CN111996181A

CN111996181A - Application of DRK protein and coding gene thereof in drought resistance of plants

Info

Publication number: CN111996181A
Application number: CN202011003964.3A
Authority: CN
Inventors: 巩志忠; 王瑜; 孙志慧
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2020-09-22
Filing date: 2020-09-22
Publication date: 2020-11-27
Anticipated expiration: 2040-09-22
Also published as: CN111996181B

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to application of DRK protein and a coding gene thereof in drought resistance of plants. The invention discovers that after the expression of the DRK gene is inhibited, the mutant plant growth is obviously better than that of the wild type under the drought treatment condition, and the water loss rate and the leaf wilting degree are obviously lower than those of the wild type, so that the function of inhibiting the gene can obviously enhance the drought resistance of the plant, gene resources are provided for cultivating and improving new varieties of drought-resistant plants, and theoretical basis is provided for clarifying the molecular mechanism of MAPKKK protein kinase in plant drought stress signal response.

Description

Application of DRK protein and coding gene thereof in drought resistance of plants

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to application of DRK protein and a coding gene thereof in drought resistance of plants.

Background

Corn is one of three major food crops in the world, and the planting area is wide. Different climatic conditions such as temperature, humidity, wind power and the like in different areas can affect the planting and yield of the corn, wherein drought is one of the most important factors affecting the yield of the corn. When drought stress is applied to the seedling stage of the corn, the growth and development of the corn are inhibited, so that the corn plants are dwarfed, the leaves are wilted and the photosynthesis is reduced. Drought during the filling stage of corn can result in incomplete kernels and reduced yield. Therefore, improving the drought resistance of corn is crucial to the yield of corn. By means of gene engineering, the novel drought-resistant variety is cultivated by utilizing gene overexpression and mutation, and the method has important significance for improving the yield of crops under adverse circumstances and solving the problem of grain shortage caused by environmental stress. Meanwhile, the transgenic overexpression and gene editing technology can also be used for basic research work, the biological function of the gene is clarified, and a theoretical basis is provided for better applying the gene resources to new variety cultivation.

MAPK (mitogen-activated protein kinase) protein kinase cascade reaction participates in a plurality of biological processes, and is a clear class of signal transmission process which is researched at present. After the receptor is activated by external stimulation signals such as biotic or abiotic stress, the downstream MAPK cascade reaction can be activated. The MAPK cascade reaction consists of three protein kinases, namely MAPKKK (MAPK kinase), MAPKK (MAPK kinase) and MAPK (MAP kinase), wherein MAPKKK can phosphorylate MAPK, phosphorylated MAPKK can phosphorylate MAPK, and phosphorylated MAPK can phosphorylate cytoplasmic or nuclear effect proteins so as to transmit signals to the downstream. The substrate of MAPK and the specificity of MAPK signaling are the major directions of current research. MAPKKKs in plants are mainly classified into three groups: ZIKs, MEKKs, RAF-like MAPKKKKs, 80 MAPKKKKs in model plant Arabidopsis thaliana, 48 of them, 74 MAPKKs in maize, and 46 of them. Studies have shown that RAF-like MAPKKKs play an important role in plant growth and development and in response to biotic and abiotic stresses. In arabidopsis thaliana, there are many reports related to RAF protein kinases, such as that CTR1 participates in the transduction of ethylene signal pathway, RAF5 participates in high salt and high sugar response, LIK1 participates in processes such as ion permeation and regulation of transporter, RAF10 and RAF11 participate in seed germination and ABA response, and RAF19 participates in studies such as carbon dioxide signal pathway. In summary, some researches on RAF-like MAPKKK protein have been carried out in plants at present, but mainly in Arabidopsis thaliana, which is a dicotyledonous plant, relatively few researches and reports on the function of the gene in maize are carried out, and particularly, the role of the protein kinase in maize drought response signal transmission is still to be studied further.

The yield of the corn is easily influenced by drought stress, and the improvement of the drought resistance of the corn by a genetic engineering method has important significance for protecting the yield of the corn. With the completion of genome sequencing of maize inbred lines such as B73 and Mo17, the genetic background of maize is clearer. Meanwhile, inbred lines which are easy to be genetically transformed are continuously sequenced and developed, so that the efficiency of transgenic overexpression and gene editing technology is greatly improved, for example, LH244 inbred lines provide important guarantee for improving the drought resistance of corns by means of gene engineering, and have application value for reducing the yield reduction of corns caused by abiotic stress such as drought and the like.

Disclosure of Invention

Through research and screening of mutant strains of a series of genes, the invention discovers that the DRK protein and the coding gene thereof have obvious influence on the drought resistance of plants (particularly corns). Based on the discovery, the invention provides application of the DRK protein and the coding gene thereof in drought resistance of plants.

Specifically, the invention firstly provides the application of the DRK protein, or the transcript thereof, or the coding gene thereof, or the inhibitor thereof, or the biological material containing the coding gene or the inhibitor thereof in regulating and controlling the drought resistance of plants.

The invention also provides application of the DRK protein, or a transcript thereof, or a coding gene thereof, or an inhibitor thereof, or a biological material containing the coding gene or the inhibitor thereof in regulating and controlling the water loss degree of plant leaves.

The invention also provides application of the DRK protein, or the transcript thereof, or the coding gene thereof, or the inhibitor thereof, or biological materials containing the coding gene or the inhibitor thereof in regulating and controlling the wilting degree of plants.

The invention also provides application of the DRK protein, or a transcript thereof, or a coding gene thereof, or an inhibitor thereof, or biological materials containing the coding gene or the inhibitor thereof in breeding plants with improved drought resistance.

Preferably, by inhibiting the expression of the gene encoding the DRK protein, at least one of the following objects is achieved:

(1) improving the drought resistance of the plants;

(2) the water loss degree of the leaves is reduced;

(3) reducing leaf wilting degree.

Preferably, the DRK protein has an amino acid sequence of any one of:

1) an amino acid sequence shown as SEQ ID NO. 2; or the like, or, alternatively,

2) the amino acid sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 2.

Preferably, the gene encoding the DRK protein has any one of the following nucleotide sequences:

(1) the nucleotide sequence shown in SEQ ID NO.1, or,

(2) the coding nucleotide sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO. 1; or the like, or, alternatively,

(3) a nucleotide sequence which can be hybridized with the nucleotide sequence shown in SEQ ID NO.1 under strict conditions.

The DRK gene of corn consists of 3405 bases, only one transcript of T01 is available at present, and the reading frame of the transcript is from 1112 th to 2609 th bases of 5' end. The gene consists of 3 exons, the reading frame comprises 1 st to 507 th bases, 650 th to 1105 th bases, 1427 th to 1498 th bases, and the rest is the intron sequence. The gene is derived from corn type B73 and is numbered GRMZM2G018280 in a corn genome database. Since the same DNA segment sequence in maize can produce different transcripts and translate into different proteins, the different transcripts produced by the segment sequence and the translated different proteins are all within the scope of the present invention. Because the genotypes of different inbred lines of the corn have natural variation, the basic groups or amino acids of the genes in the different inbred lines can be different, and the invention is within the protection scope.

In some embodiments, the biological material is an expression cassette, a vector, a host cell, or a recombinant bacterium.

Preferably, the plant is a monocotyledonous plant; more preferably corn.

The invention further provides a method for constructing drought-resistant transgenic corn, and the expression of the coding gene of the DRK protein in the corn is inhibited.

Preferably, the encoding gene of the DRK protein is edited in the corn by the CRISPR/Cas9 technology, so that the expression of the encoding gene is inhibited;

in a preferred embodiment, the method of the invention comprises: designing an editing target of a DRK gene by using a website, designing a primer according to the target, constructing a CRISPR/Cas9 vector through a series of processes such as PCR, enzyme digestion, connection and the like, transferring the vector into agrobacterium, infecting a young maize embryo with the agrobacterium to obtain a transformed seedling, identifying and screening a positive plant by using a herbicide and PCR, extracting DNA of a mutant plant, and sequencing to obtain the mutant with a mutation site. The mutants were subjected to selfing and breeding and then to drought treatment experiments. The DRK gene can be edited by more than one target, and the edited mutant gene can generate one or more nucleotide additions or deletions, so that the partial deletion or early termination of the protein can be caused, wherein some mutations can influence the biological function of the protein. Mutant plants expressing non-functional proteins that produce a phenotype responsive to drought stress are within the scope of the claimed invention. After obtaining the mutant, detecting the phenotype of the DRK mutant under drought treatment, including seedling stage drought treatment, water loss rate and the like.

Preferably, in the CRISPR/Cas9 technology, the edited target is one or more of the nucleotide sequence from position 2165 to position 2183 of SEQ ID NO. 1.

The genetic stability is stronger after the Cas9 background is removed by selfing, and the stable inheritance can be realized among different generations.

Based on the scheme, the invention has the following beneficial effects:

(1) after the DRK gene expression provided by the invention is inhibited, the mutant plant growth is obviously better than that of a wild type under the drought treatment condition, and the water loss rate and the leaf wilting degree are obviously lower than those of the wild type, so that the inhibition of the gene expression can obviously enhance the drought resistance of the plant, provide gene resources for cultivating and improving new varieties of drought-resistant plants, and provide a theoretical basis for clarifying a molecular mechanism of MAPKKK protein kinase in plant drought stress signal response.

(2) Compared with the traditional breeding mode, the method for breeding the drought-resistant plant has the advantages of short breeding time, strong purposiveness and the like, obviously shortens the breeding period and improves the efficiency of drought-response breeding.

Drawings

FIG. 1 is a nucleotide sequence of DRK gene in example 1 of the present invention.

FIG. 2 shows the maize DRK CRISPR-Cas9 mutation site in example 2 of the present invention.

FIG. 3 is a photograph of the growth of plants after drought treatment of the control and DRK CRISPR-Cas9 mutant lines in example 3 of the present invention.

FIG. 4 shows the water loss of leaves of control and DRK CRISPR-Cas9 mutant strain ex vivo in example 4 of the present invention.

In FIGS. 2 to 4, WT represents a wild-type strain, and DRK CRISPR represents a strain inhibiting the expression of DRK gene.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

The transcript and the target for editing used in the examples are only examples and do not limit the editing sites in the application.

The corn ecotype used in the examples was B73; the agrobacterium strain is EHA 105. pBUE411C as a vector was from the Chengjun laboratory publication of Chinese agriculture university (Xing et al, A CRISPR/Cas9 toolkit for multiplex genome editing in plants (2014) BMC Plant biology.14: 327). The main reagents comprise: restriction enzymes, DNA polymerases, T4 ligases, etc. from biological companies such as NEB and Toyobo; reverse transcription kit from Thermo corporation; RNA extraction kit from magenta; quantitative PCR reagents of Takara corporation; the plasmid extraction kit and the DNA recovery kit are purchased from Tiangen corporation; MS culture medium, agar powder, agarose, ampicillin, kanamycin, gentamicin sulfate, rifampicin and other antibiotics are purchased from sigma; the various other chemical reagents used in the examples were all imported or domestic analytical reagents; primer synthesis and sequencing was done by invitro.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or instruments used are conventional products available from regular distributors, not indicated by the manufacturer.

Example 1 construction and detection of CRISPR/Cas9 Gene editing vectors

In order to research the molecular mechanism of RAF MAPKKK family protein in plant drought resistance, the invention utilizes CRISPR/Cas9 technology to directionally mutate DRK gene (nucleotide sequence is shown as SEQ ID NO.1, and amino acid sequence is shown as SEQ ID NO. 2) from the genome of corn (Zea mays L.). Firstly, logging in a website http:// www.genome.arizona.edu/criprpr/CRISSPRsearch. html, and screening a target point. The sequence is shown in FIG. 1, the T01 transcript is from 1112 th to 2609 th bases of the 5' end, the capital letters are bold and are the exon, the start codon and the stop codon are in gray frame, and the underlined part is the target.

The primers used were as follows:

ID-1f：GGCGCGTCATGCCCTGGAACGGG(SEQ ID NO.3)；

ID-1r：AAACCCCGTTCCAGGGCATGACG(SEQ ID NO.4)。

the vector construction method comprises the following steps:

(1) annealing: and diluting the primers, and then carrying out gradient annealing to anneal the primers into double chains.

(2) The specific reagents and parameters for vector digestion are shown in Table 1 below.

TABLE 1

(3) The linking system is shown in Table 2 below.

TABLE 2

(4) 5 μ l of the product of the enzyme digestion-ligation system was taken and transformed into E.coli competence. Screening was performed on LB plates containing 50. mu.g/mL kanamycin. And (5) identifying the single clone by colony PCR, and selecting a positive clone for sequencing. Colony PCR primers were:

ID-1f：GGCGCGTCATGCCCTGGAACGGG(SEQ ID NO.3)；

ID-1r：AAACCCCGTTCCAGGGCATGACG(SEQ ID NO.4)。

the sequencing primer is as follows: OsU3-FD 3: GACAGGCGTCTTCTACTGGTGCTAC (SEQ ID NO. 5).

Example 2 construction and identification of the DRK Gene CRISPR-Cas9 plant

The correctly sequenced plasmid constructed in example 1 was transformed into competent Agrobacterium EHA105 strain by heat shock and positive clones were identified by colony PCR. Inoculating single colony of Agrobacterium identified correctly in 2-3mL liquid culture medium containing 100 μ g/mL kanamycin and 50 μ g/mL rifampicin, shake culturing at 28 deg.C overnight, inoculating to liquid culture medium containing large amount of antibiotics the next day, shake culturing, collecting thallus after several times of inoculation, and resuspending to OD₆₀₀Between 0.8 and 1.0. And infecting the young B73 corn embryo picked out under aseptic condition with the obtained recombinant agrobacterium suspension, and inducing the young corn embryo to be callus and become seedlings. Sequencing revealed that the single base deletion mutation in this example caused a frame shift (FIG. 2), leading to premature termination of protein translation and disruption of protein function. The mutant is bred to obtain T2 generation plants, and can be used for drought treatment and phenotype observation. In order to prevent mutation again, the mutants selected after sequencing can be subjected to selfing, Cas9 is removed, and the stable mutants are obtained and then subjected to drought treatment.

Example 3 DRK mutant maize drought treatment phenotype detection

Adding 140g soil into each small pot, adding water into the tray, placing 4 seeds in each small pot, and covering 50cm³Removing residual water from tray after water absorption, removing one seedling with uneven growth after emergence of seedlings, adding 1L of water into tray, removing water after full absorption, starting drought treatment, observing control and mutantPlant drought-treated phenotype. Control and mutant plants were replicated in 3 pots each. FIG. 3 shows that DRK CRISPR/Cas9 mutant plants have better growth status than the control and lower leaf wilting degree than the control, which indicates that the mutant plants have drought resistance than the control.

Example 4 measurement of Water loss from isolated leaves of DRK Gene CRISPR/Cas9 mutant maize

Growing the wild type and DRK CRISPR mutant plants in a greenhouse at 25 ℃ for 12 days, respectively taking the second leaf, repeating every three leaves, and weighing the fresh weight by using a ten-thousandth electronic balance; after standing at room temperature for 0.5, 1, 2, 3, 4, 5, 6, 7, 8 hours, the mixture was weighed. Calculating the water loss rate: water loss rate (initial weight-weight after water loss)/initial weight x 100%. Three replicates of wild type and CRISPR were performed for each experiment, three independent replicates. And (5) preparing a water loss curve according to the water loss rate and the time. FIG. 4 shows that the water loss rate of the PP84 CRISPR mutant plant is obviously lower than that of the wild type, which indicates that the mutant has drought resistance.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

<120> DRK protein and application of coding gene thereof in drought resistance of plants

<130> KHP201115927.8

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3405

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ttcaaatagt cctctggcga gcgtttgcgt tcacctttcc tgtctcccct tcaccagaaa 60

tggagagata tatctcgaac aaaaatggcg agacatgacc aaatgacgca ttcgctgatg 120

ccatacggtc ggcggcacgt cgtccttgcc acagaacgca ctccaagccg atcagtggat 180

tcggaactac gtagagagag tgcctttcag gtttcaggct ttcagcacca ccctttctcg 240

acgcatttta cgcttagcgt ctcgctgcag tgtcatgtca tcccagcttt ttccttgtgt 300

ttttgtctcc tttttccatt gcagatatca tttttcccgc ctccccggca ctttctccag 360

cggctacgca gctggggcct gggggtgggg ggcgggcgat cgatcagatg agaagcagag 420

ccgatctagg ctctggaaga cgtcgaaaag gtgcggcctt ttctgaactg catcttcacg 480

agacatcctt gagcagagca ccttttactc tctcctccag cggtccagcc tatccccgcg 540

gtctggggtc aacaacagta caccgtacca gagcttctca agggtgccag agacggagag 600

gagaggagga ctcgaggagg aacaaggaga gctagccgct agcgtcccct tcttcccgct 660

gcgcctgcgc gtgcctgcct ttattcgctt tcgtgccgtt ttgcatcctc ccagaagctc 720

gcatcggata gcagctgggt ccgtgccacg cgcgcatgct ttgtggatag ggtagcgaac 780

ccggccggcc cccagtacgt acgctggatt attgcgtagg catctatccg ggcgttgctt 840

gcatggtcgt aggagtttgg gatcttgttt agcttgatgc tttgatttaa ttccttgtga 900

cctgtaatta agcatatcgt gagagtggtg gtggacggac gcggcggcgc ggtgagcaat 960

gcccgtggag gtggcgcggg cgtcgtccgg cgtgtcgcaa cgtcgtcgat cgcgttggta 1020

gcgcagtagt gccgtagtgg taccgacgcc ggccaaacat gccgtgtgcg acgtcgtgct 1080

cctgctgcga atcttgatcc tggcgcccca catgctctcc tgcttccggc tgccgcggcc 1140

ggtcggcggc ggcggcgggg acgcggacca gcaggccgcg gcggtgtctc cccggcgggg 1200

gccgtcgctg ccgttcgcgg cgagcctgtt cgctgcgtcc ccgtcgacgt cgacgtcggg 1260

gcgcgggagg agcgcgtggc cgccggaggc ggacggcatg gagaagaagc ggtgggacag 1320

catggagtcg tggtccatgc tgctggacac ggtgatgggg tccggcggcg aggggtcgtc 1380

ccgggacagc gggcggcggg aggagtggat ggccgacctg tcgcagctct tcatcggcaa 1440

caagttcgcg tcgggcgcca acagccgcat ctaccgcggc atctacaagc agcgcgccgt 1500

ggccgtgaag atggtgcgca tcccggagcg cgacgaggcc cggcgcgccg agctcgagga 1560

gcagttcaac tccgaggtcg ccttcctctc ccgcctctac caccccaaca ttgtgcaggt 1620

aggtacccgg tcgatgattc tcggcttgtc gtgttcgtgc gtgcatgcat ccaccagctc 1680

gtgactgcag atcgatcgac tgacaggcaa atgccacgta tccatttgcg ttgttgtgta 1740

cactacgtac gtgcgtgcag ttcatcgcgg cgtgcaagaa gccgccggtg tactgcatca 1800

tcacggagta catgtcccag gggacgctgc ggatgtacct gaacaagaag gacccctact 1860

cgctgtcggc ggagacgatc ctgaagctgg cgctggacat ctcgcgcggc atggagtacc 1920

tgcacgcgca gggcgtgatc caccgggacc tcaagtccca gaacctgctg ctcaacgacg 1980

agatgcgcgt caaggtggcc gacttcggca cctcctgcct ggagaccaag tgccaggcca 2040

ccaagggcaa caagggcacc taccggtgga tggcgccgga gatgaccaag gagaagccct 2100

acacgcgcaa ggtggacgtg tacagcttcg gcatcgtgct ctgggagctc accacctgcc 2160

tcctcccgtt ccagggcatg acgccggtgc aggccgcgta cgccgcgtcg gagaaggttg 2220

ggttcccttt ttttctccgc ttccgtttcg gtggatgata tgatcttctc tttctctttc 2280

tctttctctt tgggaacgct gattcctgat gattgtgtgc gtttgtctgt ttgtttgttc 2340

atggatcatc atatcagaac ctgcgcccgc cgctgtcgag ctcgtgcccg ccggtgctca 2400

acaacctgat caagaagtgc tggtcggcga acccggcgcg gcggccggag ttcagctaca 2460

ttgtgtcggt gctggagaag tacgaccact gcgtgaagga ggggatgccg gtgacggcgc 2520

accaggagct caggctctgg cgctccttcg ccaagatctt caggacgggc tgcatcacca 2580

acaacctgtc cataccggtg catgcgtgat ccatctccat ccttcttcct tccgtaactg 2640

aagtgctgct gctgctgctg tttgcctagg aactactgct ctgctactaa gtagtagtgt 2700

gtgtgtgtgt gtcaaacaaa tggcataaaa agacgttgtc ggccgggaac taaatgtaat 2760

gtaactcgat caaatttgta aattataaac cactctgatc tgatcattta aatccaaaag 2820

aatcgacgca tcgggattcg gaacaggcag aacaaccatg ctacatacag atacagtaca 2880

tggaagacaa tcgaatgcta tgctatacac cgcgattgat tgattagtag caatagcaag 2940

cagcgtccag catcacagga gctgctcgta gcacaggtcc agcgtcttct tggcgaagaa 3000

ctggttcacc ttctgggtgg ggtggaagga gtcccagaag aagtacttgt cggcgtcggc 3060

gcacgtgtgg gggctcttgt cgttgcacag gtaagacatc tccaccttcc ccgtcgcgca 3120

gcagccctcc tccacgttct ccagccctgc catacatgcc atgccagtca gcccatcagc 3180

aggtcgtcgt attgcattgg agatcgatct ctctctctct ctctctctct ctctctctct 3240

ctctctctac ccagcgtgga agggttggtg atgaggtcga gcatgttctg gtacacgtcg 3300

acgtaagcta ccctgagccc cgggcgcgcc gcctggaggc ggcggagcat ggcgagcagc 3360

ttggcgttgt agtcgcgggc cacctggttg tactcgtcga cgcag 3405

<210> 2

<211> 404

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Leu Ser Cys Phe Arg Leu Pro Arg Pro Val Gly Gly Gly Gly Gly

1 5 10 15

Asp Ala Asp Gln Gln Ala Ala Ala Val Ser Pro Arg Arg Gly Pro Ser

20 25 30

Leu Pro Phe Ala Ala Ser Leu Phe Ala Ala Ser Pro Ser Thr Ser Thr

35 40 45

Ser Gly Arg Gly Arg Ser Ala Trp Pro Pro Glu Ala Asp Gly Met Glu

50 55 60

Lys Lys Arg Trp Asp Ser Met Glu Ser Trp Ser Met Leu Leu Asp Thr

65 70 75 80

Val Met Gly Ser Gly Gly Glu Gly Ser Ser Arg Asp Ser Gly Arg Arg

85 90 95

Glu Glu Trp Met Ala Asp Leu Ser Gln Leu Phe Ile Gly Asn Lys Phe

100 105 110

Ala Ser Gly Ala Asn Ser Arg Ile Tyr Arg Gly Ile Tyr Lys Gln Arg

115 120 125

Ala Val Ala Val Lys Met Val Arg Ile Pro Glu Arg Asp Glu Ala Arg

130 135 140

Arg Ala Glu Leu Glu Glu Gln Phe Asn Ser Glu Val Ala Phe Leu Ser

145 150 155 160

Arg Leu Tyr His Pro Asn Ile Val Gln Phe Ile Ala Ala Cys Lys Lys

165 170 175

Pro Pro Val Tyr Cys Ile Ile Thr Glu Tyr Met Ser Gln Gly Thr Leu

180 185 190

Arg Met Tyr Leu Asn Lys Lys Asp Pro Tyr Ser Leu Ser Ala Glu Thr

195 200 205

Ile Leu Lys Leu Ala Leu Asp Ile Ser Arg Gly Met Glu Tyr Leu His

210 215 220

Ala Gln Gly Val Ile His Arg Asp Leu Lys Ser Gln Asn Leu Leu Leu

225 230 235 240

Asn Asp Glu Met Arg Val Lys Val Ala Asp Phe Gly Thr Ser Cys Leu

245 250 255

Glu Thr Lys Cys Gln Ala Thr Lys Gly Asn Lys Gly Thr Tyr Arg Trp

260 265 270

Met Ala Pro Glu Met Thr Lys Glu Lys Pro Tyr Thr Arg Lys Val Asp

275 280 285

Val Tyr Ser Phe Gly Ile Val Leu Trp Glu Leu Thr Thr Cys Leu Leu

290 295 300

Pro Phe Gln Gly Met Thr Pro Val Gln Ala Ala Tyr Ala Ala Ser Glu

305 310 315 320

Lys Asn Leu Arg Pro Pro Leu Ser Ser Ser Cys Pro Pro Val Leu Asn

325 330 335

Asn Leu Ile Lys Lys Cys Trp Ser Ala Asn Pro Ala Arg Arg Pro Glu

340 345 350

Phe Ser Tyr Ile Val Ser Val Leu Glu Lys Tyr Asp His Cys Val Lys

355 360 365

Glu Gly Met Pro Val Thr Ala His Gln Glu Leu Arg Leu Trp Arg Ser

370 375 380

Phe Ala Lys Ile Phe Arg Thr Gly Cys Ile Thr Asn Asn Leu Ser Ile

385 390 395 400

Pro Val His Ala

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggcgcgtcat gccctggaac ggg 23

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aaaccccgtt ccagggcatg acg 23

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gacaggcgtc ttctactggt gctac 25

Claims

Application of DRK protein, or transcript thereof, or coding gene thereof, or inhibitor thereof, or biological material containing coding gene or inhibitor thereof in regulation and control of plant drought resistance.
Use of a DRK protein, or a transcript thereof, or a gene encoding the same, or an inhibitor thereof, or a biological material comprising the gene encoding the same or the inhibitor, for modulating the degree of water loss in a leaf of a plant.
Use of the DRK protein, or a transcript thereof, or a gene encoding the same, or an inhibitor thereof, or a biological material comprising the gene encoding the same or the inhibitor thereof, for modulating plant wilting.
Use of a DRK protein, or a transcript thereof, or a gene encoding the same, or an inhibitor thereof, or a biological material comprising the gene encoding the same or the inhibitor thereof, in breeding plants with improved drought resistance.
5. The use according to any one of claims 1 to 4, wherein at least one of the following objects is achieved by inhibiting the expression of a gene encoding a DRK protein:

(1) improving the drought resistance of the plants;

(2) the water loss degree of the leaves is reduced;

(3) reducing leaf wilting degree.
6. The use according to any one of claims 1 to 4, wherein the DRK protein has an amino acid sequence selected from any one of the following:

1) an amino acid sequence shown as SEQ ID NO. 2; or the like, or, alternatively,

2) the amino acid sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 2.
7. The use according to any one of claims 1 to 4, wherein the gene encoding DRK protein has any one of the following nucleotide sequences:

(1) the nucleotide sequence shown in SEQ ID NO.1, or,

(2) the coding nucleotide sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO. 1; or the like, or, alternatively,

(3) a nucleotide sequence which can be hybridized with the nucleotide sequence shown in SEQ ID NO.1 under strict conditions.
8. The use according to any one of claims 1 to 4, wherein the plant is a monocotyledonous plant; preferably corn.
9. A method for constructing drought-resistant transgenic corn is characterized by inhibiting the expression of coding genes of DRK protein in the corn.
10. The method according to claim 9, wherein the coding gene of the DRK protein is edited in maize by CRISPR/Cas9 technology to inhibit the expression of the coding gene;

preferably, the edited target is one or more of the nucleotide sequence from 2165 th position to 2183 rd position of the nucleotide sequence shown in SEQ ID NO. 1.