CN112795552B - Application of Zm00001d024568 gene and encoding protein thereof in drought stress resistance of corn - Google Patents
Application of Zm00001d024568 gene and encoding protein thereof in drought stress resistance of corn Download PDFInfo
- Publication number
- CN112795552B CN112795552B CN202110262045.6A CN202110262045A CN112795552B CN 112795552 B CN112795552 B CN 112795552B CN 202110262045 A CN202110262045 A CN 202110262045A CN 112795552 B CN112795552 B CN 112795552B
- Authority
- CN
- China
- Prior art keywords
- gene
- corn
- drought stress
- drought
- dos59
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Abstract
The invention relates to the technical field of genetic engineering application, and particularly discloses application of Zm00001d024568 gene encoding protein in drought stress resistance of corn. The Zm00001d024568 gene of the invention can be used for controlling the stomatal movement of corn plants and identifying the functions of the plants in drought stress reaction, thereby laying the theoretical foundation in the aspect of creating maize germplasm resources with strong drought tolerance.
Description
Technical Field
The invention relates to the technical field of genetic engineering application, in particular to an application of Zm00001d024568 gene and a coded protein thereof in drought stress resistance of corn.
Background
Drought is the most important limiting factor for crop yield, and has become one of the central topics of plant adversity stress. Corn is now the first crop of the world, and its yield and quality affect the survival and development of human society. In long-term drought research, a plurality of components playing an important role in plant drought stress response have been identified, but the identification of the components and the research on the function playing way of the components are mainly realized by model arabidopsis thaliana and the like, the research on important functions and regulation and control components of drought stress in important crops of corn, rice and wheat is relatively less, and the identification of the important components and the drought response way of the components in the drought stress response have more theoretical and practical significance.
The protein coded by the maize Zm00001d024568 gene belongs to a member of MAPK protein kinase family, the CDS length of the Zm00001d024568 gene is 1044bp, and the MAPK protein kinase with 348 amino acids is coded and is supposed to play a role in plant biotic and abiotic stress reactions as a MAPK cascade signal component, but a research report of the gene in stomatal movement and drought stress reactions is not seen yet.
Disclosure of Invention
In order to solve the technical problems, the invention provides the application of Zm00001d024568 gene encoding protein in drought stress resistance, and is expected to create maize germplasm resources with strong drought tolerance.
Further, the protein coded by the Zm00001d024568 gene is used for regulating and controlling the drought tolerance of plants.
Further, the protein encoded by the Zm00001d024568 gene is used for regulating and controlling the movement of corn stomata.
Further, the Zm00001d024568 gene encodes protein used for regulating maize leaf surface temperature.
Further, the Zm00001d024568 gene encoding protein is used for regulating and controlling the opening degree of the corn stomata.
Further, the Zm00001d024568 gene encodes protein for stomatal conductance of corn.
The invention also provides application of the corn Zm00001d024568 gene encoding protein in creating maize germplasm resources with strong drought tolerance.
The invention also provides application of the corn Zm00001d024568 gene in drought stress resistance of corn.
Compared with the prior art, the invention has the beneficial effects that:
1. the invention provides application of Zm00001d024568 gene encoding protein in drought stress resistance of corn, and finds that the Zm00001d024568 gene of corn can be used for regulating and controlling leaf surface temperature of corn, regulating and controlling stomatal movement of corn, regulating and controlling stomatal aperture and stomatal conductance of corn and drought tolerance of plants;
2. the maize Zm00001d024568 gene encoding protein lays a theoretical foundation in the aspect of creating maize germplasm resources with strong drought tolerance;
3. the gene EMS mutant obtained from the corn mutant library has the function deletion caused by the single base mutation of the exon of the gene to cause the early termination of a coding sequence, and the function deletion mutation causes the stomatal reaction and the drought tolerance abnormal phenotype, so that the gene plays an important role in the aspects, and a new possibility is provided for utilizing the gene to cultivate new crop strains.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.
FIG. 1 is a drawing of the present inventionZm00001d024568The basic structure and mutation position of the gene;
FIG. 2 shows the present inventionZm00001d024568Gene homozygous mutantdos59Sequencing and identifying;
FIG. 3 shows B73 and B73 in example 1dos59Performing far infrared thermal imaging on seedlings;
FIG. 4 shows B73 and B in example 1dos59Statistical comparison of the surface temperature of the seedling leaves;
FIG. 5 shows B73 and B in example 1dos59Comparing the opening degree of the air holes;
FIG. 6 shows B73 and B in example 1dos59The porosity conductivity of the seedlings grown on the culture soil for 15 days is compared;
FIG. 7 shows B73 and B in example 1dos59Comparing the water loss rate of the in vitro leaves of the seedlings growing for 15 days on the culture soil;
FIG. 8 shows the results of B73 and B73 after 10 days of normal growth and 5 days of drought treatment in example 1dos59Is dried(ii) comparison of drought-tolerant phenotypes;
FIG. 9 shows B73 and B73 after severe drought treatment in example 1dos59Comparing the survival rates of (1).
Detailed Description
The following detailed description of specific embodiments of the invention is provided, but it should be understood that the scope of the invention is not limited to the specific embodiments. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention. The experimental methods described in the examples of the present invention are all conventional methods unless otherwise specified.
The invention provides application of Zm00001d024568 gene encoding protein in corn drought stress resistance.
The specific embodiment is as follows:
example 1
Corn (corn)Zm00001d024568The CDS length of the gene is 1044bp, encodes 348 amino acid proteins, and belongs to MAPK protein kinase family members.
The corn related mutants are from a corn mutant library which is constructed in a laboratoryZm00001d024568The sequencing of the mutant of the gene was confirmed as a premature termination mutant of the coding sequence (dos59）。
1. To obtainZm00001d024568Early termination homozygosity of gene coding sequencesdos59Mutants
First obtained from a maize mutant poolZm00001d024568Early termination homozygosity of gene coding sequencesdos59Mutant, soil cultureZm00001d024568Mutant line seedlings were placed in a greenhouse with a light/dark cycle of 14/10h and temperature day/night: germinate and grow at 30/24 ℃ and 70% relative humidity. Extracting DNA of leaves by SLS (sodium lauryl sarcosinate) method, using the DNA as a template, wherein specific primers comprise a forward primer and a reverse primer, and the sequence of the forward primer is shown as SEQ ID NO. 1; the reverse primer sequence is shown as SEQ ID NO.2, the amplification is carried out, the amplified DNA segment is sequenced, the mutant sequence is compared with the normal sequence, and the confirmation is carried outdos59Mutant strain basesMutation site and mutation type, the mutation site is located at 597 th position of the first exon of the gene (figure 1), and the nucleotide is mutated from G to A, thereby being converted into a stop codon (TGA) (figure 2).
SEQ ID NO.1：CAGGGACCTCACGTATCTGC；
SEQ ID NO.2：CGTCGATCCAAATCCAACGC。
The SLS extraction steps of the corn DNA are as follows:
placing 0.1 g of corn leaves in a 2 mL centrifuge tube which is sterilized in advance and is provided with small steel balls, and quickly freezing in liquid nitrogen; the quick-frozen sample was shaken in a grinder at a frequency of 60 Hz for 1 min, and 750 μ L of SLS DNA extract (1% SLS, 0.02M EDTA (pH = 8.0), 0.1M Tris-HCl (pH = 8.0), 0.1M NaCl) was added to the sample, and shaken vigorously to mix well. Adding 750 mu L of phenol: chloroform: isoamyl alcohol (25: 24: 1) and shaking sufficiently, standing at room temperature for 5 min, and centrifuging at high speed for 10 min at 4 ℃ and 12,000 rpm; transferring the supernatant into a 1.5 mL centrifuge tube, adding isopropanol with the same volume, turning upside down, mixing uniformly, and standing in a refrigerator at 4 ℃ for 30 min; centrifuging at 12,000 rpm at 4 deg.C for 10 min to precipitate DNA; washing the DNA with 75% ethanol 2 times; DNA is dissolved by adding 100 muL of sterilized ultrapure water, and the DNA can be used as a template.
2. Mutantsdos59Leaf surface temperature of (2) and wild type comparison
In greenhouse conditions, soil culture of wild type anddos59mutant, grown normally for 10 days, then water supply was stopped. Detection of mutants using far infrared imagerdos59And the surface temperature of the wild type leaf, and the results show that the mutant has the characteristics ofdos59Leaf surface was significantly lower than wild type (fig. 3). Statistical leaf surface average temperature, mutantdos59The difference in leaf surface temperature from wild type was more than 1 deg.C (FIG. 4).
3.Zm00001d024568Influence of gene mutation on stomatal aperture and stomatal conductance
Tearing the surface skin strips of the leaves of the corn seedlings, and observing the mutants under a stereoscopic microscopedos59And the wild-type stomata open state, as shown in FIG. 5,dos59the opening degree of the air holes is obviously larger; detection by means of air hole conductivity meterDetection of mutantsdos59And the stomatal conductance of the wild type, and the results show that the stomatal conductance of the mutant is 0.31 mol m on average -2 s -1 While the wild type is only 0.05 mol m - 2 s -1 On the left and right, the difference between the two is very significant, as shown in fig. 6.
4.Zm00001d024568Effect of Gene mutation on Water loss from Ex vivo leaves and sensitivity to drought stress
In vitro leaf water loss detection platform (Li B, fan R, huang S, et al, 2017.Far in free imaging, an effective wave to screen main cutting microorganisms for loss stress response [ J ] established in laboratory]Biologica, 72 (9)), for mutantsdos59And the water loss rate of the wild type in vitro leaf blade is detected, and the result shows that the mutant in vitro leaf blade loses water faster, and has a larger difference with the wild type in 40 minutes (figure 7); the water loss rate of the leaves in vitro corresponds to the phenotype of lower leaf surface temperature, larger pore opening and conductance and the like. The water loss is fast, the water retention capacity of the plant is poor, and the drought tolerance is poor. Drought treatment phenotype experiment shows that the mutantdos59More sensitive to drought stress (figure 8).
In view of the above, it is desirable to provide,Zm00001d024568the early termination mutation of the gene leads to the increase of the stomatal aperture and stomatal conductance of the mutant (stomatal movement regulation and control change), the water loss of the leaves in vitro is faster, the temperature of the leaf surface is reduced, and the drought tolerance is poorer. The gene can be used for the function identification in the stomata movement regulation and control of corn plants and plant drought stress reaction. The results have important theoretical and productive significance for regulating stomatal movement of plants, improving drought stress tolerance of the plants and the like.
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including the preferred embodiment and all changes and modifications that fall within the scope of the invention.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Sequence listing
<110> university of Henan
<120> Zm0001d024568 gene and application of coded protein thereof <160> 2 <170> SIPOS sequence Listing 1.0 in drought stress resistance of corn
<210> 1
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial Synthesis of <400> 2
Claims (6)
- Application of Zm00001d024568 gene coding protein in regulating drought tolerance of corn.
- 2. The use of the protein encoded by the Zm00001d024568 gene of claim 1 for modulating the stomatal movement in maize.
- 3. Use of a protein encoded by the Zm00001d024568 gene of claim 1 to modulate maize leaf surface temperature.
- 4. The use of the protein encoded by the Zm00001d024568 gene of claim 1 for modulating corn stomata opening.
- 5. The use of the protein encoded by the Zm00001d024568 gene of claim 1 for modulating stomatal conductance in maize.
- 6. The use of a protein encoded by the maize Zm00001d024568 gene of claim 1 to create a maize germplasm for drought tolerance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110262045.6A CN112795552B (en) | 2021-03-10 | 2021-03-10 | Application of Zm00001d024568 gene and encoding protein thereof in drought stress resistance of corn |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110262045.6A CN112795552B (en) | 2021-03-10 | 2021-03-10 | Application of Zm00001d024568 gene and encoding protein thereof in drought stress resistance of corn |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112795552A CN112795552A (en) | 2021-05-14 |
| CN112795552B true CN112795552B (en) | 2022-10-04 |
Family
ID=75816835
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110262045.6A Active CN112795552B (en) | 2021-03-10 | 2021-03-10 | Application of Zm00001d024568 gene and encoding protein thereof in drought stress resistance of corn |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112795552B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114058629B (en) * | 2021-11-11 | 2022-12-30 | 河南大学三亚研究院 | Application of Zm00001d042263 gene in regulation and control of stomatal development of corn |
| CN115700282B (en) * | 2022-12-21 | 2023-11-03 | 河南大学三亚研究院 | Maize drought-resistant gene Zm00001d030678 and application thereof |
| CN116656698B (en) * | 2023-07-27 | 2023-11-03 | 河南大学三亚研究院 | Application of corn gene Zm00001d018037 in improving drought resistance of monocotyledonous crops |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008063755A2 (en) * | 2006-10-03 | 2008-05-29 | Monsanto Technology Llc | Methods for hybrid corn seed production and compositions produced therefrom |
| CN114752579A (en) * | 2020-12-25 | 2022-07-15 | 中国农业大学 | Application of ZmMAPK protein and coding gene thereof in regulation and control of low-temperature stress tolerance of plants |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1280398B1 (en) * | 1999-12-22 | 2008-12-03 | BASF Plant Science GmbH | Stress-related potassium channel proteins and their uses in plants |
| US7345219B2 (en) * | 2003-01-31 | 2008-03-18 | The Board Of Trustees For The University Of Arkansas | Mitogen-activated protein kinase and method of use to enhance biotic and abiotic stress tolerance in plants |
| CN1584032A (en) * | 2004-05-27 | 2005-02-23 | 上海交通大学 | Protein coding sequence of protein kinase 3 activated by cell division protoplasm for brassia rape |
| CN107325161B (en) * | 2016-04-29 | 2020-04-07 | 中国农业大学 | Protein related to low-nitrogen stress and high-salt stress resistance as well as encoding gene and application thereof |
| CN107988234B (en) * | 2017-11-17 | 2021-02-09 | 河南大学 | Application of GRMZM2G701063 gene in adversity stress |
| CN110066773B (en) * | 2018-01-22 | 2022-09-16 | 中国农业大学 | Application of corn ZmMPK11 protein or coding gene thereof in regulating plant stress tolerance |
| CN109182357B (en) * | 2018-10-12 | 2021-05-25 | 山东大学 | Application of maize mitogen-activated protein kinase gene ZmMPK20 in regulation of stomatal movement and plant heat resistance |
| CN110396510B (en) * | 2018-12-21 | 2021-08-20 | 北京市农林科学院 | Drought-resistant protein, coding gene and application thereof |
| CN111073873B (en) * | 2019-12-31 | 2022-04-05 | 中国农业大学 | Application of PP84 protein and coding gene thereof in regulation and control of plant drought resistance |
| CN111996181B (en) * | 2020-09-22 | 2022-04-12 | 中国农业大学 | Application of DRK protein and coding gene thereof in drought resistance of plants |
-
2021
- 2021-03-10 CN CN202110262045.6A patent/CN112795552B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008063755A2 (en) * | 2006-10-03 | 2008-05-29 | Monsanto Technology Llc | Methods for hybrid corn seed production and compositions produced therefrom |
| CN114752579A (en) * | 2020-12-25 | 2022-07-15 | 中国农业大学 | Application of ZmMAPK protein and coding gene thereof in regulation and control of low-temperature stress tolerance of plants |
Non-Patent Citations (1)
| Title |
|---|
| EXPLICT-Kinase: A gene expression predictor for dissectiong the functions of the Arabidopsis kinome;Yuming Peng 等;《Journal of Integrative Plant Biology》;20220421;第64卷(第7期);第1374-1393页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112795552A (en) | 2021-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112795552B (en) | Application of Zm00001d024568 gene and encoding protein thereof in drought stress resistance of corn | |
| CN111574605B (en) | Application of rice gene OsLAT5 in regulation of absorption and accumulation of diquat | |
| KR20230009299A (en) | Protein gsw8 for regulating and controlling grain shape and thousand grain weight of rice, and coding gene and application of protein gsw8 | |
| CN107988234B (en) | Application of GRMZM2G701063 gene in adversity stress | |
| CN113040159A (en) | Application of kinase inhibitor Reversine in improving bacterial wilt resistance of plants | |
| CN108624596A (en) | It is a kind of regulation and control Legume nodule growth gene GmSPX5 and its application | |
| CN113501867B (en) | Corn drought-resistant gene ZmMYBR38 and application thereof | |
| CN112210566B (en) | Application of rice OsS6K1 gene or OsS6K2 gene in improving rice yield and/or drought resistance | |
| CN113621625A (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
| CN114752579A (en) | Application of ZmMAPK protein and coding gene thereof in regulation and control of low-temperature stress tolerance of plants | |
| CN108728480A (en) | Application of the At3g16910 genes in terms of cultivating drought-resistant crops | |
| CN103570805A (en) | Active polypeptide and application of active polypeptide in plant root growth | |
| CN112341532A (en) | Application of OsDSK2a protein or coding gene thereof in regulation and control of rice blast resistance | |
| CN108285926B (en) | Method for identifying and improving germination waterlogging tolerance of rice seeds | |
| CN110004173B (en) | Method for obtaining non-transgenic storable fresh-eating Chinese wolfberry | |
| CN114107373B (en) | Method for preparing arabidopsis autophagy gene mutant and application thereof | |
| CN114350673B (en) | Rice KOB1 gene for regulating and controlling seed vigor and regulating and controlling method thereof | |
| CN111560055B (en) | Application of rice gene OsLAT3 in regulation of absorption and accumulation of diquat | |
| CN114369616A (en) | Application of tomato SISPS gene in improving high temperature resistance of plants | |
| CN102268439B (en) | Gene OS1 for regulating nitrogen absorption and utilization and drought stress of corn, and application thereof | |
| CN104498512A (en) | Application of arabidopsis calcium ion-dependent protein kinase gene AtGPK1 in regulation and control of stomatal movement and plant drought resistance | |
| CN109880831A (en) | Originally response factor PpIAA1 gene and its application of peach auxin | |
| CN114507678B (en) | Rice ABA signal negative regulation factor OsUBC12 gene, encoding protein and application thereof | |
| CN115894643B (en) | Sorghum salt and alkali tolerance related gene AT1 and application thereof in crop salt and alkali tolerance | |
| CN112301034B (en) | Rice low light response gene RLL1, mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |