CN114540367B

CN114540367B - Application of soybean GmPRR3b gene in regulation and control of soybean drought resistance

Info

Publication number: CN114540367B
Application number: CN202210151819.2A
Authority: CN
Inventors: 李聪; 王振宇; 顾进宝; 李阳; 陈衍行
Original assignee: Nanfan Seed Industry Research Institute Guangdong Academy Of Sciences
Current assignee: Nanfan Seed Industry Research Institute Guangdong Academy Of Sciences
Priority date: 2022-02-18
Filing date: 2022-02-18
Publication date: 2022-10-18
Anticipated expiration: 2042-02-18
Also published as: CN114540367A

Abstract

The invention discloses an application of a soybean GmPRR3b gene in regulating and controlling soybean drought resistance, wherein the nucleotide sequence of the soybean GmPRR3b gene is shown as SEQ ID No. 1; or the soybean GmPRR3b gene codes an amino acid sequence shown as SEQ ID NO. 2. The inventor discovers that the soybean GmPRR3b gene can negatively regulate the drought tolerance of the soybean, compared with the survival rate of 20% of wild plants, the survival rate of knockout mutant plants of the soybean GmPRR3b gene reaches more than 45%, the drought tolerance is obviously enhanced, the discovery of new functions of the soybean GmPRR3b gene provides new gene targets and resources for the genetic breeding of drought-resistant soybean.

Description

Application of soybean GmPRR3b gene in regulation and control of soybean drought resistance

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a soybean GmPRR3b gene in regulation and control of soybean drought resistance and application in regulation and control of drought-resistant soybean genetic breeding.

Background

In recent years, with global warming and increased human activities, the frequency and number of extreme weather occurrences such as drought, flooding, high temperature, and frost have increased, and the threat to agricultural production has become severe. Drought, high temperature, is currently considered to be two major abiotic stress factors that cause crop losses and outcrops. The drought stress of the plants due to water shortage can be caused by over-dry outside air or low soil water content, and the drought stress has a serious inhibiting effect on the growth and development of the plants.

Recent data show that temperature rise and water shortage due to climate change have become global problems to be solved urgently, and nearly 50% of the land areas worldwide are affected by drought every year, most of which are agricultural areas, mainly distributed in africa, asia, western north america, western south america and parts of australia (Mahalingam, 2017). Crop loss due to drought has reached $ 300 billion dollars over the last 10 years, and the growing population, increased demand for agricultural water and decreased available fresh water have further exacerbated the impact of drought on agricultural production (Gupta et al, 2020).

Soybeans are native to China and are an important source of edible protein and oil in the world. China was the world's first country of soybean production and the world's net export by the last 50 s. In recent years, with the improvement of living standard of people in China, the demand of soybeans rapidly rises, and the contradiction between supply and demand becomes more and more prominent. The reasons for the laggard production and the serious shortage of the supply of soybeans in China are various, wherein drought stress is an important environmental factor. Therefore, the identification of the drought control gene is an important step for cultivating a new drought-tolerant soybean variety.

Under drought conditions, overexpression of the GmWRKY54 gene promotes closure of stomata in soybean leaves and thus increases drought tolerance in soybeans (Wei et al, 2019, zhou et al, 2008). Recent research finds that the MADS-box transcription factor Dt2 can influence the stomata movement and the water utilization efficiency of leaves by directly regulating and controlling the expression of a drought stress response gene GmDREB1D (Zhang et al, 2019). The simultaneous loss of the gene function of the GmLHYs component of the biological clock core oscillator can enhance the response of stomata to drought, reduce the water loss rate of soybean leaves and further enhance the drought tolerance of plants, which indicates that the GmLHYs protein plays a negative regulation role in the drought stress tolerance of soybeans (Wang et al, 2021).

To date, only a few Quantitative Trait Loci (QTLs) have been identified in soybean that are associated with soybean drought stress, and few genes involved in soybean drought stress regulation have been cloned, and their regulatory networks remain unclear. Therefore, the research on the regulatory gene of the soybean to drought stress is very significant.

Disclosure of Invention

Based on the situation, one of the purposes of the invention is to provide an application of a soybean GmPRR3b gene in regulating and controlling soybean drought resistance.

The specific technical scheme for realizing the aim of the invention comprises the following steps:

an application of a soybean GmPRR3b gene in regulating soybean drought resistance is disclosed, wherein a nucleotide sequence of the soybean GmPRR3b gene is shown as SEQ ID NO. 1; or encode the amino acid sequence shown as SEQ ID NO. 2.

The invention also provides application of the soybean GmPRR3b gene in drought-resistant soybean genetic breeding, wherein the nucleotide sequence of the soybean GmPRR3b gene is shown as SEQ ID No. 1; or encode the amino acid sequence shown as SEQ ID NO. 2.

The invention also provides application of the protein coded by the soybean GmPRR3b gene in regulating and controlling the drought resistance of soybeans, wherein the amino acid sequence of the protein coded by the soybean GmPRR3b gene is shown as SEQ ID NO. 2.

The invention also provides application of the protein coded by the soybean GmPRR3b gene in drought-resistant soybean genetic breeding, wherein the amino acid sequence of the protein coded by the soybean GmPRR3b gene is shown as SEQ ID NO. 2.

The invention also provides a soybean GmPRR3b gene knockout vector, which is constructed by using a CRISPR-Cas9 editing technology, and the nucleotide sequence of the soybean GmPRR3b gene is shown as SEQ ID NO. 1; or encode the amino acid sequence shown as SEQ ID NO. 2.

The invention also provides application of the soybean GmPRR3b gene knockout vector in improving drought resistance of soybeans or in genetic breeding of drought-resistant soybeans.

The invention also provides a preparation for improving the drought resistance of soybeans, and the active component of the preparation comprises the soybean GmPRR3b gene knockout vector.

The invention also provides a method for regulating and controlling the drought resistance of soybean, which comprises the following steps: regulating and controlling the activity of a soybean GmPRR3b gene, wherein the nucleotide sequence of the soybean GmPRR3b gene is shown as SEQ ID NO. 1; or encode the amino acid sequence shown as SEQ ID NO. 2.

The invention also provides a method for improving the drought resistance of soybean, which comprises the following steps: constructing a soybean GmPRR3b gene knockout vector by using a CRISPR-Cas9 editing technology to enable the function of a soybean GmPRR3b gene to be lost; the nucleotide sequence of the soybean GmPRR3b gene is shown as SEQ ID NO. 1; or encode the amino acid sequence shown as SEQ ID NO. 2.

Compared with the prior art, the invention has the following beneficial effects:

in the invention, the inventor finds that the soybean GmPRR3b gene can negatively regulate and control the drought tolerance of the soybean, compared with the survival rate of 20% of wild plants, the survival rate of knockout mutant plants of the soybean GmPRR3b gene reaches more than 45%, the drought tolerance is obviously enhanced, the discovery of new functions of the soybean GmPRR3b gene provides new gene targets and resources for the genetic breeding of drought-resistant soybean.

Drawings

Fig. 1 is a structure diagram of the CRISPR vector before digestion with the restriction enzyme XbaI in example 1 of the present invention.

Fig. 2 is a structural diagram of a soybean GmPRR3b gene knockout CRISPR vector constructed in example 1 of the present invention.

Fig. 3 is a target sequencing result of a CRISPR gene knockout mutant strain in example 2 of the present invention, wherein TL is wild-type soybean, and Gmprr3b-1 and Gmprr3b-3 are Gmprr3b gene knockout mutants.

FIG. 4 shows the drought avoidance phenotype results of soybean GmPRR3b knock-out mutant lines of example 3 of the present invention, wherein TL is wild-type soybean, and Gmprr3b-1 and Gmprr3b-3 are GmPRR3b knock-out mutants.

FIG. 5 is a statistic of survival rate after rehydration in drought avoidance assay of soybean GmPRR3b gene knockout mutant of example 3 of the present invention; wherein TL is wild soybean, and Gmprr3b-1 and Gmprr3b-3 are GmPRR3b gene knockout mutants.

FIG. 6 shows the survival statistics after drought-tolerant phenotype identification and rehydration for soybean GmPRR3b gene knockout mutant in drought tolerance identification of example 4 of the present invention; wherein TL is wild soybean, and Gmprr3b-1 and Gmprr3b-3 are GmPRR3b gene knockout mutants.

Detailed Description

In order that the invention may be more fully understood, reference will now be made to the following description. The present invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

In one aspect of the invention, the application of the soybean GmPRR3b gene and the protein coded by the gene in the regulation of soybean drought resistance is provided. The nucleotide sequence of the soybean GmPRR3b gene is shown as SEQ ID NO. 1; the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2. The regulation is negative regulation, and the drought resistance of the soybean is improved by leading the soybean GmPRR3b gene or the protein coded by the gene to lose the biological function.

SEQ ID NO.1

ATGAACAATAATGTTGGGAAAGGGAAAAAAGGTTTGGCAGAACAAAATCATATGTTTTTTGACAAAAAGAGTCTCGAAAATGGAGTAGTTAATGGAGGGGTAGCCTCTGGATCATCAACTGAAGATGACACAAGATTTAATAAGGTGGTTGAAGATGGAAACAATGGATTGAGGGGTCTGATTCAAATCCATGGGAGCTTGCAGATTTCACAACAACCACCTCAAGAGCCAGCCGTATGCTGGGAGAGATTTCTCCCATTAAGATCGATAAAAGTTTTGCTGGTGGAAGATGATGATTCGACACGCCATGTTGTGCGTGCTCTGTTACAGAATTGTAGTTACAAAGTCACTGCCGTTTCCAATGGCCTTCAAGCGTGGAAAGTCCTGGAAGATCCAGAAAATGGCATTGATCTTGTCCTAACAGAGGTAGCTATGCCTATTTTGTCTGGAATAGGTCTTTTGTGCAAGATCATGAGCCACAAAACTCTGAAGAATATTCCTGTGATTATGATGTCATCTCATGATTCTATGGGTATAGTCTTTAAGTGTTTGTCAAAAGGTGCAGTTGATTTTTTAGTGAAACCTATTCGGAGGAATGAACTTAAAAACCTCTGGCAGCACGTTTGGAGAAGATGCCACAGTTCTAGTGGTAGTGGGAGTGAAAGTGCGACCCTCACCAGAAAATTTGCAAAGTCAAGAAGTAATGATGCATATGAAAACAATAGTGACAGCAGTGATGAGAATGACTATGGAAGCAGAGGCTTGAGCATTCGTGATGGAAGTGACAATGGAAGTGGCACTCAGAGTTCATGGACTAAATGTCTAGCTCAAGTTGGCAGTCCTCATCCAGTTTCACCTCATAAACAGTTGGTTGATGCCCCTGATAGCACATGTGCCCAAGTGATGCAAACAAAGACTGAAAAAGTTAGTAGTAGATGGGTGCATGCGACGGAAAAAGAGTGCCATGAACTTATTGATCTTGATGATGTTGCAAGGGTTAAGGACTTGGCTATGGGAATATCTTTGAATATGCAACTAGAGCATCCACTCGAGGAACTGTCTAGCAATCCAATTGTGGGTAAAGGGGCAAATAAGATGTCTGATGTAGATGATATGCAGATCATTAAGAGAAAGAGCAATGTCTGTGAAAAAGGACAATTGGAATACAATGGTGATAAAACCGGGACACAGGAAAATCAGGCTATGAATGTTATTGATGTTACTGATAGCAACAGTCCACAGGCTGAAAGCAGAGACTTGAACACTCCAAATGGGTTTTCTGGTTTTTCACAATCAAAAGCAAACTGTTGCCCCAAAGAGCATCCATCCCTTGAACTAACTCTGAAAAGGCTGGGAGAAGTAGGAGATGCTAAAAATGTCACTGGTGAAGAATGCAATGTCTTGAGACATTCAGATCAGTCAGCATTCTCAAAATATAATACTGTTTCTGCTAACCAGGCTCAAACTGGAAATGTAGGAAGCTGTTCCCCACTAGACAATAGCTCAGCTGCACCAAATACAGAGACAATGCACAACTTTCCATCTCATTCAAATGGCACTCCTTCAAATCAAAAATCTAATGGGAGCAACAACATCAATGACAGGGCCTCCACTAATACATATCTTGGCACCAAACCTGATACTTTTGACAAGAAGCCGGAGTCTGGAAGAGGGATTGGCTCGTATAATTCTTGTGAACTCCTAACTGTGCAGAACAATAGCATTTCTTCATCTCAGAAGAAAACTTCTGCCTGGGAAGAATATACAGAAATCATTAAAGAATCAGTAGGAGGCTCTGAACAAGGATTCCAAGTCGAGCACACTTACTATCAGCTTCACCATTATAATCACATTGCCCATAAAGCTGCAGTAGATCCCTAA

SEQ ID NO.2

MNNNVGKGKKGLAEQNHMFFDKKSLENGVVNGGVASGSSTEDDTRFNKVVEDGNNGLRGLIQIHGSLQISQQPPQEPAVCWERFLPLRSIKVLLVEDDDSTRHVVRALLQNCSYKVTAVSNGLQAWKVLEDPENGIDLVLTEVAMPILSGIGLLCKIMSHKTLKNIPVIMMSSHDSMGIVFKCLSKGAVDFLVKPIRRNELKNLWQHVWRRCHSSSGSGSESATLTRKFAKSRSNDAYENNSDSSDENDYGSRGLSIRDGSDNGSGTQSSWTKCLAQVGSPHPVSPHKQLVDAPDSTCAQVMQTKTEKVSSRWVHATEKECHELIDLDDVARVKDLAMGISLNMQLEHPLEELSSNPIVGKGANKMSDVDDMQIIKRKSNVCEKGQLEYNGDKTGTQENQAMNVIDVTDSNSPQAESRDLNTPNGFSGFSQSKANCCPKEHPSLELTLKRLGEVGDAKNVTGEECNVLRHSDQSAFSKYNTVSANQAQTGNVGSCSPLDNSSAAPNTETMHNFPSHSNGTPSNQKSNGSNNINDRASTNTYLGTKPDTFDKKPESGRGIGSYNSCELLTVQNNSISSSQKKTSAWEEYTEIIKESVGGSEQGFQVEHTYYQLHHYNHIAHKAAVDP

It is understood that modifications of the nucleotide sequence of the encoding gene of the present invention without changing the amino acid sequence, in view of the degeneracy of the codon and the preference of the codon for different species, are also within the scope of the present invention.

In another aspect of the invention, the application of the soybean GmPRR3b gene knockout vector in improving soybean drought resistance is provided.

In another aspect of the present invention, there is also provided a method for improving drought resistance of soybean, the method comprising the steps of: a soybean GmPRR3b gene knockout vector is constructed by using a CRISPR-Cas9 editing technology, so that the biological function of a soybean GmPRR3b gene is lost.

The present invention will be described in further detail with reference to the following specific examples and the accompanying drawings.

Example 1 construction of a vector for knocking out the Soybean GmPRR3b Gene

In this embodiment, a GmU promoter and a SgRNA comprising a 19bp target site sequence are respectively constructed on a CRISPR vector by using an Infusion system (clonech) through restriction enzyme sites XbaI, so as to construct a soybean GmPRR3b gene knockout vector, specifically comprising the following steps:

1. planting the seed of William seed 82 in nutrient soil, growing for 15 days under long-day condition, and extracting DNA from the first three compound leaves of soybean. The method for extracting the DNA comprises the following steps:

(1) Putting a proper amount of young soybean leaves into a 1.5mL RNase-free centrifuge tube with a sampling steel ball, quickly placing the young soybean leaves into liquid nitrogen, grinding the sample by a sampling machine or grinding the sample by a mortar in a frozen state, adding 500 mu L of CTAB solution preheated at 65 ℃, uniformly mixing by vortex, and placing the mixture in a drying oven at 65 ℃ for 30min.

(2) And taking out the sample from the drying oven and cooling, adding 500 μ L of a 25 [ 24 ] 1Tris-saturated phenol/chloroform/isoamyl alcohol solution (the solution must be added after cooling to room temperature), uniformly mixing by turning upside down or vortexing, centrifuging at constant speed for 15min at room temperature of 12,000rpm, and sucking the supernatant into a new centrifuge tube.

(3) And adding 500 mu L of 24 chloroform/isoamyl alcohol solution into a new 1.5mL centrifuge tube, uniformly mixing by turning upside down or vortexing, uniformly centrifuging at room temperature of 12,000rpm for 10min, and slowly sucking 500 mu L of supernatant into the new centrifuge tube.

(4) Adding 500 μ L of isopropanol with the same volume at room temperature, mixing by up-and-down inversion or vortex mixing, standing at-20 deg.C for a period of time or overnight at-80 deg.C, and centrifuging at room temperature of 12,000rpm for 10min at constant speed.

(5) Then, the supernatant was discarded, 1mL of 75% ethanol was added thereto, the mixture was mixed by inversion and centrifuged at 12,000rpm for 10min at room temperature, the supernatant was discarded again, the mixture was left at room temperature for 5min, excess ethanol was removed by a pipette tip, the mixture was left at room temperature for 20min, and 40. Mu.L of ultrapure water was added thereto to dissolve the mixture for subsequent use.

2. The GmU promoter fragment is obtained by amplification by using soybean leaf DNA as a template and GmU-Xbal-F (SEQ ID NO. 3) and GmU-R (SEQ ID NO. 4) as primers. The PCR amplification reaction system and the reaction procedure are shown in tables 1 and 2.

GmU6-Xbal-F(SEQ ID NO.3)：

GGAAGCTTAGGCCTTCTAGAAAAATAAATGGTAAAATGTC

GmU6-R(SEQ ID NO.4)：CAATCCATGTGGTGGCACAT

The PCR reaction system is shown in Table 1.

TABLE 1

The PCR reaction procedure is shown in Table 2.

TABLE 2

95℃	2min
		95℃	15s
57-62℃	15s
		72℃	1min/kb
2-4 steps of circulation	35-36
		72℃	5min
4℃	Long term storage

3. An SgRNA fragment containing a 19bp GmPRR3b gene target site sequence is obtained by amplification by using an sgRNA with a sequence shown as SEQ ID NO.7 as a template and GmPRR3b-F (SEQ ID NO.5, wherein underlining is a target site sequence of a GmPRR3b gene) and an sgRNA-XbaI-R (SEQ ID NO. 6) as primers, and a PCR amplification reaction system and a reaction program are shown as a table 1 (except that the template is different, the other parts are the same) and a table 2.

GmPRR3b-F(SEQ ID NO.5)：

AATGTGCCACCACATGGATTGTTAATGGAGGGGTAGCCTCGTTTTAGAGCTAGAAATAGCAA

sgRNA-Xba1-R(SEQ ID NO.6)：

GGCAACGCGTTCTAGAAAAAAAAGCACCGACTCGGTGCCAC

sgRNA sequence (SEQ ID NO. 7):

GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT

4. and (3) taking the GmU promoter fragment obtained in the step (2) and the SgRNA fragment containing the 19bp target site sequence obtained in the step (3) as templates, and taking GmPRR3b-F (SEQ ID NO. 5) and sgRNA-Xba1-R (SEQ ID NO. 6) as primers, amplifying to obtain a GmU-SgRNA fragment containing the 19bp GmPRR3b gene target site sequence, wherein PCR amplification reaction systems and reaction programs are shown in the table 1 (except for different templates, the other parts are the same) and the table 2.

5. The CRISPR vector (structure is shown in FIG. 1, and enzyme cutting reaction system is shown in Table 3) is digested by restriction enzyme XbaI.

TABLE 3

6. And (3) performing gel electrophoresis on the PCR product obtained in the step (4) and the vector subjected to enzyme digestion in the step (5), determining the size of a target band, and cutting off the target band (various corresponding products are recovered by using an Axygen gel recovery kit, and detailed experimental steps are operated according to the instructions of Axygen company). And (3) placing the target band In a 1.5mL centrifuge tube, connecting for 30min at 50 ℃ (the In-fusion system of the connection reaction is shown In Table 4) to obtain the CRISPR vector (CRISPR-GmPRR 3b, the structure is shown In figure 2) for knocking out the soybean GmPRR3b gene, and storing at 4 ℃.

TABLE 4

Gene PCR recovery product	1μL
		Vector after restriction enzyme digestion	1μL
In-fusion enzyme	0.5μL
		Total	2.5μL

The preparation order is added from top to bottom, so that the error is reduced.

Example 2 obtaining of Soybean GmPRR3b Gene knockout plants

In this embodiment, an agrobacterium EHA 105-mediated genetic transformation method is adopted to transfer the soybean GmPRR3b gene knockout vector constructed in example 1 into soybean cotyledonary nodes to obtain a soybean GmPRR3b gene knockout plant, and the method includes the following steps:

1. preparation of Agrobacterium competence

Selecting single colonies of the agrobacterium tumefaciens EHA105, and respectively placing the single colonies into 5mL of LB liquid culture medium containing corresponding antibiotics, wherein the EHA105 resistance is as follows: rifampicin (Rif) at 100. Mu.g/mL. Culturing at 28 deg.C overnight; inoculating 500 μ L of overnight culture liquid into 50mL LB liquid culture medium containing corresponding antibiotics, and culturing at 28 deg.C to OD ₆₀₀ About 0.5; standing on ice for 30min; centrifugation at 5,000rpm for 10min at 4 ℃ with 15mL of precooled 10mM CaCl ₂ Resuspending the Agrobacterium cells, centrifuging at 5,000rpm for 10min at 4 ℃; with 2mL of precooled 10mM CaCl ₂ Resuspending the pellet, packaging with 100 μ L/tube on ice, quick freezing with liquid nitrogen, and storing at-80 deg.C.

2. Electric shock transformation of agrobacterium

Adding 3 mu L of plasmid (namely the soybean GmPRR3b gene knockout vector constructed in the embodiment 1) into 50 mu L of agrobacterium-mediated state, sucking and stirring the mixture uniformly by a sterilizing gun head, standing the mixture for 30min on ice, and preparing an electric cup superclean workbench to dry and precool the mixture. Competence was transferred to the cuvette on ice in preparation for shock conversion. Transforming with BIO-RAD (Gene Pulser Xcell electrophoresis System) Bacterial electric shock, adding 700. Mu.L of non-anti LB liquid culture medium to resuscitate Bacterial liquid on a super clean bench after electric shock, resuscitating the Bacterial liquid at 28 ℃ and 200rpm, centrifuging, collecting the Bacterial liquid and plating. Culturing for about 2-3 days, and screening Agrobacterium tumefaciens monoclonal by screening positive Escherichia coli monoclonal method when Agrobacterium tumefaciens grows up.

3. Agrobacterium infection of soybean cotyledonary node

The co-culture solid/liquid culture medium, the induction solid/liquid culture medium, the elongation solid culture medium and the rooting culture medium in the step are all conventional commercial culture media.

(1) And (3) carrying out single cloning on the positive agrobacterium screened in the step 2, and shaking the agrobacterium in a10 mL test tube overnight.

(2) 100mL queen Bleach (Bleach) +4mL concentrated HCl was sterilized in a sealed container for 16-18 hours, placed in a sterilized clean bench for 30 minutes, and purged of chlorine.

(3) Preparing co-culture solid/liquid culture medium, water, filter paper and Erlenmeyer flask, and sterilizing at 121 deg.C for 20min. The beans are soaked in the sterilized water for about 8 hours (generally, the beans are soaked in a dark incubator at 28 ℃ for about 8 hours at 6-10 o' clock in the evening, and the beans are not suitable to be soaked for too long). Simultaneously 50mL of Agrobacterium was shaken in Erlenmeyer flasks for infection.

(4) Taking soaked beans, dividing the soybeans into two parts by using an operating blade, dividing the soybeans into two bean halves, cutting off the parts of redundant hypocotyls at the positions of 3-4mm from the hypocotyls, slightly scratching the parts of the hypocotyls at the positions of 5-7 mm by using the blade and cutting the parts of the hypocotyls to be 0.5mm deep, and placing the bean halves in a conical bottle with water after cutting.

(5) To Agrobacterium OD ₆₀₀ Centrifuging at 4,000rpm for 10min when =0.5-0.7, collecting bacterial liquid, removing supernatant, adding appropriate amount of co-culture liquid culture medium, vortex mixing to make bacterial liquid OD ₆₀₀ ＝0.6。

(6) Cutting beans, removing water in a conical flask, adding a bacterial liquid prepared by using a co-culture liquid culture medium, shaking for 2-3 times, infecting for 30 minutes, and properly shaking for several times in the middle; meanwhile, the sterilized filter paper is flatly laid in the co-culture solid culture medium, and one dish of the culture medium corresponds to one filter paper. After infection, removing the bacterial liquid, placing the infected beans on an empty culture dish containing several layers of filter paper, sucking off the redundant bacterial liquid, then uniformly placing the beans in a co-culture solid culture medium paved with the filter paper, culturing in the dark at 28 ℃ for 3 days, and spreading 20-30 bean segments in the co-culture solid culture medium of one dish. The solid culture medium for co-culture in one dish is not suitable for spreading excessive beans to prevent bad growth and cross contamination of beans.

(7) Preparing induction solid/liquid culture medium, water, filter paper and conical flask, and autoclaving at 121 deg.C for 20min. Cutting bean embryo and excessive hypocotyl cultured for three days, keeping hypocotyl for 3-4mm, and placing in conical flask containing water. Washing with sterilized water for 4-5 times, washing with induction liquid culture medium for 4-5 times, placing on an empty culture dish containing filter paper, and blotting to remove water. Then, the hypocotyl of the soybean cotyledon was obliquely inserted into the induction solid medium in an upward direction, and the cultivation was carried out for 10 days under light.

(8) After 10 days, cutting off the embryo bud with larger base part of the original bean, lightly scratching 5-7 parts at the hypocotyl part, obliquely inserting the hypocotyl part of the bean into a new induction solid culture medium, and culturing for 10 days under illumination. This was repeated twice.

(9) Preparing an elongation solid culture medium, and sterilizing the culture medium for 20min at the high temperature of 121 ℃ under high pressure. After 3 times of induction culture, most bean cotyledons have callus with embryo, the bean cotyledons are cut off, the callus is kept, black tissue on the surface of the callus is removed, and the rest callus is placed in an elongation culture medium and is cultured for 10 days by illumination. This was repeated three times.

(10) And during the period of changing the elongation culture medium, when the elongation length of the embryo of the callus is more than 3cm, cutting the embryo from the callus, placing the embryo in a rooting culture medium, culturing for 10-14 days by illumination, transplanting seedlings into soil after the seedlings grow roots, and hardening the seedlings for about 7 days to obtain T0 generation transgenic seedlings.

4. Identification of soybean GmPRR3b gene knockout strain

Taking T0 generation transgenic seedling leaves, extracting DNA, and designing a corresponding primer-GmPRR 3b-F:

TAGGCTGGTCCGATGAAC (SEQ ID NO. 8); GGTGCTAAGGCATGATTTAC (SEQ ID NO. 9) for PCR amplification, the reaction volume is 50 muL (the reaction system is shown in Table 1, and the reaction program is shown in Table 2), after the PCR is finished, 5 muL of running glue is taken to detect whether a specific strip exists, the residual 25 muL of sample is sent to a Rui Boxing Co., ltd for first-generation sequencing and is compared with wild genomic DNA to determine whether the soybean GmPRR3b gene knockout strain is homozygous mutation. Finally, two homozygous mutant soybean GmPRR3b gene knockout strains (mutants) are obtained and named as Gmprr3b-1 gene knockout mutant and Gmprr3b-3 gene knockout mutant respectively, and the phenotype identification is carried out. The CRISPR knock-out strain target sequencing results are shown in figure 3, where TL represents the control genomic DNA sequence and "-" at the base represents the deleted sequence.

Example 3 identification of drought avoidance phenotype of Soybean GmPRR3b Gene knock-out lines (mutants)

The Tianlong No.1 (control TL) and soybean GmPRR3b gene knockout homozygous lines Gmprr3b-1 and GmPRr3b-3 are planted for 2 weeks under the long-day condition (16-hour light/8-hour dark), each material is planted in a small pot independently, the small pot is subjected to drought stress treatment for two weeks by water cut, then the water supply is recovered, and the characters of the Tianlong No.1 and gene knockout lines Gmprr3b-1 and Gmprr3b-3 are observed respectively before (control) water cut treatment, 6 days after water cut and 10 days after water supply recovery, and the results are shown in figure 4. After 10 days of returning water supply, the survival rate was counted and the results are shown in fig. 5.

The results in FIG. 5 show that Tianlong No.1 (control TL) has only 25% of plant survival rate, while the two gene knockout lines Gmprr3b-1 and Gmprr3b-3 have more than 75% of plant survival rate, and Gmprr3b-3 has even reached 95% of plant survival rate. The soybean GmPRR3b gene knockout strain (mutant) can obviously improve the drought avoidance of the soybean.

Example 4 identification of drought tolerant phenotype of Soybean GmPRR3b knock-out lines (mutants)

Tianlong No.1 (control TL) and soybean GmPRR3b gene knockout homozygous lines Gmprr3b-1 and Gmprr3b-3 are planted for 2 weeks under long-day conditions (16 hours of light/8 hours of dark), and each soybean GmPRR3b gene knockout homozygous line and Tianlong No.1 are planted in a small pot. The water supply is recovered after 10 days of water cut and drought stress bearing treatment, and the characters of the Tianlong No.1 mutant and the mutant are observed respectively after 0 day of water cut and 7 days of water supply recovery, and the survival rate of the Tianlong No.1 mutant is counted. The results are shown in FIG. 6.

The result shows that after the water supply is restored for 7 days, the survival rate of the plants of Tianlong No.1 (control TL) is less than 20 percent, the survival rate of the plants of two gene knockout strains Gmprr3b-1 and Gmprr3b-3 exceeds 45 percent, and the survival rate of the plants of Gmprr3b-1 even reaches 50 percent. Therefore, the soybean GmPRR3b gene knockout strain (mutant) can obviously improve the drought tolerance of the soybean.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> research institute of south seed reproduction of academy of sciences of Guangdong province

Application of <120> soybean GmPRR3b gene in regulation and control of soybean drought resistance

<130> 1

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1881

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaacaata atgttgggaa agggaaaaaa ggtttggcag aacaaaatca tatgtttttt 60

gacaaaaaga gtctcgaaaa tggagtagtt aatggagggg tagcctctgg atcatcaact 120

gaagatgaca caagatttaa taaggtggtt gaagatggaa acaatggatt gaggggtctg 180

attcaaatcc atgggagctt gcagatttca caacaaccac ctcaagagcc agccgtatgc 240

tgggagagat ttctcccatt aagatcgata aaagttttgc tggtggaaga tgatgattcg 300

acacgccatg ttgtgcgtgc tctgttacag aattgtagtt acaaagtcac tgccgtttcc 360

aatggccttc aagcgtggaa agtcctggaa gatccagaaa atggcattga tcttgtccta 420

acagaggtag ctatgcctat tttgtctgga ataggtcttt tgtgcaagat catgagccac 480

aaaactctga agaatattcc tgtgattatg atgtcatctc atgattctat gggtatagtc 540

tttaagtgtt tgtcaaaagg tgcagttgat tttttagtga aacctattcg gaggaatgaa 600

cttaaaaacc tctggcagca cgtttggaga agatgccaca gttctagtgg tagtgggagt 660

gaaagtgcga ccctcaccag aaaatttgca aagtcaagaa gtaatgatgc atatgaaaac 720

aatagtgaca gcagtgatga gaatgactat ggaagcagag gcttgagcat tcgtgatgga 780

agtgacaatg gaagtggcac tcagagttca tggactaaat gtctagctca agttggcagt 840

cctcatccag tttcacctca taaacagttg gttgatgccc ctgatagcac atgtgcccaa 900

gtgatgcaaa caaagactga aaaagttagt agtagatggg tgcatgcgac ggaaaaagag 960

tgccatgaac ttattgatct tgatgatgtt gcaagggtta aggacttggc tatgggaata 1020

tctttgaata tgcaactaga gcatccactc gaggaactgt ctagcaatcc aattgtgggt 1080

aaaggggcaa ataagatgtc tgatgtagat gatatgcaga tcattaagag aaagagcaat 1140

gtctgtgaaa aaggacaatt ggaatacaat ggtgataaaa ccgggacaca ggaaaatcag 1200

gctatgaatg ttattgatgt tactgatagc aacagtccac aggctgaaag cagagacttg 1260

aacactccaa atgggttttc tggtttttca caatcaaaag caaactgttg ccccaaagag 1320

catccatccc ttgaactaac tctgaaaagg ctgggagaag taggagatgc taaaaatgtc 1380

actggtgaag aatgcaatgt cttgagacat tcagatcagt cagcattctc aaaatataat 1440

actgtttctg ctaaccaggc tcaaactgga aatgtaggaa gctgttcccc actagacaat 1500

agctcagctg caccaaatac agagacaatg cacaactttc catctcattc aaatggcact 1560

ccttcaaatc aaaaatctaa tgggagcaac aacatcaatg acagggcctc cactaataca 1620

tatcttggca ccaaacctga tacttttgac aagaagccgg agtctggaag agggattggc 1680

tcgtataatt cttgtgaact cctaactgtg cagaacaata gcatttcttc atctcagaag 1740

aaaacttctg cctgggaaga atatacagaa atcattaaag aatcagtagg aggctctgaa 1800

caaggattcc aagtcgagca cacttactat cagcttcacc attataatca cattgcccat 1860

aaagctgcag tagatcccta a 1881

<210> 2

<211> 626

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Asn Asn Asn Val Gly Lys Gly Lys Lys Gly Leu Ala Glu Gln Asn

1 5 10 15

His Met Phe Phe Asp Lys Lys Ser Leu Glu Asn Gly Val Val Asn Gly

20 25 30

Gly Val Ala Ser Gly Ser Ser Thr Glu Asp Asp Thr Arg Phe Asn Lys

35 40 45

Val Val Glu Asp Gly Asn Asn Gly Leu Arg Gly Leu Ile Gln Ile His

50 55 60

Gly Ser Leu Gln Ile Ser Gln Gln Pro Pro Gln Glu Pro Ala Val Cys

65 70 75 80

Trp Glu Arg Phe Leu Pro Leu Arg Ser Ile Lys Val Leu Leu Val Glu

85 90 95

Asp Asp Asp Ser Thr Arg His Val Val Arg Ala Leu Leu Gln Asn Cys

100 105 110

Ser Tyr Lys Val Thr Ala Val Ser Asn Gly Leu Gln Ala Trp Lys Val

115 120 125

Leu Glu Asp Pro Glu Asn Gly Ile Asp Leu Val Leu Thr Glu Val Ala

130 135 140

Met Pro Ile Leu Ser Gly Ile Gly Leu Leu Cys Lys Ile Met Ser His

145 150 155 160

Lys Thr Leu Lys Asn Ile Pro Val Ile Met Met Ser Ser His Asp Ser

165 170 175

Met Gly Ile Val Phe Lys Cys Leu Ser Lys Gly Ala Val Asp Phe Leu

180 185 190

Val Lys Pro Ile Arg Arg Asn Glu Leu Lys Asn Leu Trp Gln His Val

195 200 205

Trp Arg Arg Cys His Ser Ser Ser Gly Ser Gly Ser Glu Ser Ala Thr

210 215 220

Leu Thr Arg Lys Phe Ala Lys Ser Arg Ser Asn Asp Ala Tyr Glu Asn

225 230 235 240

Asn Ser Asp Ser Ser Asp Glu Asn Asp Tyr Gly Ser Arg Gly Leu Ser

245 250 255

Ile Arg Asp Gly Ser Asp Asn Gly Ser Gly Thr Gln Ser Ser Trp Thr

260 265 270

Lys Cys Leu Ala Gln Val Gly Ser Pro His Pro Val Ser Pro His Lys

275 280 285

Gln Leu Val Asp Ala Pro Asp Ser Thr Cys Ala Gln Val Met Gln Thr

290 295 300

Lys Thr Glu Lys Val Ser Ser Arg Trp Val His Ala Thr Glu Lys Glu

305 310 315 320

Cys His Glu Leu Ile Asp Leu Asp Asp Val Ala Arg Val Lys Asp Leu

325 330 335

Ala Met Gly Ile Ser Leu Asn Met Gln Leu Glu His Pro Leu Glu Glu

340 345 350

Leu Ser Ser Asn Pro Ile Val Gly Lys Gly Ala Asn Lys Met Ser Asp

355 360 365

Val Asp Asp Met Gln Ile Ile Lys Arg Lys Ser Asn Val Cys Glu Lys

370 375 380

Gly Gln Leu Glu Tyr Asn Gly Asp Lys Thr Gly Thr Gln Glu Asn Gln

385 390 395 400

Ala Met Asn Val Ile Asp Val Thr Asp Ser Asn Ser Pro Gln Ala Glu

405 410 415

Ser Arg Asp Leu Asn Thr Pro Asn Gly Phe Ser Gly Phe Ser Gln Ser

420 425 430

Lys Ala Asn Cys Cys Pro Lys Glu His Pro Ser Leu Glu Leu Thr Leu

435 440 445

Lys Arg Leu Gly Glu Val Gly Asp Ala Lys Asn Val Thr Gly Glu Glu

450 455 460

Cys Asn Val Leu Arg His Ser Asp Gln Ser Ala Phe Ser Lys Tyr Asn

465 470 475 480

Thr Val Ser Ala Asn Gln Ala Gln Thr Gly Asn Val Gly Ser Cys Ser

485 490 495

Pro Leu Asp Asn Ser Ser Ala Ala Pro Asn Thr Glu Thr Met His Asn

500 505 510

Phe Pro Ser His Ser Asn Gly Thr Pro Ser Asn Gln Lys Ser Asn Gly

515 520 525

Ser Asn Asn Ile Asn Asp Arg Ala Ser Thr Asn Thr Tyr Leu Gly Thr

530 535 540

Lys Pro Asp Thr Phe Asp Lys Lys Pro Glu Ser Gly Arg Gly Ile Gly

545 550 555 560

Ser Tyr Asn Ser Cys Glu Leu Leu Thr Val Gln Asn Asn Ser Ile Ser

565 570 575

Ser Ser Gln Lys Lys Thr Ser Ala Trp Glu Glu Tyr Thr Glu Ile Ile

580 585 590

Lys Glu Ser Val Gly Gly Ser Glu Gln Gly Phe Gln Val Glu His Thr

595 600 605

Tyr Tyr Gln Leu His His Tyr Asn His Ile Ala His Lys Ala Ala Val

610 615 620

Asp Pro

625

<210> 3

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggaagcttag gccttctaga aaaataaatg gtaaaatgtc 40

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

caatccatgt ggtggcacat 20

<210> 5

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aatgtgccac cacatggatt gttaatggag gggtagcctc gttttagagc tagaaatagc 60

aa 62

<210> 6

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggcaacgcgt tctagaaaaa aaagcaccga ctcggtgcca c 41

<210> 7

<211> 83

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt ttt 83

<210> 8

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

taggctggtc cgatgaac 18

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ggtgctaagg catgatttac 20

Claims

1. An application of a soybean GmPRR3b gene in improving soybean drought resistance is disclosed, wherein a nucleotide sequence of the soybean GmPRR3b gene is shown as SEQ ID NO. 1; or the soybean GmPRR3b gene codes an amino acid sequence shown as SEQ ID NO. 2; the drought resistance of the soybean is improved by knocking out a soybean GmPRR3b gene and losing the function of the soybean GmPRR3b gene.

2. An application of a soybean GmPRR3b gene in drought-resistant soybean genetic breeding is disclosed, wherein the nucleotide sequence of the soybean GmPRR3b gene is shown as SEQ ID NO. 1; or the soybean GmPRR3b gene codes an amino acid sequence shown as SEQ ID NO. 2.

3. The application of the protein coded by the soybean GmPRR3b gene in improving the drought resistance of soybeans is disclosed, wherein the amino acid sequence of the protein coded by the soybean GmPRR3b gene is shown as SEQ ID NO. 2; the drought resistance of the soybean is improved by knocking out a soybean GmPRR3b gene and losing the function of the soybean GmPRR3b gene.

4. The application of the protein coded by the soybean GmPRR3b gene in drought-resistant soybean genetic breeding is disclosed, wherein the amino acid sequence of the protein coded by the soybean GmPRR3b gene is shown as SEQ ID No. 2.

5. The application of the soybean GmPRR3b gene knockout vector in improving soybean drought resistance is characterized in that the gene knockout vector is constructed by using a CRISPR-Cas9 editing technology, and the nucleotide sequence of the soybean GmPRR3b gene is shown in SEQ ID No. 1; or encode the amino acid sequence shown as SEQ ID NO. 2.

6. The application of the soybean GmPRR3b gene knockout vector in drought-resistant soybean genetic breeding is characterized in that the gene knockout vector is constructed by using a CRISPR-Cas9 editing technology, and the nucleotide sequence of the soybean GmPRR3b gene is shown as SEQ ID No. 1; or encode the amino acid sequence shown as SEQ ID NO. 2.

7. A preparation for improving soybean drought resistance, wherein an active ingredient of the preparation comprises a soybean GmPRR3b gene knockout vector as defined in claim 5.

8. A method of increasing drought resistance in soybean, comprising the steps of: constructing a soybean GmPRR3b gene knockout vector by using a CRISPR-Cas9 editing technology, so that the function of a soybean GmPRR3b gene is lost; the nucleotide sequence of the soybean GmPRR3b gene is shown as SEQ ID NO. 1; or encode the amino acid sequence shown as SEQ ID NO. 2.