CN115612695A - Application of GhGPX5 and GhGPX13 genes in improving salt stress tolerance of plants - Google Patents

Abstract

The invention discloses aGhGPX5AndGhGPX13application of gene in improving salt stress tolerance of plant, and application of geneGhGPX5AndGhGPX13the gene sequence numbers of the gene in NCBI are XM _041083558.1 and XM _016881552.2 respectively. The invention is obtained by means of gene silencingGhGPX5/13The result of the plant with the silent gene shows that the plant with the silent gene has serious leaf wilting and yellowing under the high salt stress, which shows that the plant with the silent gene is more sensitive to high salt treatment. Connecting structureBuilding (2)GhGPX5/13Over-expression vector ofp35S‑GhGPX5‑GFPAndp35S‑GhGPX13‑GFPthe wild type arabidopsis (Clo-0, WT) is transformed by utilizing an agrobacterium inflorescence infection method to obtain an over-expressed plant, and an analysis result shows that under high salt stress, compared with the wild type,GhGPX5/13can improve the seed germination rate and enhance the salt stress tolerance of arabidopsis seedlings, thereby providing gene resources for the breeding of salt-tolerant molecules of crops.

Description

GhGPX5AndGhGPX13application of gene in improving salt stress tolerance of plant

Technical Field

The invention belongs to the field of biotechnology, and particularly relates toGhGPX5AndGhGPX13application of the gene in improving salt stress tolerance of plants.

Background

Plants are subjected to various biotic and abiotic stress environments throughout the growth period, and various stress factors ultimately cause the accumulation of excessive active oxygen in the plants, thereby affecting the growth and development of the plants. It has been considered that active oxygen is a byproduct of plant metabolism and plays an important role in cell signaling, redox balance, and the like. The low-concentration active oxygen can act as a signal molecule in a plant body, and the high-concentration active oxygen can generate toxic action on plant cells and oxidize intracellular components such as DNA, protein, plasma membrane and other biological macromolecules, so that the growth and development of the plant are influenced, and the yield of crops is reduced.

During the evolution, plants have developed complex enzymatic and non-enzymatic systems to eliminate oxidative damage from reactive oxygen species and maintain the reactive oxygen species homeostasis. The enzymatic system comprises various peroxidase families, and the research on the functions of the antioxidant genes can provide theoretical basis and application foundation for improving the stress resistance of plants.

Plant GPXs, which are capable of scavenging excess reactive oxygen species generated by stress environments, are generally referred to as Trx as a reducing agent, not GSH, and are therefore believed to have thioredoxin peroxidase activity. Some plant GPXs simultaneously express the activities of glutathione peroxidase and thioredoxin peroxidase, but the activity of the thioredoxin is higher than that of the thioredoxin which is taken as a substrate. But overall, becauseGPXsThe genes and the corresponding protein types are more, and the action process is more complex, so that further research is needed to lay the theoretical basis for the specific application of the genes.

The demand of China on raw cotton is increasingly intensified, but improvement of the total yield by enlarging the cultivated land area is unrealistic, 1 hundred million acres of saline-alkali land, 3 hundred million acres of saline-alkali wasteland and 60-80 percent of cotton field are in arid and semiarid areas in China. As cotton needs stronger drought resistance and saline-alkali resistance than other crops and is easily influenced by various stress factors in the growth process, a large amount of active oxygen is easily accumulated in organisms, and the GPXs family has the capability of eliminating the active oxygen and further resisting the stress of the external environment. Thereby passing through the cottonGPXsThe gene research can more clearly understand the function of the GPXs protein family of cotton under biotic and abiotic stress. Further utilizes the transgenic technology to cultivate the cotton variety capable of resisting the external stress condition, and has significance for the long-term stable development of cotton production in ChinaThe method has very important significance, the genes which are more related to drought resistance and saline-alkali resistance are known and found, and the research on the influence of the genes on the growth and development of cotton and stress resistance from a molecular level has important significance.

Disclosure of Invention

The purpose of the invention is to provideGhGPX5AndGhGPX13application of the gene in improving salt stress tolerance of plants.

In order to achieve the above purpose, the technical scheme adopted by the invention is summarized as follows:

adopted in the inventionGhGPX5The gene Sequence number (Sequence ID) of the gene in NCBI is XM _041083558.1,GhGPX5the length of messenger RNA (mRNA) sequence of the gene is 1313 bp,GhGPX5the length of the coding sequence of the gene is 702 bp, and the coding sequence comprises 233 amino acids;

GhGPX13the gene Sequence number (Sequence ID) of the gene in NCBI is XM-016881552.2,GhGPX13the length of the messenger RNA (mRNA) sequence of (2) is 1256 bp,GhGPX13the length of the coding sequence of the gene is 702 bp, and the coding sequence comprises 233 amino acids.GhGPX5AndGhGPX13has higher homology among the amino acid sequences.

The invention also constructs a series of plant expression vectors, and the functions of the expression vector containing the gene, the recombinant vector or the transgenic plant line and the host cell containing the vector in improving the salt stress resistance of the plant also fall into the protection scope of the invention.

The functions of the gene protected by the present invention include not only the aboveGhGPX5AndGhGPX13genes, also includeGhGPX5AndGhGPX13the gene has the function of homologous gene with higher homology (the homology is as high as 99%) in the aspect of salt stress resistance.

The invention disclosesGhGPX5AndGhGPX13the biological function of the gene in the salt stress tolerance of plants is specifically shown in the following steps: under the stress of salt, the plant growth regulator is used,GhGPX5andGhGPX13the leaf wilting degree and etiolation degree of the gene silencing strain are higher than those of the wild type, andGhGPX5andGhGPX13the germination rate of the seeds of the over-expression strain is higher than that of the wild type, and the yellowing degree of leaves is lower than that of the wild type.

According to the function, plants with salt stress resistance can be obtained in a transgenic way, and particularly, the plants can be obtained by using the transgenic wayGhGPX5AndGhGPX13the gene is introduced into a target plant to obtain a transgenic plant, and the salt stress resistance of the plant is higher than that of the target plant.

In particular, the amount of the solvent to be used,GhGPX5andGhGPX13the gene can be specifically introduced into the target plant by the recombinant expression vector. In the method, the recombinant expression vector can transform plant cells or tissues by using a conventional biological method such as Ti plasmid, ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium mediation, etc., and culture the transformed plant tissues into plants.

In order to improve the excellent traits of plants, the invention also protects a novel plant breeding method which is (1) or (2) or (3) below:

(1) By increasing in plants of interestGhGPX5AndGhGPX13obtaining a plant with stronger salt stress tolerance than that of a target plant by the activity of the protein;

(2) By promoting in the plant of interestGhGPX5AndGhGPX13expressing the gene to obtain a plant with salt stress tolerance stronger than that of a target plant;

(3) By inhibition in plants of interestGhGPX5AndGhGPX13expressing the gene to obtain the plant with salt stress tolerance lower than that of the target plant.

Promoting the growth of the target plantGhGPX5AndGhGPX13the expression of the gene "may be realized in the following (1) or (2) or (3):

(1) Will be provided withGhGPX5AndGhGPX13introducing a gene into a target plant;

(2) Introducing a strong promoter and/or enhancer;

(3) Other methods common in the art.

The target plant is cotton or arabidopsis thaliana.

The target gene, also called target gene, is used in genetic engineering design and operation for gene recombination, modification of recipient cell characteristics and obtaining of desired expression product. Either the organism itself or from a different organism.

"Regulation in plantsGhGPX5AndGhGPX13methods for "expression of genes" are overexpression, silencing or directed mutationGhGPX5AndGhGPX13a gene.

Regulating gene expression level includes regulating the expression level with DNA homologous recombination technology, virus mediated gene silencing technology and agrobacterium mediated transformation systemGhGPX5AndGhGPX13expressing to obtain transgenic plant strain.

In the present invention, there is no particular limitation on the plant suitable for use in the present invention, as long as it is suitable for carrying out a gene transformation operation, such as various crops, flowering plants, or forestry plants. Said plant may for example (without limitation): dicotyledonous, monocotyledonous or gymnosperm plants.

As a preferred mode, the "plant" includes but is not limited to: cotton, arabidopsis, especially gossypium hirsutum (A)Gossypium hirsutum) All genes having the gene or the gene homologous thereto are suitable.

As used herein, "plant" includes whole plants, parent and progeny plants thereof, and various parts of the plant, including seeds, fruits, shoots, stems, leaves, roots (including tubers), flowers, tissues and organs, having the gene or nucleic acid of interest in each of these various parts. Reference herein to "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the foregoing comprises a gene/nucleic acid of interest.

The present invention includes any plant cell, or any plant obtained or obtainable by the methods therein, as well as all plant parts and propagules thereof. The present patent also encompasses transfected cells, tissues, organs or whole plants obtained by any of the foregoing methods. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics and that the progeny obtained using the methods of this patent have the same characteristics.

The invention also extends to harvestable parts of a plant as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. It also relates to other post-harvest derivatives of the plant, such as dry granules or powders, oils, fats and fatty acids, starches or proteins. The invention also relates to food or food additives obtained from the relevant plants.

The invention has the advantages that:

(1) The invention adopts a method for comparing transcriptomics and innovatively treats the upland cotton (Gossypium hirsutum) ((R))Gossypium hirsutum) Glutathione Peroxidases (GPX) involved in antioxidant regulation in response to stressGhGPX5AndGhGPX13(Hejian brand)GhGPX5/13) Cloning was performed. Constructing a prokaryotic expression vector 6P1-GhGPX5/13, transforming the recombinant vector into an escherichia coli expression competent cell Rosette (DE 3), inducing GST-GhGPX5/13 to express a large amount and purifying, and showing that GhGPX5/13 has peroxidase activity and an oxidation-reduction state. Further constructing a GhGPX5/13 gene silencing vector TRV2-GPX5/13, injecting agrobacterium containing TRV2-GPX5/13 into cotton leaves by utilizing a method of infecting the cotton leaves by agrobacterium to obtain GPX5/13 silenced plants, wherein the result shows that the gene silencing plants have serious leaf wilting and yellowing phenomena under high salt stress, and the gene silencing plants are more sensitive to high salt treatment. Construction of an overexpression vector for GPX5/13p35S-GhGPX5-GFPAndp35S-GhGPX13-GFPthe wild type arabidopsis (Clo-0, WT) is transformed by utilizing an agrobacterium inflorescence infection method to obtain an over-expressed plant, and an analysis result shows that under high salt stress, compared with the wild type,GhGPX5/13can improve the germination rate of the seeds. Provides gene resources for the breeding of salt-tolerant molecules of crops.

(2) The salt-tolerant plants can be obtained by transgenic means, in particular, byGhGPX5/13The gene is introduced into a target plant to obtain a transgenic plant, the salt tolerance of the plant is higher than that of the target plant, and a new way is provided for salt tolerance breeding of the plant.

Drawings

FIG. 1 is a schematic view ofGhGPX5AndGhGPX13CDS sequence and coded amino acid sequence alignment analysis; drawing (A)1A showsGhGPX5AndGhGPX13the CDS sequence of (a), differing only by seven positions; FIG. 1B shows BGhGPX5AndGhGPX13the encoded amino acids differ only at three positions;

FIG. 2 is enzyme activity and redox status analysis of GhGPX5/13 protein; FIG. 3A shows marker genes expressed by high salt stress inductionGhERF38The expression level of (2) is increased to more than 10 times when the salt stress treatment is carried out for 8 hours, and is increased to 15 times when the salt stress treatment is carried out for 12 hours; figure 3B shows that at 12h of salt stress treatment,GhGPX5/13the expression amount of (2) is increased to 2.5 times; FIG. 4A shows transformation as a positive control group 7 days after Agrobacterium infectionTRV::GhCLA（TRV::00) The plant has a phenotype of leaf whitening; FIG. 4B shows creationGPX5/13In silent different plantsGPX5/13The expression level of (a);

FIG. 3 shows salt stress conditionsGhERF38AndGhGPX5/13analyzing the expression level of the gene;

FIG. 4 is a drawingGhGPX5/13In gene-silenced plantsGhGPX5/13Analyzing the expression level; FIG. 4A shows transformation as a positive control group 7 days after Agrobacterium infectionTRV::GhCLA（TRV::00) The plant has a phenotype of leaf whitening; FIG. 4B shows creationGPX5/13In silent different plantsGPX5/13The expression level of (a);

FIG. 5 shows cotton under salt stressGhGPX5/13Silenced plant (TRV::GPX5/13) And normal plants (TRV::00) Comparing the phenotypes;

FIG. 6 shows salt stressed cottonGhGPX5/13Analyzing phenotypes, physiological indexes and enzyme activities of silent plants and normal plants; FIG. 6A showsGhGPX5AndGhGPX13the common silencing of the two parts causes a large number of yellow spots to appear on the leaves, and the serious parts show a large-area yellowing phenomenon; FIG. 6B shows that the tan deposit is significantly greater in the leaves after high salt treatment than in the control (H) ₂ O soak), and,TRV::GPX5/13the leaves have large-area brown parts and are dyed to a greater extentTRV::00Deeper;

FIG. 6C shows the high salt stress causesTRV::GPX5/13Excess H in the blade ₂ O ₂ (ii) accumulation of (d); FIG. 6D shows the results after high salt treatmentThe blue deposits in the blade are obviously increased; FIG. 6E shows a view againstTRV::00The blades are arranged on the upper surface of the shell,TRV::GPX5/13blue parts in leaves of plants are obviously increased; FIG. 6F shows H in leaves under high salt treatment conditions ₂ O ₂ And an increased content of superoxide anions;

FIG. 6G showsTRV::00In contrast to the above-mentioned results,TRV::GPX5/13in blade H ₂ O ₂ And higher content of superoxide anion; FIG. 6H showsTRV::00In contrast to the above-mentioned results,TRV::GPX5/13more MDA accumulates in the leaves; FIGS. 6I and 6J showGPX5/13Gene silencing results in increased CAT and SOD activity in leavesTRV::00Lower enzyme activity in leaves;

FIG. 7 is a drawing GhGPX5AndGhGPX13analyzing the expression level of the transgenic arabidopsis thaliana and detecting the result by fluorescence; FIG. 7A showsGhGPX5Is up-regulated by about 40 times in 2 different strains; FIG. 7B showsGhGPX13The expression level of (a) is up-regulated by more than 50 times in 2 different strains; FIG. 7C showsGhGPX5AndGhGPX13GFP fluorescence can be detected at the root of the transgenic plant;

FIG. 8 shows overexpression in high salt hypochondriumGhGPX5AndGhGPX13analyzing the germination rate of the arabidopsis seeds and the growth condition of seedlings; FIG. 8A shows overexpressionGhGPX13The seed germination rate of (1) is more than 70%, while the seed germination rate of WT does not exceed 30%; FIG. 8B shows overexpressionGhGPX5AndGhGPX13the germination rate of (2) is over 90%, while the germination rate of WT seeds is about 70%; FIG. 8C shows overexpressionGhGPX5The germination rate of the seeds is close to 100 percent, and the seeds are over-expressedGhGPX13The germination rate of the strain is about 90 percent, while the germination rate of the WT seeds is less than 70 percent; FIG. 8D shows overexpressionGhGPX5The germination rate of the seeds is close to 80 percent, and the seeds are over-expressedGhGPX13The germination rate of (2) is about 60%, while the germination rate of WT seeds is less than 20%; FIG. 8E shows overexpression under different salt concentration conditionsGhGPX5AndGhGPX13the growth vigor of the seedlings is obviously better than that of WT, and the growth of the seedlings is insensitive to high salt stress relative to WT;

FIG. 9 shows overexpression in high salt hypochondriac regionGhGPX5AndGhGPX13and (5) analyzing the growth condition of the Arabidopsis plants.

Detailed Description

The present invention will be described in detail below by way of specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise indicated, all reagents and materials used are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botany, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics, as will be apparent to those skilled in the art. These techniques are explained fully in the published literature, and the methods of DNA extraction, phylogenetic tree construction, gene editing method, gene editing vector construction, gene editing plant acquisition, and the like used in the present invention can be realized by methods already disclosed in the prior art, in addition to the methods used in the following examples.

As used herein, the term "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" is intended to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules comprised of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences for non-coding regions. These terms include a gene. "Gene" or "gene sequence" is used broadly to refer to a functional DNA nucleic acid sequence. Thus, a gene may include introns and exons as in genomic sequence, and/or include coding sequences as in cDNA, and/or include cDNA and its regulatory sequences. In particular embodiments, e.g., with respect to an isolated nucleic acid sequence, it is preferred to default to cDNA.

Biological material

The cotton TM-1 seeds are stored in a laboratory; the arabidopsis Col-0 seeds are stored in a laboratory;

prokaryotic expression vectorpGEX6P1；Empty vector and positive control vector of gene silencing vectorTRV::GhCLAStoring for laboratory; overexpression vectorspSuper-1300-GFPStoring for laboratory;

escherichia coliDH5αAnd Agrobacterium tumefaciensGV3101Storing for laboratory;

primer synthesis and sequencing were completed by Zhengzhou Optimala Biopsis Inc.

Experimental reagent

RNA extraction kit, reverse transcription kit and fluorescent quantitation kit were purchased from nozan biotechnology ltd;

common reagents such as NaCl were purchased from Solebao corporation;

hygromycin was purchased from Solebao Bio Inc;

MS medium was purchased from Ku Ladber technologies, inc. of Beijing;

various endonucleases were purchased from monatin biotechnology, ltd;

one-step cloning of enzymes was purchased from nozan biotechnology ltd;

plasmid mini-extraction kit and gel recovery kit were purchased from Beijing Tiangen Biotechnology Co.

Experimental equipment

PCR instruments were purchased from Bio-rad;

refrigerated centrifuge was purchased from Eppendorf corporation;

quantitative PCR instruments were purchased from Bio-rad;

laser confocal microscopes were purchased from zeiss;

autoclave MLS-3750 was purchased from Sanyo corporation, japan;

nucleic acid detector Nanodrop 2000C was purchased from Thermo Scientific;

an ambient centrifuge, microplate reader SpectraMax iD5 was purchased from Thermo Scientific inc.

Example 1GhGPX5/13Cloning of Gene and amino acid sequence analysis thereof

Extracting RNA of upland cotton TM-1 growing for 15 days, using cDNA obtained by reverse transcription reaction as template, designing specific Primer from gene sequence obtained from NCBI database by Primer premier5.0, and respectively cloningGhGPX5/13The coding sequences of the two genes were converted into protein sequences by the Translate (https:// www.expasy. Org/resources/on-line tool)GhGPX5/13The gene sequence and the encoded protein sequence are aligned.

The results show that the cotton glutathione peroxidaseGhGPX5/13The coding sequences of the genes all comprise 702 bp bases. The encoded proteins all comprise 233 amino acids.GhGPX5AndGhGPX13the CDS sequence of (1) has only seven site differences (FIG. 1A), and the coded amino acid has only three site differences (FIG. 1B), and the homology is high.

Example 2 expression vectorpGEX6P1-GhGPX5/13Construction of

In order to explore the characteristics of the GhGPX5/13 protein, the inventors constructed prokaryotic expression vectors respectivelypGEX6P1- GhGPX5/13The specific process is briefly described as follows.

First, a restriction enzyme is designedEcoThe primer of the RI enzyme cutting site has the following sequence:

6P1-X5-F：5'-GGGATCCCCGGAATTCATGCTCGTTCGACGAAAT-3'

6P1-X5-R：5'-GTCGACCCGGGAATTCGCCAAGCAGTTTCTTTAT-3'

6P1-X13-F：5'-GGGATCCCCGGAATTCATGCTCGTTCGACGAAATCT-3'

6P1-X13-R：5'-GTCGACCCGGGAATTCCGTATCCACTCCCAATGCTT-3'

then, using the cDNA sample prepared in example 1 as a template, PCR amplification was performed, and the amplification product was purified and recovered;

third, toPGEX6P1The carrier adoptsEcoAnd (3) performing single enzyme digestion on the RI, and purifying an enzyme digestion product.

Fourthly, homologous recombination and connection are carried out on the PCR amplification product and the carrier after enzyme digestion to construct6p1-GhGPX5/13An expression vector;

fifthly, adopting a heat shock transformation method to transform the ligation product into escherichia coliDH5αAnd performing A (ampicillin, 50 mu g/mL) resistance screening, selecting positive colonies for PCR detection, amplifying and sequencing the colonies which are correctly identified by the PCR detection, and extracting plasmids from the bacterial liquid with correct sequencing for later use.

Sixthly, transforming the extracted plasmid into an escherichia coli expression competent cell Rosette (DE 3), inducing GST-GhGPX5/13 to express in a large quantity and purifying to obtain GhGPX5/13 protein.

At H ₂ O ₂ And (3) detecting whether the purified GhGPXs have peroxidase activity by using Trx as a substrate in the presence of the protease. As a result, ghGPX5/13 was found to have peroxidase activity (FIG. 2). To further analyze whether GhGPX5/13 has the characteristic of redox state, beta-mercaptoethanol (beta-ME), dithiothreitol (DTT) and H were used ₂ O ₂ The purified GhGPX5/13 protein was treated and analyzed by polyacrylamide gel electrophoresis (SDS-PAGE), and it was found that the peroxidase-containing GhGPX5/13 proteins all had a redox state.

Example 3 silencingGhGPX5/13Gene verification of function of the strain in cotton salt stress tolerance

To analyzeGhGPX5/13Whether the plant participates in the process of responding to the high salt stress of the cotton or not is firstly analyzed under the condition of the high salt stressGhGPX5/13The expression pattern of (2). Soaking wild type cotton plant TM-1 growing for 18 days in 400 mM NaCl solution, sampling leaves at 0 h, 2h, 4 h,8 h,12 h and 24 h respectively, and detecting by real-time fluorescent quantitative PCR (qRT-PCR)GhGPX5/13（GhGPX5/13The homology of (2) is higher, and a pair of primers can be designed according to the conserved sequence of the (2) to simultaneously detect the expression levels of two genes).

As a result, it was found that a marker gene expressed under high salt stress inductionGhERF38The expression level of (2) was increased 10-fold or more in 8 hours of salt stress treatment and 15-fold or more in 12 hours of salt stress treatment (FIG. 3A)The method shows that cotton seedlings are really treated by high salt stress; at the time of the salt stress treatment for 12h,GhGPX5/13the expression level of (2) was increased to 2.5-fold (FIG. 3B). This result suggests that GhGPX5/13 may be involved in regulating cotton response to high salt stress.

To make an intensive studyGhGPX5/13Function in response of upland cotton to high salt, aimed atGhGPX5/13The inventors constructed the conserved region of (3) by using a virus-induced gene silencing (VIGS) systemGhGPX5/13The gene silencing vector of (1)TRV2-GPX5/13To obtainGPX5/13Silenced cotton plant: (GhGPX5/13Has higher homology of (A) and is constructedTRV2-GPX5/13The vector can silence two genes simultaneously. ). The specific process is briefly described as follows.

First, design with restriction enzymesEcoRI andKpn the primer of I enzyme cutting site has the following sequence:

TRV2-GPX5/13-F：GTGAGTAAGGTTACCGAATTCGAGTCCTCCAAGGGGTCAGTT

TRV2-GPX5/13-R：GAGACGCGTGAGCTCGGTACCACCTTTGCTAGCCTTCAGGAA

firstly, taking the cDNA sample prepared in the example 1 as a template, carrying out PCR amplification, and purifying and recovering an amplification product;

third, toTRV2The carrier adoptsEcoRI andKpn carrying out double enzyme digestion, and purifying an enzyme digestion product;

fourthly, homologous recombination and connection are carried out on the PCR amplification product and the vector after enzyme digestion to constructTRV2-GhGPX5/13An expression vector;

fifthly, adopting a heat shock transformation method to transform the ligation product into escherichia coliDH5αTo proceed with K ⁺ (kanamycin, 50 mu g/mL) resistance screening, selecting positive colonies for PCR detection, amplifying and sequencing the colonies identified by the PCR detection to be correct, and extracting plasmids from bacterial liquid with correct sequencing for later use.

Sixth, the extracted plasmid is transformed into Agrobacterium-infected competent cellsGV3101And preserving at-80 ℃ for later use.

Seventh, a method of infecting cotton leaves with Agrobacterium will containTRV2-GPX5/13、TRV2、TRV-CLA、TRV1The agrobacterium tumefaciens is injected into the cotton leaves to obtainGPX5/13A silenced plant.

The results show the transformation as a positive control group 7 days after Agrobacterium infectionTRV::GhCLA（TRV::00) The plants showed a phenotype of leaf whitening (FIG. 4A), indicating that the gene silencing system was functional. Detection of VIGS System creation by qRT-PCR experimentGPX5/13In silent different plantsGPX5/13The results showed that of the 6 cotton seedlings tested, the number 1, 2, 3 and 6 plantsGPX5/13The expression level of (a) was 1/5 of that of the control group, and in plants No. 3 and 4GPX5/13The expression level of (A) was only 1/10 of that of the control group (FIG. 4B), and these results indicate that successful creation ofGPX5/13And (5) silencing the plants.

Based on the results of the foregoing example 4 analysis, gene silenced plants were treated with an aqueous solution containing 400 mM NaClTRV::GPX5/13AndTRV::00，after 8 days of treatmentTRV::00The plant leaves are still greenAnd TRV GPX5/13The plant leaves were wilted severely (fig. 5). This result indicates thatGhGPX5/13Positively regulates the tolerance of cotton to high salt stress.

On the basis of the analysis of the results, the created gene silencing plantsTRV::GPX5/13AndTRV::00the second true leaves are respectively soaked in H ₂ In O and an aqueous solution containing 400 mM NaCl, leaves soaked in water remained green after 24 h, while leaves soaked in a high-salt solution developed different degrees of macula as shown byTRV::00The blade presents a few yellow spots, andTRV::GPX5/13a large number of macula lutea appeared on the leaf, and a large area of yellowing appeared in the severe part (fig. 6A). This indicates thatGhGPX5AndGhGPX13the co-silencing of (a) significantly reduces the ability of the leaves to tolerate high salt stress.

To analyze high salt stressTRV::GPX5/13AndTRV::00the level of active oxygen in plant leaves is 12 hours after high salt treatmentTRV::GPX5/13AndTRV::00the second true leaves were subjected to DAB (3, 3-diaminobenzidine tetrahydrochloride) staining, and it was found that the high-salt treated leaves had a brownish deposit that was significantly greaterControl group (H) ₂ O soak), and moreover,TRV::GPX5/13the leaves have large area of brown parts, and the dyeing degree is higherTRV::00Deeper (FIG. 6B), indicating high salt stressTRV::GPX5/13The leaves accumulate more H ₂ O ₂ 。

The same parts of different leaves are respectively taken by using Image J, and the quantitative result of the dyeing degree of the leaves also shows that the high salt stress causesTRV::GPX5/13Excess H in the blade ₂ O ₂ Accumulation of (d) (fig. 6C). Furthermore, the accumulation of superoxide anions in leaves was analyzed by NBT (nitrotetrazolium blue chloride) staining and it was found that blue deposits were significantly increased in leaves treated with high salt (FIG. 6D) relative to leaves treated with high salt (FIG. 6D)TRV::00The blades are arranged on the upper surface of the shell,TRV::GPX5/13the blue parts of the leaves of the plants were significantly increased, and quantitative analysis of the stained parts also confirmed the results (FIG. 6E). These results show that it is possible to obtain,GPX5/13three genes silencing led to high salt treatmentTRV::GPX5/13Plants accumulate more reactive oxygen species and thus cause more damage to leaves, as evidenced by deeper leaf yellowing and greater sensitivity to high salinity treatments.

For analysis of high salt content in leavesTRV::GPX5/13AndTRV::00plant leaf H ₂ O ₂ And superoxide anion levels, we examined H under high salt stress ₂ O ₂ And superoxide anion content. As a result, it was found that under the high salt treatment conditions, H was contained in the leaves ₂ O ₂ And increased content of superoxide anionTRV::00In contrast, when the first and second electrodes are in contact,TRV::GPX5/13in the blade H ₂ O ₂ And a higher content of superoxide anion (FIG. 6F, G), which is consistent with the results of DAB and NBT staining.

To further analyze the level of reactive oxygen species in cells under high salt stress, we measured the Malondialdehyde (MDA) content in leaves, and the results showed that high salt stress resulted in more MDA accumulation in leavesTRV::00In contrast to the above-mentioned results,TRV:: GPX5/13more MDA accumulated in the leaves (fig. 6H). MDA is one of the common indexes for measuring the degree of oxidative stress and can reflect the degree of peroxidation of plant membrane lipid, MExcessive accumulation of DA, indicating that under high salt stress conditions,GPX5/13gene silencing results in higher degrees of membrane lipid peroxidation in leaf cells. In addition, to analyze the effect of other enzymes that scavenge reactive oxygen species on intracellular reactive oxygen species levels, we examined the activity of Catalase (CAT) and superoxide dismutase (SOD) in the leaves, respectively. The results show that the high salt treatment reduced the activity of CAT and SOD compared to the control group, and,GPX5/13gene silencing results in increased CAT and SOD activity in leavesTRV::00The enzyme activity was lower in leaves (FIG. 6I, J). This result indicates that, under high salt stress conditions,TRV:: GPX5/13the leaves accumulate excess active oxygen, on the one hand, due toGPX5/13The down-regulation of expression is caused, on the other hand, by a decrease in CAT and SOD activity in the leaves.

Example 4 verification of overexpression of ArabidopsisGhGPX5/13Function of gene in arabidopsis salt stress tolerance

For further analysisGPX5/13Respectively, the inventors constructedGPX5/13Over-expression vector ofp35S- GhGPX5-GFPAndp35S-GhGPX13-GFPand obtaining the over-expression arabidopsis thaliana plant. The specific process is briefly described as follows.

First, design a restriction enzymeSal The primer of the enzyme cutting site has the following sequence:

1300-GPX5-F：5' -GGGGCCCGGGGTCGACATGCTCGTTCGACGAAAT-3'

1300-GPX5-R：5' -GTATTTAAATGTCGACGGCCAAGCAGTTTCTTTAT-3'

1300-GPX13-F：5' -GGGGCCCGGGGTCGACATGCTCGTTCGACGAAATCT-3'

1300-GPX13-R：5' -GTATTTAAATGTCGACGGCCAAGCAGTTTCTTTATAT-3'

then, using the cDNA sample prepared in example 1 as a template, PCR amplification was performed, and the amplification product was purified and recovered;

third, to1300-GFPThe carrier adoptsSal And I, performing single enzyme digestion, and purifying an enzyme digestion product.

Fourthly, homologous recombination and connection are carried out on the PCR amplification product and the carrier after enzyme digestion to construct1300-GhGPX5/13Overexpression vectors；

Fifthly, adopting a heat shock transformation method to transform the ligation product into escherichia coliDH5αProceed with K ⁺ (kanamycin, 50 mu g/mL) resistance screening, selecting positive colonies for PCR detection, amplifying and sequencing the colonies which are detected and identified by the PCR detection and are correct, and extracting plasmids from bacterial liquid which is sequenced correctly for later use.

Sixthly, transforming the extracted plasmid into agrobacterium competent cellsGV3101And preserving at-80 ℃ for later use.

Seventhly, transforming wild type arabidopsis (Clo-0, WT) by utilizing an agrobacterium inflorescence infection method, screening the harvested seeds on an MS culture medium containing hygromycin, harvesting seeds of a potential transgenic plant single plant, and screening on a hygromycin-containing culture medium again until T is reached ₃ And (4) carrying out generation screening to obtain potential homozygous transgenic plants.

Respectively analyzing potential transgenic plants by utilizing qRT-PCRGhGPX5AndGhGPX13the expression level of (a). As a result, it was found thatGhGPX5Among the potential transgenic plants, inGhGPX5In the potential transgenic plants, the gene expression level of the gene is shown,GhGPX5was up-regulated by about 40-fold in 2 different lines (FIG. 7A)GhGPX13In the potential transgenic plants, the gene expression level of the gene is shown,GhGPX13the expression level of (2) was up-regulated by more than 50-fold in 2 different lines (FIG. 7B). The result of observing the GFP fluorescence of the root of the over-expressed arabidopsis thaliana by a laser confocal microscope shows that the screened arabidopsis thalianaGhGPX5AndGhGPX13GFP fluorescence was detected in all roots of the transgenic plants (FIG. 7C). These results indicate that the constructedGhGPX5AndGhGPX13the transgenic Arabidopsis thaliana is respectivelyGhGPX5-GFPAndGhGPX13-GFPover-expressing the plant.

High salt stress inhibited seed germination for further analysisGhGPX5AndGhGPX13whether to participate in the process of regulating and controlling high-salt stress to inhibit seed germination or not, we overexpress WTGhGPX5AndGhGPX13arabidopsis seeds were sown on MS medium containing NaCl at different concentrations (0 mM, 50 mM, 100 mM and 150 mM), treated at 4 ℃ for 3 days at low temperature, and then placed in a 12h light/12 h dark greenhouse (21 ℃) at 12h intervals under a body microscope for statistical analysisGermination of the seeds.

The results show that the germination rate of the over-expression seeds grown on the MS culture medium is obviously higher than that of the WT at 24 h and 36 h, and the over-expression is shown at 36 hGhGPX5The germination rate of the seeds is close to 100 percent, and the seeds are over-expressedGhGPX13The seed germination rate of (1) was greater than 70%, while the seed germination rate of WT did not exceed 30% (FIG. 8A); the NaCl treatment of different concentrations obviously inhibits the germination of seeds, and the effect of inhibiting the germination of the seeds is more obvious along with the increase of the NaCl concentration in the MS culture medium. Seeds grown for 36 h on MS Medium containing 50 mM, over-expressedGhGPX5AndGhGPX13the germination rate of the strain is more than 70 percent, while the germination rate of WT seeds is less than 20 percent, and after the strain grows for 60 hours, the strain is over-expressedGhGPX5AndGhGPX13the germination rate of WT was about 70%, whereas that of WT (FIG. 8B).

Seeds grown for 48 h on MS medium containing 100 mM, over-expressedGhGPX5AndGhGPX13the germination rate of (2) is over 60%, while the germination rate of WT seeds is about 10%, after 72 h growth, overexpression is performedGhGPX5The seed germination rate is close to 100 percent, and the over-expression is carried outGhGPX13Germination rate of about 90%, while WT seed germination rate was less than 70% (fig. 8C); seeds grown for 60 h on MS Medium containing 150 mM, over-expressedGhGPX5AndGhGPX13the germination rate of (1) is about 30%, while the germination rate of WT seeds is about 5%, after 72 h growth, over-expression is performedGhGPX5The seed germination rate is close to 80 percent, and the over-expression is carried outGhGPX13The germination rate of (A) was about 60%, while the germination rate of WT seeds was less than 20% (FIG. 8D).

These results indicate that overexpression is in ArabidopsisGhGPX5AndGhGPX13can promote the germination of seeds under high salt stress. Observing the seeds after 8 days of growth, the over-expression is realized under the condition of salt treatment with different concentrationsGhGPX5AndGhGPX13the seedlings grew significantly better than WT, indicating that their growth was insensitive to high salt stress relative to WT (FIG. 8E).

In addition, arabidopsis WT grown for 25 days was treated with an aqueous solution containing 200 mM NaCl and overexpressedGhGPX5AndGhGPX13transgenic plants, as a result, were found to overexpress in the control group (water treatment without NaCl) 7 days after high salt stressGhGPX5AndGhGPX13the transgenic plants are not obviously different from WT, and the high salt stress obviously inhibits the overexpressionGhGPX5AndGhGPX13transgenic plants and WT were grown and showed smaller rosette leaves, and WT leaves were significantly yellowed and overexpressed compared to WTGhGPX5AndGhGPX13transgenic plants did not show yellow leaves (FIG. 9), showing stronger high salt tolerance.

In conclusion, silencingGhGPX5/13The salt stress tolerance of the cotton is reduced after the gene is generated, which indicates thatGhGPX5/13The gene positively regulates and controls the tolerance of cotton to high salt stress; and the salt stress tolerance of the over-expressed arabidopsis thaliana is improved, which also shows that,GhGPX5/ 13the gene positively regulates the tolerance of arabidopsis thaliana to high salt stress. As can be seen,GhGPX5/13the gene plays an important role in regulating and controlling high salt stress of plants and has important significance for cultivating cotton varieties capable of resisting external stress conditions.

The above-mentioned embodiments are merely preferred embodiments of the present invention, which are merely illustrative and not restrictive, and it should be understood that other embodiments may be easily made by those skilled in the art by replacing or changing the technical contents disclosed in the specification, and therefore, all changes and modifications that are made on the principle of the present invention should be included in the scope of the claims of the present invention.

Claims (9)

1.GhGPX5AndGhGPX13use of a gene for increasing salt stress tolerance in a plant, wherein the gene is as describedGhGPX5AndGhGPX13the gene sequence numbers of the gene in NCBI are XM _041083558.1 and XM _016881552.2 respectively.

2. The use according to claim 1, wherein the salt stress tolerance is high concentration salt stress tolerance, and the high concentration salt concentration is 400 mM.

3. Use according to claim 1, characterised by the fact that it is obtained by constructionGhGPX5AndGhGPX13and (3) overexpressing the vector to obtain a transgenic plant with high salt stress tolerance.

4. Use according to any one of claims 1 to 3, wherein the plant is cotton or Arabidopsis thaliana.

5. The use according to claim 1, wherein the salt stress tolerance is expressed as: under the condition of salt stress, the salt stress,GhGPX5andGhGPX13the leaf wilting degree and the etiolation degree of the gene silencing strain are higher than those of the wild type, andGhGPX5andGhGPX13the germination rate of the seeds of the over-expression strain is higher than that of the wild type, and the yellowing degree of leaves is lower than that of the wild type.

6. A plant breeding method characterized in that the method is (1) or (2) or (3) below:

(1) By increasing in plants of interestGhGPX5AndGhGPX13obtaining plants with stronger salt stress tolerance than the target plants by the activity of the protein;

(2) By promoting in the plant of interestGhGPX5AndGhGPX13expressing the gene to obtain a plant with salt stress tolerance stronger than that of a target plant;

(3) By inhibition in plants of interestGhGPX5AndGhGPX13expressing the gene to obtain a plant with salt stress tolerance lower than that of a target plant;

the above-mentionedGhGPX5AndGhGPX13the gene sequence numbers of the gene in NCBI are XM _041083558.1 and XM _016881552.2 respectively.

7. Plant breeding method according to claim 6, characterized in that the plant of interest is cotton or Arabidopsis thaliana.

8. Method of plant breeding according to claim 6, characterized in that in the plant of interest is regulatedGhGPX5AndGhGPX13the expression of the gene being by overexpression, silencing or directed mutationGhGPX5AndGhGPX13a gene.

9. Plant breeding method according to claim 6, characterized in that altering the gene expression level comprises modulating the gene expression level using DNA homologous recombination techniques, virus mediated gene silencing techniquesGhGPX5AndGhGPX13and (5) obtaining a transgenic plant line according to the expression level.

Images