CN114736919B - Method for cultivating drought-resistant corn by editing carbonic anhydrase gene and application thereof - Google Patents

Abstract

The invention discloses a method for cultivating drought-resistant corn, which comprises the step of knocking out carbonic anhydrase genes in target corn to obtain drought-resistant corn with drought resistance higher than that of the target corn. After the carbonic anhydrase gene provided by the invention is mutated by CRISPR-Cas9 gene editing technology, the growth of the mutant plant under drought treatment conditions is obviously better than that of a control plant, which indicates that the mutation of the carbonic anhydrase gene can obviously improve the drought resistance of the plant. The drought-resistant plant is obtained by adopting the CRISPR-Cas9 gene editing technology in the embodiment of the invention, and compared with the traditional breeding mode, the method has short time and strong purposefulness, provides gene resources for cultivating and improving new varieties of drought-resistant plants, and provides theoretical basis for elucidating the molecular mechanism of carbonic anhydrase genes in plant drought stress signal response.

Description

Method for cultivating drought-resistant corn by editing carbonic anhydrase gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for cultivating drought-resistant corn by editing carbonic anhydrase genes and application thereof.

Background

Drought is one of the most serious abiotic stresses in the world, drought stress leads to plant growth and development resistance, short plants, reduced crop yield and quality, serious harm to agricultural production and worldwide difficulty affecting agricultural production. Therefore, the genes involved in plant drought response are searched, and the genes are mutated by utilizing the technologies of transgenic overexpression or gene editing and the like, so that candidate gene resources can be provided for molecular breeding and germplasm improvement and crop stress resistance improvement. The breeding efficiency can be improved, the hybridization and screening time is shortened, the breeding direction is determined, and the method is one of effective methods for improving the crop characteristics, and has important significance for enhancing the capability of crops for resisting biological and non-biological stress, improving the crop yield and quality and relieving the food shortage.

Corn (Zeamays) is one of three major food crops, also an important feed crop, belonging to the genus poaceae. With the completion of sequencing of the genome of the maize inbred lines such as B73, mo17 and the like, the genetic background of the maize is clearer. Meanwhile, the inbred line easy to genetic transformation is continuously sequenced and developed, so that the efficiency of the transgenic over-expression and gene editing technology is greatly improved, such as LH244 inbred line. The transformation efficiency of the inbred line is higher than that of most of the inbred lines known at present, transgenic over-expression or gene editing plants are easy to obtain through transformation, technical support is provided for genetic trait improvement by utilizing molecular breeding, and the inbred line has application value for reducing corn yield reduction caused by abiotic stress such as drought and the like.

CA (carbonic anhydrase) is a metalloenzyme closely related to photosynthesis and can catalyze CO with high efficiency and reversibility ₂ With HCO ₃ ^- Conversion between, CO ₂ Concentrating the important components of the mechanism. Carbonic anhydrase in organisms is a polygene family, which can be divided into 6 subfamilies of alpha, beta, gamma, delta, epsilon and theta according to crystal structure and subunit composition. The main function of the higher plant carbonic anhydrase is to participate in photosynthesis, such as the photosynthesis rate and biological yield of transgenic plants are obviously improved after the chlamydia CA gene is over-expressed in tobacco. In addition, CA is involved in physiological processes such as plant respiration, pH adjustment, amino acid and lipid metabolism, stomatal movement, abiotic stress, and the like. For example, maize carbonic anhydrase mutant plants have significantly higher stomatal conductance than wild type plants and are associated with CO ₂ The partial pressure increases and the closing speed of the air hole becomes slow. The opening and closing of the air holes and the water transpiration rate are closely and indispensible, so that the action mechanism of carbonic anhydrase CA is researched, and the method has important application prospect in drought resistance of plants. Functional studies of CA family proteins in plants are currently focused mainly on the regulation of photosynthesis. The role of CA in the involvement of drought responses in monocot maize is not well understood.

Disclosure of Invention

The invention aims to solve the technical problem of improving drought resistance of plants.

In order to solve the technical problems, the invention provides a method for cultivating drought-resistant corn.

The method for cultivating drought-resistant corn provided by the invention comprises the step of knocking out carbonic anhydrase genes in target corn to obtain drought-resistant corn with drought resistance higher than that of the target corn.

In the above method, the carbonic anhydrase gene is a DNA molecule of any one of the following A1 to A3:

DNA molecules with A1 coding regions shown as sequence 1 or sequence 2 in a sequence table;

a2 hybridizes under stringent conditions to the DNA molecule defined in A1 and encodes the protein;

a3 is derived from maize and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule defined in A1 and encodes said protein.

Wherein, the sequence 1 in the sequence table consists of 8517 nucleotides, the sequence 2 in the sequence table is 2572 th to 7616 th nucleotides in the sequence 1 in the sequence table, the CDS is the sequence 2 in the sequence table, and the protein shown in the sequence 3 in the sequence table is encoded.

In the method, the carbonic anhydrase gene in the target corn is knocked out by a CRISPR/Cas9 gene editing method.

According to the CRISPR/Cas9 gene editing method, the target sequence of the sgRNA is 2645 th-2663 th of sequence 1 in a sequence table.

The invention also provides application of the method for cultivating drought-resistant corn in corn breeding.

The invention also protects the above-mentioned vector for expressing the sgRNA.

The application of the vector for expressing the sgRNA in corn breeding, drought-resistant corn cultivation or carbonic anhydrase gene editing also belongs to the protection scope of the invention.

The protein encoded by the carbonic anhydrase gene is also within the scope of the present invention.

The protein is any one of the following a1-a 4:

a1 is protein shown in a sequence 3 in a sequence table;

a2, carrying out substitution and/or deletion and/or addition on the protein shown in the sequence 3 in the sequence table by one or more amino acid residues, and deriving the protein related to drought resistance of plants;

a3, connecting a label at the N end or/and the C end of the protein of a1 to obtain a fusion protein;

a4 is a protein which is derived from corn, has more than 98% identity with a1 and is related to drought resistance of plants.

In the protein, the sequence 3 in the sequence table consists of 452 amino acid residues.

In the above proteins, the identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, perresidue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity.

In the above protein, the 80% or more identity may be at least 81%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

Biological materials related to the above proteins are also within the scope of the present invention.

The protein-related biomaterial provided by the invention is any one of the following B1) to B5):

b1 Nucleic acid molecules encoding the above proteins;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B1);

b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);

b5 A transgenic plant cell line comprising the nucleic acid molecule of B1), or a transgenic plant cell line comprising the expression cassette of B2), or a transgenic plant cell line comprising the recombinant vector of B3).

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

Wherein the nucleic acid molecule of B1) is a DNA molecule of any one of the following A1-A3:

DNA molecules with A1 coding regions shown as sequence 1 or sequence 2 in a sequence table;

a2 hybridizes under stringent conditions to the DNA molecule defined in A1 and encodes the protein;

a3 is derived from maize and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule defined in A1 and encodes said protein.

8. The invention also protects the application of any one of Y1-Y3:

the application of the protein or the biological material of Y1 in regulating drought resistance of plants.

The application of the substance Y2 for reducing the activity or the content of the protein in improving the drought resistance of plants or cultivating drought-resistant plants;

the application of Y3 in inhibiting the expression of the carbonic anhydrase gene in improving drought resistance of plant or cultivating drought-resistant plant.

In the application, the substance Y2 or Y3 is a CRISPR/Cas9 system;

the CRISPR/Cas9 system comprises 1) or 2) as follows:

1) The target point of the sgRNA is 2645-2663 of sequence 1;

2) CRISPR/Cas9 vectors expressing the sgrnas.

The invention also provides the CRISPR/Cas9 system.

After the carbonic anhydrase gene provided by the invention is mutated by CRISPR-Cas9 gene editing technology, the growth of the mutant plant under drought treatment conditions is obviously better than that of a control plant, which indicates that the mutation of the carbonic anhydrase gene can obviously improve the drought resistance of the plant. The drought-resistant plant is obtained by adopting the CRISPR-Cas9 gene editing technology in the embodiment of the invention, and compared with the traditional breeding mode, the method has short time and strong purposefulness, provides gene resources for cultivating and improving new varieties of drought-resistant plants, and provides theoretical basis for elucidating the molecular mechanism of carbonic anhydrase genes in plant drought stress signal response.

The drought resistance of the mutant plant of the CRISPR-Cas9 gene editing technology mutant carbonic anhydrase gene constructed by the invention is obviously improved, and under drought conditions, the leaf wilting degree is less obvious compared with that of a wild type, and the relative water content of the leaf is higher. Compared with the traditional breeding mode, the drought-resistant plant breeding method provided by the invention has the advantages of short breeding time and strong purposeful, obviously shortens the period of drought-resistant breeding, and improves the efficiency of drought-resistant breeding.

Drawings

FIG. 1 is a maize ZmCA1CRISPR-Cas9 mutation site.

FIG. 2 is a photograph of plant growth after drought treatment of wild-type maize (control) and mutant lines. Wherein, the WT is wild corn, 0860-1 is a T2 generation ZmCA1CRISPR-Cas9 mutant line.

Detailed Description

The following examples are illustrative of the invention but do not limit the scope of the invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The main reagents include: restriction enzymes, DNA polymerases, T4 ligases, etc. of NEB, toyobo et al, bio-Inc.; a reverse transcription kit from Thermo company; RNA extraction kit from Magen company; quantitative PCR reagent of Takara company; plasmid extraction kits and DNA recovery kits were purchased from tengen company; the MS culture medium, agar powder, agarose, ampicillin, kanamycin, gentamicin sulfate, rifampicin and other antibiotics are purchased from sigma; the various other chemical reagents used in the examples are imported or homemade analytically pure reagents; primer synthesis and sequencing was done by the company inteljun.

Maize ecotype B73 is described in the following literature: zhang et al, the genetic architecture of nodal root number in mail.plant Journal,93 (6): 1032-1044,2018.

The transcript used in the following examples is T01, as just one example, without limiting the editing sites in the application. Unless otherwise indicated, examples were conducted under conventional experimental conditions or product specification conditions.

The agrobacterium strain is EHA105.

CRISPR/Cas9 vector pBUE411 is described in the following literature: xing HL, dong L, wang ZP, zhang HY, han CY, liu B, wang XC, chen QJ BMC Plant biol.2014Nov 29;14 327 (1); a CRISPR/Cas9 toolkit for multiplex genome editing in plants.

In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.

Example 1

1. Gene acquisition

To study the molecular mechanisms of drought resistance in plants, we used CRISPR/Cas9 technology to direct mutations of ZmCA1 from the maize (Zea mays l.) genome.

The corn ZmCA1 gene consists of 8517 nucleotides (the nucleotide sequence is shown as sequence 1 in a sequence table). The reading frame of the T02 transcript is 2572 th to 7616 th nucleotides of the sequence 1, CDS is sequence 2 of the sequence table, and the protein shown in the sequence 3 of the sequence table is encoded. The gene consists of 15 exons, 13 encoding exons, 1 st to 141 th nucleotides in frame of T02 transcript, 523 rd to 587 th nucleotides, 716 th to 764 th nucleotides, 1594 th to 1710 th nucleotides, 1811 th to 1950 th nucleotides, 2096 th to 2201 th nucleotides, 2332 nd to 2463 th nucleotides, 3326 to 3387 th nucleotides, 3562 nd to 3610 th nucleotides, 4236 th to 4352 th nucleotides, 4447 th to 4586 th nucleotides, 4721 nd to 4826 th nucleotides, 4911 nd to 5045 th nucleotides, and the rest is the intron sequence. The gene is derived from maize inbred line B73. Because the same DNA segment sequence of corn can produce different transcripts and translate different proteins, the different transcripts produced by the segment sequence and the translated different proteins with drought resistance function are all within the protection scope of the invention.

2. Construction of CRISPR/Cas9 Gene editing vector for editing ZmCA1 Gene

CCTCGTCACTCCTTCAGAA (2645-2663 bits of sequence 1) in ZmCA1 gene is selected as a target point of the gene, and primers CA1-ID-1f and CA1-ID-1r containing target point information are designed:

CA1-ID-1f：GGCGTTCTGAAGGAGTGACGAGG(the underlined sequence is reverse-complementary to the underlined sequence in CA1-ID-1 r);

CA1-ID-1r：AAACCCTCGTCACTCCTTCAGAA(the underlined sequence is reverse-complementary to the underlined sequence in CA1-ID-1 f).

The carrier construction method comprises the following steps:

(1) Annealing

Synthesizing a primer, diluting and annealing to obtain a double-stranded DNA fragment gRNA with a sticky end, wherein the double-stranded DNA fragment gRNA specifically comprises:

the primers CA1-ID-1f and CA1-ID-1r were annealed to obtain a double-stranded DNA fragment gRNA with cohesive ends.

(2) The pBUE411 vector (which contains the 3 xFLAG-NLS-zCas 9-NLS expression system and the gRNA scaffold for insertion of the target sequence) was digested with BsaI (NEB) to give digested pBUE411.

Table 1 shows the cleavage system

(3) Connection

Recombinant CRISPR vector against ZmCA1 gene:

and (3) connecting the double-stranded DNA fragment gRNA with the sticky end obtained in the step (1) and the digested pBUE411 obtained in the step (2) to obtain a connection product, namely a recombinant CRISPR vector pBCXUN-ZmCA 1CRISPR-Cas9, wherein the vector expresses the sgRNA. The coding sequence of the sgRNA recognition region is positions 2645-2663 of sequence 1.

The above connection system is shown in table 2:

table 2 shows the connection system

(4) Authentication

And (3) taking 5 mu l of the ligation product obtained in the step (3) to transform escherichia coli competence. Screening was performed on LB plates containing 50. Mu.g/mL kanamycin. Colony PCR identified the monoclonal.

The primers required for PCR identification are OsU3-FD3 and TaU-RD for the monoclonal of the recombinant CRISPR vector into which the ZmCA1 gene is transferred. Positive clones were selected (831 bp clones were positive) and the plasmid was extracted for sequencing.

The sequencing primers were OsU3-FD3 and TaU3-RD:

OsU3-FD3：GACAGGCGTCTTCTACTGGTGCTAC

TaU3-RD:CTCACAAATTATCAGCACGCTAGTC

sequencing results show that a recombinant CRISPR vector pBCXUN-ZmCA 1CRISPR-Cas9 (the vector is aimed at ZmCA1 gene and expresses sgRNA, and the coding sequence of the sgRNA recognition region is 2645-2663 of the sequence 1) is obtained.

3. Construction and identification of CRISPR/Cas9 gene editing plants

1. Construction and identification of ZmCA1 Gene-edited plants

The constructed CRISPR/Cas9 gene editing vector pBCXUN-ZmCA 1CRISPR-Cas9 is transformed into competent agrobacterium tumefaciens EHA105 strain by a heat shock method, and positive clones are identified by colony PCR and named EHA105/pBCXUN-ZmCA 1CRISPR-Cas 9.

Inoculating single colony of correctly identified Agrobacterium EHA105/pBCXUN-ZmCA 1CRISPR-Cas9 into 2-3mL liquid culture medium containing 100 μg/mL kanamycin and 50 μg/mL rifampicin, shake culturing overnight at 28 ℃, transferring large amount of liquid culture medium containing antibiotics for shake culturing the next day, collecting thallus after transferring several times, and re-suspendingTo OD ₆₀₀ Between 0.8 and 1.0.

The recombinant bacterium EHA105/pBCXUN-ZmCA 1CRISPR-Cas9 is transferred into a hard stalk inbred line B73 (also called wild corn hereinafter) by adopting an agrobacterium mediation method, the young embryo of the B73 is infected by agrobacterium tumefaciens EHA105, the young embryo infected by the agrobacterium tumefaciens EHA105 is placed on a selection medium for multiple screening to obtain a resistant callus, and the resistant callus is regenerated into seedlings to obtain T0 generation transformed seedlings. The construction method refers to: zhang et al, the genetic architecture ofnodal root number in mail.plant Journal,93 (6): 1032-1044,2018.

And extracting the DNA of the T0 generation transformation seedling as a template, carrying out PCR amplification and sequencing, and taking B73 corn as a control.

The primers required for amplification are CA1-CRISPR-F and CA1-CRISPR-R, and 345bp is positive.

CA1-CRISPR-F:ATGAGCAGCTGCCTCTGC；

CA1-CRISPR-R:CGATGTTGCGGACGGTGAATG。

The sequencing primer is CA1-CRISPR-F. As shown in FIG. 1, it was found that mutation in ZmCA1 gene in T0 generation transformant (upper sequence) resulted in frame shift (mutation to deletion of 1bp at position 2651 of sequence 1) compared with wild type maize B73 (lower sequence), resulting in altered protein sequence and disrupted protein function.

The transformed seedlings containing the mutant form are named as positive ZmCA1 gene T0 generation CRISPR-Cas9 mutant corn.

The Cas9 is removed from the positive ZmCA1 gene T0 generation CRISPR-Cas9 mutant corn through selfing, and the ZmCA1 gene T2 generation CRISPR-Cas9 mutant corn is obtained through cultivation, and the strain obtained through ZmCA1 gene editing is named 0860-1.

4. ZmCA1 gene CRISPR-Cas9 mutant maize drought treatment phenotype detection

1. Sowing 3 pots of T2 generation ZmCA1 gene mutant strain 0860-1 and wild corn B73 (WT) seeds in small pots filled with 110g of nutrient soil, sowing 4 seeds in each pot, covering 50ml of soil, pouring out the water remained in a tray after water is absorbed, removing one seedling with uneven growth after seedling emergence, leaving 3 seedlings in each pot, adding 1L of water in the tray, pouring out the water after full absorption, and continuously not watering for 14 days (drought treatment). Control and transgenic plants were observed for drought phenotype.

FIG. 2 shows that the ZmAE 1CRISPR mutant plants 0860-1 all grew stronger than the control and had lower leaf wilting than the control, indicating that the transgenic plants were drought resistant than the control.

After 14 days of drought treatment, the survival rate of each line (the plants which are shown to grow normally are defined as surviving plants, the plants which are shown to suffer serious drought damage and cannot grow normally are defined as dead plants), the survival rate is the percentage of the number of surviving plants in each line to the total number of planted plants, and the survival rate of 0860-1 after the T2 generation CRISPR-Cas9 mutant corn drought treatment is 78.5% and the survival rate after the wild type corn drought treatment is 49%.

Thus, inhibiting ZmCA1 protein expression or knocking out ZmCA1 gene can improve maize drought tolerance.

Sequence listing

<110> Chinese university of agriculture

<120> method for cultivating drought-resistant corn by editing carbonic anhydrase gene and application thereof

<130> GNCSY203237

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8517

<212> DNA

<213> corn (Zea mays)

<400> 1

tctccgccct tgtctgggcg ttacggcagg caagccccct cgttttcttc tgctcgcgtt 60

ctccttccat gtccacatct cctgtgccac cgcacgcaag gtgccaacgc tccctcgccg 120

cagtagcatc gcgtccacac aaactgcacc tccactagat acggcggtga tccggcgaga 180

gagcgcgaca cgcacaggcc agctagcgtt tctccgacgc cgcgcgtttc atcatttccc 240

gcttcccctg cccccggccg cgcgcgcgcg cccgtgtggt ccagaccagg acgcgcgcgg 300

atgtgcatcc ggcgcgcgcc cgtcggccac acggtgccgc cgcgcgttat cccgagccct 360

gtcctgtcct gtcctgttcc atctcgcgcg cgaggggggg aggggagggc agcgagtggc 420

gcgctggcgg atgaggcgcc gagtggcccg catccaccgg cgcaggcgag ccgcacgacg 480

ccgccgcgct cgcggaccgc cgccgccaca catgcgcacc cccggcccgc ggggctgtaa 540

cggccttgtc gccacgcgtg cgccccgtgt gtataaggag gcagcgcgta cagggggcac 600

gataagcggc actcgcacga tcaatgtaca cattgcccgt ccgcgccacc acatccagca 660

tcgtcgccag cctcgccacc cccgcgccgt cctcctcctc cggctccggc tccggccgcc 720

ccaggcccag gctcatccgg aacgcccccg tcttcgccgc ccccgccacc gtcgtggtac 780

gtacgtgcgt acggagtacg acaattaatg catgcatggc tcactgcaca gcgagcacat 840

catgcactgt acagcatgca tgtcctcgtt tctatatatt ctatccacgt acgccttcgc 900

ttcatccagc tctaataacc aagtactgac tagtcggcac tactgacgac cttgctgttt 960

tgggcacgaa atgcactcat gcaaccaaaa gtccttgctc ccattatcta ggaggacacg 1020

accaagcatg caggatattc tggaaaccca atcaaaatcc gactgtaata taagtataat 1080

gcacatccca agaagacgcc actcttagct tcatcttaaa ttcccttaaa tttagctata 1140

tatcatttat ataacatcaa aacaggcgta ctatcaaaaa tatatttcat ggtacgtaaa 1200

tatggcacac tacactgtac ataaattttt gtttgaatta attctttctg tcaaatctat 1260

aatcaaattc aaggcagttt gatatatacg ttagatctat atataatgca tctatttctg 1320

acggagggaa tagctagtga tgatgatagt aatttagatc attttcccat cagctagtag 1380

ctaccgacga catacgcatg tcagccatct ccaatagaat attcccgaag ggaggtgttt 1440

ccaaaaagat gacggccaac gatagtgcta gtttgaaggc aactactacg tatatatcct 1500

ttcagtataa cagaattcca cccagaaaaa aaaagtctcg agttgaatga aagaggagta 1560

gtgacgtcga gcgcgcgtga aataaagtat atggctggct ttttcctaaa gcgataagac 1620

cagtttatgc agtggggtca tggacatgtg tagtgatagc taataatcgt ccgcgtcttt 1680

tggcttttga gttccgtttg atccatgacg catatatatc caggcagttg aataaccgac 1740

gaccatcaaa taaaaggcgc cactactagt ggccatcgac gtcagtttaa cctttctatg 1800

tatgcatgtg taacttccca tgatttcctg cgtcgcgtta ttttgctttg tttcaccgtc 1860

ggacgacgaa gtcttttaga tagcaataag gaactatatc taagtgctag tttgggaacc 1920

tcgttttccc acgagatttt cattttccta aggtaaatta gttcattttt ttttgaaaat 1980

aagaatcttt tgaaaaagat gtaattatca aactagtcct aacagagaga tttttgaggg 2040

gggagaaaaa aaaggaagtt cttctgcatt cttttttgga ggaacaaaaa atttgcctct 2100

gcatactgaa tcagagggga tgggctttat ttcgtgttgg ctggttgatt gatgattgga 2160

tgagctccag taagtttgga agagaacagg gcacggtccc gacggttggt acgggtgaag 2220

aaagggagtg atttaattta tcgccccaac cacaaccacc catcgatcta tagttgcaga 2280

agaactcgct aatcctgtcc acaaaagccg cactcacgca ctcatccgcc actgatttta 2340

tttccccccc cccccctgtg ggcgcgcgcg cgtgctgcgt ggtggtacta ctacctgttt 2400

gtctcactga cacagttgcg cgcgtcatca tgttgctagt aaacgggacg gcgggcagct 2460

gaggagtcaa acgagagaga tcgagagaaa gaaagggagg gcatccacca gccgccggcg 2520

ataagagggg aggagagaga ggccagagaa gaggaggaga agaagaagaa aatgagcagc 2580

tgcctctgcc ttccgaaaaa aaaggagggg ccagcgaagg agaagccgtc cacagatacc 2640

cccacctcgt cactccttca gaaccagaag ccctcccaac ctccacctcc tccctccaag 2700

gcttcctcca aggtccgtcc cctcctcctc ctcctcatct tcctctctca ccttcagcac 2760

catcctccac acagcagcac gcgcgcagca atctcaccgt tttcttttcc tccattgcca 2820

tcagtagcta gccacactgc atgcattcag cttccgcttt ctccctgtgt agcgagcgct 2880

gtgccggccg gtgcagagaa gatccctgct cccccccccc cccccccccc ctaattagat 2940

cacctttgtg catttttttc cttgtgttgt ggtccgtcgg caagtaggcc aaaattgcat 3000

catgggccat ggcccctcct ctttctacta cctcgtcatg ctgcagcacg atcatgaatg 3060

acccgacgat gtatctggct gttgacattg cagggcatgg accccaccgt cgagcgcttg 3120

aagagcgggt tccagaagtt caagaccgag gtctatgagt aagtcacctg agctgtttgt 3180

tctctgcagc acccgcgttt ggtttctatt tccttttttg tttgtttgtg aattcagtga 3240

gctccgactc cgactgatca tgtgctccgc tgatctttgt tcgcagcaag aagccggagc 3300

tgttcgagcc tctcaagtcc ggccagagcc ccagggtatg cgctgctaat gtttttttat 3360

atatattttg ttgtgtgtct atagcgactc cggccaactg ggccaaaaga ttgagtagta 3420

ctagttgctc gttcctatta ctagctctgt agctcatcac cattgctgct gcaacaccct 3480

gccgcacctg cactattcag catccaccct gtctcccctg gaccaaagct gcaaggggaa 3540

ccatgcagat aatactaggt gtgtattatc agcattccat ggctaatgtg tggtccaggc 3600

gtccagcact gtccctcgcc ccacctcacg ggatcctgtc gtcatcgtga gtagttggct 3660

tggacgtgtc cccttcccct ctcgcacccc ttgcaaaaaa gttaggtgca taaatgttgg 3720

gcctgttgcc ggtcctcgag gaaatatgct acactacaga tgtcccaatt tttgtggaag 3780

atatggcagc agcatcacgc ctcctgatga tgcccggaac ggaaatgttc ttgctattgg 3840

ccgccagcag ggaatataat gggataaaga tagaccagcg tgctagagag ccacacggaa 3900

accagagcgc gcgtagagca tcctcgtcgc aactaatact agtacttaca gagccagagg 3960

aggagggtca aatcgaaact caatcaaaag cttgccgcct ttttggggcg ccagaaatct 4020

tccactgatg agatgaccag ggccgatgat ctgcttacct gcttatcgat aagagccatg 4080

ggaaaccgat cgaacttggt tttgcgtacg tgctcctccc tcttttcacc gacctgacgg 4140

tgactgattt cccctccgct gcagtacatg gtgttcgcct gctccgactc ccgcgtgtgc 4200

ccgtcggtga cactgggcct gcagcccggc gaggcattca ccgtccgcaa catcgcctcc 4260

atggtcccac cctacgacaa ggtacgtacg tacgagcaaa caccgatcga cgcatgcaac 4320

ggtggtatca gccacactaa tattactcac acggtcgtct tccgttttgg ccaaactgca 4380

gatcaagtac gccggcaccg ggtccgccat cgagtacgcc gtgtgcgcgc tcaaggtgca 4440

ggtcatcgtg gtcattggcc acagctgctg cggtggcatc agggcgctcc tctccctcaa 4500

ggacggcgcg cccgacaact tgtaagcagt agtcatcgta aaatgcgtat aaaaaatata 4560

tatagcagtt ttatttagag agagagaaaa aaattagaac cccgtgtagt gtaacctgct 4620

cagcgtgttg tctgtcgttg gtttaaatct ggccatgtat atccagccac ttcgtggagg 4680

actgggtcag gatcggcagc cctgccaaga acaaggtgaa gaaagagcac gcatcggtgc 4740

cgttcgatga ccagtgctcc atcctggaga aggtacgtaa cgtaaacgca cgcacacaca 4800

ccgaccgtat gaataatgga ttatatatta ttggtttcgc tcatcaacga acaaattcaa 4860

ggatcatcat cgacctttaa ttgtgtgtgt gtgtttctgc aggaggccgt gaacgtgtcg 4920

ctccagaacc tcaagagcta ccccttcgtc aaggaagggc tggccggcgg gacgctcaag 4980

ctggttggcg cccactacga cttcgtcaaa gggcagttcg tcacatggga gcctgtaggg 5040

gtccacgcgc acagctcttc ttttagagca actccaatag attagccaaa ttttttattc 5100

tatattctca tttagctagc cgtttagcta taattcactc tctaaattac gattaattcc 5160

aacagactag ccaaattaga ctggtaggtc ccacatgtca ttctcacctt gccttcttcc 5220

ctatgtccca cgcgcctatg ctacaccgtc ctgcctccac tccggctgag gacaaaggct 5280

atgggaggac cggatagcta gcgtagggaa ttagtcatat ttggctagcg gagggggttg 5340

tttaccgagt tggatagcga gagaaggatt tgaagagact gttggatcca atttttactc 5400

caattttatt atttttagct agtcaatttg ttttacataa gctcttggag ttgctcttac 5460

cttttttttt caattgctat attgacgaca tcacgtccgt cgtcttgcat ttgcacatag 5520

ctagcgcact ccagatccca attcccaaca tcatccggcc agcccccttt aatttatctc 5580

ccttgtttgc catcgcaatt tctttctctc cccttagctt gttgacatgc atgggaggat 5640

atcaggagac gaagaaaaga gcagagcagc gcctttgccc tcccatagat tcccacgcac 5700

ctcgtcactc cttgagaacc agaagcccac ccacccggtc cagtgtggcc aaaagttgca 5760

tcacgccccc ttcattctct cgctctctct atacccccct catgctgcat ctatcaccgt 5820

accatcacga gcatgcaagt tagtctttcc gggcatggcg aactgaccga cgattttctt 5880

gttgctggtc ctgcagcccc aggacgccat cgagcgcttg acgagcgggt tccagcagtt 5940

caaggtcaat gtctatgagt aagtcacccc tctactactc agagctggct gttgttttct 6000

gcagcaccgg cgtttggttt agccgtttca gtttcaaacg tttcatttgt atcgggaatt 6060

ctgatatagc ttcgactgat cctatattat tcctgtgcta gtacgtttga tttttttttc 6120

ttcatttcac agcaagaagc cggagctttt cgggcctctc aagtccggcc aggcccccaa 6180

ggtatgcgct attgcctact agcctatact ccattcttat tcttctgaac caaatgcatg 6240

cgccccgcgc gcgtgctaat tgctaaccca tgtgctgcca tatatgctaa gctggcgaga 6300

cttgcatttg cttggtaaat tattgagatg ccgccgtccc tatataggct cacttcctag 6360

tatatagaac ctggcgtgcc agaatattgc aagtaaccaa gtacagagtt tattgttttt 6420

ctttatgggt gttctgagtt ggcatctatc ccatgcgcat gattatttca tgcatgcgtt 6480

catgctttta gcgggttcta ctagttttgt tatccataaa aattaccata ttttaaaact 6540

tcttttgaaa aaaaaaatta tatgtatcct tgtgaaagtc gacattagac ctagtatatc 6600

ggcgtagtct acgctaccga cataacacgt atcggcgcca tatagatcaa ggagctcagc 6660

catgatatat atatatacta attggatgac ctgtggggat ggcattgtcg ctgcatagct 6720

aacaaccgcg ggaaccggcc tgattttttg tgctccttct ttttgcctga cctgacatga 6780

cagtgatttt gctatgctgc atgcagtaca tggtgttcgc ttgctccgac tcccgtgtgt 6840

gcccatcggt gaccctgggc ctgcagcccg gcgaggcctt caccgttcgc aacatagccg 6900

ccatggtccc aggctacgac aaggtatata tacacactga cgattgtgaa caacgcaatg 6960

gtctcaattt ctactcacac ggccggccgc ggcctctcgt tttcgtgtcg actgcagacc 7020

aagtacaccg gcatcgggtc cgccatcgag tacgctgtgt gcgctctcaa ggtggaggtc 7080

ctcgtggtca ttggccatag ctgctgcggt ggcatcaggg cgctcctctc cctccaggac 7140

ggcgcacctg acaccttgta agtcgcgaca gtaaaatata tacaagtttc atttagatat 7200

aaaaaactat ttgcgcttat ttatgtcatg catgattttg atcctctcta taccatgttg 7260

tgtgttggtt tggtgtggtg tacgtacgca gccacttcgt cgaggactgg gttaagatcg 7320

gcttcattgc caagatgaag gtaaagaaag agcacgcctc ggtgccgttc gatgaccagt 7380

gctccattct cgagaaggta tgttgtacat tcgtcgagca gttactgttg catgaataga 7440

ttggtttttg ctcaccaaaa ggacctctat tgtttctgca ggaggccgtg aacgtgtccc 7500

tggagaacct caagacctac cccttcgtca aggaagggct tgcaaatggg accctcaagc 7560

tgatcggcgc ccactacgac tttgtctcag gagagttcct cacatggaaa aagtgaaaaa 7620

ctagggctac ggcaattcta ccggcccgcc gactcctgca tcatcataaa tatatatact 7680

atactatact actacgtacc taccgatatg cacccgagca atgtgaatgc gtcgagtact 7740

atatatctgt tttctgcatc tacatatata taccggatca atcgcccaat gtgaatgtaa 7800

taagcaatat cattttctac cacttttcat tcctaacgct gagcttttta tgtactatat 7860

cttatatgat gaataataat atgaccgcct tgtgatctaa agacatcagc tatatttttt 7920

tcacaatatt attacgaaga gcttcttagc tttgttaatt accattagcg gatctagaaa 7980

cgaccgaggg gcaaaagaat aggactttct tgggaagcca gtaaagcaag aggtgctaaa 8040

cacagggata aaagaaccca tataagcaac taagaagata actaaaataa tattcctatg 8100

gattacctac ctaggaaaaa gtcttgagat ctctggagtt tccaaattag acctataagg 8160

ttaaaattca tacttaccaa atacttatag atctaacaaa caatgctcaa ttcaaagtgc 8220

ttaattaaac aatatataat taattataga aaatacctaa taatagctct tgataactaa 8280

ataatcaaat atttcttcac aatttcaaac tacctgggcc ggtgtcctcc attgtagata 8340

tgcctataat cattgtgtag atactgatca agggtctcct acccttatat tatataagcc 8400

aaggagaggg ttacaaaata tatgatcagc tagcatatgc attttctatt tggttacatg 8460

agaagtacaa taaaatcatc catctgtatc cttagcccga tgccttgtgc tgcacag 8517

<210> 2

<211> 1359

<212> DNA

<213> corn (Zea mays)

<400> 2

atgagcagct gcctctgcct tccgaaaaaa aaggaggggc cagcgaagga gaagccgtcc 60

acagataccc ccacctcgtc actccttcag aaccagaagc cctcccaacc tccacctcct 120

ccctccaagg cttcctccaa gggcatggac cccaccgtcg agcgcttgaa gagcgggttc 180

cagaagttca agaccgaggt ctatgacaag aagccggagc tgttcgagcc tctcaagtcc 240

ggccagagcc ccaggtacat ggtgttcgcc tgctccgact cccgcgtgtg cccgtcggtg 300

acactgggcc tgcagcccgg cgaggcattc accgtccgca acatcgcctc catggtccca 360

ccctacgaca agatcaagta cgccggcacc gggtccgcca tcgagtacgc cgtgtgcgcg 420

ctcaaggtgc aggtcatcgt ggtcattggc cacagctgct gcggtggcat cagggcgctc 480

ctctccctca aggacggcgc gcccgacaac ttccacttcg tggaggactg ggtcaggatc 540

ggcagccctg ccaagaacaa ggtgaagaaa gagcacgcat cggtgccgtt cgatgaccag 600

tgctccatcc tggagaagga ggccgtgaac gtgtcgctcc agaacctcaa gagctacccc 660

ttcgtcaagg aagggctggc cggcgggacg ctcaagctgg ttggcgccca ctacgacttc 720

gtcaaagggc agttcgtcac atgggagcct ccccaggacg ccatcgagcg cttgacgagc 780

gggttccagc agttcaaggt caatgtctat gacaagaagc cggagctttt cgggcctctc 840

aagtccggcc aggcccccaa gtacatggtg ttcgcttgct ccgactcccg tgtgtgccca 900

tcggtgaccc tgggcctgca gcccggcgag gccttcaccg ttcgcaacat agccgccatg 960

gtcccaggct acgacaagac caagtacacc ggcatcgggt ccgccatcga gtacgctgtg 1020

tgcgctctca aggtggaggt cctcgtggtc attggccata gctgctgcgg tggcatcagg 1080

gcgctcctct ccctccagga cggcgcacct gacaccttcc acttcgtcga ggactgggtt 1140

aagatcggct tcattgccaa gatgaaggta aagaaagagc acgcctcggt gccgttcgat 1200

gaccagtgct ccattctcga gaaggaggcc gtgaacgtgt ccctggagaa cctcaagacc 1260

taccccttcg tcaaggaagg gcttgcaaat gggaccctca agctgatcgg cgcccactac 1320

gactttgtct caggagagtt cctcacatgg aaaaagtga 1359

<210> 3

<211> 452

<212> PRT

<213> corn (Zea mays)

<400> 3

Met Ser Ser Cys Leu Cys Leu Pro Lys Lys Lys Glu Gly Pro Ala Lys

1 5 10 15

Glu Lys Pro Ser Thr Asp Thr Pro Thr Ser Ser Leu Leu Gln Asn Gln

20 25 30

Lys Pro Ser Gln Pro Pro Pro Pro Pro Ser Lys Ala Ser Ser Lys Gly

35 40 45

Met Asp Pro Thr Val Glu Arg Leu Lys Ser Gly Phe Gln Lys Phe Lys

50 55 60

Thr Glu Val Tyr Asp Lys Lys Pro Glu Leu Phe Glu Pro Leu Lys Ser

65 70 75 80

Gly Gln Ser Pro Arg Tyr Met Val Phe Ala Cys Ser Asp Ser Arg Val

85 90 95

Cys Pro Ser Val Thr Leu Gly Leu Gln Pro Gly Glu Ala Phe Thr Val

100 105 110

Arg Asn Ile Ala Ser Met Val Pro Pro Tyr Asp Lys Ile Lys Tyr Ala

115 120 125

Gly Thr Gly Ser Ala Ile Glu Tyr Ala Val Cys Ala Leu Lys Val Gln

130 135 140

Val Ile Val Val Ile Gly His Ser Cys Cys Gly Gly Ile Arg Ala Leu

145 150 155 160

Leu Ser Leu Lys Asp Gly Ala Pro Asp Asn Phe His Phe Val Glu Asp

165 170 175

Trp Val Arg Ile Gly Ser Pro Ala Lys Asn Lys Val Lys Lys Glu His

180 185 190

Ala Ser Val Pro Phe Asp Asp Gln Cys Ser Ile Leu Glu Lys Glu Ala

195 200 205

Val Asn Val Ser Leu Gln Asn Leu Lys Ser Tyr Pro Phe Val Lys Glu

210 215 220

Gly Leu Ala Gly Gly Thr Leu Lys Leu Val Gly Ala His Tyr Asp Phe

225 230 235 240

Val Lys Gly Gln Phe Val Thr Trp Glu Pro Pro Gln Asp Ala Ile Glu

245 250 255

Arg Leu Thr Ser Gly Phe Gln Gln Phe Lys Val Asn Val Tyr Asp Lys

260 265 270

Lys Pro Glu Leu Phe Gly Pro Leu Lys Ser Gly Gln Ala Pro Lys Tyr

275 280 285

Met Val Phe Ala Cys Ser Asp Ser Arg Val Cys Pro Ser Val Thr Leu

290 295 300

Gly Leu Gln Pro Gly Glu Ala Phe Thr Val Arg Asn Ile Ala Ala Met

305 310 315 320

Val Pro Gly Tyr Asp Lys Thr Lys Tyr Thr Gly Ile Gly Ser Ala Ile

325 330 335

Glu Tyr Ala Val Cys Ala Leu Lys Val Glu Val Leu Val Val Ile Gly

340 345 350

His Ser Cys Cys Gly Gly Ile Arg Ala Leu Leu Ser Leu Gln Asp Gly

355 360 365

Ala Pro Asp Thr Phe His Phe Val Glu Asp Trp Val Lys Ile Gly Phe

370 375 380

Ile Ala Lys Met Lys Val Lys Lys Glu His Ala Ser Val Pro Phe Asp

385 390 395 400

Asp Gln Cys Ser Ile Leu Glu Lys Glu Ala Val Asn Val Ser Leu Glu

405 410 415

Asn Leu Lys Thr Tyr Pro Phe Val Lys Glu Gly Leu Ala Asn Gly Thr

420 425 430

Leu Lys Leu Ile Gly Ala His Tyr Asp Phe Val Ser Gly Glu Phe Leu

435 440 445

Thr Trp Lys Lys

450

Claims (2)

1. A method for cultivating drought-resistant corn is characterized by comprising the steps of knocking out carbonic anhydrase genes in target corn to obtain drought-resistant corn with drought resistance higher than that of the target corn;

the carbonic anhydrase gene sequence is shown as SEQ ID No. 1;

the carbonic anhydrase gene in the target corn is knocked out by a CRISPR/Cas9 gene editing method; in the CRISPR/Cas9 gene editing method, the target sequence of sgRNA is 2645-2663 bits of SEQ ID No.1 of a sequence table, and primers containing target sequence information are CA1-ID-1f and CA1-ID-1r:

CA1-ID-1f：GGCGTTCTGAAGGAGTGACGAGG；

CA1-ID-1r：AAACCCTCGTCACTCCTTCAGAA。

2. use of the method for cultivating drought-resistant maize according to claim 1 in maize breeding.