CN112341532A

CN112341532A - Application of OsDSK2a protein or coding gene thereof in regulation and control of rice blast resistance

Info

Publication number: CN112341532A
Application number: CN202011449973.5A
Authority: CN
Inventors: 晏石娟; 刘清; 李文燕; 陈中健; 孔谦; 黄文洁
Original assignee: Guangdong Academy Of Agricultural Sciences-Agricultural Biological Gene Research Center
Current assignee: Guangdong Academy Of Agricultural Sciences-Agricultural Biological Gene Research Center
Priority date: 2020-12-09
Filing date: 2020-12-09
Publication date: 2021-02-09

Abstract

The invention discloses application of OsDSK2a protein or coding gene thereof in regulation and control of rice blast resistance. The amino acid sequence of the OsDSK2a protein is shown in SEQ ID NO. 2. The invention proves that the rice DSK2a gene (Os10g0542200) is a functional gene of rice blast infection for the first time, and the cloning and biological function verification of the gene have important reference significance for the molecular mechanism research of rice blast resistance. The invention provides a Cas 9-mediated Os10g0542200 gene editing vector. After the vector is used for transforming rice, the expression level of the Os10g0542200 can be greatly reduced, the rice blast susceptibility of transformed plants is reduced and the disease resistance is obviously enhanced along with the reduction of the expression level, and the growth state and the agronomic characters of the transgenic plants are not obviously changed. The Os10g0542200 gene knockout technology mediated by Cas9 can be applied to genetic engineering breeding of rice and production practice to improve rice blast resistance of rice, thereby ensuring the safety of rice production under the climate condition of frequent rice diseases at present.

Description

Application of OsDSK2a protein or coding gene thereof in regulation and control of rice blast resistance

The technical field is as follows:

the invention belongs to the technical field of crop genetics, and particularly relates to application of OsDSK2a protein or an encoding gene thereof in regulation and control of rice blast resistance.

Background art:

the rice blast caused by the fungus Magnaporthe grisea (Hebert) Barr is one of the rice diseases which cause the most serious harm to rice regions in the world, and has devastating influence on the cultivation of rice all over the world. The rice blast is probably generated in all stages of rice growth, particularly the damage of leaf blast and panicle blast is the largest. The yield loss caused by rice blast is 11-30% every year around the world, about 50 hundred million dollars are directly lost economically, and lost grains are enough to live 6000 million people. In China, rice blast occurs in places where rice is cultivated. The rice areas in the south and north are harmed by different degrees every year, the yield is generally reduced by 10-20%, the weight is 40-50%, and local rice fields even have no grain.

At present, the development of rice blast resistance breeding by utilizing the resistance of varieties is considered to be the most economical, effective and environment-friendly way for prevention and treatment. In recent years, breeders have developed many rice blast resistant varieties using conventional breeding techniques. However, most disease-resistant varieties lose the rice blast resistance after being popularized and applied for 2-3 years. If the high-resistance rice blast variety 'narrow leaf green No. 8' is popularized and planted for less than three years, the resistance is lost, and the high-yield disease-resistant high-quality variety 'japonica indica 89' is popularized for less than four years, the disease resistance is also obviously reduced. Therefore, the short rice blast resistance period of the rice variety is a common and outstanding problem in rice production, and the prolonging of the persistence life of the rice blast of the rice variety is a problem to be solved preferentially in rice improvement in China and even various rice producing countries.

Rice blast is likely to occur in all stages of rice growth, and leaf blast and panicle blast are the most common. Studies have shown that rice leaf blast resistance and panicle blast resistance are common. The results of genetic analysis of disease resistance of rice blast persistent resistant varieties Morobekan, flos Pruni mume No.2 and Sanhuangzhan No.2 show that the rice blast persistent resistance consists of two parts of quality resistance (major gene control) and numerical resistance (minor gene control). At least 84 major genes with 69 blast resistance loci and QTL with more than 300 blast number resistance have been reported internationally. However, the identification, cloning and application of rice susceptibility genes are rarely reported. Therefore, the discovery, identification and utilization of rice blast susceptible genes are also important ways for making breakthroughs in rice blast resistance molecular breeding.

The invention content is as follows:

the invention aims to provide application of OsDSK2a protein or coding gene thereof in regulation and control of rice blast resistance.

The invention utilizes CRISPR technology to knock out OsDSK2a gene (Os10g0542200) contained in rice, and then cultures transformed rice cells into plants to obtain the transgenic rice with changed rice blast resistance, wherein the rice blast resistance of the rice is improved after the Os10g0542200 gene is knocked out.

Therefore, the invention provides application of the OsDSK2a protein or the coding gene-OsDSK 2a gene thereof in regulation and control of rice blast resistance, and the amino acid sequence of the OsDSK2a protein is shown as SEQ ID NO. 2.

Preferably, the nucleotide sequence of the OsDSK2a gene is shown in SEQ ID NO. 1.

Preferably, the application of the OsDSK2a gene in rice to improving rice blast resistance is knocked out.

The second purpose of the invention is to provide a method for improving rice blast resistance, which is to knock out OsDSK2a gene in rice so as to improve the rice blast resistance, wherein the nucleotide sequence of the OsDSK2a gene is shown as SEQ ID NO. 1.

Preferably, the OsDSK2a gene contained in the rice cell is knocked out by using the CRISPR technology, and the transformed rice cell is cultured into a plant to obtain the transgenic rice with improved rice blast resistance.

Preferably, the nucleotide sequence of the specific editing site of the OsDSK2a gene contained in the rice knocked out by using the CRISPR technology is shown as SEQ ID NO. 3.

The third purpose of the invention is to provide a specific editing site for specifically knocking out OsDSK2a gene by Crispr/Cas9, and the nucleotide sequence is shown as SEQ ID NO. 3.

The fourth purpose of the invention is to provide the application of the specific editing site in improving the rice blast resistance of rice. Such as application in preparing medicines for improving rice blast resistance of rice.

The invention also provides a gene editing target site, sgRNA and a specific primer pair of the OsDSK2a gene; the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium containing the target site sequence belong to the protection scope of the invention.

The invention has the following beneficial effects:

1. the invention proves that the rice DSK2a gene (Os10g0542200) is a functional gene of rice blast infection for the first time, and the cloning and biological function verification of the gene have important reference significance for the molecular mechanism research of rice blast resistance.

2. The invention provides a Cas 9-mediated Os10g0542200 gene editing vector. After the vector is used for transforming rice, the expression level of the Os10g0542200 can be greatly reduced, the rice blast susceptibility of transformed plants is reduced and the disease resistance is obviously enhanced along with the reduction of the expression level, and the growth state and the agronomic characters of the transgenic plants are not obviously changed. Therefore, the Os10g0542200 gene knockout technology mediated by Cas9 can be applied to genetic engineering breeding of rice and production practice to improve rice blast resistance of rice, thereby ensuring the safety of rice production under the current climatic condition of frequent rice diseases.

Drawings

FIG. 1 is the overexpression vector pYLCRISPR/Cas9P used in example 1_ubi-vector maps of H and pYLgRNA-OsU6 b;

FIG. 2 is the PCR identification and target site sequencing diagram of transgenic plants obtained by Os10g0542200 gene knockout in example 2, wherein OsDSK2aCas9-6, OsDSK2aCas9-14 and OsDSK2aCas9-17 are transgenic homozygous mutant seedlings with Os10g0542200 gene knockout, + represents positive control, -represents negative control;

FIG. 3 is the effect of knockout of the Os10g0542200 gene on leaf blast resistance of rice plants in example 3, wherein it indicates that there is a very significant difference compared to the control, wherein OsDSK2aCas9-6, OsDSK2aCas9-14 and OsDSK2aCas9-17 are transgenic homozygous mutant seedlings with Os10g0542200 gene knockout, and Wildtype represents wild type.

Detailed Description

The following examples are further illustrative of the present invention and are not intended to be limiting thereof. The following examples are given without specifying the particular experimental conditions and methods, and the technical means employed are generally conventional means well known to those skilled in the art. The test materials used in the following examples were all available from conventional biochemical reagents companies unless otherwise specified.

Example 1 selection of Os10g0542200 Gene knockout target sites and construction of knockout vectors

1. Selection of knock-out target sites

A knockout target sequence is designed aiming at the Os10g0542200 gene (the nucleotide sequence of the gene is shown as SEQIDNo: 1). A specific target sequence of 20bp was selected for the generation of sgRNA using E-CRISP (http:// www.e-CRISP. org/E-CRISP /). The sequence (the nucleotide sequence is shown as SEQ ID NO. 3) is positioned at the 352-371bp position (5'-GCTTCAGCTGCTCCTAGCAG-3') of the second exon and the full-length 1728bp CDS sequence (the nucleotide sequence is shown as SEQ ID NO. 1) of the Os10g0542200 gene. The amino acid sequence of the coding protein DSK2a of the Os10g0542200 gene is shown in SEQ ID NO. 2.

2. Construction of knockout vector pYLCRISPR/Cas9-OsDSK2a

(1) Strain activation and plasmid extraction preparation: a single colony of a strain (TOP 10F') containing plasmid pYLCRISPR/Cas9-H (AddgeneiD66187, vector map of which is shown in FIG. 1) and a strain (DH10B) containing pYLgRNA-OsU6b (AddgeneiD66196, vector map of which is shown in FIG. 1) from the laboratory of Sichuan Guangxi university of Sichuan Guangxi were streaked out on LB plate medium containing kanamycin (25. mu.g/ml) and ampicillin (50. mu.g/ml), respectively, and 1ml of seed solution was cultured from the single colony, and then expanded for plasmid extraction. Extracting and purifying with EndoFreeMaxi plasmid kit (TIANGEN corporation) for use.

(2) Construction of sgRNA expression cassette:

taking 2-5ng pYLgRNA-OsU6b plasmid as a template, and using 4 primers in one reaction: U-F and gR each 0.2. mu.M, DSK6b-F and DSK6b-R each 0.1. mu.M. And (2) 25-28 circulation: 94 ℃ for 10s, 58 ℃ for 15s and 68 ℃ for 20 s. During the amplification process, U-F/DSK6b-R amplifies a U6a promoter + DSK2a target site sequence and DSK6b-F/gR amplifies a DSK2a target site + sgRNA sequence during the first few cycles. Later cycles generated 2 fragment-pooled sgRNA expression cassette fragments (containing OsU6b promoter, DSK2a target site and sgRNA sequence) by overlappinging PCR. PCR primers: U-F: CTCCGTTTTACCTGTGGAATCG, respectively; gR-R: CGGAGGAAAATTCCATCCAC, respectively; DSK6b-F: CTGCTAGGAGCAGCTGAAG caacacaagcggcagc; DSK6b-R: CTTCAGCTGCTCCTAGCAG gttttagagctagaaat.

② taking 1 microliter of PCR product of the first round and using H₂O is diluted by 10 times, 1 mul is taken as a template, Pps-GGL and Pgs-GG2 primers are added into a 50 mul PCR reaction system, each 0.15 mul and a proper amount of high fidelity KOD-Plus enzyme are added respectively. And (4) amplifying for 17-20 cycles: the sgRNA expression cassettes were obtained at 95 ℃ for 10s, 58 ℃ for 15s, and 68 ℃ for 20 s. 2-3. mu.l of the sample was examined electrophoretically and the approximate concentration of the sample was estimated. PCR primers: TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG for Pps-GGL; Pgs-GG2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC.

(3) Enzyme digestion-ligation reaction of binary vector pYLCRISPR/Cas9-H and sgRNA expression cassette:

performing enzyme digestion connection by temperature-variable circulation at 37 deg.C for 5min for about 10-15 cycles; 5min at 10 ℃ and 5min at 20 ℃; finally 5min at 37 ℃. The ligation product is obtained.

(4) Ligation product conversion (electro-stimulation conversion): dropping the ligation product obtained in step (3) on a suspended dialysis membrane Millipore VSWP04700(0.025 μm pore size), dialyzing 1/3xTE for 30min for desalination, and electrically transforming E.coli DH10B competent cells with 1 μ l of the ligation product.

(5) Screening positive clones: extracting plasmids by a conventional alkaline lysis method, taking about 80-100 ng, cutting out fragments of the gRNA expression cassettes connected in series by 3UAscI (20 mu l reaction), and checking whether the size of the fragments of the gRNA expression cassettes meets the expectation (the sum of the sizes of the fragments of the gRNA expression cassettes) by electrophoresis. Positive clones were selected for sequencing verification, thereby obtaining a knock-out vector pYLCRISPR/Cas9-OsDSK2a targeting the OsDSK2a gene. Sequencing primer: SP1: CCCGACATAGATGCAATAACTTC; SP2: GCGCGGTGTCATCTATGTTACT.

Example 2 obtaining and identifying of Os10g0542200 Gene knockout transgenic plants

The constructed knockout vector pYLCISPR/Cas 9-OsDSK2a is transferred into a normal japonica rice variety Nipponbare by adopting an agrobacterium EHA105 mediated genetic transformation method. The rice transformation work is finished by Wuhanbo high-tech Biotechnology Limited. The general process of transformation is as follows: extracting pYLCRISPR/Cas9-OsDSK2a plasmid, transforming into Agrobacterium EHA105, infecting the Agrobacterium EHA105 containing pYLCRISPR/Cas9-OsDSK2a plasmid into japonica rice variety Nipponbare callus, transferring to a co-culture medium for 2-4 days at 26 ℃, transferring the cleaned callus to a selection culture medium containing hygromycin for resistance screening, transferring the selected resistance callus to a pre-differentiation culture medium for 10-14 days, transferring to a differentiation culture medium for illumination culture, and transferring to a rooting culture medium for 3 weeks when plantlets grow to 2-4 cm. And (3) hardening seedlings of T0 generation seedlings for 3 days, transplanting the seedlings into soil, and performing PCR identification.

Wild type and T0 generation leaf genome DNA are used as templates, PCR amplification is carried out by Hyg-F/Hyg-R (primer Hyg-F: AGCCTGACCTATTGCATCTCCC; Hyg-R: CTGCTCCATACAAGCCAACCAC), and the plants with specific amplification bands are transgenic positive plants. Then, specific primers DSK2a-F and DSK2a-R (primer sequences DSK2 a-F: TCTTTTCTTGCTTCTCACACTCC; DSK2 a-R: TTGCCAGTAGAACCTGCCCG) are designed on both sides of the edited target sequence, and the PCR amplification product (figure 2-A) is sequenced by taking the positive transgenic plant genome DNA as a template to detect the T0 generation target sequence. With wild type as a control, 20 transformed seedlings were identified in the T0 generation, wherein 3 homozygous mutant seedlings were OsDSK2aCas9-6, -14 and-17, respectively, and the mutation sequences were shown in FIG. 2-B. Wherein, OsDSK2aCas9-6 and OsDSK2aCas9-17 are single-base insertions of the same site, which result in a frame shift mutation and differ from wild type from the 124 th amino acid at the N-terminus, and terminate early after 186 th amino acid. OsDSK2aCas9-14 is a four-base deletion, resulting in a frame shift mutation and differing from wild type starting at amino acid 122 from the N-terminus and terminating prematurely after amino acid 164.

Example 3 Os10g0542200 Gene knockout transgenic plants for phenotypic identification of leaf blast resistance

3 homozygous gene knockout T0 lines (OsDSK2aCas9-6, OsDSK2aCas9-14 and OsDSK2aCas9-17) in example 2 and wild type rice seeds germinate at 32 ℃, buds are respectively transplanted to plastic trays filled with soil after 2 days for sowing, the seedlings are transplanted to black plastic barrels (the diameter is about 30cm and the height is about 45cm) when growing to 3-4 leaves, 4 plants are planted in each barrel, 16 plants are planted in each line, and the leaf blast resistance identification is carried out by adopting a perforation inoculation method after 4 weeks. The second or third leaf of each plant was pressed out of the wound with a punch and 10 microliters of the leaf containing 5x10 was added⁵The bacterial liquid of a spore (Pyricularia oryzae) is dripped to a wound of a leaf blade, and then the leaf blade is stuck by waterproof adhesive tape to prevent the bacterial liquid from overflowing. The inoculated plants are cultured in the dark for 24h in an artificial climate box, water is sprayed for 2 minutes to maintain the humidity within 2-3 h, the plants are moved to a net room for normal light period culture after 24h, water is sprayed for 2 minutes every 2-3 h to maintain the humidity, and the size of the lesion spots is measured after 7 days. The result is shown in figure 3, and the result shows that the leaf plague resistance of the Os10g0542200 gene knockout plant is obviously enhanced, and the diseased leaf surface is compared with the wild typeThe volume is significantly reduced.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> center for researching agricultural biological genes of Guangdong province academy of agricultural sciences

<120> application of OsDSK2a protein or coding gene thereof in regulation and control of rice blast resistance

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1728

<212> DNA

<213> Rice (Oryza sativa)

<400> 1

atgggcggcg gaggaggcga ggccgggggc ggcgacggag gggagtcctc tcctgctgcg 60

gctgcggcgg cggcggtggc gggggccgcg gcgctgcaca tccggtgcgc gaacgggtcc 120

aagttcaccg tgcgggccga cctcgacgcc acggtggggg cgttcaagga ggtggtggcg 180

gggagctgcg acgtgccggc ggcgcagcag cgcctgatct acaagggccg gatcctcaag 240

gacgagcaaa ccctagaaag ctatggtgtt gaaacagatc ataccattca tatggtgcgt 300

ggcgctggtc ccccagccgg atcagctgca cctgctgcag ccagccccca agcttcagct 360

gctcctagca gcggcccaac agatggtctt ggaagtttgt ttcctggcct tggtggtaca 420

ggaactgctg gtaccaggcc atctggtctt tttgggtctg gatttccaga attggatcaa 480

atgcagcagc agttaagcca aaaccccaac ttaatgaggg aaataatgaa tatgccaatg 540

atgcagaatc tcatgaataa ccctgattta attcgtaaca tgatcatgaa caatcctcaa 600

atgcgtgata tcatcgaccg gaatccagat cttgctcatg ttctcaatga tccaagtgtt 660

ctccgccaga cccttgaagc agccagaaac cctgaaatca tgagggagat gatgcggaac 720

acagacagag caatgagcaa cattgagtct tctcctgaag ggtttaatat gctccgacgc 780

atgtatgaaa ctgtccagga gcctttccta aatgcgacaa caatgggtgg agaaggcaac 840

acagctccaa acccattctc agctcttctt ggaaatcagg gttctaacca accaagggat 900

cctgctacaa atgctccaaa tactggctca gagtctacaa caggaacccc tgctccaaac 960

actaatccac ttccaaatcc ttggagctcc aatgctggag gtgcgcaagg agcaacacgg 1020

gcaggttcta ctggcaatgc aagaaccggt gccactgggg gccttggagg gttggggtca 1080

gctgatctga gcagtttatt tggtggtctt gccggtaata caggaactgg tgctactggt 1140

ggtctaggag ggttgggttc agcagatttg ggaagtttgc ttggtggttc tcctgattct 1200

tcttccttga gccagatttt gcaaaaccct gttatgatgc agatgatgca gaatatcatg 1260

tctgatccac agtccatgaa ccagttgctt aacttcaacc caaatacacg caacctcatg 1320

gaatcaaaca ctcagttgag ggaaatgttc caaaatccag aatttattcg ccagcttaca 1380

tccccagaaa ctatgcagca attactctcg ttccagcaga cattattatc acagcttggt 1440

caaaatcaac ctaggcagga tggtagccaa ggaggcaatg cgacaggcat gcggggaaat 1500

gttagcctcg acaccttgat gggcatgctt agtgggcttg gtgctggagg tggcataggt 1560

gtacccaata catccaatgt tccaccggaa gaactgtatg caacacagct cactcagctc 1620

cgagagatgg gtttcatcga cactgcagag aacatccagg cgctagtcgc aactgctggg 1680

aatgtgaatg ctgcggtgga gcgtcttctt ggcaatcttg gccagtag 1728

<210> 2

<211> 575

<212> PRT

<213> Rice (Oryza sativa)

<400> 2

Met Gly Gly Gly Gly Gly Glu Ala Gly Gly Gly Asp Gly Gly Glu Ser

1 5 10 15

Ser Pro Ala Ala Ala Ala Ala Ala Ala Val Ala Gly Ala Ala Ala Leu

20 25 30

His Ile Arg Cys Ala Asn Gly Ser Lys Phe Thr Val Arg Ala Asp Leu

35 40 45

Asp Ala Thr Val Gly Ala Phe Lys Glu Val Val Ala Gly Ser Cys Asp

50 55 60

Val Pro Ala Ala Gln Gln Arg Leu Ile Tyr Lys Gly Arg Ile Leu Lys

65 70 75 80

Asp Glu Gln Thr Leu Glu Ser Tyr Gly Val Glu Thr Asp His Thr Ile

85 90 95

His Met Val Arg Gly Ala Gly Pro Pro Ala Gly Ser Ala Ala Pro Ala

100 105 110

Ala Ala Ser Pro Gln Ala Ser Ala Ala Pro Ser Ser Gly Pro Thr Asp

115 120 125

Gly Leu Gly Ser Leu Phe Pro Gly Leu Gly Gly Thr Gly Thr Ala Gly

130 135 140

Thr Arg Pro Ser Gly Leu Phe Gly Ser Gly Phe Pro Glu Leu Asp Gln

145 150 155 160

Met Gln Gln Gln Leu Ser Gln Asn Pro Asn Leu Met Arg Glu Ile Met

165 170 175

Asn Met Pro Met Met Gln Asn Leu Met Asn Asn Pro Asp Leu Ile Arg

180 185 190

Asn Met Ile Met Asn Asn Pro Gln Met Arg Asp Ile Ile Asp Arg Asn

195 200 205

Pro Asp Leu Ala His Val Leu Asn Asp Pro Ser Val Leu Arg Gln Thr

210 215 220

Leu Glu Ala Ala Arg Asn Pro Glu Ile Met Arg Glu Met Met Arg Asn

225 230 235 240

Thr Asp Arg Ala Met Ser Asn Ile Glu Ser Ser Pro Glu Gly Phe Asn

245 250 255

Met Leu Arg Arg Met Tyr Glu Thr Val Gln Glu Pro Phe Leu Asn Ala

260 265 270

Thr Thr Met Gly Gly Glu Gly Asn Thr Ala Pro Asn Pro Phe Ser Ala

275 280 285

Leu Leu Gly Asn Gln Gly Ser Asn Gln Pro Arg Asp Pro Ala Thr Asn

290 295 300

Ala Pro Asn Thr Gly Ser Glu Ser Thr Thr Gly Thr Pro Ala Pro Asn

305 310 315 320

Thr Asn Pro Leu Pro Asn Pro Trp Ser Ser Asn Ala Gly Gly Ala Gln

325 330 335

Gly Ala Thr Arg Ala Gly Ser Thr Gly Asn Ala Arg Thr Gly Ala Thr

340 345 350

Gly Gly Leu Gly Gly Leu Gly Ser Ala Asp Leu Ser Ser Leu Phe Gly

355 360 365

Gly Leu Ala Gly Asn Thr Gly Thr Gly Ala Thr Gly Gly Leu Gly Gly

370 375 380

Leu Gly Ser Ala Asp Leu Gly Ser Leu Leu Gly Gly Ser Pro Asp Ser

385 390 395 400

Ser Ser Leu Ser Gln Ile Leu Gln Asn Pro Val Met Met Gln Met Met

405 410 415

Gln Asn Ile Met Ser Asp Pro Gln Ser Met Asn Gln Leu Leu Asn Phe

420 425 430

Asn Pro Asn Thr Arg Asn Leu Met Glu Ser Asn Thr Gln Leu Arg Glu

435 440 445

Met Phe Gln Asn Pro Glu Phe Ile Arg Gln Leu Thr Ser Pro Glu Thr

450 455 460

Met Gln Gln Leu Leu Ser Phe Gln Gln Thr Leu Leu Ser Gln Leu Gly

465 470 475 480

Gln Asn Gln Pro Arg Gln Asp Gly Ser Gln Gly Gly Asn Ala Thr Gly

485 490 495

Met Arg Gly Asn Val Ser Leu Asp Thr Leu Met Gly Met Leu Ser Gly

500 505 510

Leu Gly Ala Gly Gly Gly Ile Gly Val Pro Asn Thr Ser Asn Val Pro

515 520 525

Pro Glu Glu Leu Tyr Ala Thr Gln Leu Thr Gln Leu Arg Glu Met Gly

530 535 540

Phe Ile Asp Thr Ala Glu Asn Ile Gln Ala Leu Val Ala Thr Ala Gly

545 550 555 560

Asn Val Asn Ala Ala Val Glu Arg Leu Leu Gly Asn Leu Gly Gln

565 570 575

<210> 3

<211> 20

<212> DNA

<213> Rice (Oryza sativa)

<400> 3

gcttcagctg ctcctagcag 20

Claims

The application of OsDSK2a protein or coding gene-OsDSK 2a gene in regulation and control of rice blast resistance is disclosed, wherein the amino acid sequence of the OsDSK2a protein is shown in SEQ ID NO. 2.
2. The use of claim 1, wherein the nucleotide sequence of the OsDSK2a gene is shown in SEQ ID NO. 1.
3. The use of claim 1 or 2, wherein the OsDSK2a gene in rice is knocked out for improving rice blast resistance.
4. A method for improving rice blast resistance is characterized in that OsDSK2a gene in rice is knocked out, so that the rice blast resistance is improved, and the nucleotide sequence of the OsDSK2a gene is shown as SEQ ID No. 1.
5. The method as claimed in claim 4, wherein the OsDSK2a gene contained in the rice cell is knocked out by CRISPR technique, and the transformed rice cell is cultivated into a plant to obtain the transgenic rice with improved rice blast resistance.
6. The method according to claim 5, wherein the OsDSK2a gene contained in the rice is knocked out by using CRISPR technology, and the nucleotide sequence of the specific editing site is shown as SEQ ID NO. 3.
7. A specific editing site for specifically knocking out OsDSK2a gene by Crispr/Cas9 is characterized in that the nucleotide sequence is shown as SEQ ID NO. 3.
8. Use of the specific editing site of claim 7 for increasing rice blast resistance.