CN111087457A - Protein NGR5 for improving nitrogen utilization rate and crop yield, and coding gene and application thereof - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to a protein NGR5 for improving nitrogen utilization rate and crop yield, and a coding gene and application thereof. More specifically, the NGR5 gene is derived from rice, the NGR5 gene participates in the regulation and control process of nitrogen-mediated rice growth and development, the expression level of NGR5 is improved, the tillering number of the rice can be increased, the rice yield is improved under the level of reducing the nitrogen input, and the improvement of the utilization efficiency of the nitrogen in the rice is realized.

Description

Protein NGR5 for improving nitrogen utilization rate and crop yield, and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a protein NGR5 for improving nitrogen utilization rate and crop yield, and a coding gene and application thereof.

Background

Rice (Oryza sativa L.) is an important food crop, the total yield accounts for 1/4 of the world's food total yield, and more than half of the global population takes rice as staple food. On one hand, as the population worldwide increases year by year, the demand for rigidity of the grain is continuously increased; on the other hand, the problems of year-by-year decrease of the cultivated land area, shortage of water resources, frequent occurrence of natural disasters, aggravation of the industrialization degree, environmental damage caused by human activities and the like become more and more serious. Therefore, how to continuously improve the yield per unit is a great challenge facing the genetic breeding of crops at present.

In agricultural production, the application of nitrogen fertilizer in large quantities is one of the important measures for high yield of rice. The semi-dwarfing variety of the 'green revolution' which has always taken the leading position in the crop breeding history for more than half a century has the excellent characteristics of high fertilizer resistance, lodging resistance and high yield, but also has the limitation of low utilization efficiency (NUE) of nitrogen fertilizer, and the high yield of the semi-dwarfing variety has great dependence on high water and fertilizer input. Therefore, to increase crop yield, nitrogen fertilizers have to be used in large quantities. However, the continuous large amount of nitrogen fertilizer input not only increases the planting cost, but also causes an increasingly serious environmental pollution problem. How to improve the utilization efficiency of the nitrogen fertilizer of the rice and still keep the yield improvement under the condition of properly reducing the application amount of the nitrogen fertilizer is a bottleneck problem to be solved urgently in the current rice breeding.

Nitrogen is one of the great amount of nutritive elements essential for plant growth and development and is the important component of plant body protein, nucleic acid, phospholipid, hormone and other nitrogen containing matter. Nitrogen metabolism, one of the basic metabolic activities of plants, is related to biomass, crop yield, quality and the like of the plants. In recent years, the study has been accompanied by genetics, molecular biology, genomics, and the likeThe rapid development of the family, the nitrogen absorption and assimilation and other related genes are cloned successively, and the functional verification of the genes on the aspect of regulating and controlling the utilization efficiency of the nitrogen fertilizer is greatly improved. There is currently considerable research on the pathways by which plants take up and utilize nitrogen, such as the discovery of nitrogen transporters (Crawford and Glass 1998; Forde 2000; Howitt and Udvardi 2000; Glass et al 2001; Williams and Miller 2001), and the functional study of enzymes responsible for converting nitrogen into amino acids and other compounds (Campbell 1988; Lam et al 1996; Hirel and Lea 2001). Flooding plants such as rice mainly pass through NH₄ ⁺Transport proteins (AMTs), which absorb NH from the soil₄ ⁺.5 gene families (OsAMT1-OsAMT5) in rice code NH₄+ transporter, studies showed that OsAMT1 is overexpressed; 1 NH capable of enhancing Rice root System₄+ absorption capacity, suitable or lower concentration of NH at the outside₄Promoting the growth and development of rice under the condition of +; but at a high concentration of NH at the outside₄+ conditions, a more pronounced ammonium poisoning phenotype results (Ranathungen et al 2014). Overexpresses OsAMT 1; 3, the carbon-nitrogen balance in the rice body is disordered, the growth and development of the plants are inhibited, and the yield is reduced (Bao et al 2015). Glutamine Synthetase (GS) OsGS 1; 2 and NADH-GOGAT1 are primarily responsible for the absorption of NH by the rice roots₄ ⁺Assimilation, while GS2 and Fd-GOGAT are primarily responsible for NH in the leaf₄+ assimilation. Studies showed overexpression of OsGS 1; 2 can improve rice yield under high nitrogen conditions (Brauer et al 2014), but overexpresses GS 1: 1 may disrupt the carbon-nitrogen metabolic balance and severely affect rice growth and reduce rice yield (Bao et al 2014). In recent years, by utilizing technologies such as GWAS analysis, QTL positioning and map-based cloning, a plurality of key genes/major QTLs participating in nitrogen absorption and metabolic regulation are successfully separated and identified. For example, in rice, a number of enzymes involved in nitrogen assimilation (Yamaya et al 2002; Obara et al 2001, 2004; Gao et al 2019) and candidate genes involved in efficient use of nitrogen fertilizer (Gallais and Hirel, 2004; Martin et al, 2006; Obara et al 2001; Tabuchi et al, 2005; Sun et al 2014; H) have been detectedu et al.2015; wang et al.2018; li et al.2018), but there is very limited knowledge of the genetic regulatory network that controls the efficiency of nitrogen fertilizer utilization by plants.

Disclosure of Invention

The inventor of the invention utilizes EMS mutagenesis and genetic screening to isolate and identify a mutant ngr5(nitrogen-mediated tiller growth response 5) material of rice growth and development (tillering) which loses response to nitrogen. On the basis, a key gene NGR5 for regulating and controlling the growth and development of rice by nitrogen mediated is cloned by a map-based cloning method, and the fact that the NGR5 gene expression is regulated and controlled by nitrogen is clear, and the expression quantity of the gene is positively correlated with the tillering and yield of rice; meanwhile, a batch of rice materials carrying different allelic variations of NGR5 was identified. The function of the gene is proved by phenotype analysis and genetic complementation experiment of the mutant.

The research of the inventor provides a theoretical basis for revealing a genetic regulation and control network of crop tillering (growth and development) response nitrogen from a molecular level and provides a new gene resource with breeding utilization value for the high-efficiency utilization of nitrogen fertilizer and the design and breeding of high-yield molecules of main crops including rice and wheat.

Therefore, in general, the invention provides a gene for controlling the nitrogen utilization efficiency and yield traits of rice and application thereof. In particular, the invention relates to NGR5 and its superior allelic variants NGR5^Guichao2Under the condition of slightly reducing the plant height, the synergistic improvement of the utilization efficiency and the yield of the nitrogen of the rice is realized. The invention aims to provide an important functional gene capable of simultaneously improving the yield of main crops (such as rice, wheat and the like) and the utilization efficiency of nitrogen and application thereof.

Specifically, the inventor carries out EMS mutagenesis on a high-yield rice variety 9311 (China Rice research institute, or can be obtained commercially) carrying a 'green revolution' semi-dwarf gene sd1, and separates and identifies a mutant material ngr5 with growth and development traits such as tillering, plant height, spike grain number and the like which lose response to nitrogen through field phenotype screening of different nitrogen fertilizer application levels. Further clones the regulation rice by experiments such as map-based cloning and genetic complementationA key gene NGR5 for tillering nitrogen response. The research finds that the expression level of the NGR5 gene is induced by nitrogen, and proves that the nitrogen can also promote the high-level accumulation of the NGR5 protein. On the basis, the NGR5 gene is over-expressed under the background of a high-yield rice variety 9311, and a field test of multiple points for many years proves that the improvement of the NGR5 expression quantity can obviously increase the tillering number and the yield of rice, and can improve the utilization efficiency and the yield of the nitrogen fertilizer of the rice under the condition of properly reducing the application amount of the nitrogen fertilizer. The present inventors also found that OsGRF4 containing excellent isogenic gene^ngr2The over-expression of NGR5 in the high-yield variety with high-efficiency utilization of nitrogen fertilizer can further improve the rice yield and the utilization efficiency of nitrogen fertilizer.

EMS mutagenesis is carried out on a high-yield rice variety 9311 carrying a green revolution gene sd1, and a nitrogen-insensitive mutant ngr5 for the growth and development of rice plants is obtained through field phenotype screening and identification under different fertilizing amount conditions (high nitrogen and low nitrogen). Specifically, the number of tillers, plant height, number of branches and number of grains per ear of the wild-type rice increased with the increase in the amount of nitrogen fertilizer applied, but the traits of the ngr5 mutant, such as the number of tillers, plant height, number of branches, number of grains per ear, and yield, lost response to nitrogen. By map-based cloning techniques we obtained the candidate gene NGR5, which encodes a transcription factor of the AP2 type. Further genetic complementation experiments prove that the NGR5 gene is a positive regulation factor of rice growth, development and yield traits in response to nitrogen.

The present invention provides a gene NGR5 for controlling the utilization efficiency and yield of nitrogen fertilizer of rice and its excellent allele, and the present inventors named the excellent allele as NGR5^Guichao2。

In one embodiment, the gene NGR5 for controlling the nitrogen utilization efficiency and yield of rice and the allele thereof are provided, wherein the coding sequence of the gene NGR5 is shown as SEQ ID NO: 1, the allele NGR5 of the gene NGR5^Guichao2The gDNA sequence of (a) is as shown in SEQ ID NO: 4, respectively.

The invention provides the application of protein for controlling nitrogen utilization rate and crop yield in improving nitrogen utilization rate and crop yield, wherein the protein comprises one of the following amino acid sequences:

1) SEQ ID NO: 2;

2) substitution, deletion and/or insertion of one or more (e.g., 1-25, 1-20, 1-15, 1-10, 1-5, 1-3) amino acid residues with the amino acid sequence of SEQ ID NO: 2, but the activity of the polypeptide is different from that of the polypeptide shown in SEQ ID NO: 2, and the amino acid sequence is the same as the protein consisting of the amino acid sequence shown in the figure;

3) and SEQ ID NO: 2, preferably at least 80%, more preferably at least 90% identity, especially at least 95% or 98% or 99% identity, and which is active in comparison to the amino acid sequence set forth in SEQ ID NO: 2, and the amino acid sequence is the same as the protein consisting of the amino acid sequence shown in the figure;

4) an active fragment comprising the amino acid sequence of any one of 1) to 3).

In some embodiments of the invention, the nucleotide sequence of the gene encoding the protein for controlling nitrogen use efficiency and crop yield comprises one selected from the group consisting of:

1) SEQ ID NO: 1;

2) substitution, deletion and/or insertion of one or more (e.g., 1-25, 1-20, 1-15, 1-10, 1-5, 1-3) nucleotide sequences to the nucleotide sequence of SEQ ID NO: 1, but the activity of the encoded protein is different from that of the protein shown in SEQ ID NO: 1, the activity of the protein coded by the nucleotide sequence shown in the figure is the same;

3) and SEQ ID NO: 1, and the activity of the encoded protein is at least 70%, preferably at least 80%, more preferably at least 90% identity, especially at least 95% or 98% or 99% identity to the nucleotide sequence set forth in SEQ ID NO: 1, the activity of the protein coded by the nucleotide sequence shown in the figure is the same;

4) due to the degeneracy of the genetic code, the sequence of SEQ ID NO: 1 different nucleotide sequences;

5) an active fragment comprising a nucleotide sequence of any one of 1) to 4).

In other embodiments of the present invention, the nucleotide sequence of the gene encoding the protein controlling nitrogen use efficiency and crop yield comprises a nucleotide sequence identical to SEQ ID NO: 1 under moderately stringent conditions, preferably high stringent hybridization conditions.

In some embodiments of the present invention, the nucleotide sequence of the gene encoding the protein controlling nitrogen use efficiency and crop yield comprises a nucleotide sequence complementary to any one of the nucleotide sequences 1) to 5).

In the study, the inventors named the superior allele of NGR5 as NGR5^Guichao2Wherein NGR5 and NGR5^Guichao2There are differences in promoter regions in genomic DNA. Specifically, NGR5 compares to the NGR5 sequence in 9311^Guichao2The promoter region and the gene region within 2kb of the gene have 25 SNPs differences, which are shown in SEQ ID NO: 3 and SEQ ID NO: 5.

In a second aspect, the present invention provides a method of cultivating a crop with high nitrogen utilization and high yield, the method comprising: transfecting the nucleotide sequence of the gene for coding the protein for controlling the nitrogen utilization rate and the crop yield into crop cells to obtain a transgenic crop plant, so that the expression level of the gene for coding the protein for controlling the nitrogen utilization rate and the crop yield in the transgenic crop is increased, and the crop with high nitrogen utilization rate and high yield is obtained, wherein the crop is a monocotyledon, preferably rice or wheat, and more preferably rice.

In some embodiments of the invention, the gene controlling nitrogen utilization and crop yield is NGR5 or its superior allele NGR5^Guichao2。

Wherein, the NGR5 gene can control the absorption and utilization efficiency of the nitrogen in the rice and the influence of the nitrogen fertilizer dosage on the biomass and yield increase of the rice. Specifically, the expression level of the NGR5 gene is increased, the absorption and assimilation of the nitrogen fertilizer of the rice can be improved, the tiller number of the rice can be increased, and the yield of the rice can be improved. Likewise, the superior allelic variation NGR5 of the gene^Guichao2Can not only increase the utilization efficiency of nitrogen fertilizer of rice, but also increase the tillering number and yield of rice。

Preferably, the genes NGR5 and NGR5 related to the invention for controlling the utilization efficiency and yield of the nitrogen fertilizer of rice^Guichao2The cDNA sequences of (A) and (B) are identical, the amino acid sequences encoded by the two are also identical, and the difference of the nucleotide sequences is only in a promoter region.

Specifically, NGR5 compares to the 2kb promoter of the NGR5 gene (SEQ ID NO: 3)^Guichao2The 2kb promoter of the gene (SEQ ID NO: 5) has 21 SNPs, and further research shows that NGR5^Guichao2The gene promoter region has 3 specific SNPs sites (i.e., g. -853T > G, g. -825T > C, g. -770G > A) associated with increased transcription levels of the gene.

The rice varieties with high nitrogen utilization rate and high yield can be identified by utilizing the specific SNPs sites. For example, if the presence of any one, two or all three specific SNPs selected from the following can be detected in the promoter region of the NGR5 gene in rice plants: g. and the rice variety is judged to have the potential of high nitrogen fertilizer utilization rate and high yield when the rice variety is-853T & gtG, G-825T & gtC and G-770G & gtA. The SNPs difference of the promoter region or the coding region of the NGR5 gene can be detected by PCR amplification enzyme digestion or sequencing method.

In a third aspect, the present invention provides a method of cultivating a crop with high nitrogen utilization and high yield, the method comprising: co-expression of GRF4 in crop plants^ngr2Genes and genes encoding said proteins controlling nitrogen utilization and crop yield or superior alleles thereof, or in a plant harboring OsGRF4^ngr2The coding gene of the protein for controlling the nitrogen utilization rate and the crop yield or the excellent allele thereof is overexpressed in the crop plant of the gene, wherein the coding gene of the protein for controlling the nitrogen utilization rate and the crop yield is OsNGR5 gene, and the excellent allele thereof is OsNGR5^Guichao2The gene, the crop is monocotyledon, preferably rice or wheat, and more preferably rice.

Using the gene of the invention or its allele and OsGRF4^ngr2And (5) performing polymerization breeding on the genes. Co-expression of the gene of the invention or its allele and OsGRF4 in rice plants^ngr2The gene can further improve the utilization rate and the yield of the nitrogen fertilizer of the rice.

Specifically, the method of pyramiding breeding may comprise: carrying excellent allele OsGRF4^ngr2Over-expression of NGR5 or allele NGR5 in rice plants^Guichao2Or other forms of alleles of NGR5 engineered by gene editing techniques. In one embodiment, OsGRF4 is carried on a superior allele^ngr2Over-expression of NGR5 gene in rice plant. In another embodiment, OsGRF4 is carried on a superior allele^ngr2Over-expression of NGR5 in rice plants^Guichao2A gene. In a preferred embodiment, OsGRF4 is carried on a superior allele^ngr2Over-expression of NGR5 in rice plants^Guichao2A gene.

Wherein OsGRF4^ngr2The gene is a gene for controlling the utilization efficiency and yield of the rice nitrogen. About OsGRF4^ngr2Genes, see PCT: WO 2019/158911a1, the above patent document being fully incorporated herein by reference.

In some embodiments of the invention, the superior allele OsNGR5^Guichao2The promoter region of the gene has 3 specific SNPs sites: g. 853T > G, G-825T > C, G-770G > A), which can increase OsNGR5^Guichao2The level of transcription of the gene.

In a fourth aspect, the present invention provides a method of cultivating a crop with high nitrogen utilization and high yield, the method comprising: will contain said OsNGR5^Guichao2Crossing a crop plant of the gene with another plant of the crop to produce a hybrid crop plant, such that OsNGR5 is present in the hybrid crop^Guichao2The expression quantity of the gene is increased, and the crop with high nitrogen fertilizer utilization rate and high yield is obtained, wherein the crop is rice.

In a fifth aspect, the present invention provides a method of identifying a rice variety having high nitrogen utilization and high yield, the method comprising: analyzing the promoter region of the OsNGR5 gene for the presence of any one, two or all three specific SNPs selected from the group consisting of: g. 853T > G, G-825T > C, G-770G > A, and analyzing the gene region of OsNGR5 gene for the presence of specific SNPs: g.3326C > T, to determine if the rice variety has the potential for high nitrogen utilization and high yield.

In some embodiments of the invention, the SNPs of the promoter region and coding region of the OsNGR5 gene are detected using PCR amplification digestion or sequencing methods.

The sixth aspect of the present invention provides a gene for controlling nitrogen utilization and crop yield, the nucleotide sequence of which is as shown in SEQ id no: 4, respectively.

The seventh aspect of the present invention provides a recombinant construct comprising the gene according to the sixth aspect.

An eighth aspect of the invention provides a host cell comprising a gene according to the sixth aspect or a recombinant construct according to the seventh aspect, wherein the host cell is a microbial cell, preferably an escherichia coli cell or an agrobacterium cell.

The invention provides a promoter of the gene NGR5 for controlling the utilization efficiency and the yield of the rice nitrogen and an allele thereof, the length of the promoter is about 2kb, and the promoter comprises one of the following nucleotide sequences:

(1) SEQ ID NO: 3 or SEQ ID NO: 5;

(2) a nucleotide sequence that hybridizes under moderately stringent conditions, preferably high stringent hybridization conditions, to the complement of the nucleotide sequence of (1);

(3) a nucleotide sequence having at least 70%, preferably at least 80%, more preferably at least 90%, especially at least 95% or 98% or 99% identity to the nucleotide sequence of (1).

In a preferred embodiment, the promoter sequence of NGR5 is as set forth in SEQ ID NO: 3, allele NGR5^Guichao2The promoter sequence of (a) is shown in SEQ ID NO: 5, respectively.

In a preferred embodiment, NGR5 and its allelic NGR5^Guichao2The related sequences are shown as SEQ ID NOs: 1-5, see table 1 below for details.

Table 1.SEQ ID NOs: 1-5 and their sources

The present invention also provides mutant types produced by gene editing techniques and containing the SNPs according to the fifth aspect of the present invention or other mutant types capable of causing an increase in the expression level of the OsNGR5 gene.

The present invention provides other types of mutations that increase the stability of the OsNGR5 protein, produced using gene editing techniques. The invention provides a recombinant construct which contains the gene NGR5 or the allele NGR5 for controlling the nitrogen utilization efficiency and the yield of rice^Guichao2The polynucleotide sequence of (1). Wherein the vector used for the construct may be a cloning vector or an expression vector for expressing the polynucleotide.

The invention provides a recombinant host cell, which contains the recombinant construct, or integrates the gene NGR5 or allele NGR5 for controlling the utilization efficiency and the yield of the nitrogenous fertilizer of rice into the genome^Guichao2The polynucleotide sequence of (1). The host cell may be selected from plant cells or microbial cells, such as e.coli cells or agrobacterium cells, preferably plant cells, most preferably rice cells. The cell may be isolated, ex vivo, cultured or part of a plant.

The present invention provides polynucleotides of the present invention (i.e., gene NGR5 or allele NGR5 controlling the efficiency and yield of nitrogen fertilizer utilization in rice^Guichao2Or other forms of alleles following modification by gene editing techniques) or polypeptides or recombinant constructs of the invention or recombinant host cells of the invention for use in improving crop plant traits (e.g., increasing crop yield) and nitrogen fertilizer use efficiency.

The invention provides the NGR5 or the allele NGR5^Guichao2The use of (a) for controlling nitrogen use efficiency and yield of rice, but is not limited thereto.

The present invention provides a method for breeding improved rice varieties. The method comprises the following steps: using a gene comprising NGR5 or the allele NGR5^Guichao2The recombinant agrobacterium cell transfected rice plantObtaining transgenic rice plants, or using NGR5 or allelic NGR5^Guichao2The rice plant with other forms of alleles after being modified by the gene editing technology is crossed with another rice plant to obtain a progeny rice plant, wherein the obtained rice plant is preferably a rice plant with improved nitrogen utilization efficiency and yield.

In a more preferred embodiment of the invention, based on more detailed experimental verification, the inventors have found that the NGR5 gene and its superior allele NGR5 can be utilized^Guichao2The breeding experiment with the function of increasing the utilization efficiency and the yield of the nitrogen fertilizer is carried out by the following three ways:

(1) alteration of NGR5 or allelic NGR5 in rice^Guichao2The expression level of (a);

(2) alteration of NGR5 or allelic NGR5 in rice^Guichao2The content and activity of the encoded protein;

(3) the promoter sequence or gDNA sequence of NGR5 gene in rice is changed.

The following are definitions of some terms used in the present invention. Unless otherwise indicated, terms used herein have meanings known to those of ordinary skill in the art.

In the present invention, "NGR 5 gene" and "OsNGR 5 gene" both refer to the rice NGR5 gene, "Excellent allele" and "NGR 5 gene^Guichao2"and" OsNGR5^Guichao2All the genes refer to rice genes having the SNPs site differences from the promoter of the NGR5 gene.

"associated"/"operably linked" refers to two nucleic acid sequences that are physically or functionally related. For example, a promoter or regulatory DNA sequence is said to be "associated with" a DNA sequence encoding an RNA or protein if the promoter or regulatory DNA sequence and the DNA sequence encoding the RNA or protein are operably linked or positioned such that the regulatory DNA sequence will affect the level of expression of the coding or structural DNA sequence.

A "chimeric gene" is a recombinant nucleic acid sequence in which a promoter or regulatory nucleic acid sequence is operably linked to, or associated with, a nucleic acid sequence that encodes mRNA or is expressed as a protein, such that the regulatory nucleic acid sequence is capable of regulating the transcription or expression of the associated nucleic acid sequence. The regulatory nucleic acid sequences of the chimeric gene are not normally operably linked to the relevant nucleic acid sequences as found in nature.

A "coding sequence" is a nucleic acid sequence that is transcribed into RNA, e.g., mRNA, rRNA, tRNA, snRNA, sense RNA or antisense RNA. Preferably, the RNA is subsequently translated in the organism to produce a protein.

"hybrid rice" refers to the first generation hybrid species with heterosis produced by crossing between two rice varieties (lines) with different genetic compositions. At present, three-line hybrid rice and two-line hybrid rice are widely used in production. The production of three-line hybrid rice seeds requires the mutual matching of a male sterile line, a male sterile maintainer line and a male sterile restorer line. The sterility of the sterile line is controlled by cytoplasm and nucleus together, and the sterile line can be obtained only by hybridizing with the maintainer line; the sterile line is hybridized with the restorer line to obtain hybrid rice seeds for field production. The production of two-line hybrid rice only needs sterile line and restoring line. The fertility of the sterile line is regulated and controlled by the recessive sterile gene in the cell nucleus and the light length and the temperature of the planting environment, and the fertility conversion from sterility to fertility is generated along with the change of the light and temperature conditions, and the fertility is unrelated to cytoplasm. The characteristics of the photo-thermo-sensitive sterile line of producing death fertility conversion along with the change of photo-thermal conditions are utilized, and the seeds can be bred by self-crossing in a proper photo-thermal period.

In the context of the present invention, "corresponding to" means that when the nucleic acid coding sequences or amino acid sequences of different NGR5 genes or proteins are compared to each other, the nucleic acids or amino acids "corresponding to" some of the enumerated positions are aligned with these positions, but not necessarily in these exact numerical positions relative to the respective nucleic acid coding sequence or amino acid sequence of a particular NGR 5. Likewise, when a particular NGR5 coding or amino acid sequence is aligned with a reference NGR5 coding or amino acid sequence, the nucleic acids or amino acids in that particular NGR5 sequence that "correspond to" some of the enumerated positions of the reference NGR5 sequence are aligned with those positions of the reference NGR5 sequence, but are not necessarily in those precise numerical positions of the respective nucleic acid coding sequence or amino acid sequence of that particular NGR5 protein.

As used herein, an "expression cassette" is intended to mean a nucleic acid sequence capable of directing the expression of a particular nucleotide sequence in a suitable host cell, comprising a promoter operably linked to a nucleotide sequence of interest operably linked to a termination signal. Typically, it also comprises sequences required for proper translation of the nucleotide sequence. An expression cassette comprising a nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The expression cassette may also be naturally occurring, but obtained in recombinant form for heterologous expression. However, in general, the expression cassette is heterologous with respect to the host, i.e., the particular nucleic acid sequence of the expression cassette does not occur naturally in the host cell and must be introduced into the host cell or a precursor of the host cell by a transformation event. Expression of the nucleotide sequence in the expression cassette may be controlled by a constitutive promoter or an inducible promoter, wherein transcription is initiated by the inducible promoter only when the host cell is exposed to some specific external stimulus. In the case of multicellular organisms, such as plants, the promoter may also be specific to a particular tissue, or organ or developmental stage.

A "gene" is a defined region within the genome which, in addition to the aforementioned coding nucleic acid sequences, comprises other, mainly regulatory nucleic acid sequences which are responsible for the expression of the coding part, i.e.transcriptional and translational control. The gene may also contain other 5 'and 3' untranslated sequences and termination sequences. Further elements that may be present are, for example, introns.

A "heterologous" nucleic acid sequence is a nucleic acid sequence that is not naturally associated with the host cell into which it is introduced, comprising multiple copies of a naturally occurring nucleic acid sequence that is not naturally occurring.

A "homologous" nucleic acid sequence is a nucleic acid sequence that is naturally associated with the host cell into which it is introduced.

An "isolated" nucleic acid molecule or isolated protein is one that exists artificially isolated from its natural environment and is therefore not a natural product. An isolated nucleic acid molecule or protein may exist in purified form, or may exist in a non-natural environment such as, for example, a recombinant host cell or a transgenic plant.

"native gene" refers to a gene that is present in the genome of an untransformed cell.

The term "naturally occurring" is used to describe a subject that can be found in nature, as opposed to an artificially produced subject. For example, a protein or nucleotide sequence present in an organism (including viruses) that has been isolated from a natural source and that has not been intentionally artificially modified in the laboratory is "naturally-occurring".

A "nucleic acid molecule" or "nucleic acid sequence" is a linear fragment of single or double stranded DNA or RNA that can be isolated from any source. In the context of the present invention, preferably, the nucleic acid molecule is a DNA fragment. A "nucleic acid molecule" is also referred to as a polynucleotide molecule.

A "plant" is any plant, particularly a seed plant, at any developmental stage.

A "plant cell" is the structural and physiological unit of a plant, comprising protoplasts and a cell wall. Plant cells may be in the form of isolated individual cells or cultured cells, or as a higher organized unit such as, for example, a plant tissue, a plant organ, or a portion of a whole plant.

"plant material" refers to leaves, stems, roots, flowers or parts of flowers, fruits, pollen, egg cells, zygotes, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant.

A "plant organ" is a distinct and well-structured and differentiated part of a plant, such as a root, stem, leaf, flower bud or embryo.

As used herein, "plant tissue" means a group of plant cells organized into structural and functional units. Including any tissue of the plant in the plant or in culture. The term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue cultures, and any group of plant cells organized into structural and/or functional units. The use of this term in combination or alone with any particular type of plant tissue enumerated above or encompassed by this definition is not meant to exclude any other type of plant tissue.

A "promoter" is an untranslated DNA sequence upstream of a coding region that contains a binding site for RNA polymerase II and initiates transcription of the DNA. The promoter region may also contain other elements that act as regulators of gene expression.

A "protoplast" is an isolated plant cell that has no cell wall or only a partial cell wall.

"regulatory element" refers to a sequence involved in controlling the expression of a nucleotide sequence. The regulatory elements comprise a promoter operably linked to the nucleotide sequence of interest and a termination signal. Usually they also comprise sequences required for correct translation of the nucleotide sequence.

The phrase "substantially identical" in an alignment of two nucleic acid or protein sequences refers to two or more sequences or subsequences that have at least 60%, preferably 80%, more preferably 90%, even more preferably 95% and most preferably at least 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as determined using one of the following sequence comparison algorithms or visual inspection. Preferably, substantial identity exists over a region of the sequence that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably, the sequences are substantially identical over at least about 150 residues. In a particularly preferred embodiment, the sequence is substantially the same throughout the length of the coding region. Moreover, substantially identical nucleic acid or protein sequences have substantially identical functions.

For sequence comparison, typically, one sequence is compared to the test sequence as a reference sequence. When using a sequence comparison algorithm, the test and reference sequences are input into a computer, the coordinates of the subsequences are specified, if necessary, and the parameters of the sequence algorithm program are specified. The sequence comparison algorithm will then calculate the percent sequence identity of the test sequence relative to the reference sequence based on the selected program parameters.

For example, by Smith & Waterman, adv.appl.math.2: 482(1981) by Needleman & Wunsch, j.mol.biol.48: 443(1970) by Pearson & Lipman, proc.nat' 1.acad.sci.usa 85: 2444 (1988), by computerized implementation of these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics software package, Genetics computer Group, 575Science Dr., Madison, Wis.) or by visual inspection (see generally Ausubel et al, infra) optimal alignment of sequences for comparison can be performed.

An example of an algorithm suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, described in Altschul et al, j.mol.biol.215: 403- & 410(1990) describes the algorithm. Software for BLAST analysis is publicly available through the national center for Biotechnology information (http:// www.Ncbi.nlm.nih.gov /). The algorithm comprises the following steps: high scoring sequence pairs (HSPs) are first identified by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbor word score threshold (Altschul et al, 1990). These initial neighborhood word hits act as clues to the initial lookup to find longer HSPs containing them. These word hits will then extend as far as possible in both directions of each sequence until the cumulative alignment score no longer increases. For nucleotide sequences, cumulative scores were calculated using the parameters M (reward score for pairwise matching residues; always greater than zero) and N (penalty score for mismatching residues; always less than zero). For amino acid sequences, a scoring matrix was used to calculate the cumulative score. Word hit extension in each direction stops when the cumulative alignment score falls back by the number X of maximum achieved, the cumulative score reaches or falls below zero due to one or more negative scoring residue alignments being accumulated, or either of the two sequences reaches the endpoint. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses a word length value (W)11, an expectation value (E)10, a cutoff value of 100, M-5, N-4 and a comparison of the two strands as defaults. For amino acid sequences, the BLASTP program uses the word length value (W)3, expectation value (E)10 and BLOSUM62 scoring matrices as default values (see, Henikoff & Henikoff, proc. natl. acad. sci. usa 89: 10915 (1989)).

In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. nat' 1.Acad. Sci. USA 90: 5873) 5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P (N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability of comparing the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase "specifically hybridizes" refers to the binding of a molecule to only a specific nucleotide sequence, forming a duplex or hybridizing under stringent conditions when the sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. "substantial binding" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and comprises fewer mismatches that can be tolerated by reducing the stringency of the hybridization medium to achieve the desired detection of the target nucleic acid sequence.

"stringent hybridization conditions" and "stringent hybridization rinse conditions" in the context of nucleic acid hybridization assays, such as Southern and Northern hybridizations, are sequence dependent and differ under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. A number of guidelines for Nucleic acid Hybridization can be found in Tijssen (1993) Laboratory Techniques in Biochemistry and molecular biology-Hybridization with Nucleic acid probes, Chapter 2 "Overview of principles of Hybridization and the protocol of Nucleic acid probe assays" Elsevier, New York. Generally, for a particular sequence at a defined ionic strength and pH, high stringency hybridization and rinse conditions are selected to be about 5 ℃ below the thermal melting point (Tm). Typically, under "stringent conditions" a probe will hybridize to its target subsequence, but not to other sequences.

The Tm is the temperature (under defined ionic strength and pH conditions) at which 50% of the target sequence hybridizes to a perfectly matched probe. For a particular probe, very stringent conditions are chosen to be equal to Tm. An example of a stringent hybridization condition for hybridization of complementary nucleic acids having more than 100 complementary residues on the filter in a southern or Northern blot is to perform the hybridization overnight at 42 ℃ in 50% formamide with 1mg heparin. An example of high stringency rinsing conditions is 72 ℃, 0.15M NaCl for about 15 minutes. An example of stringent rinse conditions is a 0.2 XSSC rinse at 65 ℃ for 15 minutes (see, Sambrook, infra, for a description of SSC buffer). Typically, a low stringency rinse is performed before a high stringency rinse to remove background probe signal. For duplexes of, for example, more than 100 nucleotides, an example of a medium stringency rinse is a 45 ℃ 1 × SSC rinse for 15 minutes. For duplexes of, for example, more than 100 nucleotides, an example of a low stringency rinse is a 40 ℃ rinse for 15 minutes in 4-6 XSSC. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically include a salt concentration of less than about 1.0M Na ion, typically about 0.01 to 1.0M Na ion concentration (or other salt) at pH7.0 to 8.3, typically at a temperature of at least about 30 ℃. Stringent conditions may also be achieved by the addition of destabilizing agents such as formamide. Generally, a signal-to-noise ratio 2 × (or higher) higher than that observed for an unrelated probe in a particular hybridization assay indicates detection of specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.

The following are examples of settings of hybridization/rinse conditions that may be used to clone a homologous nucleotide sequence that is substantially identical to a reference nucleotide sequence of the present invention: the reference nucleotide sequence and the reference nucleotide sequence are preferably at 50 ℃ with 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO₄Hybridization in 1mM EDTA, rinsing in 50 deg.C, 2 XSSC, 0.1% SDS, more desirably at 50 deg.C, 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO₄Hybridization in 1mM EDTA, rinsing in 50 deg.C, 1 XSSC, 0.1% SDS, more desirably 50 deg.C, 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO₄Hybridization in 1mM EDTA, rinsing in 0.5 XSSC, 0.1% SDS at 50 ℃, preferably 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO at 50 ℃₄Hybridization in 1mM EDTARinsing in 0.1 XSSC, 0.1% SDS at 50 ℃, more preferably 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO at 50 ℃₄Hybridization in 1mM EDTA, rinsing at 65 ℃ in 0.1 XSSC, 0.1% SDS.

Another indication that two nucleic acid sequences or proteins are substantially identical is that the protein encoded by the first nucleic acid immunologically cross reacts with or specifically binds to the protein encoded by the second nucleic acid. Thus, a protein is typically substantially identical to a second protein, e.g., where the two proteins differ only by conservative substitutions.

"synthetic" refers to a nucleotide sequence that contains structural features not found in the native sequence. For example, artificial sequences that are said to more closely resemble the G + C content and normal codon distribution of dicotyledonous and/or monocotyledonous plant genes are synthetic.

"transformation" is the process of introducing a heterologous nucleic acid into a host cell or organism, and in particular "transformation" means the stable integration of a DNA molecule into the genome of an organism of interest.

"transformed/transgenic/recombinant" refers to a host organism, such as a bacterium or plant, into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule may be stably integrated into the host genome or the nucleic acid molecule may also be present as an extrachromosomal molecule. Such extrachromosomal molecules may be autonomously replicating. Transformed cells, tissues, or plants are understood to encompass not only the end product of the transformation process, but also transgenic progeny thereof. A "non-transformed", "non-transgenic", or "non-recombinant" host refers to a wild-type organism, such as a bacterium or plant, that does not contain a heterologous nucleic acid molecule.

The terms "polynucleotide", "polynucleotide molecule", "polynucleotide sequence", "coding sequence", "Open Reading Frame (ORF)" and the like as used herein include single-or double-stranded DNA and RNA molecules, which may comprise one or more prokaryotic sequences, cDNA sequences, genomic DNA sequences comprising exons and introns, chemically synthesized DNA and RNA sequences, as well as sense and corresponding antisense strands.

Methods for producing and manipulating the polynucleotide molecules and oligonucleotide molecules disclosed herein are known to those skilled in the art and can be accomplished according to recombinant techniques already described (see Maniatis et al, 1989, molecular cloning, A laboratory Manual, Cold spring harbor laboratory Press, Cold spring harbor, N.Y.; Ausubel et al, 1989, Current techniques in molecular biology, Greene publishing Associates & Wiley Interscience, NY; Sambrook et al, 1989, molecular cloning, A.laboratory Manual, 2 nd edition, Cold spring harbor laboratory Press, Cold spring harbor, N.Y.; Innis et al (eds.), 1995, PCR strategies, academic Press, Inc., San Diego; and Erlich (eds.), 1992, PCR technology, Oxford university Press, N.Y.).

"plant transformation" refers to the expression of at least one foreign gene in a plant in order to confer one or more desirable phenotypic traits on the transformed plant.

In a particularly preferred embodiment, at least one gene for the rice nitrogen fertilizer use efficiency and yield traits of the invention is expressed in higher organisms such as plants. Specifically, the nucleotide sequence of the gene for rice nitrogen fertilizer use efficiency and yield traits of the present invention may be inserted into an expression cassette, which is then preferably stably integrated into the plant genome. In another preferred embodiment, the nucleotide sequence of the gene for the rice nitrogen fertilizer use efficiency and yield traits is transfected into cells or calli of a plant by including the nucleotide sequence in a non-pathogenic self-replicating virus, thereby obtaining a transformed plant, also called a transgenic plant.

Plants transformed according to the present invention may be monocotyledonous or dicotyledonous plants including, but not limited to, maize, wheat, barley, rye, sweet potato, beans, peas, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, pepper, celery, squash, pumpkin, zucchini, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tomato, sorghum, sugarcane, sugar beet, sunflower, rapeseed, clover, tobacco, carrot, cotton, alfalfa, rice, potato, eggplant, cucumber, arabidopsis and woody plants such as conifers and deciduous trees. Particularly preferred is rice, wheat, barley, corn, oats, or rye.

Once the desired nucleotide sequence has been transformed into a particular plant species, it may be propagated in that species or transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques.

Preferably, the nucleotide sequences of the present invention are expressed in transgenic plants, thereby causing the biosynthesis of proteins in transgenic plants that control nitrogen fertilizer use efficiency and yield traits, respectively. In this way, transgenic plants with improved traits can be produced. In order to express the nucleotide sequence of the present invention in transgenic plants, the nucleotide sequence of the present invention may need to be modified and optimized. All organisms have a particular preference for codon usage, which is known in the art, and the codons can be changed to conform to plant preferences while maintaining the amino acids encoded by the nucleotide sequences of the present invention. Moreover, high levels of expression in plants can best be achieved from coding sequences having at least about 35%, preferably more than about 45%, more preferably more than 50%, and most preferably more than about 60% GC content. Although preferred gene sequences can be expressed adequately in monocot and dicot species, the sequences can be modified to accommodate the specific codon preferences and GC content preferences of monocots or dicots, as these preferences have been shown to be different (Murray et al, Nucl. acids Res.17: 477-498 (1989)). In addition, the nucleotide sequence can be screened for the presence of non-canonical splice sites that cause truncation of the message. All changes that need to be made in these nucleotide sequences, such as those described above, are carried out using the methods described in published patent applications EP 0385962 (Monsanto), EP 0359472 (Lubrizol) and WO 93/07278(Ciba-Geigy) using site-directed mutagenesis techniques, PCR and synthetic gene construction well known in the art.

Drawings

The invention will be described below with reference to the accompanying drawings.

Figure 1 shows transformation of pNGR5 against the background of wild type 9311, mutant ngr5, mutant ngr 5: : transgenic plants of NGR5 and mutant NGR5 background transformed pNGR 5: : ngr5 phenotype of transgenic plant under high nitrogen and low nitrogen conditions (A, B), tillering number under high nitrogen and low nitrogen strips (C), secondary branch number (D), spike number (E) and cell yield (F);

FIG. 2 shows the map-positional cloning (A) of the NGR5 gene and the changes in bases and amino acids caused by mutation (B);

FIG. 3 shows the effect of over-expressing NGR5 on tillering number (A), plant height (B), yield (C) in 9311 background;

FIG. 4 is a graph showing the results obtained in 9311-GRF4^ngr2Effect of over-expression of NGR5 on yield in background;

FIG. 5 shows the effect of overexpression of NGR5 gene on the expression level of a gene involved in nitrogen uptake and assimilation;

FIG. 6 shows the presence of 5 haplotypes of the NGR5 gene (A), and the effect of the 5 haplotypes on tiller number, yield (B);

FIG. 7 shows the gene expression levels of NGR5 for different haplotypes in different rice varieties;

FIG. 8 shows NGR5 at various nitrogen levels in the Gui Dynasty No. 2 background^Hap.1And NGR5^Hap.2The level of gene expression of (a);

FIG. 9 shows the results of the yeast two-hybrid experiment (A) of NGR5 with SLR1 and the results of the yeast two-hybrid experiment (B) of NGR5 with LC 2;

FIG. 10 shows NGR5 interacting with SLR1 in plants (A), NGR5 interacting with LC2 in plants (B);

FIG. 11 shows the phenotype of NJ6, NJ6-sd1, and NJ6-gid1-10 under high and low nitrogen conditions (A), and tillering number (B) results;

FIG. 12 shows the effect of SLR1, Rht-B1a, Rht-B1B on the stability of NGR5 protein;

figure 13 shows the transcript levels of NGR5 at different nitrogen concentrations;

FIG. 14 shows the effect on NGR5-HA protein accumulation at different nitrogen concentrations;

FIG. 15 shows gene expression levels of D14 and OsSPL14 under low nitrogen and high nitrogen conditions for wild type and ngr5 mutant;

FIG. 16 shows the binding relationship of NGR5 to the promoter and gene region of the D14 and OsSPL14 genes;

FIG. 17 shows the results of comparing phenotype (A) and tiller number (B) of WT, ngr5, D14, ngr 5D 14 double mutants and phenotype (C) and tiller number (D) of WT, ngr5, ospl 14, ngr5 ospl 14 double mutants;

FIG. 18 shows the phenotype of wild type 9311, mutant lc2 under high and low nitrogen conditions;

FIG. 19 shows gene expression levels of D14 and OsSPL14 (A), and H3K27me3 modification levels of D14 and OsSPL14 sites (B) for wild type and lc2 mutants under low nitrogen and high nitrogen conditions;

FIG. 20 shows the phenotype (A) and tiller number (B) comparisons of the WT, lc2, D14, D14 lc2 double mutants and the phenotype (C) and tiller number (D) comparisons of the WT, lc2, ospl 14, ospl 14 lc2 double mutants;

FIG. 21 shows gene expression levels of D14 and OsSPL14 under different nitrogen conditions for wild type and ngr5 mutant (A), and H3K27me3 modification levels at D14 and OsSPL14 sites (B).

Detailed Description

The invention is further described below with reference to specific examples, but it will be understood by those skilled in the art that the invention is not limited to these specific examples.

The experimental procedures in the following examples are conventional, unless otherwise specified. Reagents, kits and experimental instruments used in the experiment can be purchased from biological instruments and reagent companies without special instructions.

Example 1: cloning of rice tillering nitrogen response insensitive gene NGR5

The present inventors performed field phenotype screening of EMS mutagenic mutant library with 9311 background at different nitrogen application rates using two different nitrogen treatments (low nitrogen treatment and normal nitrogen fertilizer control group) with 4 rows of 6 plants per row planted in each plot. And (3) respectively inspecting agronomic character indexes such as plant height, tillering number, branch number, spike grain number, cell yield and the like to find out a mutant material which is insensitive or super-sensitive to nitrogen response.

Through genetic screening, we obtained a mutant ngr5 (fig. 1A) in which tiller number, branch number, spike number and cell yield were all insensitive to nitrogen response. Specifically, the ngr5 mutant showed significant increases in tiller number, branch number, ear number and cell yield under high nitrogen conditions in the 9311 compared to the wild type 9311, while the ngr5 mutant showed no significant changes in tiller number, branch number, ear number and cell yield under high nitrogen and low nitrogen conditions (fig. 1C-1F).

In order to further know the genetic control basis of promoting the growth and development of rice by nitrogen, the invention constructs a genetic population by hybridizing the ngr5 mutant and japonica rice variety lan Sheng (China Rice research institute). The gene is positioned between two SSR molecular markers RM18384 and RM19751 on chromosome 5 by a map-based cloning technology and is named NGR5 by the inventor (FIG. 2A).

In the following examples, the NGR5 candidate gene was actually determined by sequencing comparative analysis to be a known rice grain SIZE controlling SMOS1(SMALL organic SIZE1) gene encoding a transcription factor of the AP2 type. The inventor finds that G at the 658 th base of the NGR5 gene cDNA in the NGR5 mutant is mutated into A (figure 2B) through sequencing comparison analysis (NGR5 mutant can also obtain mutant material through the existing gene editing technology).

TABLE 2 primers and sequences for map-based cloning of the NGR5 gene

Example 2: genetic complementation of NGR5 gene and verification of response function of NGR5 gene in regulating and controlling rice tillering nitrogen element

The inventor designs the following primers according to the promoter sequence and cDNA sequence of NGR5 gene by the conventional molecular biology and genetic operation method:

primers for constructing the promoter of the NGR5 gene onto a vector (pCAMBIA2300, which is commercially available, for example, from Hippocampus bioengineering Co., Ltd.):

EcoRI-NGR 5-P-F: CGGAATTCTTACTATTAATCTAGTCTATTGC, as shown in SEQ ID NO: 248 is shown;

XmaI-NGR 5-P-R: ATACCCGGGGGCGCGCGCACGCAGCAGCAGC, as shown in SEQ ID NO: 249, respectively.

The primer when the coding sequence of the mutated NGR5 gene in the NGR5 gene or NGR5 mutant is constructed on a vector:

XmaI-5400E 1F: ATACCCGGGATGGCGTCCCCCGGCCCCGC, as shown in SEQ ID NO: shown as 250;

SalI-5400E 2R: CCAGTCGACTCACTCTTGACCATGGAATG, as shown in SEQ ID NO: 251, respectively.

The 9311 and ngr5 mutant DNA is used as a template, and a pCAMBIA2300 vector framework is used for respectively constructing pNGR 5: : NGR5 and pNGR 5: : ngr5 vector, transforming ngr5 mutant by agrobacterium-mediated method, and planting the positive transgenic plant under high nitrogen and low nitrogen conditions to observe the phenotype of the transgenic plant. The results show that the transformation of pNGR 5: : growth of NGR5 mutant material of NGR5 restored its response to nitrogen fertilizer (fig. 1A), while transformation of pNGR 5: : ngr5 the ngr5 mutant material was similar to the ngr5 mutant, and the tillering number, branch number, ear number and plot yield were all unresponsive to the amount of nitrogen fertilizer applied (FIG. 1B).

Example 3: increasing the expression level of NGR5 can increase the yield of rice and the utilization efficiency of nitrogen fertilizer.

The inventor designs the following primers according to the cDNA sequence of the NGR5 gene by the conventional molecular biology and genetic operation method:

kpn1-NGR 5-F: GGGGTACCATGGCGTCCCCCGGCCCCGC, as shown in SEQ ID NO: 252;

xba1-NGR 5-R: TGCTCTAGATCACTCTTGACCATGGAATG, as shown in SEQ ID NO: 253, as shown.

Using the pCAMBIA2300 vector backbone, p35S was constructed: : after the NGR5 vector and the agrobacterium-mediated method are used for transforming a high-yield rice variety 9311 to obtain a positive transgenic plant, the inventor plants wild type 9311 and p35S under different nitrogen application rates (60 kg/hectare, 120 kg/hectare, 210 kg/hectare and 300 kg/hectare): : an NGR5 positive transgenic line. The comparison shows that the over-expression of NGR5 can slightly reduce the plant height of rice under each nitrogen application condition, but obviously increase the tiller number and can improve the rice cell yield (figures 3A-3C).

Example 4: excellent allele OsGRF4^ngr2And NGR5 polymerization can further improve the rice yield and the utilization efficiency of nitrogen fertilizer.

On the basis, the inventor further uses the material 9311-GRF4 for high-efficiency utilization of nitrogen fertilizer^ngr2Background transformation of (WO 2019/158911a1) p35S described in example 3: : after the NGR5 vector obtains positive transgenic plants, the inventor plants 9311-GRF4 under different nitrogen application conditions (60 kg/hectare, 120 kg/hectare, 210 kg/hectare and 300 kg/hectare)^ngr2And 9311-GRF4^ngr2The field experiment result of the positive transgenic line under the background shows that the positive transgenic line is more than 9311-GRF4^ngr2The yield can be further increased (fig. 4).

Example 5: NGR5 positively regulates OsGRF4 expression and improves the expression level of nitrogen absorption and assimilation related genes.

The present inventors first analyzed the expression level of OsGRF4 in wild type 9311, NGR5 mutant, NGR5 over-expressed NGR5 transgenic material grown for 4 weeks in hydroponic conditions, and found that the expression level of OsGRF4 in NGR5 mutant was reduced compared to wild type, while the expression level of OsGRF4 in over-expressed NGR5 transgenic material was significantly increased, which indicates that NGR5 can positively regulate the expression of OsGRF4 gene (fig. 5A).

Further, the present inventors analyzed the expression levels of the nitrogen uptake assimilation-associated genes (AMT1.1, GS1.2, NRT1.1b, NRT2.3a, NiR1, GS2, NADH-GoGAT2, NIA1, NPF2.4), and as a result, it was revealed that the nitrogen uptake assimilation-associated genes were expressed at a higher level in the overexpressed NGR5 transgenic material than in the wild type (FIGS. 5B to 5J).

Quantitative PCR detection primer sequence

Example 6: mining and utilization of excellent allelic variation of NGR5

The present inventors performed haplotype analysis on SNPs of the 1kb promoter region, the gene region and the 3' non-coding region of NGR5 gene of 686 rice varieties (the institute of crop science, academy of agricultural sciences, China). The results showed that there were 5 different haplotypes (Haplotype), hap.1 (e.g., Nipponbare), hap.2 (e.g., Guichao No. 2), hap.3 (e.g., Xiangzao No. 2), hap.4 (e.g., Jinghu B), and hap.5 (e.g., 9311) (FIG. 6A). Counting the tillering number and the single plant yield of the rice varieties with different haplotypes, the tillering number and the yield of the rice variety with hap.2 are found to be obviously higher than those of the rice varieties with other haplotypes (FIG. 6B). Further studies showed that there were 3 specific SNP sites (i.e., g. -853T > G, g. -825T > C, g. -770G > A) for distinguishing between hap.2 type alleles.

On the basis, the inventor selects different varieties from 5 different haplotypes for qRT-PCR analysis (quantitative PCR primer sequence: NGR 5F: ACCTGCAACTGGACATG ACACA, shown as SEQ ID NO: 274; NGR 5R: GAAAAGAGGGTCCGCAG AAG, shown as SEQ ID NO: 275), and finds a rice variety carrying hap.2 haplotype (we name the excellent allelic variation thereof as NGR 5)^Guichao2) With higher transcription level of NGR5 (fig. 7).

Further, the inventor utilizes the background of Gui Dynasty No. 2 with NGR5^Hap.1The near isogenic line material of (4), detecting the gene expression level under different nitrogen levels. The results show NGR5^Hap.1Is significantly lower than NGR5 at each nitrogen level^Hap.2The gene expression level of (1) (FIG. 8).

The primer sequences used to identify 3 specific SNPs (G. -853T > G, G. -825T > C, G. -770G > A) were as follows:

pNGR 5-F: CGGTCCTCACATAGAGGCCA, as shown in SEQ ID NO: 276;

pNGR 5-R: GTTTCCTCGGAACGGCAAC, as shown in SEQ ID NO: 277 as shown.

Detecting the presence or absence of any one, two or all three specific SNPs selected from the group consisting of: g. -853T > G, G-825T > C, G-770G > A, while analyzing the coding region of the OsNGR5 gene for the presence of specific SNPs: g.3326C > T, and can judge whether the rice variety has the potential of high nitrogen fertilizer utilization rate and high yield.

Example 7: identification of NGR5 interacting protein

To further study the function of NGR5 gene, the present inventors constructed NGR5 on yeast double-hybrid vector pGBKT7 (commercially available, for example, from Youbao) by conventional molecular biology methods (primer sequence used for construction: Do-NGR 5-F1: GGGGACAAGTTTGT ACAAAAAAGCAGGCTCCATGGCGTCCCCCGGCCCCGC, as shown in SEQ ID NO: 278; Do-NGR 5-R1: GGGGACCACTTTGTACAAGAAAGCTGGG TCCTCTTGACCATGGAATG, as shown in SEQ ID NO: 279), used as bait protein, screened yeast library constructed from rice cDNA by yeast double-hybrid system using GAL4 as reporter gene, and found interacting protein SLR1 (important growth inhibitor of gibberellin signaling pathway) of NGR5 and LC2(LC2 is a subunit of PRC2 complex, and PRC2 complex can perform 3 methylation on K27 site of histone H3 by yeast double-hybrid screening, thereby inhibiting gene expression) (FIG. 9).

To further verify the interaction of NGR5 with SLR1 and LC2, the present inventors designed the following primers according to the cDNA sequences of SLR1(LOC _ Os03g49990), LC2(LOC _ Os02g05840) and NGR5 genes by conventional molecular biology manipulation methods:

Do-NGR 5-F2: GGGGACAAGTTTGTACAAAAAAGCAGGCTCCAT GGCGTCCCCCGGCCCCGC, as shown in SEQ ID NO: 280;

Do-NGR 5-R2: GGGGACCACTTTGTACAAGAAAGCTGGGTCCTC TTGACCATGGAATG, as shown in SEQ ID NO: 281;

Do-LC 2-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGG ATCCACCCTACGCAGGAGTA, as shown in SEQ ID NO: 282, respectively;

Do-LC 2-R: GGGGACCACTTTGTACAAGAAAGCTGGGTCATGCC AAAGTTCCATGCAGAAACC, as shown in SEQ ID NO: 283 is shown;

Do-SLR 1-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATG AAGCGCGAGTACCAAGA, as shown in SEQ ID NO: 284;

Do-SLR 1-R: GGGGACCACTTTGTACAAGAAAGCTGGGTCCGCCG CGGCGACGCG, as shown in SEQ ID NO: 285, respectively.

Constructing nYFP-NGR5, cYFP-LC2 and cYFP-SLR1 plasmids by using pCAMBIA2300 vector skeleton, transforming agrobacterium, picking monoclonal shake bacteria, and then using resuspension buffer (150 mu M acetosyringone, 10mM MgCl. sub.L. sub.₂pH 5.7 in 10mM MES-KOH), OD600 of the bacterial suspension of nYFP and cYFP vectors was 1.0, OD600 of p19 was 0.5. After standing for 3 hours, nYFP, cYFP and p19 were mixed at a ratio of 5: 2 and injected subcutaneously into the lower surface of 3-week-old tobacco using a 1mL syringe. After 2-3 days of injection, the interaction was observed using a confocal laser microscope. Experimental results show that NGR5 is able to interact with SLR1 and LC2, respectively (fig. 10).

Example 8: the multi-tillering character of the semi-dwarf 'green revolution' rice variety is formed depending on the existence of NGR5

The 'green revolution' characterized by semi-dwarf breeding greatly improves the rice yield, and the core is that the accumulation of DELLA proteins in rice bodies is caused by the mutation of gibberellin synthetic gene SD1(LOC _ Os01g66100), thereby reducing the plant height, improving the tillering capability of the rice, improving the lodging resistance capability and finally improving the yield.

To further clarify the function of NGR5 in DELLA protein regulation of rice tillering. The inventor designs a primer Do-GID1-F GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGCCGGCAGCGAC GAGGT as shown in SEQ ID NO: GID GGGGACCACTTTGTA CAAGAAAGCTGGGTGTAGTAGAGGTTAGCGTTGAG 6, a primer Do-Do 6342-SD 5842-F GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGCCGGCAGCGAC GAGGT as shown in SEQ ID NO: Do-Do 6342 as shown in SEQ ID NO: 5928, a primer AMA 599 as shown in two groups of vectors constructed by using different concentrations of GID 639 and AMD 599 as shown in two groups of vectors AMA 599 respectively, by using a high-stalk rice variety carrying SD1 sites and derived from China Rice institute, NJ6-SD1 (a near-isogenic line material obtained by introducing SD1 gene into Nanjing 6 background by genetic hybridization), NJ6-GID1-10 (Guangdong farm college), NJ6-SD1-ngr5 (a near-isogenic line material obtained by further introducing ngr5 gene into NJ6-SD1 by genetic hybridization) and a transgenic material over-expressing GID 1(LOC _ Os05g33730) as shown in NJ 1 background by conventional molecular biology operation method according to GID1 gene cDNA sequence Under conditions and simultaneously with 1. mu.M gibberellin treatment. The results show that the tillering numbers of the SLR1 protein high-level accumulated NJ6-SD1 and NJ6-GID1-10 are more than those of NJ6-SD1 under high nitrogen and low nitrogen conditions, while the tillering numbers of the GID1 transgenic material over-expressed in the NJ6-SD1 background and the gibberellin-treated NJ6 and NJ6-SD1 material are less than those of the control group under the high nitrogen and low nitrogen conditions, which indicates that the high-level accumulation of the SLR1 protein can promote the increase of the rice tillering numbers. However, NJ6-sd1-NGR5 was the less tillering phenotype under both high and low nitrogen treatment conditions, suggesting that the function of SLR1 protein in promoting rice tillering increase was dependent on NGR5 (FIG. 11).

Example 9: high-level accumulation of SLR1, Rht-B1a and Rht-B1B proteins increases the stability of NGR5 protein

Examples 3 and 8 mention that increasing both NGR5 and SLR1 promotes the production of rice tillers. The inventor utilizes an in vitro protein degradation experiment to confirm the biological significance of the interaction between the SLR1 and the NGR5 and further confirms that the DELLA proteins (Rht-B1a and Rht-B1B) from wheat have similar functions with the rice DELLA protein (SLR 1).

The specific method comprises the following steps: in vitro protein degradation buffer (25mM Tris-HCl, pH7.5, 10mM NaCl, 10mM MgCl)₂4mM PMSF, 5mM dithioreitol, 10mM ATP) to extract the total protein of the leaf of Nanjing No. 6 rice growing for 4 weeks in the field as a reaction system. Adding GST-NGR5 fusion protein after the above extractive solution is subjected to allelic state, and respectively adding 50 μ MMG132, SLR1-Flag, Rht-B1a-Flag, and Rht-B1B-Flag. The reaction was stopped at 0, 3, 6 and 9 minutes, and the change of GST-NGR5 fusion protein was detected by Western blot. The results show that SLR1-Flag, Rht-B1a-Flag and Rht-B1B-Flag can all increase the stability of GST-NGR5 protein (FIG. 12). This also suggests that NGR5 is conserved in function in rice and wheat.

Example 10: the expression level and protein level of NGR5 gene are positively regulated by nitrogen

The inventors utilizedA nitrogen concentration gradient (0N, 0.2N 0.25mM NH)₄NO₃，0.6N 0.75 mM NH₄NO₃And 1N 1.25mM NH₄NO₃) The 9311 and ngr5 mutants were cultured in the nutrient solution. Total RNA was extracted from 9311 and NGR5 mutant leaves hydroponically cultured for 4 weeks, and the transcript levels of NGR5 in the 9311 and NGR5 mutants were analyzed by quantitative PCR. The results showed that with the increase of nitrogen concentration in the nutrient solution, the transcription level of NGR5 in 9311 increased with the increase of nitrogen concentration, while the expression change of NGR5 gene was hardly detected in NGR5 mutant (fig. 13).

The inventors utilized four nitrogen concentration gradients (0N, 0.2N 0.25mM NH)₄NO₃，0.6N O.75 mM NH₄NO₃And 1N 1.25mM NH₄NO₃) Culturing 9311 background over-expression NGR5-HA transgenic plants. Total protein is extracted from leaves of NGR5-HA transgenic plants with 9311 backgrounds cultured in water for 4 weeks, and the protein accumulation level of NGR5-HA is analyzed by Western-blot. The results showed that NGR5-HA protein accumulated with increasing nitrogen concentration (figure 14).

Example 11: NGR5 mediates the response of rice tillering nitrogen by regulating the expression of D14 and OsSPL14 genes.

The inventors found that the gene expression levels of D14 and OsSPL14(D14 and OsSPL14 are negative regulators of rice tillering) in wild-type 9311 were inhibited by nitrogen, but were highly expressed and not inhibited by nitrogen in ngr5 mutant (FIG. 15) (the quantitative PCR primers used were D14F: ACGTGATGATCTGCGTGATGCC as shown in SEQ ID NO: 288, D14R: GGCTTTGGTTTGGCCAGCTAAC as shown in SEQ ID NO: 289, OsSPL 14F: TGCTGCCTGAATTTGACCAAGG as shown in SEQ ID NO: 290, and OsSPL 14R: TTCTGAACCTGCGATGCTCACC as shown in SEQ ID NO: 291). Through ChIP-PCR and EMSA experiments, NGR5 can be directly combined at the D14 and OsSPL14 sites (FIG. 16).

Furthermore, the inventor hybridizes the NGR5 mutant and the D14 mutant (China Rice research institute) to obtain a double-mutant material of NGR5 and D14 genes, hybridizes the NGR5 mutant and the OsSPL14 mutant (obtained by knocking out the OsSPL14 gene through a conventional gene editing technology in the 9311 background) to obtain a double-mutant material of NGR5 and OsSPL14 genes, and the tillering number of the NGR 5D 14 double-mutant is almost consistent with that of the D14 mutant through counting the tillering number, and the tillering number of the NGR5OsSPL14 double-mutant is almost consistent with that of the OsSPL14 mutant. This suggests that both D14 and OsSPL14 can inhibit the NGR5 mutant from the phenotype of few tillers, i.e., D14 and OsSPL14 are genetically located downstream of NGR5 (fig. 17).

Example 12: LC2 participates in the regulation of rice tillering nitrogen response by regulating the modification level of D14 and H3K27me3 of OsSPL14 locus.

The inventors planted wild-type 9311 and LC2 mutants (obtained by knocking out LC2 gene by conventional gene editing technology in 9311 background) under high nitrogen and low nitrogen conditions, respectively, and found that nitrogen promoted the increase in 9311 tillering number, while the tillering of LC2 mutant lost response to nitrogen, which indicates that LC2 is a key gene of rice tillering response to nitrogen (fig. 18).

Further, the present inventors compared the expression changes of D14 and ospl 14 genes by quantitative PCR using 9311 and lc2 mutants planted at different nitrogen levels, and found that the expression of D14 and ospl 14 genes was inhibited by nitrogen in 9311, while the expression of D14 and ospl 14 genes was consistently highly expressed and not inhibited by nitrogen in lc2 mutants (fig. 19).

Further, the inventor hybridizes the LC2 mutant with the D14 mutant and the osppl 14 mutant respectively to obtain double-mutant materials of LC2 and D14 and LC2 and OsSPL14, and counting tillering numbers can see that the tillering number of the LC 2D 14 double-mutant is almost consistent with that of the D14 mutant, and the tillering number of the LC2 ospl 14 double-mutant is almost consistent with that of the osppl 14 mutant. This suggests that both D14 and OsSPL14 inhibited the LC2 mutant from the less tillering phenotype, i.e., D14 and OsSPL14 were genetically located downstream of LC2 (fig. 20).

Example 13: NGR5 regulates and controls the H3K27me3 modification level of D14 and OsSPL14 locus to realize the rice tillering nitrogen response.

The present inventors compared the expression changes of D14 and ospl 14 genes by quantitative PCR using 9311 and ngr5 mutants planted at different nitrogen levels, and found that the expression of D14 and ospl 14 genes was suppressed by nitrogen in 9311, whereas the expression of D14 and ospl 14 genes was consistently highly expressed and not suppressed by nitrogen in ngr5 mutants (fig. 21A).

Next, the present inventors compared the H3K27me3 modification levels of D14 and OsSPL14 sites at different nitrogen levels by ChIP-PCR using 9311 and ngr5 mutants planted at different nitrogen levels, and found that the H3K27me3 modification levels of D14 and OsSPL14 sites were induced by nitrogen, whereas the H3K27me3 modification levels of D14 and OsSPL14 sites were not induced by nitrogen in the ngr5 mutant. The above experiments demonstrated that nitrogen-mediated regulation of the level of modification of H3K27me3 at the D14 and ospl 14 sites was dependent on NGR5 (fig. 21B).

It should be noted that the above-mentioned embodiments are only for explaining the present invention, and do not constitute any limitation to the present invention. The present invention has been described with reference to exemplary embodiments, but the words which have been used herein are words of description and illustration, rather than words of limitation. The invention can be modified, as prescribed, within the scope of the claims and without departing from the scope and spirit of the invention. Although the invention has been described herein with reference to particular means, materials and embodiments, the invention is not intended to be limited to the particulars disclosed herein, but rather extends to all other methods and applications having the same functionality.

Sequence listing

SEQ ID NO：1：

SEQ ID NO：2：

SEQ ID NO：3：

SEQ ID NO：4：

SEQ ID NO：5：

Claims (11)

1. Use of a protein for controlling nitrogen use efficiency and crop yield for increasing nitrogen use efficiency and crop yield, wherein the protein comprises one of the amino acid sequences selected from the group consisting of:

1) SEQ ID NO: 2;

2) substitution, deletion and/or insertion of one or more amino acid residues with SEQ ID NO: 2, but the activity of the polypeptide is different from that of the polypeptide shown in SEQ ID NO: 2, and the amino acid sequence is the same as the protein consisting of the amino acid sequence shown in the figure;

3) and SEQ ID NO: 2, and which has at least 70%, preferably at least 80%, more preferably at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 2, and the amino acid sequence is the same as the protein consisting of the amino acid sequence shown in the figure;

4) an active fragment comprising the amino acid sequence of any one of 1) to 3).

2. The use according to claim 1, wherein the nucleotide sequence of the gene encoding the protein for controlling nitrogen use efficiency and crop yield comprises one selected from the group consisting of:

1) SEQ ID NO: 1;

2) substitution, deletion and/or insertion of one or more nucleotide sequences corresponding to SEQ ID NO: 1, but the activity of the encoded protein is different from that of the protein shown in SEQ ID NO: 1, the activity of the protein coded by the nucleotide sequence shown in the figure is the same;

3) and SEQ ID NO: 1, and the activity of the encoded protein is at least 70%, preferably at least 80%, more preferably at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 1, the activity of the protein coded by the nucleotide sequence shown in the figure is the same;

4) due to the degeneracy of the genetic code, the sequence of SEQ ID NO: 1 different nucleotide sequences;

5) an active fragment comprising a nucleotide sequence of any one of 1) to 4).

3. A method of growing a crop with high nitrogen utilization and high yield, the method comprising: transfecting a nucleotide sequence of the gene encoding the protein for controlling nitrogen use efficiency and crop yield according to claim 2 into a crop cell to obtain a transgenic crop plant, so that the expression level of the gene encoding the protein for controlling nitrogen use efficiency and crop yield according to claim 2 in the transgenic crop plant is increased, thereby obtaining a crop plant having high nitrogen use efficiency and high yield, wherein the crop plant is a monocotyledon, preferably rice or wheat, more preferably rice.

4. A method of growing a crop with high nitrogen utilization and high yield, the method comprising: co-expression of GRF4 in crop plants^ngr2A gene encoding the protein for controlling nitrogen use efficiency and crop yield of claim 2 or a superior allele thereof, or a gene carrying OsGRF4^ngr2A gene encoding the nitrogen use efficiency and crop yield controlling protein of claim 2, wherein the gene encoding the nitrogen use efficiency and crop yield controlling protein of claim 2 is OsNGR5 gene, and the superior allele thereof is OsNGR5 gene, or an excellent allele thereof, is overexpressed in a crop plant thereof^Guichao2The gene, the crop is monocotyledon, preferably rice or wheat, and more preferably rice.

5. The method of claim 4, wherein the superior allele OsNGR5^Guichao2The promoter region of the gene has 3 specific SNPs sites: g. 853T > G, G-825T > C, G-770G > A), which can increase OsNGR5^Guichao2The level of transcription of the gene.

6. A method of growing a crop with high nitrogen utilization and high yield, the method comprising: will contain OsNGR5 as claimed in claim 5^Guichao2Crossing a crop plant of the gene with another plant of the crop to produce a hybrid crop plant, such that OsNGR5 is present in the hybrid crop^Guichao2The expression quantity of the gene is increased, and the crop with high nitrogen fertilizer utilization rate and high yield is obtained, wherein the crop is rice.

7. A method of identifying a rice variety with high nitrogen utilization and high yield, the method comprising: analyzing the promoter region of the OsNGR5 gene for the presence of any one, two or all three specific SNPs selected from the group consisting of: g. 853T > G, G-825T > C, G-770G > A, and analyzing the gene region of OsNGR5 gene for the presence of specific SNPs: g.3326C > T, to determine whether the rice variety has the potential of high nitrogen utilization and high yield.

8. The method according to claim 7, wherein the SNPs of the promoter region and the coding region of the OsNGR5 gene are detected by PCR amplification digestion or sequencing.

9. The nucleotide sequence of the gene for controlling the nitrogen utilization rate and the crop yield is shown as SEQ ID NO: 4, respectively.

10. A recombinant construct comprising the gene of claim 9.

11. Host cell comprising the gene according to claim 9 or the recombinant construct according to claim 10, wherein the host cell is a microbial cell, preferably an e.

Images