CN114716521A

CN114716521A - Corn drought-resistant related protein and application thereof in plant drought resistance

Info

Publication number: CN114716521A
Application number: CN202011525281.4A
Authority: CN
Inventors: 王瑜; 巩志忠; 王亚琳
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2020-12-22
Filing date: 2020-12-22
Publication date: 2022-07-08
Anticipated expiration: 2040-12-22
Also published as: CN114716521B

Abstract

The invention discloses a corn drought-resistant related protein and application thereof in plant drought resistance, wherein the protein is GRMZM2G121851, and after the GRMZM2G121851 protein is overexpressed in plants, the growth of the overexpressed plants is obviously superior to that of wild type under the drought treatment condition, which shows that the gene overexpression can obviously improve the plant drought resistance. The drought-resistant plant obtained by adopting the transgenic overexpression technology in the embodiment of the invention has good growth condition under drought conditions, has the leaf wilting degree obviously lower than that of a wild type, has short time and strong purpose compared with the traditional breeding mode, provides gene resources for cultivating and improving new varieties of drought-resistant plants, and provides theoretical basis for clarifying the molecular mechanism of the gene in plant drought stress signal response.

Description

Corn drought-resistant related protein and application thereof in plant drought resistance

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a corn drought-resistant related protein and application thereof in plant drought resistance.

Background

More than half of the corns in China are planted on dry land which depends on natural rainfall in the northwest, southwest, northwest and northeast areas, the water loss is fast, the rainfall rate is high, and the growth of the corns is seriously influenced. Corn is an important grain crop in China, and the research on the drought resistance of the corn is significant for solving the problem of corn yield in China. We aimed at finding drought-related genes in maize over-expression lines and studying their gene functions and signal transduction pathways. Through the research of drought-related genes, the corn is improved, the drought resistance of the corn is improved, and the yield of the corn is increased.

Drought can cause osmotic stress in plants, the osmotic pressure in the plant is lower than the osmotic pressure of the environment (such as soil solution), and the plant cannot absorb water or even lose water. Osmotic stress has two pathways: ABA-dependent and ABA-independent pathways. When subjected to environmental stress, ABA, PYL, PYR and RCAR are ABA receptors generated in an ABA pathway and can be combined with ABA. The activity of protein phosphatase of PP2C is inhibited, so that SnRK2 has kinase activity and can phosphorylate downstream transcription factors and the like, thereby regulating and controlling the expression of downstream stress response genes, inhibiting stomatal opening, regulating and controlling ABA sensitivity and generating other responses. DREB2A is phosphorylated, thereby regulating downstream stress response gene expression, independent of the ABA pathway. The drought stress can induce the abscisic acid (ABA) in the plant body, the ABA can guide stomata to close in time so as to reduce the water loss in the plant body, and simultaneously the ABA can activate the expression of a large number of drought-related genes so as to cause various drought stress responses of the plant. ABA is an extremely important plant hormone, and plays a key role in stomata closure, expression of stress response genes, and the like.

Disclosure of Invention

The invention aims to provide application of a corn GRMZM2G121851 protein and a coding gene thereof in regulation and control of plant drought resistance.

The invention provides a protein which is firstly related to corn drought resistance, the protein is GRMZM2G121851 protein, and the GRMZM2G121851 protein is any one of the following proteins b1) -b 3):

b1) the amino acid sequence is protein of SEQ ID No.2 in a sequence table;

b2) the protein with the same biological function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No.2 in the sequence table;

b3) protein which has 80 percent or more than 80 percent of identity with the amino acid sequence limited by SEQ ID No.2 in the sequence table, is derived from corn and has the same biological function.

The invention also provides a related biological material of the GRMZM2G121851 protein, wherein the related biological material is any one of the following B1) to B9):

B1) a nucleic acid molecule encoding the GRMZM2G121851 protein of claim 1;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

B4) a recombinant microorganism containing B1) said nucleic acid molecule, or a recombinant microorganism containing B2) said expression cassette, or a recombinant microorganism containing B3) said recombinant vector;

B5) a transgenic plant cell line comprising B1) the nucleic acid molecule or a transgenic plant cell line comprising B2) the expression cassette;

B6) transgenic plant tissue comprising the nucleic acid molecule of B1) or transgenic plant tissue comprising the expression cassette of B2);

B7) a transgenic plant organ containing the nucleic acid molecule of B1), or a transgenic plant organ containing the expression cassette of B2);

B8) a nucleic acid molecule that increases or facilitates expression of said GRMZM2G121851 protein;

B9) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line comprising the nucleic acid molecule according to B8).

The protein can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

In the above proteins, identity refers to the identity of amino acid sequences. The identity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web pages of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, setting the value of Expect to 10, setting all filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residual Gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a calculation by searching for the identity of a pair of amino acid sequences, a value (%) of identity can be obtained.

In the above protein, the 80% or more identity may be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

The related biological materials of the GRMZM2G121851 proteins in any one of the above B1) to B9) also belong to the protection scope of the invention. Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

The plant expression vector can be a pBCXUN vector.

The nucleic acid molecule of B1) is any one of the following a1) -a 3):

a1) the coding region is a DNA molecule shown as SEQ ID No. 3;

a2) the nucleotide sequence is a DNA molecule shown as SEQ ID No.1 in a sequence table;

a3) a DNA molecule having 90% or more 90% identity to the nucleotide sequence defined in a1) or a2), derived from maize and encoding the GRMZM2G121851 protein of claim 1.

The above "identity" refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 90% or more, or 95% or more identical to the nucleotide sequence of the present invention encoding the GRMZM2G121851 protein.

Alternatively, the maize GRMZM2G121851 gene consists of 4945 nucleotides and the T01 transcript is in frame from nucleotide 745 to nucleotide 3970 from the 5' end. The gene consists of 7 exons, wherein a T01 transcript encodes 7 exons, and the reading frame comprises nucleotides 1 to 158, 265 to 340, 825 to 877, 968 to 1458, 2039 to 2199, 2314 to 2514, 2636 to 3226 and the rest of intron sequences. The gene is derived from corn type B73-329 and is numbered GRMZM2G121851 in the corn genome database. Since the same DNA segment sequence in maize can produce different transcripts and translate into different proteins, the production of different transcripts by the segment sequence and the translation of different proteins are all within the scope of this patent.

The application of the protein or the related biological material in the regulation of the drought resistance of plants also belongs to the protection scope of the invention.

The application of the protein or the related biological materials in breeding drought-resistant plant varieties also belongs to the protection scope of the invention.

The invention also provides a method for cultivating the high drought-resistant plant, which comprises the step of promoting or improving the expression of the nucleic acid of the GRMZM2G121851 protein in a target plant to obtain the high drought-resistant plant, wherein the target plant is a plant containing the nucleic acid of the GRMZM2G121851 protein, and the drought resistance of the high drought-resistant plant is higher than that of the target plant.

The invention also provides a plant breeding method, which comprises the following steps: increasing the content and/or activity of the protein according to claim 1 in the target plant, thereby increasing the drought resistance of the plant.

In the above, the plant is a monocotyledon or a dicotyledon.

The plant is a gramineous plant.

The plant is corn.

After the GRMZM2G121851 gene provided by the invention is overexpressed in plants, the growth of the overexpressed plants is obviously better than that of wild plants under the drought treatment condition, which shows that the drought resistance of plants can be obviously improved by overexpression of the gene. The drought-resistant plant obtained by adopting the transgenic overexpression technology in the embodiment of the invention has good growth condition under drought conditions, has the leaf wilting degree obviously lower than that of a wild type, has short time and strong purpose compared with the traditional breeding mode, provides gene resources for cultivating and improving new varieties of drought-resistant plants, and provides theoretical basis for clarifying the molecular mechanism of the gene in plant drought stress signal response.

Drawings

FIG. 1 is a control and GRMZM2G121851 overexpression line drought treatment phenotype.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The corn ecotype is B73; the agrobacterium strain is EHA 105. The main reagents comprise: restriction enzymes, DNA polymerases, T4 ligases, etc. from biological companies such as NEB and Toyobo; a reverse transcription kit of Thermo corporation; RNA extraction kit from magenta; quantitative PCR reagents of Taraka corporation; the plasmid extraction kit and the DNA recovery kit are purchased from Tiangen corporation; MS culture medium, agar powder, agarose, ampicillin, kanamycin, gentamicin sulfate, rifampin and other antibiotics are purchased from sigma; the various other chemical reagents used in the examples were all imported or domestic analytical reagents; primer synthesis and sequencing was done by invitro.

Example 1

1. Discovery of maize GRMZM2G121851 protein

A novel protein related to plant drought tolerance is found in maize B73-329, and is named as GRMZM2G121851, and the amino acid sequence of the novel protein is shown as SEQ ID No.2 in a sequence table.

In maize B73-329 genomic DNA, the corresponding maize GRMZM2G121851 gene consists of 4945 nucleotides as shown in the list as SEQ ID No.1, and the transcript is in frame from nucleotide 745 to nucleotide 3970 from the 5' end. The gene consists of 7 exons, wherein the transcript codes for 7 exons, and the 1 st to 158 th nucleotides, the 265 th to 340 th nucleotides, the 825 th to 877 th nucleotides, the 968 th to 1458 th nucleotides, the 2039 th to 2199 th nucleotides, the 2314 th to 2514 th nucleotides, the 2636 th to 3226 th nucleotides in a reading frame, and the rest of the sequence is an intron sequence thereof.

Construction and detection of GRMZM2G121851 gene overexpression vector

2.1 construction of GRMZM2G121851 Gene overexpression vector

The sequences of 7 exons in the maize GRMZM2G121851 gene are sequentially joined to form a DNA molecule as shown in sequence No.3, which is capable of encoding a protein having the amino acid sequence shown in sequence No. 2.

The DNA molecule shown in the sequence 3 was inserted into pBCXUN vector to obtain recombinant plasmid pBCXUN-GRMZM2G 121851. In the recombinant plasmid pBCXUN-GRMZM2G121851, the DNA molecule shown in sequence 3 of the sequence listing was initiated by the Ubi promoter and terminated by the Nos terminator, thereby expressing the GRMZM2G121851 protein.

The pBCXUN vector is an expression vector obtained by replacing the HYG gene (hptII, hygromycin resistance gene) of the pCXUN vector (GenBank: FJ905215.1, 06-JUL-2009) with the Bar gene (encoding phosphinothricin acetyltransferase) (GenBank: 284-835 nucleotides in MG719235.1, 02-OCT-2018) and keeping the other nucleotides of pCXUN unchanged.

2.2 validation of recombinant vectors

The recombinant vector pBCXUN-GRMZM2G121851 was transformed into E.coli competent. Screening was performed on LB plates containing 50. mu.g/mL kanamycin. And (5) identifying the single clone by colony PCR, and selecting a positive clone for sequencing. The obtained recombinant expression vector with correct sequencing was named pBCXUN-GRMZM2G 121851. Colony PCR and sequencing universal primers were as follows:

UbiP-seq:TTTTAGCCCTGCCTTCATACGC

NosR-seq:AGACCGGCAACAGGATTCAATC。

construction of GRMZM2G121851 gene overexpression plants

3.1 the pBCXUN-GRMZM2G121851 over-expression plasmid constructed in step 2 is transformed into competent Agrobacterium EHA105 strain by heat shock method, and positive clone is identified by colony PCR to obtain recombinant Agrobacterium.

3.2 Single colony inoculation of recombinant Agrobacterium into 2-3mL liquid medium containing 100. mu.g/mL kanamycin and 50. mu.g/mL rifampicinShaking for overnight culture at 28 deg.C, transferring to liquid culture medium containing antibiotics the next day, shaking for several times, collecting thallus, and resuspending to OD₆₀₀Between 0.8 and 1.0. Infecting the young B73 corn embryo with the obtained recombinant Agrobacterium tumefaciens suspension under aseptic condition, inducing the young corn embryo to callus and grow into seedling to obtain T₀Regenerating plants.

3.3 transgenic plants were self-bred to obtain T3 generation for subsequent experiments. The cultivation method of the T3 generation plants comprises the following steps: will T₀Carrying out PCR identification on the generation regeneration plant, and screening to obtain a transgenic plant; will T₀Selfing the transgenic plant to obtain the seed T₁Seed generation, T₁The plant grown by the seed generation is T₁Plant generation; will T₁Selfing the plant to obtain the seed T₂Seed generation, T₂The plant grown by the seed generation is T₂Plant generation; will T₂Selfing the plant to obtain the seed T₃Seed generation, T₃The plant grown by the seed generation is T₃And (5) plant generation. The screening method of the transgenic plant comprises the following steps: extracting genome DNA of plant leaves, carrying out PCR amplification by adopting a primer pair consisting of the primer Ubip-seq and the primer NosR-seq in the step 2.2, and if a specific amplification product is obtained, the plant is a transgenic plant.

Over-expression of GRMZM2G121851 gene for maize drought treatment phenotype detection

Seeds of transgenic lines OE1 and OE2 in T3 generation plants are selected, seeds of corn B73 are used as wild type controls, corn drought treatment phenotype detection is carried out, the controls and transgenic plants are repeated in 3 pots, and the experiment is repeated for three times.

The method comprises the following specific steps:

1. adding 100g of soil into each small pot, adding water into the tray, putting 4 seeds into each small pot, covering 50ml of soil, pouring the residual water in the tray after the water is fully absorbed, removing one seedling with uneven growth after the seedlings emerge, adding 1L of water into the tray, pouring the water after the water is fully absorbed, starting drought treatment, observing the drought treatment phenotype of the control and transgenic plants, and the result after one week is shown in figure 1. FIG. 1 shows that the growth of the transgenic over-expressing GRMZM2G121851 plants is better than the control, and the leaf wilting degree is lower than the control, indicating that the transgenic plants are drought resistant than the control.

2. On the basis of the step 1, the watering is continued for 20 days, the normal watering is recovered, the culture is carried out for 7 days, and then the survival rate is counted. Survival rate is the percentage of surviving plants to the total number of plants. Recall that the survival rate of transgenic line OE1 in T3 generation plants is 68.95%, that of transgenic line OE2 in T3 generation plants is 70.11%, and that of wild type is 36.25%.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> university of agriculture in China

<120> drought-resistant related protein of corn and application thereof in plant drought resistance

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4945

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggatcagttc cacgcctgat ccttcgttaa attattctcg ctttgacgcc acagcctttt 60

gcactggcat gtgcttaccc tctgagggaa cgtgccatgt ctacccttcc tgcagtgaca 120

tctttattat ctctacaccc ctttcctgtt atgagtgtat ttactgttcc tctacttggc 180

ctggtctcga tctgatcgaa ctcttggctg ttgttacggc tgcgaaaaaa gagttgcctg 240

caggctgcag tccgccaatt catcgacgcc tgcaagttgt ccaggttcaa tgcaccgata 300

ttctattgca cgtggttgca aagtttatgt aatttattta tgttgttttg gttgatgggt 360

tgcattgttg caagattatt ttagcttggt caccggtcag gaattgtggc tggtatctta 420

aaacggaaca aagcagacca cttgctgtta ctaggctctt aattaaaaga atgctggcct 480

ggggccgacc cggcctgcct ccgagtggac cggtcgtgcc gtaccgccca tctgcccgcc 540

cccaacggcc caccagagga acccgaggtc attttgtgga cgggaaagga aaagaaaagt 600

aatgtatttc catggaaccg aacgcgtgct gcgcctcctg tacggcgcgg aggtaggtca 660

agccgcggtt gggacgcggt gtggcgtggg cgagccgaac caagcggcga tcgatcgaaa 720

cgaggcgtcg cgtggcagcc ggagatgtcg cagaagaggc agccggagga gggcgacgtc 780

ccgcggcgcg ccgccgatgc cggcggcggc ggcggaggag acgagcccgg tgggagctcg 840

tcgcgctcct ctctgcccca gcgccacggc gagccgaagc ggcagaggat cgcccttcgc 900

gagtgagttt gtcctccccc gcgcgccctg gattgggtcg cgccgattcg tgcgccgcgc 960

tctctgattc gatgcgccgt ggtgacttgg attgttcccc ccttgcagtg tgatcacgga 1020

ggtgatgcgg aacaccagca tcgagaagtt tctaatcgcg ctcgagcccc tcatcaggag 1080

agtggtgaga ccgccttttt tatcttttac tatctgcccc atttctcact tcagtccttc 1140

ttgaatggaa attcatagga ttggatagtg atctgatgtg agccctctag gttgtttgcc 1200

tttcctcttg ttggatacat aacgatacat agtgctgttg taatcccatc tgcatgtgtg 1260

gctgattggc actctgatat tggttttggc aagagcaagt tcttctttcc ctcccaaact 1320

actatctgag aagctaaggc atttatctgt atcgtattaa tagctctata ggctttgctg 1380

tcatgattgt atccataatg attccagcct tacaaaataa ggcttggctt cactgtttcc 1440

gatgtgttca gccattccaa ttcagtgata attttacagt gggctacatc atatgttctc 1500

cttgaaccat ttgcttattt tagccatcta ctgctaccag tggggtttga tagtctattc 1560

atttctaggt aaaagaagaa attgagtcgg cttttgcaaa ccatgcctct atgatggcaa 1620

ggtatggagt ttaaacactg cttttgacaa ccaccatgat ttgttattgg tcgctgtatc 1680

tctaataagt ttatttctta tttttcatta ggagtgtcac agacagtgtt ccatctgtgt 1740

caaagaattt gcagctgcag ttcatgacca gactttctct tccaatattt actggatcca 1800

agattgaagg agagggctcc ttaagtataa ctattgctct agtcgacgct ttgacaagac 1860

aaattgtagc accaggcaaa gagttccaga taaaggtcga gattgtagtt ctggaggggg 1920

attttgaaag tggagaagat gatgactgga cagctcagga gtttaacaat aacattgtta 1980

aagaaagaga aggcaaaagg cccttgattt ctggggatgc attcattgcc ctcgtcgatg 2040

gcattggaac agtaggggaa ctttcattca cagataactc cagctggaca cggagccgaa 2100

agttcaggct aggagcaaga acagaggatg gttctttcaa tggtgtaaga gtacgggaag 2160

caaaaactga atcatttgtg gttaaggacc atcgaggaga atgtgagttt attattggat 2220

ttttaaaatt ttaatgccca agctatcctt ttactttgtt gcctttttgc tctgctagac 2280

tcattctagg ttcaagaacg atttggcgta gtggtactta attcaacaat ttcatgaaaa 2340

ataaatgaat tctttcttgt cctctactgt ctagacttag ttctagttga ggaagactag 2400

ttgaggtgga aagtatgatc atgcacccaa tcttcaccga ggtttgtgtc ctcttgaact 2460

taaatttggg tgcctatttt cttcttaggg ctagtttggg aaccacattt tcccaagggt 2520

ttttcgtttt cccaaggtaa attagttcat tttcccttgg gaaattgaaa accccatgga 2580

aaaatgcggt tgccaaacta gcccttaatg aaaaaaccta gtttttccta gtatgttctc 2640

aactttcccc tctagactta gttttgtagt atgtttcctt aaatatctac tgatctacat 2700

ctccaattga atgatgagac atgctatttc cctgaatact tctaaaatgg tgtaatttaa 2760

ttgattacct cctattgacc agtgtacaag aagcaccacc caccatttct tgaagatgaa 2820

gtctggcgcc tagagaaaat tggcaaggaa ggtgcttttc acaagcgttt gaatagggag 2880

aacatttgca ctgtcaaaga ttttctcacc ttgttaaatc ttgatgcttc taggcttcga 2940

aaggtattgt tcttgtcttc tattgttttt ctgatgttct gtatattgtt gtctatggta 3000

gttgcagttc agcaaagatg tgtattacta accctgcttt atgtccaaat cgtgcagata 3060

ttaggtggtg gcatgtcaac aaagatgtgg gaggccactg tggaacatgc aaaaacatgt 3120

gttctaactg acaaagtgca tcactactat cctgatggtc taaacaaagc tggtgttgta 3180

ttcaatgtag ttggagaagt aagagggtta atatctgata aatatgtttt tgttgatgac 3240

tttactgaaa aggagaaggt aaccatgttg cattgctttc caagttttct ttaaacaagt 3300

ccatccattt tccttatatg cccacctttt ctgacccgga ccatgtgttt ttacatgttt 3360

gctgtttgcc tattttcagg ccgaagcacg tgcagcagtg aagcaagcat atgaacactg 3420

gaaggatgtc catacttgtg acaatgaaac gcttgtggaa aacccttcac atccattcaa 3480

tttgggatct ccatctttgc atgaaaatca gtataaccag ttgcccacac aagtttctac 3540

tgatggtttt agtttgagca attcggccat actatcaccc aacattttct caatggagcc 3600

atcgagtgct ttagaccctt gtagtatatt ggagactgaa gaaagcagtg ctaatcaatt 3660

tcagtcggtg ttgcccccag ttggtggcca tgaagtgccc cgagaacctc agacgctgga 3720

taagttctcc aactcgttgg tatatgatga ctgcagcgcc catccctcat tcagtgaaag 3780

ctattacagc actgtagatc caagcatgtc cttcgacaca caagatcttg gagctgcact 3840

gaaaggcttc attgcaacca tatcgaagcc taaggcggca tatagaggat ggagaacatt 3900

gtcttatgtg ctaggatgga ttttctatac caagagaatt gttgcaagga gaaagaaaca 3960

tgggaaataa gtgaacacaa gtctttgtgt agttaaatgc gaatataagc ttagagaatg 4020

agagattatg tacattagtt tgtttcttgt cacagctggt aagctctgct ggtttcttca 4080

gctgtacatg ggctgtcagc tatggttcgc tatgcggctg taaataatca aatgaagttt 4140

gtacagggtg agggatgcgc atagcatttc tgatgttttg gatggatgcc ggagcttgct 4200

ttttgatgcg gcccgtgtat tatctatgta gtagtatgca gtatgctgct taattctgca 4260

gtattttcga catttggaat ctatatgtcg catggtaaca agtttaattc tgcttatttt 4320

cgtacacaga taatactgca gaattaccat gccgcaaact gatttttatg tagacagtaa 4380

tgtgtttatg gatatggttg acacttaaat aaaaagctgg gcagcgtgca catgccattt 4440

acaatagaga tttgccttgc gcgggaaatt gtattccatt tacagtagag tcttgccttg 4500

aacaacaatg ttcgatgtgg tgggataact gacttgatcc tacaactacc atagtagcta 4560

atctccccgt tgctcgtatg actagtaaca cacttgagga gcacagataa acatattgct 4620

gctactctgg atatacgggt atgcgtactt cttgttgtgc ttttcttcta ctatgctgtg 4680

tgcctagtga taataattta tgatcctcta ctcacacgtt atcttgcttg gtatggtaaa 4740

tatgctagtg catagtgtaa ttaaaaatgg ttgttttacg agaataatat attgatttcc 4800

gttttaatgc atgcactttc atttaaaatt gagttgagta gaacttgaag taatctataa 4860

aaaatgctgt acctctagaa caattggcac aaggtcctgg actgtttttt gtatggttct 4920

tatattgaat agcacaaaaa aattt 4945

<210> 2

<211> 576

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ser Gln Lys Arg Gln Pro Glu Glu Gly Asp Val Pro Arg Arg Ala

1 5 10 15

Ala Asp Ala Gly Gly Gly Gly Gly Gly Asp Glu Pro Gly Gly Ser Ser

20 25 30

Ser Arg Ser Ser Leu Pro Gln Arg His Gly Glu Pro Lys Arg Gln Arg

35 40 45

Ile Ala Leu Arg Asp Val Ile Thr Glu Val Met Arg Asn Thr Ser Ile

50 55 60

Glu Lys Phe Leu Ile Ala Leu Glu Pro Leu Ile Arg Arg Val Val Lys

65 70 75 80

Glu Glu Ile Glu Ser Ala Phe Ala Asn His Ala Ser Met Met Ala Arg

85 90 95

Ser Val Thr Asp Ser Val Pro Ser Val Ser Lys Asn Leu Gln Leu Gln

100 105 110

Phe Met Thr Arg Leu Ser Leu Pro Ile Phe Thr Gly Ser Lys Ile Glu

115 120 125

Gly Glu Gly Ser Leu Ser Ile Thr Ile Ala Leu Val Asp Ala Leu Thr

130 135 140

Arg Gln Ile Val Ala Pro Gly Lys Glu Phe Gln Ile Lys Val Glu Ile

145 150 155 160

Val Val Leu Glu Gly Asp Phe Glu Ser Gly Glu Asp Asp Asp Trp Thr

165 170 175

Ala Gln Glu Phe Asn Asn Asn Ile Val Lys Glu Arg Glu Gly Lys Arg

180 185 190

Pro Leu Ile Ser Gly Asp Ala Phe Ile Ala Leu Val Asp Gly Ile Gly

195 200 205

Thr Val Gly Glu Leu Ser Phe Thr Asp Asn Ser Ser Trp Thr Arg Ser

210 215 220

Arg Lys Phe Arg Leu Gly Ala Arg Thr Glu Asp Gly Ser Phe Asn Gly

225 230 235 240

Val Arg Val Arg Glu Ala Lys Thr Glu Ser Phe Val Val Lys Asp His

245 250 255

Arg Gly Glu Leu Tyr Lys Lys His His Pro Pro Phe Leu Glu Asp Glu

260 265 270

Val Trp Arg Leu Glu Lys Ile Gly Lys Glu Gly Ala Phe His Lys Arg

275 280 285

Leu Asn Arg Glu Asn Ile Cys Thr Val Lys Asp Phe Leu Thr Leu Leu

290 295 300

Asn Leu Asp Ala Ser Arg Leu Arg Lys Ile Leu Gly Gly Gly Met Ser

305 310 315 320

Thr Lys Met Trp Glu Ala Thr Val Glu His Ala Lys Thr Cys Val Leu

325 330 335

Thr Asp Lys Val His His Tyr Tyr Pro Asp Gly Leu Asn Lys Ala Gly

340 345 350

Val Val Phe Asn Val Val Gly Glu Val Arg Gly Leu Ile Ser Asp Lys

355 360 365

Tyr Val Phe Val Asp Asp Phe Thr Glu Lys Glu Lys Ala Glu Ala Arg

370 375 380

Ala Ala Val Lys Gln Ala Tyr Glu His Trp Lys Asp Val His Thr Cys

385 390 395 400

Asp Asn Glu Thr Leu Val Glu Asn Pro Ser His Pro Phe Asn Leu Gly

405 410 415

Ser Pro Ser Leu His Glu Asn Gln Tyr Asn Gln Leu Pro Thr Gln Val

420 425 430

Ser Thr Asp Gly Phe Ser Leu Ser Asn Ser Ala Ile Leu Ser Pro Asn

435 440 445

Ile Phe Ser Met Glu Pro Ser Ser Ala Leu Asp Pro Cys Ser Ile Leu

450 455 460

Glu Thr Glu Glu Ser Ser Ala Asn Gln Phe Gln Ser Val Leu Pro Pro

465 470 475 480

Val Gly Gly His Glu Val Pro Arg Glu Pro Gln Thr Leu Asp Lys Phe

485 490 495

Ser Asn Ser Leu Val Tyr Asp Asp Cys Ser Ala His Pro Ser Phe Ser

500 505 510

Glu Ser Tyr Tyr Ser Thr Val Asp Pro Ser Met Ser Phe Asp Thr Gln

515 520 525

Asp Leu Gly Ala Ala Leu Lys Gly Phe Ile Ala Thr Ile Ser Lys Pro

530 535 540

Lys Ala Ala Tyr Arg Gly Trp Arg Thr Leu Ser Tyr Val Leu Gly Trp

545 550 555 560

Ile Phe Tyr Thr Lys Arg Ile Val Ala Arg Arg Lys Lys His Gly Lys

565 570 575

<210> 3

<211> 1731

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgtcgcaga agaggcagcc ggaggagggc gacgtcccgc ggcgcgccgc cgatgccggc 60

ggcggcggcg gaggagacga gcccggtggg agctcgtcgc gctcctctct gccccagcgc 120

cacggcgagc cgaagcggca gaggatcgcc cttcgcgatg tgatcacgga ggtgatgcgg 180

aacaccagca tcgagaagtt tctaatcgcg ctcgagcccc tcatcaggag agtggtaaaa 240

gaagaaattg agtcggcttt tgcaaaccat gcctctatga tggcaaggag tgtcacagac 300

agtgttccat ctgtgtcaaa gaatttgcag ctgcagttca tgaccagact ttctcttcca 360

atatttactg gatccaagat tgaaggagag ggctccttaa gtataactat tgctctagtc 420

gacgctttga caagacaaat tgtagcacca ggcaaagagt tccagataaa ggtcgagatt 480

gtagttctgg agggggattt tgaaagtgga gaagatgatg actggacagc tcaggagttt 540

aacaataaca ttgttaaaga aagagaaggc aaaaggccct tgatttctgg ggatgcattc 600

attgccctcg tcgatggcat tggaacagta ggggaacttt cattcacaga taactccagc 660

tggacacgga gccgaaagtt caggctagga gcaagaacag aggatggttc tttcaatggt 720

gtaagagtac gggaagcaaa aactgaatca tttgtggtta aggaccatcg aggagaattg 780

tacaagaagc accacccacc atttcttgaa gatgaagtct ggcgcctaga gaaaattggc 840

aaggaaggtg cttttcacaa gcgtttgaat agggagaaca tttgcactgt caaagatttt 900

ctcaccttgt taaatcttga tgcttctagg cttcgaaaga tattaggtgg tggcatgtca 960

acaaagatgt gggaggccac tgtggaacat gcaaaaacat gtgttctaac tgacaaagtg 1020

catcactact atcctgatgg tctaaacaaa gctggtgttg tattcaatgt agttggagaa 1080

gtaagagggt taatatctga taaatatgtt tttgttgatg actttactga aaaggagaag 1140

gccgaagcac gtgcagcagt gaagcaagca tatgaacact ggaaggatgt ccatacttgt 1200

gacaatgaaa cgcttgtgga aaacccttca catccattca atttgggatc tccatctttg 1260

catgaaaatc agtataacca gttgcccaca caagtttcta ctgatggttt tagtttgagc 1320

aattcggcca tactatcacc caacattttc tcaatggagc catcgagtgc tttagaccct 1380

tgtagtatat tggagactga agaaagcagt gctaatcaat ttcagtcggt gttgccccca 1440

gttggtggcc atgaagtgcc ccgagaacct cagacgctgg ataagttctc caactcgttg 1500

gtatatgatg actgcagcgc ccatccctca ttcagtgaaa gctattacag cactgtagat 1560

ccaagcatgt ccttcgacac acaagatctt ggagctgcac tgaaaggctt cattgcaacc 1620

atatcgaagc ctaaggcggc atatagagga tggagaacat tgtcttatgt gctaggatgg 1680

attttctata ccaagagaat tgttgcaagg agaaagaaac atgggaaata a 1731

Claims

1. A protein which is previously related to corn drought resistance, wherein the protein is GRMZM2G121851 protein, and the GRMZM2G121851 protein is any one of the following proteins b1) -b 3):

b1) the amino acid sequence is protein of SEQ ID No.2 in a sequence table;

2. The related biomaterial of GRMZM2G121851 protein as set forth in claim 1, which is any one of the following B1) to B9):

B1) a nucleic acid molecule encoding the GRMZM2G121851 protein of claim 1;

B2) an expression cassette comprising the nucleic acid molecule of B1);

3. The related biological material as claimed in claim 2, wherein the nucleic acid molecule of B1) is any one of the following a1) -a 3):

a1) the coding region is a DNA molecule shown as SEQ ID No. 3;

4. Use of the protein of claim 1 or the related biological material of claim 2 or 3 for modulating drought resistance in a plant.

5. Use of the protein of claim 1 or the related biological material of claim 2 or 3 for breeding drought resistant plant varieties.

6. A method for cultivating a plant with high drought resistance, which is characterized by comprising the following steps: comprising promoting or increasing the expression of a nucleic acid of a GRMZM2G121851 protein of claim 1 in a plant of interest, said plant of interest being a plant comprising a nucleic acid of a GRMZM2G121851 protein of claim 1, to obtain a highly drought resistant plant, said highly drought resistant plant having a drought resistance higher than the drought resistance of said plant of interest.

7. A method of plant breeding comprising the steps of: increasing the content and/or activity of the protein according to claim 1 in the target plant, thereby increasing the drought resistance of the plant.

8. The use according to claim 4 or 5 or the method according to claim 6 or 7, characterized in that: the plant is a monocotyledon or a dicotyledon.

9. The use according to claim 4 or 5 or the method according to claim 6 or 7, characterized in that: the plant is corn.