CN116622666A

CN116622666A - Method for regulating drought resistance of plants and application of TaMPK3 in regulating drought resistance of plants

Info

Publication number: CN116622666A
Application number: CN202210133034.2A
Authority: CN
Inventors: 徐兆师; 刘�英; 于太飞; 郑雷; 李宜统; 陈隽; 陈明; 周永斌; 马有志
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2022-02-14
Filing date: 2022-02-14
Publication date: 2023-08-22

Abstract

The application discloses a method for regulating and controlling drought resistance of plants and application of TaMPK3 in regulating and controlling drought resistance of plants, and belongs to the technical field of biological breeding. The application provides TaMPK3 or a substance for regulating and controlling expression of a TaMPK3 coding gene or application of a substance for regulating and controlling activity or content of the TaMPK3 in regulating and controlling drought resistance of plants, wherein the TaMPK3 is a protein with an amino acid sequence shown as a sequence 1 in a sequence table. The application also provides a method for regulating drought resistance of plants, which comprises regulating expression of the TaMPK3 coding gene in target plants or regulating activity or content of the TaMPK3 in target plants. The result shows that the drought resistance of the wheat is reduced by the overexpression of the TaMPK3, and the drought resistance of the wheat is obviously improved after the interference of the TaMPK 3; taMPK3 can regulate and control drought resistance of wheat.

Description

Method for regulating drought resistance of plants and application of TaMPK3 in regulating drought resistance of plants

Technical Field

The application belongs to the technical field of biological breeding, and particularly relates to a method for regulating and controlling drought resistance of plants and application of TaMPK3 in regulating and controlling drought resistance of plants.

Background

Wheat, one of the three major crops, provides about 19% of dietary calories worldwide. Drought poses a significant threat to agriculture worldwide, particularly to field crop productivity, due to climate change and increasingly severe water resource shortages. The period of drought stress, the duration of drought and the intensity of drought can have different degrees of influence on crop yield, and drought in reproductive period can directly lead to average yield loss of more than 50%. The plant hormone abscisic acid (ABA) is rapidly produced under drought stress and plays a key role in regulating a wide range of developmental processes. For example, ABA can control stomatal closure to reduce water loss due to transpiration or photosynthesis, reprogram metabolic pathways, increase the accumulation of osmoticum cells and stress response proteins, prevent plant growth, promote leaf senescence, to accommodate extreme environmental stresses. Therefore, understanding the response of wheat to drought stress and the signal transduction mechanism, improving the stress resistance of wheat varieties, becomes one of important tasks of wheat genetic research and wheat variety improvement.

The adaptation of plants to drought stress depends not only on the expression of stress tolerance related genes, but also on the comprehensive regulation and control of various signal pathways induced by drought stress induction. Gene products related to stress can be divided into two main classes: the products coded by the first type of genes comprise gene products directly involved in plant stress response, such as ion channel proteins, aquaporins, osmotic adjusting factors (sucrose, proline, betaine and the like) synthetases and the like; the products encoded by the second class of genes include protein factors involved in stress-related signaling and regulation of gene expression, such as protein kinases, transcription factors, and the like. Among them, key enzymes in metabolic pathways related to the production of osmotic factors and small molecule compounds play an important role in regulating plant stress. When abiotic stress comes, the activity of the transcription factor in the metabolic pathway of the plant body and the key enzyme in the metabolic process is changed, so that the metabolic process mediated by the transcription factor and the metabolic product produced in the process are correspondingly changed, namely the expression quantity of the stress-resistant metabolic product is increased. That is, when the plant is stimulated by abiotic stress, a secondary signal molecule is generated outside the cell membrane, and then the signal molecule stimulates the intracellular membrane to sequentially generate phosphorylated protein molecules, and then a key enzyme gene in a metabolic pathway is started, so that the activity of the key enzyme gene is increased to regulate the stress resistance of the plant.

Disclosure of Invention

The application aims to solve the technical problem of how to regulate and control drought resistance of plants.

In order to solve the technical problems, in a first aspect, the application provides an application of TaMPK3 or a substance for regulating and controlling the expression of a TaMPK3 coding gene or a substance for regulating and controlling the activity or content of the TaMPK3 in regulating and controlling drought resistance of plants,

the TaMPK3 is any one of the following proteins a 1) to a 3):

a1 Protein with amino acid sequence shown as sequence 1 in a sequence table;

a2 Protein related to drought resistance of plants is obtained by substituting and/or deleting and/or adding amino acid residues in the amino acid sequence shown in the sequence 1 in the sequence table;

a3 A) a protein which has 80% or more identity with the protein represented by a 1) or a 2) and is related to drought resistance of a plant.

Further, the above protein is derived from wheat.

Further, in the above application, the regulation of drought resistance of plants is to increase drought resistance of plants, the regulation of expression of TaMPK3 encoding genes is to inhibit the expression of TaMPK3 encoding genes, and the regulation of activity or content of TaMPK3 is to inhibit or reduce the activity or content of TaMPK3.

Further, in the above application, the substance that inhibits or reduces the expression of the gene encoding TaMPK3 is any one of the following:

a1 A nucleic acid molecule which inhibits or reduces the expression of the gene encoding TaMPK 3;

a2 Expression of a gene encoding the nucleic acid molecule of A1);

a3 An expression cassette containing the coding gene of A2);

a4 A recombinant vector comprising the coding gene of A2) or a recombinant vector comprising the expression cassette of A3);

a5 A) a recombinant microorganism comprising the gene encoding A2), or a recombinant microorganism comprising the expression cassette of A3), or a recombinant microorganism comprising the recombinant vector of A4);

a6 A) a transgenic plant cell line containing the coding gene of A2), or a transgenic plant cell line containing the expression cassette of A3), or a transgenic plant cell line containing the recombinant vector of A4);

a7 A) a transgenic plant tissue containing the coding gene of A2), or a transgenic plant tissue containing the expression cassette of A3), or a transgenic plant tissue containing the recombinant vector of A4);

a8 A) a transgenic plant organ containing the coding gene of A2), or a transgenic plant organ containing the expression cassette of A3), or a transgenic plant organ containing the recombinant vector of A4).

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

A1 The inhibition or reduction of expression of the TaMPK3 encoding gene may be achieved by gene knockout or gene silencing.

The gene knockout (geneknockout) refers to a phenomenon in which a specific target gene is inactivated by homologous recombination. Gene knockout is the inactivation of a particular target gene by a change in DNA sequence.

The gene silencing refers to the phenomenon that the gene is not expressed or expressed under the condition of not damaging the original DNA. Gene silencing is premised on the fact that the DNA sequence is not altered, so that the gene is not expressed or is underexpressed. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level due to DNA methylation, heterochromatin, and positional effects, and the other is post-transcriptional gene silencing, i.e., inactivation of a gene by specific inhibition of a target RNA at the post-transcriptional level of the gene, including antisense RNA, co-suppression (co-suppression), gene suppression (sequencing), RNA interference (RNAi), and microrna (miRNA) -mediated translational inhibition, among others.

Among the above, the recombinant microorganism of A5) may be specifically yeasts, bacteria, algae and fungi.

Among the above, the plant tissue of A7) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

Among the above, the transgenic plant organs described in A8) can be the roots, stems, leaves, flowers, fruits and seeds of transgenic plants.

Among the above, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs may or may not include propagation material.

Further, in the above application:

b1 The nucleic acid molecule A1) is a double-stranded RNA molecule, and one strand sequence of the double-stranded RNA molecule is a sequence obtained by transcribing a DNA fragment from 10 th to 411 th positions of a sequence 3 in a sequence table;

one strand sequence of the double-stranded RNA molecule is a nucleic acid molecule consisting of 402 ribonucleotides obtained by replacing all T in positions 10 to 411 of sequence 3 with U and all deoxyribonucleotides A, G and C with ribonucleotides A, G and C.

B2 The coding genes of the A2) are shown as the formula (I):

SEQ forward-X-SEQ reverse formula (I);

the sequence of the SEQ forward direction is 10 th-411 th of the sequence 3 in the sequence table; the sequence of the SEQ reverse direction is reversely complementary to the sequence of the SEQ forward direction; and X is a spacer sequence between the SEQ forward direction and the SEQ reverse direction, and is not complementary with both the SEQ forward direction and the SEQ reverse direction.

Further, the nucleotide sequence of the coding gene of A2) is shown as the 10 th to 965 th positions of the sequence 3 in the sequence table.

Further, in the above application, the TaMPK3 encoding gene is b 1) or b 2) as follows:

b1 The coding sequence of the coding chain is a DNA molecule shown as a sequence 2 in a sequence table;

b2 A DNA molecule which has more than 80% identity with the DNA molecule of b 1) and encodes the same functional protein.

In the above applications, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp or blastn as a program, setting the aspect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating the identity, and then obtaining the value (%) of the identity.

In such applications, the 80% identity or more may be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity.

In order to solve the technical problem, in a second aspect, the application provides a method for regulating drought resistance of plants, which comprises regulating expression of a TaMPK3 coding gene in a target plant or regulating activity or content of the TaMPK3 in the target plant.

Further, in the above method, the regulation of drought resistance of the plant is to increase drought resistance of the plant, and the regulation of expression of a TaMPK3 encoding gene or the regulation of activity or content of TaMPK3 is to inhibit expression of the TaMPK3 encoding gene in the target plant or to inhibit or reduce activity or content of TaMPK3 in the target plant.

Further, in the above method, the method comprises expressing the double stranded RNA molecule of B1) in the plant of interest.

Further, in the above method, the regulation of drought resistance of the plant is to reduce drought resistance of the plant, and the regulation of expression of a TaMPK3 encoding gene or the regulation of activity or content of the TaMPK3 is to increase expression of the TaMPK3 encoding gene or increase activity or content of the TaMPK3.

In the above method, the improvement of the expression of the TaMPK3 coding gene or the improvement of the activity or content of the TaMPK3 can be achieved by introducing the TaMPK3 coding gene into the target plant.

To solve the above technical problems, the present application in a third aspect provides the TaMPK3 or the TaMPK3 coding gene in the above application, or the substance inhibiting or reducing the expression of the TaMPK3 coding gene in the above application.

Further, the plant of the present application is selected from the following group P1) -P4):

p1) monocotyledonous plants;

p2) a gramineous plant;

p3) wheat plants;

p4) wheat.

The drought resistance enhancement in the application is embodied as follows:

(1) The proline content is high;

(2) The content of malondialdehyde is low;

(3) The survival rate is high;

(4) The yield of the single plant is increased;

(5) The tillering number is increased;

(6) The thousand grain weight increases.

The results show that: the drought resistance of wheat is reduced by the overexpression of TaMPK3, and the drought resistance of wheat is obviously improved after the interference of TaMPK 3; taMPK3 can regulate and control drought resistance of wheat. The method provided by the application can be used for obtaining TaMPK3 interference wheat with obviously enhanced drought resistance and transgenic wheat with obviously reduced drought resistance, and the obtained wheat can be used for production and scientific research.

Drawings

FIG. 1 shows strain expression analysis and transgene insertion site identification of TaMPK3 gene-transferred wheat.

FIG. 2 is an analysis of sensitivity of TaMPK3 gene-transferred wheat to ABA during germination.

FIG. 3 is an analysis of sensitivity of TaMPK3 gene-transferred wheat to ABA at seedling stage.

FIG. 4 is an analysis of sensitivity of TaMPK3 gene-transferred wheat and TaMPK3 gene-interfered wheat to drought stress at seedling stage.

FIG. 5 is an analysis of sensitivity of TaMPK3 gene-disrupted wheat transformed with TaMPK3 gene to drought stress during seedling stage.

Detailed Description

The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

pEASY-Blunt Blunt end cloning vector (TransGen Biotech, CB 101-01) and Trans1-T1 E.coli competence (TransGen Biotech, CD 501-02): the method is mainly used for gene cloning and sequencing.

Wheat field and plant binary expression vector pWMB110 are provided by The national academy of agricultural sciences She Xingguo teacher laboratory and are disclosed in The literature "Wang K, shi L, liang X, zhao P, wang W, liu J, chang Y, hiei Y, yanagihara C, du L, ishida Y, ye X (2022)," The gene TaWOX5 overcomes genotype dependency in wheat genetic transformation. Nat plants. Doi:10.1038/s41477-021-01085-8. "and The doctor's academic paper" cloning and functional analysis of genes related to Agrobacterium transformation and tissue culture regeneration, respectively, and The above biological materials are available to The public from The applicant, and are only used for experiments of The duplicate application, but are not used for other purposes.

Example 1, taMPK3 protein and acquisition of the Gene encoding it

The primers were designed by Primer Premier 5 with reference to TaMPK3 gene sequence of China spring published by Ensembl website (TraescS 4D02G 198600), and the specificity of the primers was verified by NCBI and WheatOmics website, then gene cloning was performed by using cDNA of common wheat 60 as a template, and then the cloned fragment was connected to intermediate cloning vector pEASY-Blunt, and TaMPK3 gene sequence was verified by sequencing.

Wheat seedlings are grown for about 7 days under normal conditions, and the leaves are taken and quickly frozen by liquid nitrogen and stored at the temperature of minus 80 ℃ for standby.

The total RNA of the wheat leaves is extracted by adopting a rapid extraction kit (ZOMANBIO, ZP 405-1) for total RNA of the plants, and cDNA is synthesized by removing gDNA and synthesizing cDNA mixed solution (AT 311-02) of the full gold company in one step. The PCR products were detected by electrophoresis on a 1.0% agarose gel.

And obtaining a sequence 2 in the sequence table by a PCR method. The DNA molecule shown in the sequence 2 in the sequence table codes the protein shown in the sequence 1 in the sequence table.

The protein shown in the sequence 1 in the sequence table is named as TaMPK3 protein. The gene for encoding the TaMPK3 protein is named as the TaMPK3 gene, and the encoding frame is shown as a sequence 2 of a sequence table.

Example 2 obtaining TaMPK 3-transformed wheat

1. Construction of recombinant overexpression vectors

1. Extracting total RNA of the leaf of the Jimai 60 wheat, and carrying out reverse transcription to obtain cDNA.

2. The cDNA in the above step 1 was used as a template, primers specific to the 5'UTR and 3' UTR of the TaMPK3 gene were designed to amplify the gene, and PCR products were recovered. The amplification primers were as follows:

TaMPK3-F：5'-CTCAGCCTCATCCCGTTGC-3'；

TaMPK3-R：5'-GAAATCATACTATTGGGGGTAACTA-3'。

3. the PCR product amplified and recovered as described above was ligated with pEASY-Blunt vector (full gold, beijing) and transformed into E.coli competent cells, which were plated on solid LB medium plates containing 50. Mu.g/L kanamycin, and cultured overnight at 37 ℃. And (3) performing bacterial liquid PCR detection on the clone colony of the escherichia coli, sending positive clones to a company for sequencing, and preserving bacterial liquid with correct sequencing to obtain the pEASY-Blunt-TaMPK3 plasmid.

4. And (3) taking the plasmid obtained in the step (3) as a template, adopting a primer pair consisting of TaMPK3-110-F and TaMPK3-110-R to carry out PCR amplification to obtain a PCR amplification product, and carrying out gel recovery of the PCR amplification product.

TaMPK3-110-F：5'-CGACTCTAGAGGATCCATGGACGGCGCTCCGGT-3'；

TaMPK3-110-R：5'-GGGTACCCGGGGATCCCTAGTATCGGAAGTTGG-3'。

5. The vector pWMB110 was digested with the restriction enzyme BamHI to recover the vector backbone.

6. The PCR product of step 4 and the vector backbone of step 5 were ligated using the In-Fusion technique of Takara Co., ltd.) to obtain recombinant plasmid pWMB110-TaMPK3. Based on the sequencing results, the recombinant plasmid pWMB110-TaMPK3 was structurally described as follows: DNA molecules shown in sequence 2 of a sequence table are inserted into BamHI enzyme cutting sites of a vector pWMB 110.

2. Construction of recombinant interference vector

1. The forward sequence (1 st to 411 rd bit of sequence 3, including Sma I restriction site and protecting base, 412 bp), the intermediate intron sequence (412 th to 563 rd bit of sequence 3, 152 bp) and the reverse sequence (564 th to 972 nd bit of sequence 3, including Sac I restriction site and protecting base, 409 bp) of the MAPK3 RNAi interference fragment shown in sequence 3 in the sequence table are synthesized directly. After sequence synthesis, constructing the sequence on an intermediate cloning vector pEASY-Blunt to obtain MAPK3-RNAi-pEASY-Blunt plasmid, extracting MAPK3-RNAi-pEASY-Blunt plasmid, and then carrying out double digestion with SmaI and SacI to obtain MAPK3-RNAi fragments with SmaI and SacI double digested sticky ends.

2. The vector pWMB110 was digested with restriction enzymes SmaI and SacI, and the vector backbone was recovered.

3. The MAPK3-RNAi fragment product of step 1 and the vector backbone of step 2 were purified using Solution I (T) ₄ Ligase) to obtain recombinant plasmid pWMB110-TaMPK3-RNAi. pWMB110-TaMPK3-RNAi contains a DNA molecule of formula (I):

SEQ forward-X-SEQ reverse formula (I);

The pWMB110-TaMPK3-RNAi expresses double-stranded RNA molecule, and one strand sequence of the double-stranded RNA molecule is a sequence obtained by transcribing a DNA fragment from 10 th position to 411 th position of the sequence 3 in a sequence table. One strand sequence of the double-stranded RNA molecule is a nucleic acid molecule consisting of 402 ribonucleotides obtained by replacing all T in positions 10 to 411 of sequence 3 with U and all deoxyribonucleotides A, G and C with ribonucleotides A, G and C.

4. The detection primers (located within the intron) after successful vector construction were:

JianF：5'-GCCCCTAAGACAGATAAGCCGC-3'；

JianR：5'-CCAAGGTATCTAATCAGCCATC-3'。

3. TaMPK3 overexpression and interference in the acquisition of transgenic wheat

1. Recombinant plasmids pWMB110-TaMPK3 and pWMB110-MAPK3-RNAi are respectively introduced into the agrobacterium tumefaciens EHA105 to obtain recombinant agrobacterium tumefaciens EHA105/pWMB110-TaMPK3 and recombinant agrobacterium tumefaciens EHA105/pWMB110-MAPK3-RNAi.

2. The recombinant Agrobacterium obtained in step 1 was inoculated into liquid YEP medium, respectively, and cultured at 28℃for about 3 hours with shaking at 220 rpm.

3. After completion of step 2, the cells were collected and uniformly spread on solid YEP medium containing 50. Mu.g/L rifampicin and 50. Mu.g/L kanamycin, respectively, and cultured upside down at 28℃for 3 days.

4. After the step 3 is completed, the monoclonal bacteria are picked up and respectively cultured in liquid YEP culture medium containing 50 mug/L rifampicin and 50 mug/L kanamycin at 28 ℃ for 8 hours by shaking at 220rpm, bacterial liquid PCR detection is carried out on the clone colony of the agrobacterium, and positive colony is preserved.

5. After the completion of step 4, wheat "Fielder" transformation was performed with reference to the wheat transformation method of japan tobacco corporation, respectively. The main steps were carried out according to The references "Wang K, shi L, liang X, zhao P, wang W, liu J, chang Y, hiei Y, yanagihara C, du L, ishida Y, ye X (2022). The gene TaWOX5 overcomes genotype dependency in wheat genetic transformation. Nat plants. Doi:10.1038/s41477-021-01085-8.

6. T to be screened ₀ Sowing the wheat, and obtaining the plant T ₁ Replacing wheat.

7、T ₁ Selfing wheat and harvesting seeds to obtain T ₁ Seeds of wheat are replaced. T (T) ₁ The plant obtained by seed culture of the wheat is T ₂ Replacing wheat. T (T) ₂ Selfing wheat and harvesting seeds to obtain T ₂ Seeds of wheat are replaced. T (T) ₂ The plant obtained by seed culture of the wheat is T ₃ Replacing wheat.

8. For T ₂ Substituted wheat and sampled T ₃ And carrying out PCR identification on the wheat substitute. If a certain T ₂ Substituted wheat and T obtained by selfing ₃ The generation wheat is positive in PCR identification, and the T is ₂ The wheat generation and the selfing progeny are 1 homozygous wheat strain transformed with TaMPK3 gene. PCR identification method: extracting genomic DNA of leaf blades, carrying out PCR amplification on TaMPK3 over-expressed wheat material by adopting a primer pair consisting of vector universal primers 110-JC-F and 110-JC-R, and if an amplification product of about 1300bp is obtained, identifying positive for PCR. TaMPK3 interference wheat material adopts a primer pair consisting of a vector universal primer 110-JC-F and JianR to carry out PCR amplification, and if an amplification product of about 500bp is obtained, the PCR identification is positive.

110-JC-F：5'-CCCTGTTGTTTGGTGTTACTTCTG-3'；

110-JC-R：5'-ATTGCGGGACTCTAATCATA-3'；

JianR：5'-CCAAGGTATCTAATCAGCCATC-3'。

4. Detection of relative expression level of TaMPK3 Gene (FIG. 1 (a), (b))

After the first to third steps are completed, wheat 'field' and T are taken ₃ And (3) extracting total RNA from the leaves of the wheat, carrying out reverse transcription to obtain cDNA, carrying out qRT-PCR by using a cDNA template, and detecting the relative expression quantity of the TaMPK3 gene by using an action gene as an internal reference gene.

The primers used to detect the TaMPK3 gene were as follows:

RT-TaMPK3-F：5'-AGATGGTGGCAATCAAGAAGA-3'；

RT-TaMPK3-R：5'-GCCTACTATGTTCTCGTGGTCG-3'。

the primers used for detecting the action gene are as follows:

RT-Actin-F：5'-CCTCTCTGCGCCAATCGT-3'；

RT-Actin-R：5'-TCAGCCGAGCGGGAAATTGT-3'。

the results are shown in FIG. 1 (a) and (b). Wherein, (a): the relative gene expression levels of the 16 TaMPK3 over-expressed lines were detected by qPCR. Three independent TaMPK3 overexpression lines (OE-2, OE-6 and OE-11) with the highest expression levels were selected for functional studies. Beta-actin is used as reference gene. Each data point is the average of three experiments (±sd). (b): the relative gene expression levels of 15 TaMPK3-RNAi strains were examined by qPCR. Three independent TaMPK3-RNAi lines i-1, i-3 and i-10 with the lowest expression levels were selected for the experiments of step five, example 3 and example 4 below. Beta-actin is used as reference gene. Each data point is the average of three experiments (±sd).

5. Detection of the insertion position of exogenous Gene (c), (d) in FIG. 1)

Wheat leaves were taken and total DNA was extracted and identified by reference to the Tail-PCR method published in Liu Yaoguang laboratories: tan J, gong Q, yu S, hou Y, zeng D, zhu Q, liu YG (2019) A modified high-efficiency thermal asymmetric interlaced PCR method for amplifying long unknown flanking sequences.J Genet genomics.doi 10.1016/j.jgg.2019.05.002.

Primers used for Tail-PCR:

mLAD1：GCTCACGATGGACTGCTGAGTGGCACCTG(G/C/A)N(G/C/A)NNGGAA

mLAD2：GCTCACGATGGACTGCTGAGTGGCACCTG(G/C/T)N(G/C/T)NNCCTT

mLAD3：GCTCACGATGGACTGCTGAGTGGCACCTG(C/T/A)N(C/T/A)NNAACC

mLAD4：GCTCACGATGGACTGCTGAGTGGCACCTG(G/T/A)N(G/T/A)NNTTGG

mAC0：GAGCTCACGATGGACTGC

mAC1：CGATGGACTGCTGAGT

RB-0a：TAATCGCCTTGCAGCACATCCCCCT(160bp from RB)

RB-1a：CGATGGACTGCTGAGTGGCACCTGCGTAATAGCGAAGAGGCCCGCAC(120bp from RB)

RB-2a：AGTTGCGCAGCCTGAATGGCGAATG(80bp from RB)

LB-0a：ATGACGTGGGTTTCTGGCAGCTGGACTT(334bp from LB)

LB-1a：CGATGGACTGCTGAGTGGCACCTGGTCCTGCCCGTCACCGAGATTTG(281bp from LB)

LB-2a：TCCAGTACTAAAATCCAGATCCCCCGAA(97bp from LB)

the results are shown in FIG. 1 (c) and (d). In fig. 1, (c), (d) show that: schematic representation of T-DNA insertion sites in wheat genome for transgenic lines detected by mhiTAIL-PCR. The mhiTAIL-PCR product purified from agarose gel was cloned into the pEASY-Blunt end cloning vector (TransGen Biotech, CB 101-01) and 6 monoclonal colonies were then selected for sequencing with universal primers (M13F and M13R). The inserted T-DNA is shown in color triangles and the genomic sequences flanking it are shown in lower case letters. The bottom numbers indicate the position of the T-DNA insertion site (bp) and the wheat genome.

M13F：5'-TGTAAAACGACGGCCAGT-3'

M13R：5'-CAGGAAACAGCTATGACC-3'

The TaMPK3 gene and the TaMPK3 gene are transferred to interfere the expression quantity of the TaMPK3 gene in wheat and the position of the TaMPK3 gene inserted into the wheat genome, which indicates that the exogenous gene is successfully integrated into the wheat genome and can be normally transcribed and expressed in transgenic wheat.

Example 3 analysis of wheat sensitivity to ABA

1. Analysis of sensitivity of wheat germination to ABA (FIG. 2)

The wheat seeds are soaked with a proper amount of tap water (without passing through the seeds) for 12 hours to allow the seeds to swell, and then the seeds are washed once with tap water. Wheat seeds were then spread evenly in Fang Min (110 mm. Times.110 mm) containing different concentrations of aqueous ABA solution, each square dish was covered with a layer of filter paper of the same size as the bottom of the dish, and the volume of liquid added to each dish was 10mL, leaving only a small amount of liquid just after wetting the filter paper. ABA treatment concentrations during germination were 0, 1, 5 and 10 μm. The plates were then placed in a wheat tissue culture room at 25℃under 16h light/8 h darkness. Seed germination was observed every 12h, and 2-3d later, the length of the aerial parts was kept under light and counted.

The results are shown in FIG. 2. The results of fig. 2 show that: wheat plants overexpressing TaMPK3 are insensitive to ABA. Wherein, (a-c): the phenotype of TaMPK3 overexpression (OE-2, OE-6 and OE-11) and WT wheat plants after control and different concentrations of ABA treatment. Photographs were taken after 2d incubation in the greenhouse. (d): bar graphs of seedling aerial length under control and ABA treatment were analyzed. There were at least 3 independent replicates per treatment, each replicate containing 8 plants. Each data point is the average of 15 seedlings (+/-SD). Multiple comparisons using one-way ANOVA showed significant differences compared to WT (< p <0.05, < p < 0.01).

2. Sensitivity analysis of wheat seedling stage to ABA (FIG. 3)

As described above, soaking the seeds for 12h swells the seeds and then washing with tap water once. A small amount of water (the degree that each seed can be contacted with a little water is guaranteed) is reserved in a small plastic round dish containing wheat, and the dish cover is covered for about 6 hours at room temperature, so that the seeds germinate. Germinated wheat seeds were then selected for uniform spreading in Fang Min (110 mm. Times.110 mm) containing 10mL of sterilized water, and each square dish was covered with a layer of filter paper of the same size as the bottom of the dish. The plates were then placed in a wheat tissue culture room for 12-24h until the length of the main root reached 0.5-1cm. Wheat with uniform growth vigor is selected and transplanted into 96-hole (12 columns×8 rows) black water planting boxes, each water planting box contains 900mL of nutrient solution, 3 columns of each wheat material are planted, 8 seedlings are planted in each column, and then the wheat is placed in a wheat tissue culture room for culture. The water culture nutrient solution is an improved Hoagland nutrient solution, and is purchased from Shandong Tuo Pu bioengineering Co. After 1d of recovery of growth in the hydroponic cassette, ABA treatments (0, 2.5, 5 and 7.5 μm) were given at different concentrations, wheat growth was observed every 12h, and the length of the aerial and subsurface parts was left and counted after 5-7 d.

The results are shown in FIG. 3. Fig. 3 shows that: wheat plants overexpressing TaMPK3 have reduced sensitivity to ABA. Wherein, (a): the phenotype of TaMPK3 overexpression (OE-2, OE-6 and OE-11) and WT wheat plants after 7d of control and different concentrations of ABA treatment. (b): control and ABA treatments at different concentrations are bar graphs of 7d seedling height (aerial, subsurface and whole plant length). There were at least 3 independent replicates per treatment, each replicate containing 8 plants. Each data point is the average of 15 seedlings (+/-SD). (c): phenotype of TaMPK3 overexpression (OE-2, OE-6 and OE-11) and WT wheat plants after 9d under control and different concentrations of ABA treatment. (d): control and ABA treatments at different concentrations were performed on 9d seedling height (aerial, subsurface and whole length) histograms. There were at least 3 independent replicates per treatment, each replicate containing 8 plants. Each data point is the average of 15 seedlings (+/-SD). Multiple comparisons using one-way ANOVA found significant differences compared to WT (< 0.05, <0.01, < p)

Example 4 sensitivity analysis of wheat to drought stress

1. Analysis of sensitivity of wheat seedling stage to drought stress (FIG. 4)

The size of the used small red basin is kept consistent, the diameter of the basin is 12cm, the depth of the basin is 10.5cm, and the height of the basin edge is 2.5cm. For repeatability of drought treatment experiments, the following criteria were adopted. Firstly, the soil is crushed uniformly, and large blocks are removed. Then 2628g of nutrient soil was weighed and thoroughly stirred with 3L of tap water. Each small red pot weighed 230g of wet soil and then pressed the fluffy soil evenly until the soil was flush with the lower edge of the pot rim. Each pot is planted with a single wheat material, each pot is planted with 18 seeds, the planting mode is that the seeds are planted in a mode of one-point two-circle (1/6/11) from the center of the small red pot to the edge at equal intervals, and the distance between the outer ring seeds and the edge of the small pot is 1.5cm. Uniformly planting the seeds in a way that the seed umbilicus of the germinated seeds face downwards and the sprouting point faces the center of the pot, and finally lightly covering the seeds with mixed wet soil until the seeds are flush with the upper edge of the pot. And (3) placing the planted wheat in a wheat greenhouse for growth, and performing water control treatment during the growth period without additional application of water. Leaving the wheat 6d, 10d, 13d, 14d, 15d and 16d after planting; rehydrating at 18d of water control (no watering), and leaving for 3d, wherein the survival rate of different materials and the fresh weight of overground parts are counted. Wherein, at 15d of controlling water, wheat leaf tissue (0.1 g) is collected to determine the proline and malondialdehyde content. Each drought treatment experiment contained at least four replicates, and at least 3 replicates were measured for physiological index of individual strains of each material. Each drought phenotype experiment was repeated at least three times.

The results are shown in FIG. 4. Fig. 4 shows that: the drought resistance of wheat is reduced by the overexpression of TaMPK3, and the drought resistance of wheat is obviously improved after the interference of TaMPK3. Wherein, (a): water deficit stress suppresses the phenotype of TaMPK3-RNAi (i-1, 1-3 and i-10), WT and TaMPK3 overexpression (OE-2, OE-6 and OE-11) wheat plants under water treatment. The follow-up time was 6, 13, 15, 16d after planting, respectively. After stopping watering for 18d, all plants were re-watered and photographed after 3d rehydration. There were at least 3 independent replicates per treatment, each replicate containing 18 plants. (b-c): a 12d proline content (b); malondialdehyde content of TaMPK3-RNAi, WT and TaMPK3 overexpressing wheat plants at 15d (c) under water deficit stress. (d): survival of TaMPK3-RNAi, WT and TaMPK3 overexpressing wheat plants under water deficit stress. And (5) rehydrating at 18d, and calculating the survival rate after 3 d. (e): fresh weight of overground part after rehydration for 3 d. Multiple comparisons using one-way ANOVA showed significant differences compared to WT (< p <0.05, < p < 0.01).

2. Sensitivity analysis of wheat Cheng Miaoqi to drought stress (FIG. 5)

The size of the white basin is consistent with the soil consumption of each basin, the diameter of the basin is 21.5cm, the depth of the basin is 17cm, and the height of the rim of the basin is 4.5cm. Firstly compacting the nutrient soil to be flush with the lower edge of the basin edge, sowing 6 germinated wheat seeds in each basin at equal intervals, covering the same amount of soil until the nutrient soil is flush with the upper edge of the basin edge, and finally uniformly watering by using a water pipe with a sprinkler head until the soil moisture is saturated. Wheat was normally cultivated in a greenhouse for 35d (at which time TaMPK3 overexpressing material is about to enter the heading stage) with water every four days, 1L each time per pot. And after 15d of water control treatment, normal water supply is given to all plants until the plants are mature, then the final growth state of the plants of different materials is recorded by photographing, and finally the agronomic characters of the different wheat materials are counted.

The method for measuring the proline and the malondialdehyde of the sample is operated according to the specific operation steps of the kit: malondialdehyde content detection kit and proline content detection kit (Beijing Soy Bao technology Co., ltd., beijing)

The results are shown in fig. 5, and fig. 5 shows that: under the greenhouse condition, the over-expression quantity of TaMPK3 is obviously reduced, and the drought tolerance of wheat is obviously improved by TaMPK3-RNAi. Wherein, (a): phenotypic analysis of TaMPK3-RNAi (i-1, 1-3 and i-10), WT and TaMPK3 overexpression (OE-2, OE-6 and OE-11) wheat plants under drought stress in greenhouse conditions. Agronomic traits (b-j) of TaMPK3-RNAi, WT and TaMPK3 overexpressing wheat lines under drought stress in greenhouse conditions: spike number (b); tillering number (c); spike length (d); plant height (e); number of individual plants (f); individual grain weight (g); thousand grain weight (h); grain width (i) and grain length (j).

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Sequence listing

<110> institute of crop science at national academy of agricultural sciences

<120> method for regulating drought resistance of plant and application of TaMPK3 in regulating drought resistance of plant

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 369

<212> PRT

<213> wheat (Triticum aestivum)

<400> 1

Met Asp Gly Ala Pro Val Ala Glu Phe Arg Pro Thr Met Thr His Gly

1 5 10 15

Gly Arg Phe Leu Leu Tyr Asn Ile Phe Gly Asn Gln Phe Glu Ile Thr

20 25 30

Ala Lys Tyr Gln Pro Pro Ile Met Pro Ile Gly Arg Gly Ala Tyr Gly

35 40 45

Ile Val Cys Ser Val Met Asn Phe Glu Thr Arg Glu Met Val Ala Ile

50 55 60

Lys Lys Ile Ala Asn Ala Phe Asp Asn Asn Met Asp Ala Lys Arg Thr

65 70 75 80

Leu Arg Glu Ile Lys Leu Leu Arg His Leu Asp His Glu Asn Ile Val

85 90 95

Gly Leu Arg Asp Val Ile Pro Pro Ala Thr Pro Gln Ser Phe Asn Asp

100 105 110

Val Tyr Ile Ala Thr Glu Leu Met Asp Thr Asp Leu His His Ile Ile

115 120 125

Arg Ser Asn Gln Glu Leu Ser Glu Glu His Cys Gln Tyr Phe Leu Tyr

130 135 140

Gln Leu Leu Arg Gly Leu Lys Tyr Ile His Ser Ala Asn Val Ile His

145 150 155 160

Arg Asp Leu Lys Pro Ser Asn Leu Leu Leu Asn Ala Asn Cys Asp Leu

165 170 175

Lys Ile Cys Asp Phe Gly Leu Ala Arg Pro Ser Ser Glu Ser Asp Met

180 185 190

Met Thr Glu Tyr Val Val Thr Arg Trp Tyr Arg Ala Pro Glu Leu Leu

195 200 205

Leu Asn Ser Thr Asp Tyr Ser Ala Ala Ile Asp Val Trp Ser Val Gly

210 215 220

Cys Ile Phe Met Glu Leu Ile Asn Arg Ala Pro Leu Phe Pro Gly Arg

225 230 235 240

Asp His Met His Gln Met Arg Leu Ile Thr Glu Val Ile Gly Thr Pro

245 250 255

Thr Asp Asp Asp Leu Gly Phe Ile Arg Asn Glu Asp Ala Arg Arg Tyr

260 265 270

Met Arg His Leu Pro Gln Phe Pro Arg Arg Ser Phe Pro Gly Gln Phe

275 280 285

Pro Lys Val Gln Pro Ala Ala Leu Asp Leu Ile Glu Arg Met Leu Thr

290 295 300

Phe Asn Pro Leu Gln Arg Ile Thr Val Glu Glu Ala Leu Glu His Pro

305 310 315 320

Tyr Leu Glu Arg Leu His Asp Val Ala Asp Glu Pro Ile Cys Thr Asp

325 330 335

Pro Phe Ser Phe Asp Phe Glu Gln His Pro Leu Thr Glu Asp Gln Met

340 345 350

Lys Gln Leu Ile Phe Asn Glu Ala Leu Glu Leu Asn Pro Asn Phe Arg

355 360 365

Tyr

<210> 2

<211> 1110

<212> DNA

<213> wheat (Triticum aestivum)

<400> 2

atggacggcg ctccggtggc cgagttccgg ccgacgatga cgcacggcgg ccgcttcctc 60

ctctacaaca tattcggcaa ccagttcgag atcacggcca agtaccagcc gccgatcatg 120

cccatcggcc gcggcgccta cgggatcgtc tgctcggtga tgaacttcga gacgagggag 180

atggtggcaa tcaagaagat cgcaaacgct ttcgacaaca acatggacgc caagcgcacg 240

ctccgggaga tcaagctcct gaggcacctc gaccacgaga acatagtagg cctccgagat 300

gtgatcccgc cggcgacccc gcagtccttc aacgacgtct acatcgccac cgagctcatg 360

gacacggacc tccaccacat catccgctcc aaccaagaac tctcggaaga acactgccag 420

tacttcctgt accagctgct gcgcggcctc aagtacatcc actcggcgaa cgtgatccac 480

cgcgacctca agccgagcaa cctgctgctg aacgccaact gcgacctcaa gatctgcgac 540

ttcggcctgg cgcggccgtc gtccgagagc gacatgatga cggagtacgt ggtcacgcgg 600

tggtaccggg ccccggagct gctgctcaac tccaccgact actccgcggc catcgacgtc 660

tggtccgtcg gctgcatctt catggagctc atcaaccgcg cgccgctctt cccggggagg 720

gaccacatgc accagatgcg gctcatcacg gaggtgatcg gcacccccac cgacgacgac 780

ctgggcttca tccggaacga ggacgccagg aggtacatga ggcacctgcc gcagttccct 840

cgccggtcct tcccgggaca gttccccaag gtgcagcccg ccgcgctgga cctcatcgag 900

aggatgctca ccttcaaccc gctgcagagg atcacagttg aagaggcgct ggagcaccca 960

tacctagagc ggcttcacga cgtcgccgac gagcccatct gcacggaccc cttctccttc 1020

gacttcgaac agcacccact gacggaagac cagatgaagc agctcatatt caacgaagcc 1080

ctggagttga accccaactt ccgatactag 1110

<210> 3

<211> 972

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tcccccgggt gcatcttcat ggagctcatc aaccgcgcgc cgctcttccc ggggagggac 60

cacatgcacc agatgcggct catcacggag gtgatcggca cccccaccga cgacgacctg 120

ggcttcatcc ggaacgagga cgccaggagg tacatgaggc acctgccgca gttccctcgc 180

cggtccttcc cgggacagtt ccccaaggtg cagcccgccg cgctggacct catcgagagg 240

atgctcacct tcaacccgct gcagaggatc acagttgaag aggcgctgga gcacccatac 300

ctagagcggc ttcacgacgt cgccgacgag cccatctgca cggacccctt ctccttcgac 360

ttcgaacagc acccactgac ggaagaccag atgaagcagc tcatattcaa cgatccgatc 420

gaaaaacggg agtctgcccc taagacagat aagccgccaa gaaggcgcaa gtcaaccgcg 480

agttgttgta tcatatctac tgacaaagat cacaaatggg atggctgatt agataccttg 540

gcctcccaga tcgattcaga tctgttgaat atgagctgct tcatctggtc ttccgtcagt 600

gggtgctgtt cgaagtcgaa ggagaagggg tccgtgcaga tgggctcgtc ggcgacgtcg 660

tgaagccgct ctaggtatgg gtgctccagc gcctcttcaa ctgtgatcct ctgcagcggg 720

ttgaaggtga gcatcctctc gatgaggtcc agcgcggcgg gctgcacctt ggggaactgt 780

cccgggaagg accggcgagg gaactgcggc aggtgcctca tgtacctcct ggcgtcctcg 840

ttccggatga agcccaggtc gtcgtcggtg ggggtgccga tcacctccgt gatgagccgc 900

atctggtgca tgtggtccct ccccgggaag agcggcgcgc ggttgatgag ctccatgaag 960

atgcagagct cg 972

Claims

Application of TaMPK3 or a substance for regulating and controlling expression of a TaMPK3 coding gene or a substance for regulating and controlling activity or content of TaMPK3 in regulating and controlling drought resistance of plants,

the TaMPK3 is any one of the following proteins a 1) to a 3):

a1 Protein with amino acid sequence shown as sequence 1 in a sequence table;

a2 Protein related to drought resistance of plants is obtained by substituting and/or deleting and/or adding amino acid residues in the amino acid sequence shown in the sequence 1 in the sequence table;

a3 A) a protein which has 80% or more identity with the protein represented by a 1) or a 2) and is related to drought resistance of a plant.
2. The use according to claim 1, characterized in that: the regulation of plant drought resistance is to improve plant drought resistance, the regulation of TaMPK3 coding gene expression is to inhibit the TaMPK3 coding gene expression, and the regulation of TaMPK3 activity or content is to inhibit or reduce the TaMPK3 activity or content.
3. Use according to claim 1 or 2, characterized in that: the substance that inhibits or reduces the expression of the TaMPK3 encoding gene according to claim 1 is any one of the following:

a1 A nucleic acid molecule which inhibits or reduces the expression of the gene encoding TaMPK3 as described in claim 1;

a2 Expression of a gene encoding the nucleic acid molecule of A1);

a3 An expression cassette containing the coding gene of A2);

a4 A recombinant vector comprising the coding gene of A2) or a recombinant vector comprising the expression cassette of A3);

a5 A) a recombinant microorganism comprising the gene encoding A2), or a recombinant microorganism comprising the expression cassette of A3), or a recombinant microorganism comprising the recombinant vector of A4);

a6 A) a transgenic plant cell line containing the coding gene of A2), or a transgenic plant cell line containing the expression cassette of A3), or a transgenic plant cell line containing the recombinant vector of A4);

a7 A) a transgenic plant tissue containing the coding gene of A2), or a transgenic plant tissue containing the expression cassette of A3), or a transgenic plant tissue containing the recombinant vector of A4);

a8 A) a transgenic plant organ containing the coding gene of A2), or a transgenic plant organ containing the expression cassette of A3), or a transgenic plant organ containing the recombinant vector of A4).
4. A use according to claim 3, characterized in that:

b1 The nucleic acid molecule A1) is a double-stranded RNA molecule, and one strand sequence of the double-stranded RNA molecule is a sequence obtained by transcribing a DNA fragment from 10 th to 411 th positions of a sequence 3 in a sequence table;

b2 The coding genes of the A2) are shown as the formula (I): SEQ forward-X-SEQ reverse formula (I);

the sequence of the SEQ forward direction is 10 th-411 th of the sequence 3 in the sequence table; the sequence of the SEQ reverse direction is reversely complementary to the sequence of the SEQ forward direction; and X is a spacer sequence between the SEQ forward direction and the SEQ reverse direction, and is not complementary with both the SEQ forward direction and the SEQ reverse direction.
5. A use according to any one of claims 1-3, characterized in that: the TaMPK3 coding gene is the gene described in b 1) or b 2) as follows:

b1 The coding sequence of the coding chain is a DNA molecule shown as a sequence 2 in a sequence table;

b2 A DNA molecule which has more than 80% identity with the DNA molecule of b 1) and encodes the same functional protein.
6. The method for regulating drought resistance of plants is characterized in that: the method comprises regulating the expression of the TaMPK3 coding gene in the target plant or regulating the activity or content of the TaMPK3 in the target plant.
7. The method according to claim 6, wherein: the regulation of plant drought resistance is to improve plant drought resistance, and the regulation of TaMPK3 coding gene expression or the regulation of activity or content of TaMPK3 is to inhibit the expression of the TaMPK3 coding gene in the target plant or inhibit or reduce the activity or content of TaMPK3 in the target plant.
8. The method according to claim 6 or 7, characterized in that: the method comprises introducing into the plant of interest a gene encoding the double stranded RNA molecule of B1) of claim 4.
9. The method according to claim 6, wherein: the regulation of plant drought resistance is to reduce plant drought resistance, and the regulation of expression of a TaMPK3 coding gene or the regulation of activity or content of the TaMPK3 is to improve expression of the TaMPK3 coding gene or the activity or content of the TaMPK3.
10. The TaMPK3 or the TaMPK3 encoding gene in the use of claim 1, or the agent which inhibits or reduces the expression of the TaMPK3 encoding gene in claim 1 in the use of claim 3 or 4.