CN114350673B - Rice KOB1 gene for regulating and controlling seed vigor and regulating and controlling method thereof - Google Patents

Abstract

The invention discloses a rice KOB1 gene for regulating seed activity and a regulating method thereof, wherein the nucleotide sequence of the KOB1 gene is shown as a sequence 1, and the regulating method comprises the following steps: through transduction of a rice KOB1 gene (OsKOB 1) into recipient rice or other plants, the OsKOB1 is over-expressed or heterologously expressed in seeds, so that the activity of the seeds is improved; alternatively, knock-out of KOB1 gene of rice or other plants by CRISPR/Cas9 gene editing methods, resulting in reduced seed vigor of the mutant; wherein: the KOB1 gene sequence of rice is shown in SEQ ID NO. 1. The invention can control the expression of the potassium ion channel protein related gene KOB1 in the seeds by genetic engineering, and can obviously influence the activity of the seeds. The genetic engineering method is used for carrying out genetic manipulation on the rice KOB1, so that the seed vitality can be obviously changed, and the biological function has a wide application prospect for improving the seed vitality.

Description

Rice KOB1 gene for regulating and controlling seed vigor and regulating and controlling method thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a rice KOB1 gene for regulating and controlling seed vigor and a regulating and controlling method thereof.

Background

Agricultural production is not free of high-vigor seeds, and maintaining high vigor of seeds during storage has been a concern for scientists and agricultural producers. After harvesting, a series of physiological and biochemical metabolic changes occur in the seeds during storage, such as damaged cell membrane integrity, degradation of DNA, impaired synthesis of RNA and protein, reduced energy metabolism, etc., resulting in aging of the seeds, and thus reduced or even complete loss of seed vigor. The low-activity seeds have low germination rate, slow emergence and weak resistance to adverse environment, and finally the crop yield is obviously reduced. Scientists widely study physiological biochemistry and molecular mechanisms of seed vitality, and screen a large number of related QTLs and genes; and attempts have been made to improve the storage tolerance and seed vigor of crop seeds by genetic modification of these genes. However, the simplest and most commonly used methods and techniques for maintaining seed viability at present are to keep the seeds dry (reduce moisture content), to store them at low temperatures, to vacuum package them, and so on. In addition, the method can also be used for treating wet balance by PEG permeation, chemical drugs such as inorganic salt (ZnSO ₄ 、NaH ₂ PO ₄ NaCl, KI, etc.), trace elements (B, zn, mo, cu, etc.), fertilizers (urea, (NH) ₄ ) ₂ SO ₄ Etc.), plant hormone (GA ₃ IAA, KT, etc.) and growth active substances (polyamines, triacontane)Alcohol, etc.) and the like to improve seed vigor. But these methods and techniques fail to radically improve seed vigour or anti-aging ability.

The vital activities of the seeds are controlled by the genetic genes of the seeds, and the vitality of the seeds is also regulated and controlled by the expression of the related genes. Therefore, the gene related to the regulation of the seed vitality can be mined, and the seed vitality is regulated and controlled by the expression of the plant transgenic technology operating gene, so as to achieve the aim of improving the agronomic characters of germplasm resources. Potassium ion is one of the essential elements for plant growth and development. It has been shown that treatment of aged corn seeds with a solution of potassium ions can increase their germination rate, indicating that potassium ions have a certain effect on the restoration of aged seeds. Potassium ion channels (proteins) in plants are one of the important pathways for the transport of potassium ions by cells. However, research on whether potassium ion channel proteins are involved in seed vigor regulation has not been reported yet. Therefore, the method for regulating the expression of potassium ion channel protein so as to regulate the activity of seeds has potential application prospect.

Disclosure of Invention

The invention aims to provide a potassium ion channel protein related gene KOB1 gene for regulating and controlling the activity of seeds and a regulating and controlling method thereof, and the invention controls the expression of a rice KOB1 gene (OsKOB 1) in the seeds through genetic engineering, thereby obviously influencing the activity of the seeds.

The rice KOB1 gene (OsKOB 1) for regulating and controlling the seed vitality has a nucleotide sequence shown as a sequence 1.

The method for regulating and controlling the seed vitality by the rice KOB1 gene in the invention, namely, the method for regulating and controlling the seed vitality by controlling the rice KOB1 gene expression through genetic engineering, comprises the following steps:

through transduction of the OsKOB1 into receptor rice or other plants, the OsKOB1 is over-expressed or heterologously expressed in seeds, so that the activity of the seeds is improved;

alternatively, the KOB1 gene of rice or other plants is knocked out by CRISPR/Cas9 gene editing method, and the seed vigor of mutant seeds is reduced. .

The specific method for transducing OsKOB1 into recipient rice or other plants comprises the following steps:

1.1 cloning cDNA sequence of OsKOB1 without stop codon to construct pCUbi1390 expression vector of the gene;

1.2 using inflorescence dip-dyeing to transduce the pCubi1390 expression vector of step 1.1 into recipient rice or other plants and harvesting seeds thereof;

1.3 after the seeds harvested in step 1.2 are sterilized, they are sown in 1/2MS medium containing 30mg/L hygromycin; screening transgenic plant plants with over-expression or heterologous expression of the OsKOB1 according to the principle that positive seeds of the OsKOB1 can normally grow on the culture medium and false positive seeds die after germination and growth for a period of time by utilizing genes encoding hygromycin contained in the vector;

1.4, transplanting the positive plants screened in the step 1.3 to natural conditions (soil) for continuous growth and development, sterilizing according to the method of the step 1.3 after seeds are received, sowing the positive plants in a 1/2MS culture medium containing 30mg/L hygromycin, and continuously screening positive lines after the seeds germinate; transplanting the screened positive strain to natural conditions (soil) for continuing growth and development; respectively adopting leaves of a positive strain and a wild type plant, extracting total RNA, detecting and comparing the expression level of the OsKOB1 in the transgenic strain and the wild type plant by using a semi-quantitative PCR method, and identifying an overexpression or heterologous expression strain of the OsKOB 1; and further obtaining seeds of the positive strain;

1.5 disinfecting the seeds of the positive strain in the step 1.4, and propagating the seeds of the OsKOB1 over-expression or heterologous expression transgenic plant strain with good genetic stability according to a conventional cultivation and management method.

In the step 1.2, other plants are other crops, important wild plant germplasm resources or Arabidopsis thaliana with important research value; the primer sequences of the pCubi1390 expression vector for constructing the gene are respectively as follows: pCubi1390-OsKOB1-F (forward primer): TTCTGCACTAGGTACCTGCAGATGCAGTACAAGAACCTGGGGA, as shown in sequence 2; pCubi1390-OsKOB1-R (reverse primer): CGGGGATCCGTCGACCTGCAGTCTGTATGACTCGGTGCGCTT as shown in SEQ ID NO. 3.

In the step 1.4, the primers adopted for detecting and comparing the expression quantity of the OsKOB1 gene in the transgenic strain and the wild strain by a semi-quantitative PCR method are as follows: atactin-F (forward primer): GCCATCCAAGCTGTTCTCTC, as shown in SEQ ID NO. 4; atactin-R (reverse primer): GCTCGTAGTCAACAGCAACAA, as shown in SEQ ID NO. 5; TCGTCGAACAGCCTGAGTACAACC, osKOB1-F (Forward primer), as shown in SEQ ID NO. 6; osKOB1-R (reverse primer): GTGAGAACTCCCGAAGCTAGAGGG, shown in SEQ ID NO: 7.

The specific method for obtaining the mutant by knocking out the OsKOB1 by using the CRISPR/Cas9 gene editing method comprises the following steps:

2.1, selecting a knock-out target site of a rice KOB1 gene (OsKOB 1) and designing a primer; constructing an OsKOB1 knockout vector; the constructed OsKOB1 knockout vector is transferred into competent cells of agrobacterium EHA105 by an electrotransformation method, and agrobacterium containing the OsKOB1 knockout site vector is identified by a colony PCR method.

2.2 inducing target rice material (receptor, wild type) to generate callus by using plant growth regulator 2,4-D, selecting healthy callus as genetic transformation explant material, and introducing the OsKOB1 knockout vector constructed in the step 2.1 by using an agrobacterium-mediated method;

2.3, carrying out hygromycin resistance identification on the genetically transformed plant obtained in the step 2.2, extracting genome DNA by adopting a CTAB method, and carrying out PCR amplification and sequencing analysis on the mutant OsKOB1 gene to identify a positive strain;

2.4, propagating seeds of the OsKOB1 knockout mutant strain with excellent agronomic characters and good genetic stability according to a conventional field cultivation and management method;

2.5 seed vigor of the OsKOB1 knockout mutant strain in step 2.4 was tested.

In the step 2.1, the target sequence is as follows: CTAGCTTCGGGAGTTCTCAC as shown in sequence 8; primer gRT1: CTAGCTTCGGGAGTTCTCACGTTTTAGAGCTAGAAAT as shown in SEQ ID NO. 9; osU6aT1: GTGAGAACTCCCGAAGCTAGCGGCAGCCAAGCCAGCA as shown in SEQ ID NO. 10; colony PCR method to identify PBL primers of agrobacterium comprising OsKOB1 knockout vector: GCGCGCGGTCTCGCTCGACTAGTATGG, as shown in sequence 11; PBR primer: GCGCGCGGTCTCTACCGACGCGTATCC as shown in sequence 12.

In the step 2.3, the primer sequences for PCR amplification are as follows: cas9-F primer: ATTCAACTGAGTGTGTAGGA, as shown in sequence 13; cas9-R primer: GTTACAGCGTAGTATTGTCG as shown in sequence 14.

In the step 2.4, the OsKOB1 gene sequence of the Japanese sunny kob1 knockout mutant strain is mutated into one of kob1-1 or kob1-2 sequences, and the kob1-1 sequence is inserted with 1 base "T" after 79bp of the 2 nd exon of the original OsKOB1 gene, as shown in a sequence 15; kob1-2 is a deletion of 7 bases "GTTCTCA" after 74bp of the 2 nd exon of the original OsKOB1 gene, as shown in sequence 16.

The invention has the beneficial effects that: the invention can control the expression of the potassium ion channel protein related gene KOB1 in the seeds by genetic engineering, and can obviously influence the activity of the seeds. The genetic engineering method is used for carrying out genetic manipulation on the rice KOB1, so that the seed vitality can be obviously changed, and the biological function has a wide application prospect for improving the seed vitality.

Drawings

FIG. 1 shows the effect of Arabidopsis Wild Type (WT) and OsKOB1 heterologous expression transgenic lines "OE-1" and "OE-2" identification and artificial aging on seed germination capacity in example 1; wherein: (A) Semi-quantitative RT-PCR analysis of OsKOB1 expression in Arabidopsis leaves, atactin is a positive control; (B) Germination rate before and after artificial aging of seeds, data represent mean ± SD (n=3), significance of differences between WT and OsKOB1 heterologous expression transgenic seeds was detected using t-test (< 0.05, <0.01, <0.001, < P); (C) On 1/2MS medium, the unaged WT seed and OsKOB1 heterologous expression transgenic seed germinated for 5 days (left) and the artificially aged WT seed and OsKOB1 heterologous expression transgenic seed germinated for 6 days.

FIG. 2 shows the identification of the knockout sites of Japanese sunny kob1 mutant strains kob1-1 and kob1-2 in example 2. (a) a base change at the knockout site; (B) The amino acid sequence changes of the proteins KOB1 of KOB1-1 and KOB1-2 were predicted.

FIG. 3 shows TTC staining of freshly harvested seeds of the Japanese sunny WT and knockout mutant strains kob1-1 and kob1-2 in example 2.

FIG. 4 shows germination of freshly harvested seeds of the Japanese sunny WT and knockout mutant strains kob1-1 and kob1-2 in example 2 for 5 days.

FIG. 5 is a comparison of germination phenotype (A, B), germination rate (C) and simple vigor index (D) before and after artificial aging of seeds of the Japanese sunny WT and knockout mutant strains kob1-1 and kob1-2 of example 2; simple Viability Index (VI) =germination rate (%) x bud length (cm).

Detailed Description

Example 1 cloning of cDNA (stop codon removed) of Oryza sativa seed OsKOB1, construction of OsKOB1 expression vector, introduction of Arabidopsis thaliana, and creation of Arabidopsis thaliana seed for heterologous expression of OsKOB 1.

1. Construction of OsKOB1 expression vector pCubi1390-OsKOB1

1.1 obtaining full-length cDNA sequence of OsKOB1, as shown in SEQ ID NO. 1, specifically as follows:

(. 1-564bp, 565-708bp, 709-873bp and 874-987bp are respectively the first to OsKOB 1)

1, 2 nd, 3 rd and 4 th exons, as shown in FIG. 2A)

1.2 cleavage of the vector pCubi1390, the reaction scheme is as follows: mu.l pCUbi1390, 1. Mu.l PstI (U.S. Thermo Fisher Scientific), 2. Mu.l 10 Xbuffer, 12. Mu.l purified water; water bath at 37 ℃ for 15min;

1.3 Total RNA from seeds of Nippon Rice was extracted according to the protocol using Beijing full gold TransGen TransZol Plant kit Total RNA extraction kit, reverse transcribed using Norpran HiScript 1st Strand cDNA Synthesis Kit kit, and OsKOB1cDNA with stop codon removed was amplified by PCR technique. The primer is pCubi1390-OsKOB1-F: TTCTGCACTAGGTACCTGCAGATGCAGTACAAGAACCTGGGGA, as shown in sequence 2; pCubi1390-OsKOB1-R CGGGGATCCGTCGACCTGCAGTCTGTATGACTCGGTGCGCTT as shown in SEQ ID NO. 3. The reaction system is as follows: mu.l of purified water, 3. Mu.l of 5 Xbuffer, 0.6. Mu.l of dNTP, pCUbi1390-OsKOB1-F/R primer (SEQ ID NO: 2 and SEQ ID NO: 3), 0.5. Mu.l of GXL enzyme (high-fidelity polymerase STAR of TAKARA Co., ltd.), and reverse transcription product (genomic cDNA) of the above-mentioned 1. Mu.l of rice RNA; the PCR procedure was: (98 ℃ C. 10s,55 ℃ C. 15s,68 ℃ C. 1 min). Times.35 cycles, and preserving the PCR product at 4 ℃ C;

1.4, recovering plasmid enzyme digestion products and PCR amplification products according to the steps of the operation instruction of the kit by using a glue recovery kit of a manufacturer;

1.5 construction of OsKOB1 expression vector by using a homologous recombination kit of Norflu according to the procedure of its operational instructions.

2. Agrobacterium-transfected Arabidopsis inflorescence transformation OsKOB1

2.1 0.5. Mu.l of the above-constructed OsKOB1 expression vector was transferred into competent cells of Agrobacterium GV3101 by electrotransformation. The specific operation is as follows: adding the OsKOB1 expression vector into competent cells of agrobacterium GV3101, and ice-bathing for 10min; adding competent cells mixed with plasmids into an electrotransfer cup, electrifying for 4.6ms on an electrotransfer instrument, transferring the competent cells into an EP tube, adding 100 μl of LB culture based on 37 ℃ water bath for 1h, and taking out a coated plate; after a colony grows out, picking a colony line, and carrying out colony PCR, wherein the reaction system is as follows: 5. Mu.l Mix (Green Taq Mix of Nanjinouzan Co.), 0.5. Mu.l pCUbi1390-OsKOB1-F primer (SEQ ID NO: 2), 0.5. Mu.l pCUbi1390-OsKOB1-R primer (SEQ ID NO: 3), 3. Mu.l purified water, and ultra clean bench were stirred in the above mixture; (94 ℃ C. 30s,55 ℃ C. 30s,72 ℃ C. 1min,). Times.32 cycles, 4 ℃ C. Preservation; mu.l of colony PCR product was taken and subjected to gel electrophoresis (gel formulation: 4.84g/L Tris,0.744g/L Na) ₂ EDTA·2H ₂ O,1.142ml/L glacial acetic acid, 1mg/L EB nucleic acid dye, 1% agar powder; buffer configuration: 4.84g/L Tris,0.744g/L Na ₂ EDTA·2H ₂ O,1.142ml/L glacial acetic acid; electrophoresis conditions: voltage 120V, current 104mA, power 12W) to detect the gene fragment of interest (OsKOB 1) contained in the positive colonies.

2.2 infection of Arabidopsis inflorescences with Agrobacterium comprising an OsKOB1 expression vector, osKOB1 was transduced into Arabidopsis.

2.3 sterilizing the harvested Arabidopsis transgenic seeds, sowing in 1/2MS medium (macroelement 825mg/L NH) ₄ NO ₃ ，950mg/L KNO ₃ ，220mg/L CaCl ₂ ·2H ₂ O，185mg/L MgSO ₄ ·7H ₂ O，85mg/L KH ₂ PO ₄ The method comprises the steps of carrying out a first treatment on the surface of the Trace elements: 0.415mg/L KI,3.1mg/L H ₃ BO ₃ ，11.15mg/L MnSO ₄ ·4H ₂ O，4.3mg/L ZnSO ₄ ·7H ₂ O，0.125mg/L Na ₂ MnO ₄ ·2H ₂ O，0.0125mg/L CuSO ₄ ·5H ₂ O，0.0125mg/L CoCl ₂ ·6H ₂ O，27.8mg/L FeSO ₄ ·7H ₂ O+37.3mg/L Na ₂ -EDTA·2H ₂ O; organic components: 100mg/L inositol, 0.5mg/L niacin, 0.5mg/L pyridoxine hydrochloride, 0.1mg/L thiamine, 2mg/L glycine, 30,000 mg/L sucrose, 5,000 mg/L agar, pH 5.8). Transplanting the positive plants to natural conditions (soil) for further growth and development, collecting seeds after the seeds are ripe, sterilizing, placing in a refrigerator at 4 ℃ for 3 days to go to dormancy, and sowing in a 1/2MS culture medium containing 30mg/L hygromycin for further screening to obtain positive plant lines. Transplanting the positive strain under natural conditions (soil), collecting leaves of the positive strain and wild strain, extracting total RNA according to Trizol kit instruction of Beijing Soy pal company, and using NovoxamReverse Transcriptase kit reverse transcription of RNA.

2.4 verification of positive lines by semi-quantitative PCR method, primers used were: atactin-F GCCATCCAAGCTGTTCTCTC, shown in SEQ ID NO. 4; atactin-R GCTCGTAGTCAACAGCAACAA, shown in SEQ ID NO. 5; osKOB1-F TCGTCGAACAGCCTGAGTACAACC, shown in SEQ ID NO. 6; osKOB1-R GTGAGAACTCCCGAAGCTAGAGGG, shown in SEQ ID NO. 7. As can be seen from FIG. 1A, the gene is not expressed in the Arabidopsis wild type and the expression levels in the transgenic lines OE-1 and OE-2 are high. Germination tests were performed on both these strains and wild-type unaged seeds and on seeds artificially aged for 6d at 42 ℃ and RH 100%, as shown in the results of fig. 1B, C, the aging treatment significantly reduced the germination rate of arabidopsis seeds; however, compared with the wild type, the aged transgenic strain has higher seed germination rate and better germination condition, which indicates that the heterologous expression of the OsKOB1 is helpful for improving the vigor or anti-aging capability of the Arabidopsis seeds.

Example 2 obtaining mutant seed by knocking out OsKOB1 Using Paddy Nippon Temminck

1. Construction of OsKOB1 knockout vector

Knockout target site selection was performed aT http:// skl.scau.edu.cn/website (target: CTAGCTTCGGGAGTTCTCACTGG, as shown in SEQ ID NO: 8; primer gRT1: CTAGCTTCGGGAGTTCTCACGTTTTAGAGCTAGAAAT, as shown in SEQ ID NO: 9; osU6aT1: GTGAGAACTCCCGAAGCTAGCGGCAGCCAAGCCAGCA, as shown in SEQ ID NO: 10); and constructing an OsKOB1 knockout vector (see methods: wu Xian, li Jiali, zeng Qinghong, zhang Dashuang, xu Haifeng, jiang Xue, song Li, peng Jiang, zhu Susong. Seed 2021 (40): 50-55) is improved by using CRISPR/Cas9 gene editing technology.

2. Callus induction of Japanese sunny seed embryo. Selecting fresh mature seeds of Nippon sunny, removing glume, cleaning the seeds with sterilized purified water for 4-5 times, cleaning with 75% alcohol for 3min, and discarding alcohol; adding 2.5% sodium hypochlorite, shaking at 180rpm for 30min, and discarding disinfectant; the seeds are washed by sterilized purified water for more than 5 times, and after the seeds are placed on sterilized filter paper on an ultra-clean workbench for air drying, the seeds are planted on a callus induction culture medium (N6 +30g/L sucrose, 2.8g/L proline, 0.3g/L casein, 2.5 mg/L2, 4-D,3.5g/L agar, pH5.8) and are subjected to dark culture for 7-10D at 25-28 ℃.

3. The OsKOB1 knockout vector was transduced into agrobacterium. Mixing 0.5 μl of OsKOB1 knockout vector into competent cells of Agrobacterium EHA105, and ice-bathing for 10min; transferring competent cells mixed with plasmids into an electrotransfer cup, electrifying for 4.6ms on an electrotransfer instrument, transferring into a 1.5ml EP tube, adding 100 mu L of LB culture medium (yeast powder 5g/L, tryptone 10g/L and sodium chloride 10 g/L), uniformly mixing, carrying out water bath at 37 ℃ for 1h, taking out a coated plate, taking out colonies, marking out the colonies, and carrying out colony PCR to identify the agrobacterium EHA105 competent cells containing the OsKOB1 knockout vector. The reaction system: 5. Mu.l Mix (Green Taq Mix from Nanjinopran), 0.5. Mu.l of PBL primer (GCGCGCGGTCTCGCTCGACTAGTATGG, SEQ ID NO: 11) and 0.5. Mu.l of PBR primer (GCGCGCGGTCTCTACCGACGCGTATCC, SEQ ID NO: 12), purified water 3. Mu.l; on an ultra-clean workbench, picking single bacterial colonies and uniformly stirring in the mixed solution of the reaction system; (94 ℃ C. 30s,55 ℃ C. 30s,72 ℃ C. 1 min). Times.32 cycles, preserving at 4 ℃ C; mu.l of colony PCR product was taken and subjected to gel electrophoresis (gel, buffer and electrophoresis parameters were the same as those of step 2.1 in example 1), and a target DNA fragment containing the target site was detected.

4. Selecting the healthy and strong callus, placing in a triangular flask, and adding 150mL of agrobacterium tumefaciens (EHA 105) bacterial liquid (OD) which is identified as containing the positive OsKOB1 knockout vector in the step 3 ₆₀₀ =0.1), after shaking and dip-dyeing for 5min at 28 ℃, taking out the callus, and drying in the shade for 1h on sterile filter paper on an ultra-clean workbench; then placed on a monolayer filter paper on a co-culture medium (N6+10 g/L glucose, 0.5g/L proline, 0.3g/L casein, 2.0 mg/L2, 4-D, acetosyringone 20mg/L,7.2g/L agar, pH 5.8). The dishes were sealed and co-cultured for 3d in the dark at 25 ℃.

5. Screening of resistant calli. Washing the co-cultured calli with sterile water containing 800mg/L of carbenicillin for 2-3 times, adding 50mL of liquid screening culture medium (N6 +30g/L of sucrose, 0.5g/L of proline, 0.3g/L of casein, 2.0mg/L of 2,4-D, 500mg/L of carbenicillin, 50mg/L of hygromycin, pH 5.8) and gently shaking on a shaker at 100rpm for 10min; transferring the callus blocks to a sterile condition, drying in the shade for 30min, and inoculating to a screening culture medium (the liquid screening culture medium is+3.4g/L agar), and culturing in dark at 28 ℃ for about 20 d; the resistant calli were transferred to fresh screening medium and dark culture continued for 5d.

6. Callus differentiation and plant regeneration. The resistant callus blocks obtained by the screening are inoculated on a differentiation medium (MS+30 g/L sucrose, 30g/L sorbitol, 2g/L casein, 0.02mg/L NAA, 0.02mg/L KT, 50mg/L hygromycin, 4g/L agar, pH 5.8) and are subjected to dark culture at 28 ℃ for 16 hours under illumination (5 000 lx)/8 hours until regenerated seedlings (10-16 d) are grown; the regenerated plantlets (T0 generation plants) with obvious growth advantages are transferred to rooting medium (MS+30 g/L sucrose, 0.05mg/L NAA,3.4g/L agar, pH 5.8) and cultured for about 5 days at 28 ℃ under 16h illumination (5 000lx)/8 h darkness. Hardening off seedlings in a greenhouse for 7d after rooting, and transferring the seedlings into outdoor soil for cultivation.

7. Positive detection of oskob1 mutant plants. The CTAB method extracts DNA of regenerated plant (T0 generation) leaves, and the DNA is entrusted to the sequencing of related biotechnology (such as Beijing qingke) company to obtain mutants with various knockout site types.

8. Knock-out site identification. In this example, the knockout sites of the two mutant strains were identified as follows: the 1st strain is OsKOB1cDNA, which has 1 base "T" inserted 79bp after the 2 nd exon, and is named kob1-1, and the cDNA sequence is shown as sequence 15, and is specifically as follows:

red T in sequence is the inserted base "T", redTGAThe translation of the mutant kob1-1cDNA is terminated in advance. As shown in FIG. 2A

The 2 nd line was a 74bp deletion of the 2 nd exon of 7 bases "GTTCTCA" (FIG. 2B), designated kob1-2, and the cDNA sequence was shown as sequence 16, specifically as follows:

red in sequence, 7 bases deleted, redTAGThe translation of the mutant kob1-2 cDNA is terminated in advance. As shown in FIG. 2A

9. Bioinformatics analysis shows that kob1-1 generates frame shift due to insertion of one base "T", so that amino acid from 216 th to 226 th is mutated, 227 th is mutated into a stop codon "UGA", and translation is terminated in advance; kob1-2 was deleted by 7 bases "GTTCTCA", resulting in frame shift, resulting in mutation of 16 amino acids from 214 th to 229 th, mutation of 230 th to stop codon "UAG", and premature termination of translation. These two types of mutations resulted in KOB1-1 and KOB1-2 translating into incomplete KOB1 protein, possibly without normal function (fig. 2B).

10. TTC method compares the difference in vigor of kob1-1 and kob1-2 seeds of oskob1 mutant strain with wild type seeds.

Seeds of the wild type Japanese and oskob1 mutant lines kob1-1 and kob1-2 were stained by triphenyltetrazolium chloride (TTC) method to examine seed vigor. The operation steps are as follows: soaking the glume-stripped seeds in clear water for 1h; the seeds were removed, and after the surface moisture of the seeds was sucked up with filter paper, the seeds were placed in a 0.5% TTC dye solution (Beijing cool Lao Bo Co.) and stained at 37℃for 5 hours in the absence of light. The staining results showed that 50% of WT seeds were stained red and that kob1-1 and kob1-2 mutant seeds were stained red at 20% and 10%, respectively (FIG. 3), indicating that the oskob1 mutant lines kob1-1 and kob1-2 seeds were less viable than the wild type seeds.

11. The difference in vigor of the oskob1 mutant strain seed was compared to the wild type seed by a seed germination test.

And sun-drying the newly harvested seeds, and performing germination experiments. As shown in FIG. 4, the germination rates of both the kob1-1 and kob1-2 mutant lines were not high compared to the wild type seeds, wherein the germination rates of kob1-1 and kob1-2 were 20% and 33%, respectively, and the germination rate of the wild type was 53%, further indicating that the mutant seed vigor was inferior to that of the wild type.

12. Seed dormancy removal treatment, artificial aging treatment and germination tests compared the difference in anti-aging capacity between oskob1 mutant strain seed and wild type seed.

Seeds of oskob1 mutant lines kob1-1 and kob1-2 and wild type seeds were first subjected to a de-dormancy treatment (alternating treatments at 25℃2d and 4℃2d for 8 times) and then subjected to a germination test after 8d of artificial aging (see methods: song Songquan, cheng Gong, long Chunlin, jiang Xiaocheng. Guidelines for seed biology research [ M ]. Beijing: science Press, 2005). As shown in FIG. 5, after dormancy removal, the germination rate of wild type seeds before aging can reach 92%, and the germination rates of kob1-1 and kob1-2 seeds are 62% and 68%, respectively; the germination rate of the aged wild-type seeds was 75%, while the germination rates of kob1-1 and kob1-2 seeds were 45.7% and 46.7%, respectively. The results showed that both the seed germination rate and the vigor index of kob1-1 and kob1-2 before and after aging were significantly lower than that of the wild type.

The results of the steps 10, 11 and 12 show that the OsKOB1 gene is involved in the regulation of the activity of dormant seeds and the regulation of the activity of non-dormant seeds, and the activity of the seeds is obviously reduced after the knockout mutation of the OsKOB1 gene; the results of the artificial aging test show that the knockout mutation of the OsKOB1 leads to the reduction of the anti-aging capability of the seeds, and further shows that the KOB1 gene participates in the regulation of the activity of the seeds.

Sequence listing

<110> Hunan university of teachers and students

<120> Rice KOB1 Gene regulating seed Activity and method for regulating the same

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 987

<212> DNA

<213> Rice KOB1 Gene (Rice)

<400> 1

atgcagtaca agaacctggg gaggtcgggg ctgcgggtga gccagctgtc gtacggggcg 60

tgggtgacgt tcggcaacca gctggacgtg aaggaggcga aggcgctgct ccaggcgtgc 120

cgcgacgccg gcgtgaactt cttcgacaac gccgaggtgt acgcgaacgg gcgcgccgag 180

gagatcatgg ggcaggcgat gcgggacctc gggtggcgcc gctccgacgt cgtcgtctcc 240

accaagctct tctggggagg gcagggcccc aacgacaagg gcctctcccg gaagcacatc 300

gtcgagggcc tccgcggctc gctcaagcgc ctcgacatgg actacgtcga cgtcgtctac 360

tgccaccgcc ccgacgccac cacccccgtc gaggagaccg tgcgcgccat gaactgggtc 420

atcgaccacg gcatggcctt ctactggggc acctccgagt ggtccgccca gcagatcacc 480

gaggcgtgga gcgtcgccaa ccgcctcgac ctcgtcggac ccatcgtcga acagcctgag 540

tacaacctct tctcgcgcca caaggtggaa tctgagttct tacctcttta cagcacgtat 600

ggcctgggtt tgactacatg gagccctcta gcttcgggag ttctcactgg aaagtatgcc 660

aaaggaaata tacctgctga tagtaggttt gccctagaaa attacaagaa cctggccaac 720

agatctctgg ttgacgacac actgagaaag gtgaatgggc taaaaccaat tgcttctgag 780

cttggtgttt cgttagccca acttgctatc gcgtggtgcg catcgaaccc aaacgtctca 840

tctgtgatca ctggagccac aaaagaaaac cagattgttg aaaacatgaa ggccctcgat 900

gtcattccgc tgctaacccc agaagtcgtc gacaagatcg aagcggtggt ccaaagcaag 960

ccgaagcgca ccgagtcata cagatga 987

<210> 2

<211> 43

<212> DNA

<213> Artificial sequence (pCUbi 1390-OsKOB1-FpCUbi1390-OsKOB 1-F)

<400> 2

ttctgcacta ggtacctgca gatgcagtac aagaacctgg gga 43

<210> 3

<211> 42

<212> DNA

<213> Artificial sequence (pCubi 1390-OsKOB1-Rpcubi1390-OsKOB 1-R)

<400> 3

cggggatccg tcgacctgca gtctgtatga ctcggtgcgc tt 42

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (atacin-FAtactin-F)

<400> 4

gccatccaag ctgttctctc 20

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (atacin-RAtactin-R)

<400> 5

gctcgtagtc aacagcaaca a 21

<210> 6

<211> 24

<212> DNA

<213> Artificial sequence (OsKOB 1-FOsKOB 1-F)

<400> 6

tcgtcgaaca gcctgagtac aacc 24

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence (OsKOB 1-ROSKOB 1-R)

<400> 7

gtgagaactc ccgaagctag aggg 24

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (target)

<400> 8

ctagcttcgg gagttctcac 20

<210> 9

<211> 37

<212> DNA

<213> Artificial sequence (gRT 1gRT 1)

<400> 9

ctagcttcgg gagttctcac gttttagagc tagaaat 37

<210> 10

<211> 37

<212> DNA

<213> Artificial sequence (OsU aT1OsU aT 1)

<400> 10

gtgagaactc ccgaagctag cggcagccaa gccagca 37

<210> 11

<211> 27

<212> DNA

<213> Artificial sequence (PBL primer)

<400> 11

gcgcgcggtc tcgctcgact agtatgg 27

<210> 12

<211> 27

<212> DNA

<213> Artificial sequence (PBR primer)

<400> 12

gcgcgcggtc tctaccgacg cgtatcc 27

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (Cas 9-F primer)

<400> 13

attcaactga gtgtgtagga 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence (Cas 9-R primer)

<400> 14

gttacagcgt agtattgtcg 20

<210> 15

<211> 988

<212> DNA

<213> Rice Gene (kob 1-1kob 1-1)

<400> 15

atgcagtaca agaacctggg gaggtcgggg ctgcgggtga gccagctgtc gtacggggcg 60

tgggtgacgt tcggcaacca gctggacgtg aaggaggcga aggcgctgct ccaggcgtgc 120

cgcgacgccg gcgtgaactt cttcgacaac gccgaggtgt acgcgaacgg gcgcgccgag 180

gagatcatgg ggcaggcgat gcgggacctc gggtggcgcc gctccgacgt cgtcgtctcc 240

accaagctct tctggggagg gcagggcccc aacgacaagg gcctctcccg gaagcacatc 300

gtcgagggcc tccgcggctc gctcaagcgc ctcgacatgg actacgtcga cgtcgtctac 360

tgccaccgcc ccgacgccac cacccccgtc gaggagaccg tgcgcgccat gaactgggtc 420

atcgaccacg gcatggcctt ctactggggc acctccgagt ggtccgccca gcagatcacc 480

gaggcgtgga gcgtcgccaa ccgcctcgac ctcgtcggac ccatcgtcga acagcctgag 540

tacaacctct tctcgcgcca caaggtggaa tctgagttct tacctcttta cagcacgtat 600

ggcctgggtt tgactacatg gagccctcta gcttcgggag ttcttcactg gaaagtatgc 660

caaaggaaat atacctgctg atagtaggtt tgccctagaa aattacaaga acctggccaa 720

cagatctctg gttgacgaca cactgagaaa ggtgaatggg ctaaaaccaa ttgcttctga 780

gcttggtgtt tcgttagccc aacttgctat cgcgtggtgc gcatcgaacc caaacgtctc 840

atctgtgatc actggagcca caaaagaaaa ccagattgtt gaaaacatga aggccctcga 900

tgtcattccg ctgctaaccc cagaagtcgt cgacaagatc gaagcggtgg tccaaagcaa 960

gccgaagcgc accgagtcat acagatga 988

<210> 16

<211> 980

<212> DNA

<213> Rice Gene (kob 1-2kob 1-2)

<400> 16

atgcagtaca agaacctggg gaggtcgggg ctgcgggtga gccagctgtc gtacggggcg 60

tgggtgacgt tcggcaacca gctggacgtg aaggaggcga aggcgctgct ccaggcgtgc 120

cgcgacgccg gcgtgaactt cttcgacaac gccgaggtgt acgcgaacgg gcgcgccgag 180

gagatcatgg ggcaggcgat gcgggacctc gggtggcgcc gctccgacgt cgtcgtctcc 240

accaagctct tctggggagg gcagggcccc aacgacaagg gcctctcccg gaagcacatc 300

gtcgagggcc tccgcggctc gctcaagcgc ctcgacatgg actacgtcga cgtcgtctac 360

tgccaccgcc ccgacgccac cacccccgtc gaggagaccg tgcgcgccat gaactgggtc 420

atcgaccacg gcatggcctt ctactggggc acctccgagt ggtccgccca gcagatcacc 480

gaggcgtgga gcgtcgccaa ccgcctcgac ctcgtcggac ccatcgtcga acagcctgag 540

tacaacctct tctcgcgcca caaggtggaa tctgagttct tacctcttta cagcacgtat 600

ggcctgggtt tgactacatg gagccctcta gcttcgggac tggaaagtat gccaaaggaa 660

atatacctgc tgatagtagg tttgccctag aaaattacaa gaacctggcc aacagatctc 720

tggttgacga cacactgaga aaggtgaatg ggctaaaacc aattgcttct gagcttggtg 780

tttcgttagc ccaacttgct atcgcgtggt gcgcatcgaa cccaaacgtc tcatctgtga 840

tcactggagc cacaaaagaa aaccagattg ttgaaaacat gaaggccctc gatgtcattc 900

cgctgctaac cccagaagtc gtcgacaaga tcgaagcggt ggtccaaagc aagccgaagc 960

gcaccgagtc atacagatga 980

Claims (1)

1. Manipulation of rice by genetic engineeringKOB1A method for regulating seed viability by gene expression comprising the steps of:

by mixing riceKOB1Gene [ (B/C)OsKOB1) Transduction into recipient rice, toOsKOB1Over-expression in seeds, thereby improving seed vigor;

alternatively, rice is subjected to CRISPR/Cas9 gene editing methodKOB1The activity of the mutant seeds is reduced by knocking out the genes;

the rice is provided withKOB1The nucleotide sequence of the gene is shown in a sequence 1;

the seed vigor refers to the anti-aging capability.