CN112795552A

CN112795552A - Application of Zm0001d024568 gene and encoding protein thereof in drought stress resistance of corn

Info

Publication number: CN112795552A
Application number: CN202110262045.6A
Authority: CN
Inventors: 李保珠; 宋纯鹏; 刘炯; 张辉; 陈婷婷; 刘茹南
Original assignee: Henan University
Current assignee: Henan University
Priority date: 2021-03-10
Filing date: 2021-03-10
Publication date: 2021-05-14
Anticipated expiration: 2041-03-10
Also published as: CN112795552B

Abstract

The invention relates to the technical field of genetic engineering application, and particularly discloses application of Zm0001d024568 gene encoding protein in drought stress resistance of corn. The Zm0001d024568 gene of the invention can be used for the control of the stomatal movement of corn plants and the functional identification of plant drought stress reaction, thereby laying a theoretical foundation in the aspect of creating maize germplasm resources with strong drought tolerance.

Description

Application of Zm0001d024568 gene and encoding protein thereof in drought stress resistance of corn

Technical Field

The invention relates to the technical field of genetic engineering application, in particular to an application of a Zm0001d024568 gene and a coded protein thereof in drought stress resistance of corn.

Background

Drought is the most important limiting factor for crop yield, and has become one of the central topics of plant adversity stress. Corn is now the first crop of the world, and its yield and quality affect the survival and development of human society. In long-term drought research, many components playing important roles in plant drought stress reaction are identified, but the identification of the components and the research on the function playing ways of the components are mainly realized by model arabidopsis thaliana and the like, the research on important functions and regulation and control components of drought stress in important crops of corn, rice and wheat is relatively less, and the identification of the important components and the drought reaction ways of the components in response to the drought stress has more theoretical and practical significance.

The protein coded by the maize Zm0001d024568 gene belongs to a member of MAPK protein kinase family, the CDS length of the Zm0001d024568 gene is 1044bp, and the MAPK protein kinase with 348 amino acids is coded, and is supposed to play a role in plant biotic and abiotic stress reactions as a MAPK cascade signal component, but a research report of the gene in stomatal movement and drought stress reactions is not seen.

Disclosure of Invention

In order to solve the technical problems, the invention provides the application of Zm0001d024568 gene encoding protein in drought stress resistance, and is expected to create maize germplasm resources with strong drought tolerance.

Further, the Zm0001d024568 gene encoding protein is used for regulating and controlling plant drought tolerance.

Further, the protein encoded by the Zm0001d024568 gene is used for regulating the movement of the corn stomata.

Further, the protein encoded by the Zm0001d024568 gene is used for regulating and controlling the surface temperature of corn leaves.

Further, the protein encoded by the Zm0001d024568 gene is used for regulating and controlling the opening degree of the corn stomata.

Further, the protein encoded by the Zm0001d024568 gene is used for the stomatal conductance of corn.

The invention also provides application of the corn Zm0001d024568 gene encoding protein in creating maize germplasm resources with strong drought tolerance.

The invention also provides application of the corn Zm0001d024568 gene in drought stress resistance of corn.

Compared with the prior art, the invention has the beneficial effects that:

1. the invention provides application of Zm0001d024568 gene encoding protein in drought stress resistance of corn, and finds that the Zm0001d024568 gene of corn can be used for regulating and controlling leaf surface temperature of corn, pore movement of corn, pore opening and pore conductance of corn and drought tolerance of plants;

2. the corn Zm0001d024568 gene encoding protein lays a theoretical foundation in the aspect of creating strong drought-resistant corn germplasm resources;

3. the gene EMS mutant obtained from a corn mutant library is subjected to single base mutation of the exon of the gene to cause the premature termination of a coding sequence and further cause functional deletion, and the functional deletion mutation causes the stomatal reaction and the drought tolerance abnormal phenotype, so that the gene plays an important role in the aspects, and a new possibility is provided for the cultivation of a new crop strain by utilizing the gene.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 shows the basic structure and mutation position of Zm0001d024568 gene of the present invention;

FIG. 2 shows the sequencing identification of Zm0001d024568 gene homozygous mutant dos 59;

FIG. 3 is a far infrared thermography of B73 and dos59 seedlings from example 1;

FIG. 4 is a statistical comparison of the leaf surface temperatures of seedlings of B73 and dos59 in example 1;

FIG. 5 is a comparison of vent openings B73 and dos59 in example 1;

FIG. 6 is a comparison of stomatal conductance of seedlings grown for 15 days on culture soil according to B73 and dos59 in example 1;

FIG. 7 is a comparison of the water loss rate of the excised leaf of the seedling of example 1, in which B73 and dos59 were grown on the culture soil for 15 days;

FIG. 8 is a comparison of the drought tolerant phenotypes of B73 and dos59 after 5 days of drought treatment with 10 days of normal growth in example 1;

FIG. 9 is a comparison of survival rates of B73 and dos59 after severe drought treatment in example 1.

Detailed Description

The following detailed description of specific embodiments of the invention is provided, but it should be understood that the scope of the invention is not limited to the specific embodiments. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention. The experimental methods described in the examples of the present invention are all conventional methods unless otherwise specified.

The invention provides application of Zm0001d024568 gene encoding protein in corn drought stress resistance.

The specific embodiment is as follows:

example 1

The CDS length of the maize Zm0001d024568 gene is 1044bp, encodes a protein of 348 amino acids, and belongs to a MAPK protein kinase family member.

Maize-related mutants were derived from a laboratory-established pool of maize mutants, whose mutants of the maize Zm0001d024568 gene were confirmed by sequencing as early termination mutants of the coding sequence (dos 59).

Firstly, obtaining Zm0001d024568 gene coding sequence early termination homozygous dos59 mutant

Firstly, obtaining Zm0001d024568 gene coding sequence from a corn mutant library, terminating a homozygous dos59 mutant in advance, and placing seedlings of a soil-culture Zm0001d024568 mutant line in a greenhouse, wherein the light/dark cycle is 14/10h, and the temperature is day/night: 30/24 ℃, relative humidity 70% and germination and growth. Extracting DNA of leaves by SLS (sodium lauryl sarcosinate) method, using the DNA as a template, wherein specific primers comprise a forward primer and a reverse primer, and the sequence of the forward primer is shown as SEQ ID NO. 1; the reverse primer sequence is shown as SEQ ID NO.2, amplification is carried out, the amplified DNA fragment is sequenced, the mutant sequence is compared with the normal sequence, the dos59 mutant strain base mutation site and the mutation type are confirmed, the mutation site is located at the 597 th site of the third exon of the gene (figure 1), the nucleotide is mutated from G to A, and therefore the nucleotide is converted into a planting codon (TGA) (figure 2).

SEQ ID NO.1：CAGGGACCTCACGTATCTGC；

SEQ ID NO.2：CGTCGATCCAAATCCAACGC。

The SLS extraction steps of the corn DNA are as follows:

placing 0.1g of corn leaves in a 2mL centrifuge tube which is sterilized in advance and is provided with small steel balls, and quickly freezing in liquid nitrogen; the quick-frozen sample was shaken in a grinder at a frequency of 60Hz for 1min, and 750 μ L of SLS DNA extract (1% SLS, 0.02M EDTA (pH 8.0), 0.1M Tris-HCl (pH 8.0), 0.1M NaCl) was added to the sample, and vigorously shaken to mix them well. Add 750 μ L phenol: chloroform: isoamyl alcohol (25:24:1) and shaking sufficiently, standing at room temperature for 5min, and centrifuging at high speed at 4 ℃ and 12,000rpm for 10 min; transferring the supernatant into a 1.5mL centrifuge tube, adding isopropanol with the same volume, turning upside down, mixing uniformly, and standing in a refrigerator at 4 ℃ for 30 min; centrifuging at 12,000rpm at 4 deg.C for 10min to precipitate DNA; the DNA was washed 2 times with 75% ethanol; the DNA was dissolved in 100. mu.L of sterilized ultrapure water and used as a template.

Second, leaf surface temperature of mutant dos59 was compared with wild type

Wild type and dos59 mutants were grown in soil under greenhouse conditions for 10 days and then water supply was stopped. The surface temperature of the mutant dos59 and the wild-type leaf is detected by a far infrared imager, and the result shows that the leaf surface of the mutant dos59 is obviously lower than that of the wild-type leaf (figure 3). The average leaf surface temperature was counted, and the difference between the mutant dos59 and the wild-type leaf surface temperature was more than 1 ℃ (FIG. 4).

Influence of Zm0001d024568 gene mutation on stomatal aperture and stomatal conductance

Tearing skin strips on leaves of the maize seedlings, and observing the opening states of the mutant dos59 and wild stomata under a stereoscopic microscope, wherein as shown in fig. 5, the opening degree of the dos59 stomata is remarkably large; the stomatal conductivities of the mutant dos59 and the wild type were measured by a stomatal conductivity meter, and the results showed that the stomatal conductivities of the mutants were 0.31mol m on average^-2s^-1While the wild type is only 0.5mol m^-2s^-1On the left and right, the two showed very significant differences, as shown in fig. 6.

IV, influence of Zm0001d024568 gene mutation on water loss of in vitro leaves and sensitivity to drought stress

The water loss rate of mutant dos59 and wild type excised leaves is detected by utilizing an in vitro leaf water loss detection platform (Li B, Fan R, Huang S, et al.2017.far in free imaging, an effective way to screen mail cutting microorganisms for loss stress response [ J ]. biologica, 72(9)) established in a laboratory, and the result shows that the mutant excised leaves lose water quickly and have great difference with the wild type in 40 minutes (figure 7); the water loss rate of the isolated leaf corresponds to the phenotype of lower leaf surface temperature, larger stomatal aperture and conductance and the like. The water loss is fast, the water retention capacity of the plant is poor, and the drought tolerance is poor. Drought treatment phenotype experiments showed that mutant dos59 was more sensitive to drought stress (fig. 8).

In conclusion, early termination mutation of Zm0001d024568 gene resulted in increased stomata opening and stomata conductance of the mutant (altered stomata movement control), faster water loss from the leaves in vitro, decreased leaf surface temperature, and poor drought tolerance. The gene can be used for the function identification in the stomata movement regulation and control of corn plants and plant drought stress reaction. The results have important theoretical and productive significance for regulating stomatal movement of plants, improving drought stress tolerance of the plants and the like.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> university of Henan

<120> Zm0001d024568 gene and application of coded protein thereof <160> 2 <170> SIPOS sequence Listing 1.0 in drought stress resistance of corn

<210> 1

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 1

cagggacctcacgtatctgc 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Synthesis of <400> 2

cgtcgatccaaatccaacgc 20

Claims

The application of Zm0001d024568 gene encoding protein in drought stress resistance of corn.
2. The use of a protein encoded by the Zm0001d024568 gene of claim 1, wherein the protein encoded by the Zm0001d024568 gene is used for controlling drought tolerance in a plant.
3. The use of a protein encoded by the Zm0001d024568 gene of claim 2, wherein the protein encoded by the Zm0001d024568 gene is used for modulating stomatal movement.
4. The use of a protein encoded by the Zm0001d024568 gene of claim 3, wherein the protein encoded by the Zm0001d024568 gene is used for modulating maize leaf surface temperature.
5. The use of a protein encoded by the Zm0001d024568 gene of claim 4, wherein the protein encoded by the Zm0001d024568 gene is used for modulating corn stomata opening.
6. The use of a protein encoded by the Zm0001d024568 gene of claim 5, wherein the protein encoded by the Zm0001d024568 gene is used for modulating the stomatal conductance of maize.
7. The use of a protein encoded by the maize Zm0001d024568 gene of claim 1 to create a maize germplasm resource with strong drought tolerance.
8. The use of the maize Zm0001d024568 gene of claim 1 in drought stress resistance in maize.