relates to a primer or a probe for detecting the rice zinc finger protein gene OsCTZFP 8. It also relates to a vector containing the rice zinc finger protein gene OsCTZFP8 and a recombinant cell containing the vector. It also relates to the application of the rice zinc finger protein or rice zinc finger protein gene OsCTZFP8 or vector or recombinant cell in improving the cold resistance of rice. The rice zinc lipoprotein gene OsCTZFP8 can be used for encoding and forming rice zinc lipoprotein, can improve the cold resistance of rice, and has obvious value in practical application.

Description

Rice zinc finger protein and coding gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a rice zinc finger protein and a coding gene and application thereof.

Background

Rice is the most important food crop in the world and provides food for half of the population in the world. Rice is sensitive to temperature, and the growth and yield of the rice are seriously influenced by low temperature. The cold injury may occur at every stage of the whole growing season of rice. According to the mechanism of influence of low temperature on rice, cold damage can be divided into 3 types of delayed cold damage, barrier cold damage and mixed cold damage: delayed cold damage refers to the long-lasting low temperature influence in the vegetative growth phase of rice, resulting in slow growth and development of seedlings, reduced plant height and tiller number (Iba et al, 2002; Tian et al, 2011). The obstacle type cold injury refers to the phenomena that the short-term abnormal low temperature in the reproductive growth period of rice causes heading delay, incomplete heading, pollen sterility, poor grain filling and reduction of seed setting rate, and finally causes yield reduction (Zhang et al, 2011; Pan et al, 2015). The low-temperature cold damage often occurs in high-latitude temperate regions and tropical and subtropical high-altitude regions, and is particularly prominent in Japan, China, Korea and other countries. Major cold injury and minor cold injury occur frequently in three provinces in northeast China, northern Korea, northern Hakkaido in Japan, and other areas on average for 3-4 years (Quzhijuan, 2009). The northeast rice growing area is the largest high-quality rice production area in China, but the cold damage occurrence frequency is high, the damaged area is large, and the rice production is seriously influenced. Therefore, the cultivation of cold-resistant rice varieties has very important significance for high and stable yield and high-quality rice production. With the development of molecular biology and genomics, modern biotechnology has been widely applied to genetic improvement of grain crops such as rice.

The cold resistance of rice is a complex character, and genes and molecular mechanisms related to the cold resistance can be revealed by a biotechnology means. Transcription factors play a crucial role in plant stress response, and are also regarded as important in plant genetic engineering improvement. The most serious low-temperature disaster in rice production in China is obstacle type cold damage encountered in the booting stage. The cold resistance identification and evaluation can be carried out under natural low-temperature conditions and constant-temperature cold water irrigation conditions with artificially controlled water temperature. Pollen fertility and seed set percentage are important indicators for cold tolerance evaluation at the booting stage (Dai et al, 2002; Zhang et al, 2017). Therefore, a biotechnological means capable of improving the cold resistance of rice is lacking.

Disclosure of Invention

The invention aims to provide a rice zinc finger protein which can improve the cold resistance of rice in the reproductive growth period and participate in the low-temperature stress regulation process of rice.

The invention also aims to provide a rice zinc finger protein gene OsCTZFP8, which can encode the rice zinc finger protein gene.

The invention also aims to provide a vector containing the rice zinc finger protein gene OsCTZFP 8.

Another object of the present invention is to provide a recombinant cell containing the above vector.

The invention also aims to provide application of the rice zinc finger protein gene OsCTZFP8 or a vector or a recombinant cell in improving the cold resistance of rice.

The invention also aims to provide a primer or a probe for detecting the rice zinc finger protein gene OsCTZFP 8.

The invention is realized by the following steps:

the amino acid sequence of the rice zinc finger protein provided by the invention is shown in SEQ ID NO. 1.

The invention also relates to a rice zinc finger protein gene OsCTZFP8 which codes the rice zinc finger protein of claim 1.

The invention also relates to a primer or a probe for detecting the rice zinc finger protein gene OsCTZFP 8.

The invention also relates to a vector containing the rice zinc finger protein gene OsCTZFP 8.

The invention also relates to a recombinant cell containing the vector.

The invention also relates to the application of the rice zinc finger protein or the rice zinc finger protein gene OsCTZFP8 or the vector or the recombinant cell in improving the cold resistance of rice.

The rice zinc lipoprotein gene OsCTZFP8 can be used for encoding and forming rice zinc lipoprotein, can improve the cold resistance of rice, and has obvious value in practical application. And the rice zinc lipoprotein gene OsCTZFP8 can be used for carrying out genetic improvement on crops through over-expression, and cold-resistant transgenic crops can be cultivated.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a gene structure diagram of a rice zinc finger protein gene OsCTZFP 8;

FIG. 2 is a protein homologous sequence alignment analysis diagram of a rice zinc finger protein encoded by a rice zinc finger protein gene OsCTZFP 8;

FIG. 3 is a phylogenetic tree analysis diagram of rice zinc finger protein gene OsCTZFP 8;

FIG. 4 is a non-biological induction analysis diagram of rice zinc finger protein gene OsCTZFP 8;

FIG. 5 shows that the rice zinc finger protein gene OsCTZFP8 constructs P_Ubi-partial structural schematic of the OsCTZFP8 vector;

FIG. 6 is a diagram showing a process of tissue culture for introducing a plant expression vector into rice by Agrobacterium mediated method;

FIG. 7 is T₀Generating a detection result of PCR detection of the bar gene of the transgenic plant;

FIG. 8 is a Southern blot analysis diagram of rice zinc finger protein gene OsCTZFP8 overexpression strain;

FIG. 9 shows the result of detecting the mRNA expression level of rice zinc finger protein gene OsCTZFP8 overexpression strain;

FIG. 10 is a schematic representation of basta resistance segregation ratio identification;

FIG. 11 is a pollen fertility identification diagram of rice zinc finger protein gene OsCTZFP8 overexpression strain under cold stress;

FIG. 12 is a diagram showing the detection result of the fertile pollen rate of rice zinc finger protein gene OsCTZFP8 over-expression strain;

FIG. 13 is a graph comparing seed set of over-expressed lines and control varieties under normal and cold water conditions at harvest time;

FIG. 14 is a graph comparing seed set percentage for over-expressed lines and control varieties under normal and cold water conditions at harvest time.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The following describes a rice zinc finger protein, its coding gene and application.

Some embodiments of the invention provide a rice zinc finger protein, the amino acid sequence of which is shown in SEQ ID NO. 1.

Zinc lipoproteins are a class of transcription factors with finger-like domains, and regulate the expression of target genes mainly through the interaction of binding domains of DNA and RNA with other proteins. The molecular mechanism research of the zinc finger protein transcription factor of the rice as an important grain crop and a model plant for regulating the abiotic stress is still in the initial stage, and the embodiment of the invention separates a novel zinc finger protein gene OsCTZFP8 from the rice and identifies the biological function of the gene. The zinc finger protein gene OsCTZFP8 overexpression transgenic strain can obviously improve the cold resistance in the reproductive growth period, so that the rice zinc finger protein obtained by the gene coding can participate in the low-temperature stress regulation and control process of rice, and the cold resistance in the reproductive growth period of the rice is improved.

Some embodiments of the invention also provide a rice zinc finger protein gene OsCTZFP8 which codes the rice zinc finger protein. In some embodiments of the invention, the nucleotide sequence of the rice zinc finger protein gene OsCTZFP8 is shown as SEQ ID NO. 2.

The rice zinc lipoprotein gene OsCTZFP8 can form rice zinc finger protein in rice through coding and perform overexpression to improve the cold resistance of the rice, and has obvious value in practical application. Therefore, the gene can be used for carrying out genetic improvement on crops through over-expression of the gene, and cold-resistant transgenic crops can be cultivated.

In some embodiments of the invention, the rice Zinc lipoprotein gene OsCTZFP8 is isolated by identifying Cold Tolerance of the rice in booting stage under multiple environmental conditions by using rice recombinant inbred line, positioning a major QT L on the short arm of chromosome8, positioning a target QT L in a 99.4kb target segment (not disclosed) by fine positioning, screening out a Zinc Finger Protein gene with unknown biological function, closely related to Cold Tolerance, from candidate genes in the target region, and naming the Zinc Finger Protein gene as OsCTZFP8(Oryza sativa Cold tomato Finger Protein in endocrine chromosome Immo 8). through bioinformatics analysis, the rice Zinc lipoprotein encoded by the rice Zinc lipoprotein gene OsCTZFP8 consists of 225 amino acids, has a molecular weight of 23.7kD and an isoelectric point of 10.5. further analyzing the gene structure of the rice Zinc lipoprotein gene OsCTZFP8, which contains two exons and the first exon, the second exon, the rice Zinc lipoprotein gene contains C₂H₂The structure of the zinc finger domain (http:// www.prosite.expasy.org) is shown in figure 1, in the gene structure diagram of the rice zinc lipoprotein gene OsCTZFP8 shown in figure 1, the white boxes represent exons, the black connecting lines represent introns, and the black boxes represent C₂H₂A zinc lipoprotein functional domain.

Some embodiments of the invention also provide a primer or a probe for detecting the rice zinc finger protein gene OsCTZFP 8.

According to some embodiments, the primers comprise a primer pair having nucleotide sequences set forth in SEQ ID NO. 3 and SEQ ID NO. 4, and the probes comprise probes having nucleotide sequences set forth in SEQ ID NO.5 and SEQ ID NO. 6.

Some embodiments of the invention also provide a vector containing the rice zinc finger protein gene OsCTZFP 8.

Some embodiments of the present invention also provide a method for constructing the above vector, which comprises: mu.g of total RNA was reverse transcribed into cDNA using SuperscriptIII reverse transcriptase (Invitrogen, Carlsbad, USA) to obtain rice zinc finger protein baseThe full-length cDNA of OsCTZFP8 is connected to P3300-Ubi vector to construct P_Ubi::OsCTZFP8 plant expression vector.

Some embodiments of the invention also provide recombinant cells containing the vectors described above.

Some embodiments of the invention also relate to the application of the rice zinc finger protein or the rice zinc finger protein gene OsCTZFP8 or a vector containing the rice zinc finger protein gene OsCTZFP8 or a recombinant cell containing the vector in improving the cold resistance of rice.

According to some embodiments, the rice cold tolerance is cold tolerance during the reproductive phase of rice. In some embodiments, the temperature corresponding to cold resistance is 10 to 20 ℃, preferably 13 to 20 ℃, and more preferably 16 to 20 ℃.

According to some embodiments, the above application is mainly to transform the vector containing the rice zinc finger protein gene OsCTZFP8 into rice seeds by agrobacterium-mediated genetic transformation method, for example, the above P can be transformed_Ubi::The OsCTZFP8 plant expression vector is transformed into japonica rice variety kitaake.

According to some embodiments, the specific method for transforming the vector containing the rice zinc finger protein gene OsCTZFP8 into rice seeds by agrobacterium-mediated genetic transformation method is as follows: the rice seeds with glumes removed are disinfected, then callus is induced, subculture is carried out, agrobacterium strain EHA105 bacteriostat carrying a carrier containing rice zinc finger protein gene OsCTZFP8 is used for infecting the callus, and a transgenic independently transformed plant is obtained through basta resistance screening, differentiation and rooting and finally transplantation. For example, the vector containing the rice zinc finger protein gene OsCTZFP8 can be selected from the above P_Ubi::OsCTZFP8 plant expression vector.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

Separation and sequence analysis of rice zinc finger protein gene OsCTZFP8

1.1, the cold tolerance of the rice at the booting stage is identified by utilizing a rice recombinant inbred line under a plurality of environmental conditions, a main effect QT L is positioned on the short arm of the No. 8 chromosome, a target QT L is positioned in a target segment of 99.4kb through fine positioning, a zinc finger protein gene OsCTZFP8 which is closely related to the cold tolerance and has unknown biological functions is screened from candidate genes in a target region, and the base sequence of the zinc finger protein gene OsCTZFP8 is shown as SEQ ID NO. 2.

1.2 Using NCBI multiple sequence alignment tool (https:// www.ncbi.nlm.nih.gov/tools/cobalt cgi), using the full-length amino acid sequence of the rice zinc finger protein (the amino acid sequence of which is shown in SEQ ID NO. 1) encoded by the rice zinc finger protein gene OsCTZFP8 as query to perform B L ASTp, searching for homologous proteins in plants, and performing multiple sequence alignment, the alignment results are shown in FIG. 2, black parts are conserved amino acid residues, gray parts are conserved times, boxes indicate C₂H₂A zinc lipoprotein domain. As can be seen from FIG. 2, C of the zinc finger protein gene OsCTZFP8₂H₂The type zinc finger domain correspondingly encodes a protein that is highly conserved relative to other plants, such as rice, maize, sorghum, arabidopsis, and the like.

1.3 construction of 14 plants C by the multiple sequence alignment method₂H₂The phylogenetic tree was constructed, for example, by using MEGA version 4.1 software, using 13 rice zinc finger proteins OsCTZFP8 homologous proteins, Neighbor-Joining method to construct phylogenetic tree, with bootstrap test value of 1000. the results are shown in FIG. 3. it can be seen from FIG. 3 that rice zinc finger proteins encoded by rice zinc finger protein gene OsCTZFP8 have the highest homology with indica rice zinc lipoproteins of unknown function and are in the same major branches as zinc finger proteins in monocotyledons.14 plant zinc finger proteins used for constructing phylogenetic tree are rice OsCTZFP8, rice Osl _28710(Oryza sativa L., gi |34015350), maize ZfFP 1(Zea mays, gi |242032883), Arabidopsis thaliana ZFP1(Arabidopsis thaliana, gihia, gii | 36 15240742), soybean GgsyZA | ZFP 34 (GlycoZA | ZF 1), rice gigiya mangi | 3648, Oryza Japonica 685279228, Osatypi, Ossa 685279228, Oryza Japonica 685279228, Osatypic 685279228, Osteva III b, Osteva 3 _ 3, Ossa, rice intro, rice introsis, rice intro₂H₂transformation factor (Oryza sativa Japonica, gi |323388891), Rice OsJ _12692(Oryza sativa Indica, gi |125588016), and corn Putative zincfinger protein1(Zea mays, gi |195640880), Sorghum SbZFP1(Sorghum bicolor, gi |670405684), Arabidopsis thaliana C₂H₂and C₂HC zinc fingers superfamily protein(Arabidopsisthaliana C₂H₂and C₂HC zinc fingers perfect protein, gi |15229643), rape BrAZF1(Brassica rapa, gi | 923538325).

1.4 promoter analysis is carried out by adopting P L ACE (http:// www.dna.affrc.go.jp.com/P L ACE/signalscan. html.) analysis results show that 2000bp sequence at the upstream of the initiation codon of the Rice zinc finger protein gene OsCTZFP8 is rich in low-temperature reaction cis-acting element (L TR) and abscisic acid reaction element (ABRE). Gene function prediction of Chinese national Rice data center (http:// www.ricedata.cn.org) and Rice Genome inhibition Project fused the NSF (http:// Rice plant biology. msu.edu.) shows that the gene is involved in stress response regulation.

Example 2

qRT-PCR analysis of rice zinc finger protein gene OsCTZFP8 under abiotic stress induction

2.1 stress treatment of rice seedlings cultured for two weeks at low temperature (4 ℃), NaCl (200mM) and ABA (5. mu.M) for 0, 1, 2, 5, 12 and 24 hours, sampling, quick freezing with liquid nitrogen, and extracting total RNA with MiniBEST Universal RNA extraction kit (Takara, Japan).

2.2 the change of the transcription level of the rice zinc finger protein gene OsCTZFP8 after different abiotic stress treatments is detected by utilizing qRT-PCR and taking the amplification factor-1 α (eEF1- α) as an internal reference.

For example, the specific method is as follows: 800ng of total RNA was used to obtain cDNA by reverse transcription using PrimeScriptTM RT Reagent kit with gDNA Eraser (Takara, Japan). Mu.l of cDNA were extracted and qRT-PCR amplification was performed using the FastStartUniversal SYBR GreenMaster kit (ROX) (Roche, Germany) on ABI7500HT instrument (ABI, USA) using 2^–ΔΔCTExpression calculation was performed by relative quantification methods (L ivak and Schmittgen, 2001).

According to some embodiments, the primer sequences are shown in table 1.

TABLE 1 real-time quantitative primer sequences

Primer name	Primer sequences	Sequence identifier
			CTZFP8-qF	ACGAGCCACCGGTTCAAG	SEQ ID NO.3
CTZFP8-qR	ATTACGCGGTGAGAAGGCGA	SEQ ID NO.4
			eEF1α-F	TTTCACTCTTGGTGTGAAGCAGAT
eEF1α-R	GACTTCCTTCACGATTTCATCGTAA

Example 3

Stress-induced expression analysis of rice zinc finger protein gene OsCTZFP8

The expression level change of the gene under low temperature, ABA and high salt stress is detected by a qRT-PCR method. For example, rice seedlings are subjected to low temperatures (A), ABA (B) andqRT-PCR detection was performed after high salt (C) treatment, Elongation factor1 α (eEF1 α) was used as an internal reference gene, and 2 was used^–ΔΔCTThe method calculates the relative expression amount. The expression result is shown in FIG. 4, and it can be seen from FIG. 4 that the expression level of the rice zinc finger protein gene OsCTZFP8 shows different degrees of change trend in seedlings and roots under three stresses. Under low temperature and NaCl treatment, the transcription level of the rice zinc finger protein gene OsCTZFP8 in seedlings is obviously increased, particularly after 5 hours of low temperature treatment, the transcription level is increased by more than 6 times, but the transcription level is slightly increased under ABA treatment. In roots, the expression level of the rice zinc finger protein gene OsCTZFP8 was not significantly different between stress treatment and no treatment. The results show that the rice zinc finger protein coded by the rice zinc finger protein gene OsCTZFP8 plays a role in the response reaction of rice to low-temperature and high-salt stress.

Example 4

Construction of plant expression vector of rice zinc finger protein gene OsCTZFP8 and overexpression of transgenic rice

4.1 isolating and cloning the full-length cDNA of the rice zinc finger protein gene OsCTZFP8 from rice, namely, reverse transcribing 1 mu g of total RNA into cDNA by utilizing Superscript III reverse transcriptase (Invitrogen, Carlsbad, USA) to obtain the full-length cDNA of the rice zinc finger protein gene OsCTZFP8, and then connecting the cDNA into a P3300-Ubi vector containing a Ubi promoter and a bar marker gene to construct P_Ubi::The OsCTZFP8 vector and the process is shown in FIG. 5.

4.2 plant expression vectors are introduced into rice by utilizing an agrobacterium-mediated method, and 46 independent transformation events are finally obtained through callus induction, subculture, agrobacterium infection, basta resistance screening, differentiation, root induction and seedling hardening. The above process is shown in fig. 6, and in fig. 6, the rice genetic transformation process can be divided into the processes of callus induction (a), subculture (b), basta resistance selection after agrobacterium infection (c), differentiation (d), rooting (e), seedling hardening (f), and the like.

4.3 extraction of T₀Generating transgenic rice genome DNA, PCR amplifying herbicide resistance gene bar segment, and for T₀The bar gene of the transgenic plant is subjected to PCR detection, and the detection result is shown in figure 7T can be demonstrated in FIG. 7₀The transgenic rice of the generation carries a bar resistance fragment, the positive rate is 89%, and it needs to be explained that M in figure 7 is Marker 100bp L adder, and PC is P_Ubi::OsCTZFP8 vector DNA; 1 is a non-transgenic control variety; 2-21 is T₀And (5) independently transforming plants.

Example 5

Screening of overexpression single-copy insertion homozygous line of rice zinc finger protein gene OsCTZFP8

5.1 analyzing the integration and copy number of the rice zinc finger protein gene OsCTZFP8 in the rice genome by using a southern hybridization method.

The specific method comprises the following steps: plant genomic DNA was extracted by the CTAB method (Doyle and Doyle, 1987), 40. mu.g of DNA was digested with Hind III restriction enzyme (Takara, Japan), and the digested product was separated on 0.8% agarose gel and transferred to HybondN⁺Nylon membranes (Amersham, UK), hybridized with digoxigenin-labeled (Roche, USA) probes, and autoradiographed with X-ray film chemiluminescence. The probe sequence comprises a 3 'partial sequence of a Ubi promoter and a 5' partial sequence of a rice zinc finger protein gene OsCTZFP 8.

The probe sequence is as follows: Ubi-SF, TTTAGCCCTGCCTTCATACG (SEQ ID NO. 5); ZFP8-SR, ATTACGCGGTGAGAAGGCGA (SEQ ID NO. 6).

The Southern blot analysis results are shown in FIG. 8, where M is the DNA molecular weight standard in FIG. 8; NT is a non-transgenic control variety; OE # 1-OE #8 are overexpression strains; PC is P_Ubi::OsCTZFP8 vector DNA.

5.2 the transcription level of the rice zinc finger protein gene OsCTZFP8 in a single-copy insertion strain is determined by adopting an RT-PCR method. The result is shown in figure 9, the transcription level of the rice zinc finger protein gene OsCTZFP8 of 6 single-copy insertion strains is obviously higher than that of a non-transgenic control variety, which indicates that the rice zinc finger protein gene OsCTZFP8 obtains over-expression and does not generate gene silencing on the transcription level, and the transgenic single-copy insertion homozygous lines can stably maintain the consistency of genetic and phenotypic characters, accelerate the generation process and reduce the workload. In fig. 9, NT is a non-transgenic control variety; OE # 1-OE #6 are single copy over-expression lines.

5.3 Single copy insertion homozygous lines were screened by the seed germination test (Jin et al, 2015).

The specific method comprises sowing sterilized rice seeds on 1/2MS (30 mg/L basta) culture medium containing basta herbicide, culturing under long-day sunlight at 28 deg.C, investigating germination rate at 5 days after germination, using bud length of 1.5cm as normal germination identification index, selecting strains with basta resistance segregation ratio conforming to Mendel genetic rule as single copy insertion homozygous lines, and selecting two single copies with segregation ratio conforming to Mendel genetic rule as OE #1 and OE #3 in FIG. 10₁，T₂For different generations of transgenes; NT is a non-transgenic control variety; OE #1, OE #3 are overexpression lines.

Example 6

Cold resistance identification of rice zinc finger protein gene OsCTZFP8 overexpression transgenic strain

6.1 the rice zinc finger protein gene OsCTZFP8 over-expression strain and non-transgenic contrast variety are used for low-temperature stress treatment in a cold tolerance identification garden with artificial water temperature control.

The cold tolerance identification of the rice is carried out in a cold tolerance identification nursery of agricultural academy of sciences of Jilin province, seeding is carried out in 2017 in 25 days in 4 months, rice is transplanted in 2 days in 6 months, the rice transplanting specification is 27 × 12.5.5 12.5 cm., the fertilization level is N-P-K:140-80 kg/ha, and the management of the whole growth period is carried out according to the conventional cultivation technology.

The low-temperature stress is carried out by adopting a constant-temperature deep cold water irrigation method, wherein the cold water irrigation period is from young ear differentiation to booting ear, the water temperature is 18.5 ℃, the constant-temperature cold water is used, and the water depth is 15 cm. The cold tolerance identification indexes are pollen fertility and seed setting rate.

6.2 after the cold water irrigation treatment is finished, detecting the pollen fertility by adopting an iodine-potassium iodide pollen dyeing method. Using 1% of I₂KI solution was used to determine pollen fertility at flowering time, method reference shinjyo (1969). Selecting anther from glume flower of rice, gently pounding on glass slide, adding a drop I₂the-KI solution was used to disperse the pollen sufficiently, the cover slips were covered, and observation was performed under a microscope after 5 min. The fertile pollen is dyed into blue,The sterile pollen is yellow brown and shriveled, 5 visual fields are observed in each tablet, and the percentage of the fertile pollen is counted, wherein the calculation formula is that the percentage of the fertile pollen is × 100 percent (the number of the dyed effective pollen/the number of all the pollen).

In a normal irrigated plot, pollen from both the over-expressed line (OE #1-6, OE #3-2) and the control variety stained dark blue as shown in FIG. 11. As shown in FIG. 12, the pollen fertility rate in the normal irrigated nursery was 98% or more, while in the cold irrigated nursery, the pollen fertility rate was significantly decreased, whereas the pollen fertility rate of the over-expressed lines was significantly higher than the pollen fertility rate of the control varieties, i.e., OE #1-6 and OE #3-2, by 76-81%, while the pollen fertility rate of the control varieties was only 41%.

The results show that cold water irrigation has a large influence on pollen fertility, but the overexpression of the rice zinc finger protein gene OsCTZFP8 can improve the pollen fertility under cold stress.

6.3, after harvesting, investigating seed setting rate, taking 5 plants from each plant, taking 5 larger ears from each plant, after threshing, investigating the number of grains per ear and the number of shrunken grains, and calculating the setting rate, wherein the seed setting rate is × 100 percent (the number of the seeds/(the number of the grains + the number of the shrunken grains)).

The seed setting rate is an important index for evaluating the cold resistance in the reproductive period. During harvest, comparative analysis of seed set percentage was performed on low temperature stress treated or untreated rice, i.e., phenotypic observations were made and photographed during harvest. Results as shown in figure 13, there was no difference in seed set (> 92%) between the over-expressed lines and the control varieties in the normal irrigated nursery. However, in the cold water irrigated nursery, the seed set rates of the over-expressed lines OE #1-6 and OE #3-2 were significantly higher than the control varieties (p <0.05), i.e. the seed set rates of OE #1-6 and OE #3-2 were 73.3% and 72.5%, respectively, whereas the seed set rate of the control varieties was only 52.9%. The results show that cold water irrigation has a large influence on seed setting rate, but the over-expression of the rice zinc finger protein gene OsCTZFP8 can improve the seed setting rate under cold stress.

By combining the results, the cold resistance of the rice in the reproductive growth period can be improved by the rice zinc finger protein encoded by the rice zinc finger protein gene OsCTZFP8, so that the rice zinc finger protein encoded by the gene is known to participate in the cold resistance regulation process of the rice.

Example 7

Taking 5 representative plants, and measuring the agronomic characters such as the tillering number of each plant, the ear length, the thousand kernel weight, the yield of each plant and the like. The results are shown in Table 2.

TABLE 2 agronomic traits of rice zinc finger protein gene OsCTZFP8 overexpression lines

Indicates that there was a very significant difference between the non-transgenic control variety (WT) and the over-expressed strain (OE) at p <0.01 under cold water treatment conditions.

From the results in table 2, it can be seen that the seed setting rate and the single plant yield of the rice zinc finger protein gene OsCTZFP8 overexpression strain under low-temperature stress treatment are significantly higher than those of a control (p is less than 0.01), and other characters such as tiller number, spike length and the like have no significant difference, which indicates that the rice zinc finger protein gene OsCTZFP8 overexpression strain can improve the rice yield under low-temperature stress.

In the above examples, the recipient variety is the Japanese rice variety Kitaake, provided by Rice, Jilin academy of agriculture. The japonica rice is a very early-maturing japonica rice variety cultivated in Japan, has a growth period of 110 days in Changchun, and has the characteristics of weak rice blast resistance, weak cold resistance, large grain type, low yield and the like.

In conclusion, the biological function of the gene is identified by the isolated novel zinc finger protein gene OsCTZFP 8. Through molecular identification and phenotypic identification, the over-expression of the zinc finger protein gene OsCTZFP8 is found to improve the pollen fertility and the seed setting rate of rice, and the gene has cold tolerance in the reproductive growth period of the rice. Therefore, it can be known that the rice zinc finger protein encoded by the zinc finger protein gene OsCTZFP8 participates in the cold tolerance regulation process of rice. In the future research, the molecular mechanism of the rice zinc finger protein coded by the zinc finger protein gene OsCTZFP8 in the process of resisting various abiotic stresses can be further clarified by methods such as transcriptome sequencing, differential gene expression analysis and the like, and the theoretical basis is provided for the research of the cold tolerance mechanism of rice.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Jilin province academy of agricultural sciences

<120> paddy rice zinc finger protein and coding gene and application thereof

<160>6

<170>PatentIn version 3.5

<210>1

<211>224

<212>PRT

<213>Oryza sativa

<400>1

Met Ala Met Ala Phe Leu Gly Gln Ser Arg Leu Tyr Asp Gly Ile Ser

1 5 10 15

Trp Asn Ser His Leu Ser Met Ala Phe Leu Val Pro Pro Val Ser Val

20 25 30

Ala Thr Ser Ala Pro Ser Leu Ser Leu Pro Pro Pro Leu Pro Ser Ser

3540 45

Ser Leu Ser Leu Ser Leu Phe Ser Ala Ser Arg Pro Val Ala Gly Ala

50 55 60

Lys Ala Ala Arg Val Arg Arg Arg Arg Gln Val Ala Asn Gly Glu Thr

65 70 75 80

Glu Ala Leu His Ala Ala Val Leu Lys Glu Glu Glu Gln Gln His Glu

85 90 95

Val Glu Glu Ala Ala Val Val Thr Ser Ser Ser Ala Thr Ser Gly Glu

100 105 110

Glu Gly Gly His Leu Pro Gln Gly Trp Ala Lys Arg Lys Arg Ser Arg

115 120 125

Arg Gln Arg Ser Glu Glu Glu Asn Leu Ala Leu Cys Leu Leu Met Leu

130 135 140

Ala Leu Gly Gly His His Arg Val Gln Ala Pro Pro Pro Leu Ser Ala

145 150 155 160

Pro Val Gly Ala Glu Phe Lys Cys Ser Val Cys Gly Arg Ser Phe Ser

165 170 175

Ser Tyr Gln Ala Leu Gly Gly His Lys Thr Ser His Arg Phe Lys Leu

180 185 190

Pro Thr Pro Pro Ala Ser Pro Val Leu Ala Pro Ala Ser Ser Glu Val

195 200205

Gln Ser Pro Leu Ala Phe Ser Pro Arg Asn Ser Ala Ala Ala Arg Ile

210 215 220

<210>2

<211>675

<212>DNA

<213>Oryza sativa

<400>2

atggcgatgg catttttggg acaaagtcgt ttgtacgatg gcatttcttg gaactcacac 60

ttgtcgatgg catttctggt cccacctgtc agcgtggcca cgtcagcacc ctctctctct 120

cttccccctc ctctcccttc ctcatctctc tctctctcac tcttctcggc aagccggccg 180

gtggctgggg cgaaggccgc cagggtgagg cggcggcggc aggtcgcgaa tggcgagacg 240

gaagcgctcc acgccgcggt gctcaaggag gaggagcagc agcacgaggt ggaggaggcg 300

gcggtcgtga cgagcagcag cgccacaagc ggggaggagg gcgggcacct accgcagggg 360

tgggcgaagc ggaagaggtc gcgccgccag cgatcggagg aggagaacct cgcgctctgc 420

cttctcatgc tcgccctcgg cggccaccac cgcgtccagg cgccgcctcc tctctcggcg 480

ccggtaggtg cggagttcaa gtgctccgtc tgcggcaggt ccttcagctc ctaccaggcg 540

ctcggcggcc acaagacgag ccaccggttc aagctgccta ctccgcccgc atctcccgtc 600

ttggctcctg cctcctccga ggtccagagc cccctcgcct tctcaccgcg taattcagca 660

gctgcacgga tctga 675

<210>3

<211>18

<212>DNA

<213> Artificial sequence

<400>3

acgagccacc ggttcaag 18

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

attacgcggt gagaaggcga 20

<210>5

<211>20

<212>DNA

<213> Artificial sequence

<400>5

tttagccctg ccttcatacg 20

<210>6

<211>20

<212>DNA

<213> Artificial sequence

<400>6

attacgcggt gagaaggcga 20

Claims

1. The application of a rice zinc finger protein, or a rice zinc finger protein gene OsCTZFP8, or a vector, or a recombinant cell in improving the cold resistance of rice is characterized in that the amino acid sequence of the rice zinc finger protein is shown as SEQ ID NO. 1; the rice zinc finger protein gene OsCTZFP8 encodes the rice zinc finger protein; the vector contains a rice zinc finger protein gene OsCTZFP 8; the recombinant cell contains the vector.

2. Use according to claim 1, wherein the cold tolerance of rice is the cold tolerance of rice during the reproductive phase.