CN116515888A

CN116515888A - Application of GmMTAs protein in regulating and controlling soybean plant height

Info

Publication number: CN116515888A
Application number: CN202310534653.7A
Authority: CN
Inventors: 赵涛; 张丽雅; 李宏宇; 刘军; 刘斌
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2023-05-12
Filing date: 2023-05-12
Publication date: 2023-08-01

Abstract

The invention discloses application of GmMTAs protein in regulating and controlling soybean plant height. The invention belongs to the technical field of biology, and particularly relates to application of GmMTAs protein in regulating and controlling soybean plant height. The present invention provides a method for reducing the plant height of soybean comprising reducing the plant height by knocking out a gene encoding a protein in the genome of soybean; the knocked-out protein is protein GmMTAa and/or protein GmMTAb, the protein GmMTAa is protein with the amino acid sequence of SEQ ID No.3, and the protein GmMTAb is protein with the amino acid sequence of SEQ ID No. 4. The CRISPR-Cas9 vector is used for knocking out the genes of the soybean endogenous GmMTAa or/and GmMTAb, so that the plant height of the soybean plant with the gene knocked out is obviously reduced compared with that of a control. The invention has important significance for the breeding of soybean dominant varieties and the development of germplasm resources.

Description

Application of GmMTAs protein in regulating and controlling soybean plant height

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of GmMTAs protein in regulating and controlling soybean plant height.

Background

The soybean is the main grain and oil and cash crop in China, and plays an important role in the national economy development in China. Although the land area of China is larger, the soybean planting area is limited, and the soybean yield is improved on the basis of not increasing the land planting area, mainly through reasonable close planting and intercropping. However, under such a planting condition, plants may develop a shade reaction due to shading, resulting in traits such as elongation and thinning of stems, and further resulting in lodging of soybeans and reduced yield. Therefore, the cultivation of dwarf close-planting resistant soybean varieties has important significance.

m ⁶ A methylation modification is one of the most common modifications in animals and plants and is a reversible process dynamically coordinated by methyltransferases (writers), demethylases (erasers) and methylation recognition enzymes (readers). Research shows that m ⁶ A methylation modification is critical to plant growth and development. Can influence a plurality of processes of flowering, height, embryo development, meiosis, root development, microspore development and the like of plants. MTA is one of important methyltransferases in plants, and it is found through bioinformatics analysis that two MTA proteins exist in soybeans, whether the GmMTAs proteins in the soybeans can influence the growth and development of the soybeans is not reported yet, and the application of transgenic technology to the modification of the genes in the soybeans is of great significance.

Disclosure of Invention

The invention aims to solve the technical problems of reducing the plant height of plants, constructing dwarf plants, resisting lodging of soybeans and improving the yield.

In order to solve the problems in the prior art, the invention provides a method for reducing the plant height of soybeans.

The method for reducing the plant height of the soybean comprises the steps of reducing the plant height by knocking out the coding gene of the protein in the soybean genome;

the protein is protein A and/or protein B, the protein A is protein with an amino acid sequence of SEQ ID No.3, and the protein B is protein with an amino acid sequence of SEQ ID No. 4.

The coding gene of the protein in the soybean genome is at least one mutation of the following:

m1) replacing positions 1-25 (corresponding to positions 822-846 of SEQ ID No. 11) of SEQ ID No.1 in the gene encoding said protein A in soybean genomic DNA with a DNA molecule having a nucleotide sequence of the sequence 5 '-ATGGAGACACAATCAGATGGTATG-3';

m2) substitution of the SEQ in the gene coding for protein A in soybean genomic DNA with a DNA molecule whose nucleotide sequence is the sequence 5' -AGGAACTTGGAGGGGATCG-3IDNo.1 at positions 530-549 (corresponding to SEQID1351-1370 bits of No. 11);

m3) substitution of SEQ ID No.2, positions 806-825 (corresponding to positions 2574-2593 of SEQ ID No. 12) in the gene encoding said protein B in soybean genomic DNA with a DNA molecule having the nucleotide sequence 5 '-GGATGGGAAGGCCAGCTG-3'; substitution of the nucleotide sequence 5'-AAGGGGGGC-3' DNA molecule for SEQ ID No.2 at positions 903-938 (corresponding to positions 2671-2706 of SEQ ID No. 12) in the gene encoding said protein B in soybean genomic DNA;

m4) replacing positions 851-873 (corresponding to positions 2619-2641 of SEQ ID No. 12) of SEQ ID No.2 in the gene encoding said protein B in soybean genomic DNA with a DNA molecule having the nucleotide sequence of the sequence 5 '-CCCATGAGACCCCCATATGTCA-3'; substitution of the nucleotide sequence 5'-CCATTGGGGCCTAACCAGG-3' DNA for SEQ ID No.2 at positions 976-998 (corresponding to positions 2744-2766 of SEQ ID No. 12) in the gene encoding said protein B in soybean genomic DNA;

M5) replacing positions 861-883 (corresponding to positions 1682-1704 of SEQ ID No. 11) of the gene encoding the protein A in soybean genomic DNA with a DNA molecule whose nucleotide sequence is the sequence 5 '-CCCCCATGTCAGCATTGCAGC-3'; substitution of the deletion at positions 716-883 of SEQ ID No.2 (corresponding to positions 2484-2651 of SEQ ID No. 12) in the gene encoding said protein B in soybean genomic DNA with a DNA whose nucleotide sequence is the sequence 5 '-TTGAATCAAGTTCTGGAATGTCAGCATTGCAGC-3';

m6) replacing positions 883-905 (corresponding to positions 1704-1726 of SEQ ID No. 11) of the gene encoding the protein A in soybean genomic DNA with a DNA molecule having a nucleotide sequence of the sequence 5 '-CCAATGTTTTTCAGGAGGACCAAG-3'; replacing positions 961-983 (corresponding to positions 1782-1804 of SEQ ID No. 11) of the gene encoding protein A in soybean genomic DNA with a DNA molecule having a nucleotide sequence of the sequence 5 '-CCTTCATGCATAGACTCCCATT-3'; substitution of the nucleotide sequence 5'-CCAATGATGCATAGACTCCCAT-3' DNA molecule for the 883-979 deletion (corresponding to positions 2651-2747 of SEQ ID No. 12) in the gene encoding protein B in soybean genomic DNA;

M7) replacing positions 883-905 (corresponding to positions 1704-1726 of SEQ ID No. 11) of the gene encoding the protein A in soybean genomic DNA with a DNA molecule having a nucleotide sequence of the sequence 5 '-CCAATGTCAGGAGGACCAAG-3'; replacing positions 961-983 (corresponding to positions 1782-1804 of SEQ ID No. 11) of the gene encoding protein A in soybean genomic DNA with a DNA molecule having a nucleotide sequence of the sequence 5 '-CCTTCAGCATAGACTCCCATT-3'; simultaneously replacing the 883-979 deletion (corresponding to 2651-2747 of SEQ ID No. 12) of the gene encoding the protein B in soybean genomic DNA with a DNA molecule whose nucleotide sequence is the sequence 5 '-CCAATGATGCATAGACTCCCAT-3';

m8) replacing positions 1-25 (corresponding to positions 822-846 of SEQ ID No. 11) of the gene encoding said protein A in soybean genomic DNA with a DNA molecule having a nucleotide sequence of the sequence 5 '-ATGGAGACACAATCAGATGGTATG-3'; replacing positions 851-873 (corresponding to positions 2619-2641 of SEQ ID No. 12) of SEQ ID No.2 in the gene encoding said protein B in soybean genomic DNA with a DNA molecule whose nucleotide sequence is the sequence 5'-CCCATG AGACCCCCATATGTCA-3'; substitution of the nucleotide sequence 5'-CCATTGGGGCCTAACCAGG-3' molecular DNA for SEQ ID No.2 at positions 976-998 (corresponding to positions 2744-2766 of SEQ ID No. 12) in the gene encoding protein B in soybean genomic DNA.

The invention also provides application of the protein or the expression substance of the regulatory gene or the substance for regulating the activity or the content of the protein in any one of the following:

1) The application of protein or the expression substance of regulating gene or the substance for regulating the activity or content of the protein in regulating plant height;

2) The application of protein or the substance for regulating gene expression or the substance for regulating the activity or content of the protein in preparing products for regulating plant height;

3) Use of a protein or an expression substance of a regulatory gene or a substance regulating the activity or content of said protein in growing plants of altered plant height;

4) Use of a protein or an expression substance of a regulatory gene or a substance regulating the activity or content of said protein for the preparation of a product for growing plants of altered plant height;

5) Use of a protein or an expression substance of a regulatory gene or a substance regulating the activity or content of said protein in plant breeding.

The protein is protein GmMTAs.

The protein GmMTAs can be represented by the following protein A) or B):

the protein A) can be protein with the amino acid sequence of SEQ ID No. 3;

the protein B) may be a protein with the amino acid sequence of SEQ ID No. 4.

The protein A) is named GmMTAa.

The protein B) is named GmMTAb.

In order to facilitate purification or detection of the protein in a 1) or b 1), a tag protein may be attached to the amino-or carboxy-terminus of the protein consisting of the amino acid sequence shown in SEQ ID No.3 or SEQ ID No.4 of the sequence Listing.

The protein can be synthesized artificially or obtained by synthesizing the coding gene and then biologically expressing.

Such tag proteins include, but are not limited to: GST (glutathione-sulfhydryl transferase) tag protein, his6 tag protein (His-tag), MBP (maltose binding protein) tag protein, flag tag protein, SUMO tag protein, HA tag protein, myc tag protein, eGFP (enhanced green fluorescent protein), eFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

The nucleotide sequences of the proteins GmMTAa or GmMTAb according to the invention can be mutated easily by the person skilled in the art by known methods, for example directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity to the nucleotide sequence of the protein GmMTAa or GmMTAb isolated according to the present invention are all nucleotide sequences derived from the present invention and are equivalent to the sequences of the present invention as long as they encode the protein GmMTAa or GmMTAb and have the function of the protein GmMTAa or GmMTAb.

The 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

Herein, identity refers to identity of an amino acid sequence or a nucleotide sequence. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity.

Herein, the 80% identity or more may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

Herein, the 90% identity or more may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

In the above application, the protein is derived from soybean (Glycine max (l.) merr.).

Herein, the substance that regulates the activity and/or content of the protein may be a substance that regulates the expression of a gene encoding the protein GmMTAa or/and GmMTAb.

In the above, the substance that regulates gene expression may be a substance that performs at least one of the following 6 regulation: 1) Regulation at the level of transcription of said gene; 2) Regulation after transcription of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) Regulation of RNA transport of the gene (i.e., regulation of nuclear to cytoplasmic transport of mRNA of the gene); 4) Regulation of translation of the gene; 5) Regulation of mRNA degradation of the gene; 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated by the gene).

In the present invention, the modulation may be up-regulation or enhancement or improvement. The modulation may also be down-regulation or reduced or lowered.

In the above application, the substance for regulating the expression of the gene or the substance for regulating the activity or content of the protein may be a biological material related to the protein as described above, and the biological material may be any of the following:

c1 A nucleic acid molecule encoding a protein GmMTAa or/and GmMTAb as described hereinbefore;

c2 An expression cassette comprising c 1) said nucleic acid molecule;

c3 A recombinant vector comprising c 1) said nucleic acid molecule, or a recombinant vector comprising c 2) said expression cassette;

c4 A recombinant microorganism comprising c 1) said nucleic acid molecule, or a recombinant microorganism comprising c 2) said expression cassette, or a recombinant microorganism comprising c 3) said recombinant vector;

c5 A transgenic plant cell line comprising c 1) said nucleic acid molecule, or a transgenic plant cell line comprising c 2) said expression cassette;

c6 A transgenic plant tissue comprising c 1) said nucleic acid molecule, or a transgenic plant tissue comprising c 2) said expression cassette;

c7 A transgenic plant organ comprising c 1) said nucleic acid molecule, or a transgenic plant organ comprising c 2) said expression cassette;

e1 A nucleic acid molecule which inhibits or reduces or silences the expression of the protein GmMTAa or/and GmMTAb coding gene described above;

e2 An expression cassette comprising e 1) said nucleic acid molecule;

e3 A recombinant vector comprising e 1) said nucleic acid molecule, or a recombinant vector comprising e 2) said expression cassette;

e4 A recombinant microorganism comprising e 1) said nucleic acid molecule, or a recombinant microorganism comprising e 2) said expression cassette, or a recombinant microorganism comprising e 3) said recombinant vector;

e5 A transgenic plant cell line comprising e 1) said nucleic acid molecule, or a transgenic plant cell line comprising e 2) said expression cassette;

e6 A transgenic plant tissue comprising e 1) said nucleic acid molecule, or a transgenic plant tissue comprising e 2) said expression cassette;

e7 A transgenic plant organ containing e 1) said nucleic acid molecule, or a transgenic plant organ containing e 2) said expression cassette.

In the above application, the nucleic acid molecule of c 1) may be a DNA molecule as shown in any one of the following,

d1 A DNA molecule with a nucleotide sequence shown as SEQ ID NO. 1;

d2 A coding region sequence is a DNA molecule shown as SEQ ID NO.1 in a sequence table;

f1 A DNA molecule with a nucleotide sequence shown as SEQ ID NO. 2;

f2 A coding region sequence is a DNA molecule shown as SEQ ID NO.2 in a sequence table;

the nucleic acid molecule described herein may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be an RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

Vectors described herein are well known to those of skill in the art and include, but are not limited to: plasmids, phages (e.g., lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), ti plasmids, or viral vectors. Specifically, CRISPR-Cas9 recombinant vector pCas 9-AtU-sgRNA and vector PTF101-GFP can be used.

As a specific example, the recombinant vectors pCas9-AtU6-sgRNA are recombinant vectors Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1 and Gmmtas-dm-2.

Wherein the Gmmtaa-1 (GmMTaa-gRNA 1) recombinant vector is a recombinant plasmid obtained by inserting a DNA fragment of SEQ ID No.5 in a sequence table between recognition sites of pCas 9-AtU-sgRNA vector restriction enzymes StuI and XbaI and keeping other sequences of the pCas 9-AtU-sgRNA vector unchanged.

The Gmmtaa-2 (GmMTaa-gRNA 2) recombinant vector is a recombinant plasmid obtained by inserting a DNA fragment of SEQ ID No.6 in a sequence table between recognition sites of pCas9-AtU6-sgRNA vector restriction enzymes StuI and XbaI and keeping other sequences of the pCas 9-AtU-sgRNA vector unchanged.

The GmmTab-1 (GmMTAb-gRNA 1/3) recombinant vector is a recombinant plasmid obtained by inserting a DNA fragment of SEQ ID No.7 in a sequence table between recognition sites of restriction enzymes StuI and XbaI of a pCas 9-AtU-sgRNA vector and keeping other sequences of the pCas 9-AtU-sgRNA vector unchanged.

The GmmTab-2 (GmMTaa-gRNA 2/4) recombinant vector is a recombinant plasmid obtained by inserting a DNA fragment of SEQ ID No.8 in a sequence table between recognition sites of restriction enzymes StuI and XbaI of a pCas 9-AtU-sgRNA vector and keeping other sequences of the pCas 9-AtU-sgRNA vector unchanged.

The Gmmmas-dm-1 (GmMTAs-gRNA 11/12) recombinant vector is a recombinant plasmid obtained by inserting a DNA fragment of SEQ ID No.9 in a sequence table between recognition sites of pCas9-AtU6-sgRNA vector restriction enzymes StuI and XbaI and keeping other sequences of the pCas9-AtU6-sgRNA vector unchanged.

The Gmmmas-dm-2 (GmMTAs-gRNA 13/14) recombinant vector is a recombinant plasmid obtained by inserting a DNA fragment of SEQ ID No.10 in a sequence table between recognition sites of pCas9-AtU6-sgRNA vector restriction enzymes StuI and XbaI and keeping other sequences of the pCas9-AtU6-sgRNA vector unchanged.

As a specific example, the recombinant vector is recombinant vectors GmMTAa-GFP and GmMTAb-GFP.

The GmMTAa-GFP recombinant vector is a recombinant plasmid which is obtained by inserting a DNA fragment with the sequence of 1 st to 2286 th positions of the sequence 1 in a sequence table between recognition sites of PTF101-GFP vector restriction endonuclease XbaI and keeping other sequences of the PTF101-GFP vector unchanged.

The GmMTAb-GFP recombinant vector is a recombinant plasmid which is obtained by inserting a DNA fragment with the sequence of 1 st to 2283 rd positions of the sequence 2 in a sequence table between recognition sites of PTF101-GFP vector restriction endonuclease XbaI and keeping other sequences of the PTF101-GFP vector unchanged.

The recombinant expression vector containing the GmMTAa or/and GmMTAb gene can be constructed by using the existing plant expression vector. Such plant expression vectors include, but are not limited to, vectors such as binary Agrobacterium vectors and vectors useful for microprojectile bombardment of plants, and the like. The plant expression vector may also comprise the 3' -untranslated region of a foreign gene, i.e., comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal may direct the addition of polyadenylation to the 3 'end of the mRNA precursor and may function similarly to untranslated regions transcribed from the 3' end of plant genes including, but not limited to, agrobacterium tumefaciens induction (Ti) plasmid genes (e.g., nopaline synthase Nos genes), plant genes (e.g., soybean storage protein genes).

When the GmMTAa or/and GmMTAb gene is used for constructing a recombinant plant expression vector, any one of an enhanced promoter or a constitutive promoter can be added before the transcription initiation nucleotide, and the enhanced promoter comprises, but is not limited to, a cauliflower mosaic virus (CAMV) 35S promoter, a ubiquitin promoter (ubiquitin) of corn, which can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, enhancers, including translational enhancers or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, such as by adding genes encoding enzymes or luminescent compounds that produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.), or anti-chemical marker genes (e.g., anti-herbicide genes), etc., which may be expressed in plants. From the safety of transgenic plants, transformed plants can be screened directly in stress without adding any selectable marker gene.

The GmMTAa or/and GmMTAb gene or gene fragment provided by the invention is/are introduced into plant cells or receptor plants by using any vector capable of guiding exogenous gene to express in plants, so that transgenic cell lines and transgenic plants with changed plant heights can be obtained. The expression vector carrying the GmMTAa or/and GmMTAb gene may be transformed into plant cells or tissues by using conventional biological methods such as Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, conductance, agrobacterium-mediated, etc., and the transformed plant tissues are cultivated into plants.

The invention also provides a method for increasing plant height, which comprises the step M, wherein the step M is used for enhancing, increasing or up-regulating the activity and/or content of the protein in the target plant, or/and enhancing, increasing or up-regulating the expression level of the encoding gene of the protein to increase the plant height.

The invention also provides a method for reducing plant height, which comprises the step P, wherein the step P is used for inhibiting or reducing or silencing the activity and/or content of the protein in a target plant, or/and inhibiting or reducing or silencing the expression quantity of the encoding gene of the protein to reduce plant height.

In the above method, the reduction of the expression level and/or activity of the gene encoding the protein GmMTAa or/and GmMTAb in the target plant may be a reduction or inactivation of the gene encoding the protein GmMTAa or/and GmMTAb in the target plant genome by using a gene mutation, gene knockout, gene editing or gene knockdown technique.

The present invention provides a method for growing plants with reduced plant height, comprising inhibiting or reducing or silencing the expression of the gene encoding the protein and/or the content and/or the activity of the protein in a target plant, or/and inhibiting or reducing or silencing the activity and/or the content of the gene encoding the protein, so as to obtain plants with reduced plant height.

In one embodiment of the present invention, the breeding method for growing a plant with reduced plant height comprises the steps of:

(1) Constructing a recombinant expression vector for inhibiting or reducing or silencing the encoding gene of the protein;

(2) Transferring the recombinant expression vector constructed in the step (1) into a receptor plant (such as crops or soybeans) to obtain a plant with a plant height lower than that of the receptor plant.

In the present invention, the object of plant breeding may include growing plants of reduced plant height.

In the present invention, the aforementioned proteins and/or the aforementioned biological materials are also within the scope of the present invention.

In the present invention, the plant may be a dicotyledonous plant.

In the above applications or methods, the dicotyledonous plant may be N1) or N2) or N3) or N4):

n1) plants of the order Douglas;

n2) leguminous plants;

n3) a plant of the genus glycine;

n4) soybean.

In the above, the soybean may be soybean variety Tianlong 1.

According to the invention, two regulatory genes GmMTAa or/and GmMTAb cDNA fragments related to plant height and hypocotyl growth are cloned from a soybean variety Tianlong No. 1, single genes of GmMTAa and GmMTAb and a GmMTAs double-gene knockout target site primer sequence are designed through sequence analysis, and the gene of the soybean endogenous GmMTAa or/and GmMTAb is knocked out through a CRISPR-Cas9 vector, so that the plant height of a soybean plant with the gene knocked out is obviously reduced compared with that of a control. The hypocotyl of the soybean plants overexpressed by GmMTAa or/and GmMTAb genes has a remarkable increasing trend. The invention has important significance for the breeding of soybean dominant varieties and the development of germplasm resources.

Drawings

FIG. 1 is a long-day phenotype map of Gmmtaa and Gmmtab single mutant plants. A is a GmMTAs gene structure and mutation schematic diagram; b is a GmMTAs protein structure and a mutation schematic diagram; c is a Gmmtaa-1, gmmtaa-2, gmmtab-1 and Gmmtab-2 long-day phenotype chart; the D is the hypocotyl and epicotyl length data statistics of Gmmtaa-1, gmmtaa-2, gmmtab-1 and Gmmtab-2.

FIG. 2 is a long-day phenotype plot of Gmmmas-dm-1, gmmas-dm-2, gmmas-dm-3 and Gmmas-dm-4 double mutant plants. A is a GmMTAs gene structure and mutation schematic diagram; b is a GmMTAs protein structure and a mutation schematic diagram; c is a Gmmmas-dm-1, gmmmas-dm-2 and Gmmmas-dm-3 long-day phenotype chart; the hypocotyl and epicotyl data statistics of D are Gmmmas-dm-1, gmmmas-dm-2 and Gmmmas-dm-3.

FIG. 3 is a phenotypic map of Gmmtaa and Gmmtab single mutant plants in Beijing summer sowing. A is a field phenotype chart of the Gmmtaa-1, gmmtaa-2, gmmtab-1 and Gmmtab-2 single mutant plants; b is the plant height, the main stem node number, the effective branching, the individual plant weight, the individual plant grain number and hundred grain weight field character data statistics of the Gmmtaa-1, gmmtaa-2, gmmtab-1 and Gmmtab-2 single mutant plants.

FIG. 4 is a phenotypic chart of Gmmmas-dm-1, gmmmas-dm-2 and Gmmas-dm-3 double mutant plants in Beijing summer sowing. A is a field phenotype chart of the Gmmmas-dm-1, gmmmas-dm-2 and Gmmmas-dm-3 double mutant plants; b is the plant height, the main stem node number, the effective branches, the individual grain weight, the individual grain number and hundred grain weight field character data statistics of the Gmmmas-dm-1, gmmmas-dm-2 and Gmmmas-dm-3 double mutant plants.

FIG. 5 is a long-day phenotype plot of GmMTAa-GFP and GmMTAb-GFP overexpressing plants. A is a phenotype chart of GmMTAa-GFP-1, gmMTAa-GFP-2, gmMTAb-GFP-1 and GmMTAb-GFP-2 over-expression plants; b is the detection of the expression of fusion proteins in wild type and over-expressed transgenic plants by using anti-GFP antibodies; c is the data statistics of the epicotyl and the hypocotyl; d is plant height data statistics.

FIG. 6 is a graph showing that Gmmas-dm-3 and Gmmas-dm-4 double mutant plants are involved in Low Blue Light (LBL) and low red/far red (WL+FR) -induced shade avoidance response. A is the three illumination conditions of the experiment, namely WL, LBL and WL+FR respectively; b is a phenotype chart of the Gmmmas-dm-3 and Gmmmas-dm-4 double mutant plants; plant height data statistics of double mutant plants of Gmmmas-dm-3 and Gmmas-dm-4 are carried out on C; d is a fold difference statistic, namely the ratio of the plant height of the Gmmmas-dm-3 and Gmmas-dm-4 double mutants under LBL and WL+FR conditions to the plant height under white light, respectively.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The quantitative experiments in the following examples were performed in triplicate unless otherwise indicated.

In the examples of the present invention, soybean willow 82 has been described in: schmutz, j., cannon, s.b., schlueter, j., ma, j., mitros, t., nelson, w., … Jackson, s.a. (2010) Genome sequence of the palaeopolyploid soybean. Nature,463 (7278), 178-183. The biological material is available to the public from national academy of agricultural sciences crop science, and is used only for repeated experiments related to the invention, and is not used for other purposes.

The CRISPR-Cas9 vector pCas9-AtU6-sgRNA vector in the examples of the present invention has been described in: li, C.et al A. Precipitation-associated gene GmPRR3b regulates the circadian clock and flowering time in soybean. Mol Plant 13,745-759 (2020), which is available to the public from the national academy of agricultural science crop science institute, is used only for repeated experiments related to the invention, and is not used for other purposes.

The PTF101-GFP vector in the examples of the present invention has been described in: cheng Q et al, the Soybean Gene J Contributes to Salt Stress Tolerance by Up-adjusting Salt-Responsive genes front Plant Sci.17; the public is available from the national academy of agricultural sciences crop science research at 11:272,2020, and the biomaterial is used only for repeated experiments related to the invention and is not used for other purposes.

In the embodiment of the invention, the Tianlong one of the soybean variety is described in: li, C.et al A. Precipitation-associated gene GmPRR3b regulates the circadian clock and flowering time in soybean. Mol Plant 13,745-759 (2020), available to the public from national academy of agricultural sciences crop science research, which is used only for repeated experiments related to the invention, but not as other uses.

In the examples of the present invention, the JRH0951 vector is described in: li, C.et al A-precipitation-associated gene GmPRR3b regulates the circadian clock and flowering time in soybean. Mol Plant 13,745-759 (2020), publicly available to the national academy of agricultural sciences crop science research, which is used only for repeated experiments related to the invention, but not as other uses.

The primer sequences used in the present invention are shown in Table 1 below.

TABLE 1 primer sequence information in the present invention

Example 1 construction of GmMTAs Single Gene, multi-Gene knockout vector

The double-gene knockout target site primer sequences of GmMTAa and GmMTAb are designed through a CRISPR-P website (http:// CRISPR. Dbcls. Jp /), and the target site primer sequences are respectively as follows:

GmMTAa-gRNA1：

5’-AATGTGCCACCACATGGATTGACACAATCAGATGGTAATGGTTTTAGAGCTAGAAATAGCAA-3’

GmMTAa-gRNA2：

5’-AATGTGCCACCACATGGATTGGGAACTTGGAGGGGATTCGGTTTTAGAGCTAGAAATAGCAA-3’

GmMTAb-gRNA1：

5’-AATGTGCCACCACATGGATTGGATGGGAAGGCCAGTTCTGGTTTTAGAGCTAGAAATAGCAA-3’

GmMTAb-gRNA2：

5’-AATGTGCCACCACATGGATTGGACATATGGGGGTCTCCATGTTTTAGAGCTAGAAATAGCAA-3’

GmMTAb-gRNA3：

5’-AATGTGCCACCACATGGATTGAGGGGAGCACCCAGACTAAGTTTTAGAGCTAGAAATAGCAA-3’

GmMTAb-gRNA4：

5’-AATGTGCCACCACATGGATTGCATTGGGGCCTAATGCACCGTTTTAGAGCTAGAAATAGCAA-3’

GmMTAs-gRNA11：

5’-AATGTGCCACCACATGGATTGTGAATCAAGTTCTGGAGATGTTTTAGAGCTAGAAATAGCAA-3’

GmMTAs-gRNA12：

5’-AATGTGCCACCACATGGATTGCTGCAATGCTGACATATGGGTTTTAGAGCTAGAAATAGCAA-3’

GmMTAs-gRNA13：

5’-AATGTGCCACCACATGGATTGTTGGTCCTCCTGAAAACATGTTTTAGAGCTAGAAATAGCAA-3’

GmMTAs-gRNA14：

5’-AATGTGCCACCACATGGATTGATGGGAGTCTATGCATTGAGTTTTAGAGCTAGAAATAGCAA-3’

1. Acquisition of U6 and gRNA

1.1PCR reaction System:

when amplifying the U6 fragment: the Primer-F is U6-StuI-F or U6-EcoRI-F, and the Primer-R is U6-R; in amplifying gRNA, primer-F is the target site Primer in example 1, and Primer-R is gRNA-EcoRI-R or gRNA-Xbal-R.

1.2 reaction procedure: preheating at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 57℃for 30s, extension at 72℃for 30s (30-60 s/kb), 35 cycles; final extension at 72℃for 5min; preserving at 4 ℃.

1.3 the PCR products were recovered using an agarose gel recovery kit (Axygen Co.) and the obtained U6 and gRNA products were subjected to a second round of PCR amplification as templates to obtain U6-GmMTAa-gRNA1, U6-GmMTAa-gRNA2, U6-GmMTAb-gRNA1, U6-GmMTAb-gRNA2, U6-GmMTAb-gRNA3, U6-GmMTAb-gRNA4, U6-GmMTAs-gRNA11, U6-GmMTAs-gRNA12, U6-GmMTAs-gRNA13, U6-GmMTAs-gRNA14 fragments. The PCR product was recovered again.

2. Acquisition of GmMTAs gene CRISPR-Cas9 recombinant knockout vector

2.1 enzyme digestion

The restriction enzyme StuI and XbaI are used for double digestion of the carrier CRISPR-Cas9 carrier pCas 9-AtU-sgRNA, and the digestion product is recovered to obtain the linear pCas 9-AtU-sgRNA. The fragments U6-GmMTAa-gRNA1 and U6-GmMTAa-gRNA2 were cut with the restriction enzymes StuI and XbaI. The sections U6-GmMTAb-gRNA1, U6-GmMTAb-gRNA2, U6-GmMTAs-gRNA11 and U6-GmMTAs-gRNA13 were cut with the restriction enzymes StuI and EcoRI. The sections U6-GmMTAb-gRNA3, U6-GmMTAb-gRNA4, U6-GmMTAs-gRNA12 and U6-GmMTAs-gRNA14 were cut with the restriction enzymes EcoRI and XbaI.

Cleavage vector pCas9-AtU6-sgRNA reaction System:

enzyme section reaction system:

reaction conditions: water bath at 37 ℃ for 1h.

2.2 connection

The ligation reagent used was T4 DNA ligase. Firstly, the digested fragments U6-GmMTAa-gRNA1, U6-GmMTAa-gRNA2, U6-GmMTAb-gRNA1, U6-GmMTAb-gRNA2, U6-GmMTAb-gRNA3, U6-GmMTAb-gRNA4, U6-GmMTAs-gRNA11, U6-GmMTAs-gRNA12, U6-GmMTAs-gRNA13 and U6-GmMTAs-gRNA14 in 2.1 are recovered.

U6-GmMTAa-gRNA1 and U6-GmMTAa-gRNA2 were each single-site ligated to the linearized pCas9-AtU6-sgRNA vector. U6-GmMTAb-gRNA1 and U6-GmMTAb-gRNA3, U6-GmMTAb-gRNA2 and U6-GmMTAb-gRNA4, U6-GmMTAs-gRNA11 and U6-GmMTAs-gRNA12, U6-GmMTAs-gRNA13 and U6-GmMTAs-gRNA14 are respectively connected with linearized pCas9-AtU6-sgRNA carrier in double-site mode. And 6 GmMTAs genes CRISPR-Cas9 recombinant knockout vectors are respectively obtained. Named GmMTaa-1 (GmMTaa-gRNA 1), gmMTaa-2 (GmMTaa-gRNA 2), gmmtab-1 (GmMTAb-gRNA 1/3), gmmtab-2 (GmMTaa-gRNA 2/4), gmmtas-dm-1 (GmMTAs-gRNA 11/12), and Gmmtas-dm-2 (GmMTAs-gRNA 13/14), respectively.

Single target site ligation reaction system:

double target site ligation reaction system:

in the ligation reaction system, the inserted DNA fragments 1 and 2 refer to U6-GmMTAb-gRNA1 and U6-GmMTAb-gRNA3 in the recombinant vector Gmmtab-1, U6-GmMTAb-gRNA2 and U6-GmMTAb-gRNA4 in the recombinant vector Gmmtab-2, U6-GmMTAs-gRNA11 and U6-GmMTAs-gRNA12 in the recombinant vector Gmmas-dm-1, and U6-GmMTAs-gRNA13 and U6-GmMTAs-gRNA14 in the recombinant vector Gmmas-dm-2, respectively.

Reaction conditions: the mixture was then stored at 16℃for 8 hours or overnight at 4 ℃.

3. CRISPR-Cas9 recombinant vector GmMTAs-gRNA plasmid propagation

3.1 transformation of the recombinant vector into E.coli TOP10

1) 100 mu L of escherichia coli TOP10 stored at the temperature of minus 80 ℃ is sub-packaged into two centrifuge tubes, 10 mu L of the recombinant vectors Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1, gmmtas-dm-2 and Gmmtas-dm-3 obtained in the step 2 are added, and the mixture is kept stand on ice for 30min;

2) Heat-shocking the water bath kettle at 42 ℃ for 45s, and standing on ice for 2min;

3) To E.coli (TOP 10) competence, 700. Mu.L of antibiotic-free LB liquid medium was added and the shaking table was incubated at 37℃for 45min at 180 rpm;

4) Centrifuging at 12000rpm for 30s, discarding supernatant in an ultra-clean workbench, repeatedly sucking and beating the gun head, mixing, uniformly coating bacterial liquid on LB solid culture medium with corresponding antibiotic, slightly airing, inverting, and culturing overnight in a constant temperature incubator at 37deg.C.

3.2 identification of Positive monoclonal

A plurality of E.coli monoclonals on a solid culture medium are picked up by using a toothpick sterilized at high temperature, a light streak is carried out on LB solid culture medium containing kanamycin resistance, the toothpick is placed in a PCR reaction tube, colony PCR detection is carried out by using 0645-T-F/0645-T-R, and a streaked LB solid culture dish is placed in a 37 ℃ incubator for overnight culture in darkness.

1) Colony PCR reaction system:

2) The PCR reaction procedure was as follows:

the PCR product is detected by electrophoresis, positive monoclonal colonies are selected, and the positive monoclonal colonies are sent to sequencing, and the correct recombinant vectors of Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1 and Gmmtas-dm-2 are obtained after sequencing.

The Gmmmas-dm-1 (GmMTAs-gRNA 11/12) recombinant vector is a sequence table with SEQ in the sequence table inserted between the recognition sites of pCas 9-AtU-sgRNA vector restriction enzymes StuI and XbaIIDThe DNA fragment of No.9, the recombinant plasmid obtained by keeping other sequences of pCas 9-AtU-sgRNA vector unchanged.

3.3 plasmid extraction and purification

Plasmid extraction and purification fractions were carried out according to the plasmid miniprep kit (TIANGEN, cat# DP 106-02). To obtain the plasmids Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1 and Gmmtas-dm-2.

Example 2 construction of GmMTAa and GmMTAb overexpression vectors

Downloading GmMTAa and GmMTAb CDS sequences according to soybean reference genome (phytozome), and designing primers, wherein the primers are designed as follows:

GmMTAa-F:CACGGGGGACTCTAGA ATGGAGACACAATCAGATGG

GmMTAa-R:GGGGAGGACCTCTAGA GCCAATGTCCACATCAATGG

GmMTAb-F:CACGGGGGACTCTAGA ATGGAGACACAATCAGATGG

GmMTAb-R:GGGGAGGACCTCTAGA GCCAATGTCCACATCAATAG

and designing PCR detection primers and sequencing detection primers according to the PTF101-GFP vector sequence, wherein the sequences of the primers are as follows:

PTF101-F1：TTGGAGAGAACACGGGGGAC

PTF101-R：CGCCGGACACGCTGAACTTG

1. acquisition of CDS sequences

1.1 taking soybean Williams 82 seeds, planting in nutrient-containing soil, and growing for 7 days under long sunlight. Taking soybean leaves, extracting RNA, synthesizing cDNA by using a reverse transcription kit, and performing PCR amplification by using designed GmMTAa and GmMTAb cDNA amplification primers and using reverse transcription products as templates.

1.2 PCR reaction system

1.3 reaction procedure: preheating at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 57℃for 30s, extension at 72℃for 30s (30-60 s/kb), 35 cycles; final extension at 72℃for 5min; preserving at 4 ℃. If no band exists, the second round of PCR product amplification can be performed, and the amplified template is the product of the first round.

1.4 recovery of GmMTAa-CDS and GmMTAb-CDS PCR products was performed using an agarose gel recovery kit (Axygen). The coding sequence (CDS) of the GmMTAa gene in soybean Williams 82 is shown as a nucleotide sequence shown as SEQ ID NO.1, and the amino acid sequence of the coding protein is shown as SEQ ID NO. 3. The coding sequence (CDS) of the GmMTAb gene in soybean Williams 82 is shown as a nucleotide sequence shown as SEQ ID NO.2, and the amino acid sequence of the coding protein is shown as SEQ ID NO. 4.

2. Acquisition of GmMTAs Gene overexpression vector

2.1 enzyme digestion

The PTF101-GFP vector was digested with the restriction enzyme XbaI, and the digested vector reaction system was as follows:

reaction conditions: water bath at 37 ℃ for 1h.

2.2 connection

Connection reaction In-fusion system

And (3) connecting at 50 ℃ for 30min to obtain a connecting product PTF101-GmMTAa-GFP recombinant overexpression vector and a PTF101-GmMTAb-GFP recombinant overexpression vector, and preserving at 4 ℃.

3. Plasmid propagation of GmMTAs gene over-expression vector

3.1GmMTAs Gene overexpression vector for transforming E.coli TOP10

1) 100 mu L of escherichia coli stored at-80 ℃ are sub-packaged into two centrifuge tubes, 10 mu L of a connecting product (GmMTaa-GFP/GmMTAb-GFP recombinant vector) is added, and the mixture is kept stand on ice for 30min;

3) Adding 700 mu L of antibiotic-free LB liquid medium into TOP10 competence of escherichia coli, and recovering for 45min by a shaking table at a constant temperature of 37 ℃ and 180 rpm;

3.2 identification of Positive monoclonal

Coli monoclonal obtained in step 3.1 on solid medium was picked with autoclaved toothpick, streaked gently on LB solid medium containing spectinomycin resistance, the toothpick was placed in PCR reaction tube using PTF101-F1:5'-TTGGAGAGAACACGGGGGAC-3', PTF101-R:5'-CGCCGGACACGCTGAACTTG-3' primer colony PCR detection (same as in step 3.2 of example 1) was performed, and streaked LB solid plates were placed in a 37℃incubator overnight for cultivation.

1) Colony PCR reaction system:

2) The PCR reaction procedure was as follows:

the PCR product is detected by electrophoresis, positive monoclonal colonies are selected, and the positive monoclonal colonies are sent to sequencing, and the correct recombinant overexpression vectors of PTF101-GmMTAa-GFP and PTF101-GmMTAb-GFP are obtained after sequencing.

The PTF101-GmMTAa-GFP recombinant vector is a recombinant plasmid which is obtained by inserting a DNA fragment with the sequence of 1 st to 2286 th positions of the sequence 1 in a sequence table between recognition sites of a restriction enzyme XbaI of the PTF101-GFP vector and keeping other sequences of the PTF101-GFP vector unchanged.

The GmMTAb-GFP recombinant vector is a recombinant plasmid which is obtained by inserting a DNA fragment (with a stop codon removed) with the sequence of 1 st to 2283 nd of the sequence 2 in a sequence table between recognition sites of restriction enzyme XbaI of the PTF101-GFP vector and keeping other sequences of the PTF101-GFP vector unchanged.

3.3 plasmid extraction

Plasmid extraction and purification fractions were carried out according to the plasmid miniprep kit (TIANGEN, cat# DP 106-02). Obtaining a PTF101-GmMTAa-GFP plasmid and a PTF101-GmMTAb-GFP plasmid

Example 3 obtaining transgenic Soybean plants

1. Working efficiency of verifying target site of recombinant vector by soybean hairy root

Six CRISPR-Cas9 recombinant vector plasmids Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1 and Gmmtas-dm-2 constructed in example 1 are converted into K599 Agrobacterium rhizogenes (ZC 1506D, beijing village allied biosystems) to be competent, and the working efficiency of the recombinant vector is verified by a soybean hairy root technology.

1.1 competent preparation of Agrobacterium rhizogenes K599

1) Preparing 10% glycerol in advance, sterilizing at 121deg.C for 20min, cooling, and pre-cooling in a refrigerator at-4deg.C;

2) Streaking and inoculating frozen K599 on solid LB medium containing streptomycin (50 mug/mL), and culturing for 2 days at 28 ℃;

3) Single colonies were picked and inoculated into 10mL sterile centrifuge tubes containing 3mL of liquid LB medium (containing streptomycin, 50. Mu.g/mL), shake-cultured overnight at 28 ℃,220 rpm;

4) Inoculating 30-50 μl of overnight cultured bacterial liquid into 100mL sterile conical flask containing 50mL of liquid LB culture medium (containing streptomycin, 50 μg/mL), shake culturing at 28deg.C and 220rpm to OD ₆₀₀ =about 0.5;

5) Collecting bacteria: 4000rpm, centrifugation at 4℃for 10min;

6) Removing the supernatant (removing cleanly as much as possible), adding 50mL of pre-cooled 10% glycerol to re-suspend the thalli, and carrying out ice bath for 30min;

7) After the ice bath is finished, the mixture is centrifuged at 4000rpm and 4 ℃ for 10min;

8) Rinsing: removing supernatant, adding 30mL 10% glycerol to re-suspend K599 thallus, centrifuging at 4000rpm at 4deg.C for 10min, and repeating the steps for 3 times;

9) And (5) subpackaging: after rinsing, adding 3-5mL of 10% glycerol to re-suspend K599 thalli, sub-packaging the thalli in a sterile 1.5mL centrifuge tube with 50 mu L of each tube, quick freezing with liquid nitrogen, and preserving at-80 ℃ for standby.

1.2 electric shock transformation of Agrobacterium

1) Sterilizing the ultra-clean workbench in advance, taking out the electric shock cup and the cup cap from the ethanol solution in the ultra-clean workbench, and placing the electric shock cup and the cup cap on paper in an inverted manner to enable the electric shock cup to be naturally dried;

2) Inserting the completely dried electric shock cup into ice for precooling, taking out K599 agrobacterium competent, melting on ice, adding 2 μl plasmid, and mixing;

3) Adding competent cells into precooled electric shock cup, and placing on ice for 30min;

4) Inserting the electric shock cup into an electric shock conversion instrument to perform electric shock, adding 700 mu L of antibiotic-free LB culture solution into an ultra-clean workbench, sucking and beating uniformly, and sucking out bacterial solution by using a pipetting gun;

5) Placing the bacterial liquid into a 1.5mL sterile centrifuge tube, and culturing for 2-3h at 28 ℃ and 220 rpm;

6) Centrifuging at 12000rpm for 30s, pouring out the supernatant on an ultra-clean workbench, repeatedly sucking and beating the gun heads, uniformly coating bacterial liquid on LB solid medium added with corresponding antibiotics by using the sterilized gun heads, slightly airing, inversely culturing at 28 ℃ for 2 days, picking bacterial plaques by using toothpicks, placing in LB liquid medium containing antibiotics of kanamycin and streptomycin, and using 0645-T-F: ACATTTAATACGCGATAGAAAAC,0645-T-R3: TGCAAGGCGATTAAGTTGGGTAA primer is identified to obtain K599 recombinant agrobacterium containing Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1 and Gmmtas-dm-2 recombinant plasmids.

2. Hairy root transformation of soybean

1) Selecting clean seeds (soybean Tianlong No. 1) without disease spots, placing the seeds in a square dish with the diameter of 90mm, placing the square dish in a closed container, sterilizing the seeds by using chlorine (100 mL of peanut Bleach+4mL of concentrated hydrochloric acid), taking out the seeds after 16-18h, sterilizing the seeds in advance by using an ultra-clean workbench, and blowing out residual chlorine in the seeds by using the ultra-clean workbench;

2) Placing sterilized soybean seeds on a germination accelerating culture medium, and carrying out illumination culture for about 5 days;

3) 2 days in advance, the K599 recombinant agrobacterium containing the Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1 and Gmmtas-dm-2 recombinant vectors was inoculated into a 50mL sterilized tube containing 25mL of the corresponding antibiotic, respectively, one day before transformation, and cultured overnight at 28℃at 220 rpm;

4) Taking beans with the sprouted, dividing the beans into two pieces by using a surgical knife blade, cutting off a plurality of remaining hypocotyl parts from the position of 3-4mm of hypocotyls, lightly scratching the position of the hypocotyl cotyledon node by using the knife blade under 3-5 mm of depth, and placing the beans in a conical flask with water after cutting;

5) When the concentration of the bacterial liquid reaches OD ₆₀₀ The value is about 0.6 to 0.8, 4000rpm,10min, the supernatant is removed in an ultra-clean workbench, the supernatant is removed as much as possible, and a proper amount of co-cultivation conversion solution is added to resuspend the bacterial solution;

6) Placing the cut soybean cotyledon into an invasion dye solution, infecting for about 20-30min, and slightly shaking for several times during the period;

7) Placing sterilized filter paper on a 90mm dish and a co-culture medium, placing the infected soybean cotyledon on the filter paper to suck dry the invasion solution, placing the invasion solution on a solid co-culture medium, and culturing in the dark for three days;

8) Cutting off the bean embryo and redundant hypocotyl after three days of co-cultivation, reserving the hypocotyl for 3-4mm, placing in an conical flask with induced liquid, washing for 4-5 times, placing on an empty culture dish containing filter paper, and sucking water;

9) The cotyledon is downwards inserted into an induction culture medium, a cotyledon incision is positioned above the culture medium and is cultured for about 2 weeks, hairy roots are seen to appear, a single hairy root is taken and cut, at least three times of the hairy root are repeated, DNA is extracted, and the editing efficiency of different gRNA target sites is detected by using corresponding primers (see a primer list). The genome sequence of the GmMTAa gene in the soybean Tianlong No.1 is the nucleotide sequence shown in SEQ ID NO.11, and the genome sequence of the GmMTAb gene in the soybean Tianlong No.1 is the nucleotide sequence shown in SEQ ID NO. 12.

Sequencing results showed: the bases at all the gRNA target sites are bimodal, which indicates that the six CRISPR-Cas9 recombinant vectors Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1 and Gmmtas-dm-2 can effectively edit ten target sites and can be used for genetic transformation of soybeans.

3. Transformation of soybean cotyledonary node

Six CRISPR-Cas9 recombinant vector plasmids and PTF-GmMTaa-GFP/PTF-GmMTAb-GFP which have been verified in the step 2 are transferred into EH105 agrobacterium competence, and are identified by detection primers 0645-T-F/R and PTF101-F1/R respectively, positive colonies are used for soybean genetic transformation, and the positive colonies are preserved at the temperature of minus 80 ℃.

3.1 preparation of electric conversion EH105 Agrobacterium competence and electric shock conversion of Agrobacterium

Specific steps for preparing the electrotransformation EH105 agrobacterium competence and transforming the agrobacterium by electric shock are detailed in the preparation and transformation part of the K599 agrobacterium competence. Finally, EH105 recombinant agrobacterium containing Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1, gmmtas-dm-2, PTF101-Gmmtaa-GFP and PTF101-Gmmtab-GFP recombinant vectors is obtained

3.2 infection of cotyledonary node of soybean with Agrobacterium

1) 10mL test tube shake EH105 recombinant Agrobacterium containing Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1, gmmtas-dm-2, gmmtaa-GFP and Gmmtab-GFP recombinant vector overnight;

2) Sterilizing soybean seeds with no disease spots and good growth vigor for 16-18h in a sealed container by 100mL of pollen bleaching water (Bleach) +4mL of concentrated hydrochloric acid, placing the soybeans in a sterilized super clean bench for about 30min, and blowing off residual chlorine;

3) Co-culture solid/liquid medium, water, filter paper and conical flask were prepared and sterilized at 121 ℃ for 20min. Sterilized water is used for soaking beans (about 10 o' clock in the evening, beans are not suitable for too long). Simultaneously, using a conical flask to shake and recombine 100mL of EH105 agrobacterium for infection;

4) Cutting soybean radicle at 3-4mm, dividing into two leaves along the middle of two cotyledons, removing seed coats, lightly scratching the cotyledon node for 5-7 times, and placing the soybean radicle in an conical flask for standby;

5) Agrobacterium till OD ₆₀₀ When the bacterial liquid is=0.5-0.7, centrifuging at 4000rpm for 10min, collecting bacterial liquid, removing supernatant, adding a proper amount of co-culture liquid culture medium, and uniformly mixing by vortex to ensure that the bacterial liquid OD600 is=0.6;

6) Removing water in the conical flask, and infecting the conical flask for about 30min by using bacterial liquid prepared by adding co-culture liquid culture medium, and increasing the contact times of agrobacterium and wounds at cotyledonary nodes;

7) Pouring out the co-cultivation bacterial liquid after infection is finished, placing soybean cotyledon on sterile filter paper, sucking the residual bacterial liquid to dryness, placing the soybean cotyledon on a layer of co-cultivation solid culture medium of the sterile filter paper, and carrying out dark cultivation in an incubator for 3 days;

8) After the dark culture is finished, placing the culture in an illumination incubator for illumination for morning, cutting off the elongated embryo at the position of 3-5mm of cotyledonary node, fully cleaning the embryo for 4-5 times by using a sugar-free induction culture medium containing antibiotics, cleaning the embryo once every ten minutes, and continuously and gently shaking the embryo during the cleaning period to fully clean the embryo;

9) Placing the cleaned soybean cotyledon on sterilized filter paper, absorbing water, obliquely inserting the cotyledon node downwards into an induction culture medium, and performing tissue culture for 10 days;

10 Cutting off large buds growing out of cotyledonary nodes, reinserting the large buds into an induction culture medium after cutting a new wound at the lower part of the cotyledonary nodes, and growing cluster buds after 3 times of subculture of the induction culture medium;

11 Removing black tissue and most cotyledons from soybean cotyledons with cluster buds, inserting the cluster buds into an elongation culture medium, and carrying out secondary culture on the elongation culture medium for 3-4 times;

12 During elongation, the cluster buds are inserted into a root extending culture medium when the cluster buds are elongated to 3-5cm, roots can grow after illumination culture for 2 weeks, the roots are moved into soil when the roots are luxuriant, and seedlings are trained for 7-10 days to obtain T ₀ And replacing transgenic positive seedlings.

Example 4 identification of transgenic Positive lines

To determine transgenic positive plants, the T obtained in example 3 was first of all used ₀ Basta detection was performed on leaves of individual plants of the transgenic lines, and if the leaves yellow wilt, they were false positive transgenic plants, DNA was extracted from the anti-basta plants, and PCR detection was performed with the primers of step 2 of example 3.

Sequencing results showed (A in FIG. 1 and A in FIG. 2), T ₀ The plants subjected to gene editing in the transgenic soybean plants are 7 plants. Wherein Gmmas-dm-2 and Gmmas-dm-3 are the same target site and different editing types. Will T ₀ The plants edited by the generation genes are respectively selfed for 2 generations to obtain T ₂ And (5) generating a plant subjected to gene editing. Then T was detected according to the PCR method described above ₂ Mutation type of the genetically edited plant. A total of 7 homozygous mutants were obtained: gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1, gmmtas-dm-2, gmmtas-dm-3. Gmmmas-dm-4 was obtained by hybridization of Gmmtaa-1 and Gmmtab-2.

Compared with the wild type, the GmMTa-1 has the following mutation on GmMTaa genes in 2 homologous chromosomes: "5'-ATGGAGACACAATCAGATGGTAATG-3'" (corresponding to positions 1-25 of SEQ ID No.1, positions 822-846 of SEQ ID No. 11) in the GmMTaa gene is mutated to "5'-ATGGAGACACAATCAGATGGTATG-3'". The mutation causes the deletion of the 23 rd nucleotide A of the sequence 1 in the sequence table, the deletion of the nucleotide causes frame shift, leading to premature termination of translation and causing the deletion of GmMTAa protein function, thereby knocking out GmMTAa gene, and the sequencing result of the mutation site and the peripheral nucleotide is shown in the A in the figure 1.

Compared with the wild type, the GmMTa-2 has the following mutation on GmMTaa genes in 2 homologous chromosomes: "5'-AGGAACTTGGAGGGGATTCG-3'" (corresponding to positions 530-549 of SEQ ID No.1 and positions 1351-1370 of SEQ ID No. 11) in the GmMTAa gene is mutated to "5'-AGGAACTTGGAGGGGATCG-3'". The mutation causes the nucleotide 'T' at 547 th position of the sequence 1 in the sequence table to be deleted, the deletion of the nucleotide causes frame shift, translation is stopped in advance, and the GmMTAa protein is caused to have a function deletion, so that the GmMTAa gene is knocked out, and the sequencing result of the mutation site and the peripheral nucleotide is shown in the A in the figure 1.

Compared with the wild type, the GmMTAb gene of Gmmtb-1 has the following mutations in 2 homologous chromosomes: "5'-GGATGGGAAGGCCAGTTCTG-3'" (corresponding to positions 806-825 of SEQ ID No.2 and 2574-2593 of SEQ ID No. 12) in the GmMTAb gene is mutated to "5'-GGATGGGAAGGCCAGCTG-3'". The "5'-AAGGGGAGCACCCAGACTAATGGGCATGATGGGGGC-3'" in the GmMTAb gene (corresponding to positions 903-938 of SEQ ID No.2 and positions 2671-2706 of SEQ ID No. 12) was mutated to "5'-AAGGGGGGC-3'". The mutation causes deletion of 821-822 th nucleotide TT and 909-935 th nucleotide AGCACCCAGACTAATGGGCATGATGGG of sequence 2 in a sequence table, the deletion of the nucleotides causes frame shift, translation is stopped in advance, and GmMTAb protein function is lost, so that GmMTAb genes are knocked out, and the sequencing result of the mutation site and surrounding nucleotides is shown in a figure 1A.

Compared with the wild type, the GmMTAb gene of Gmmtb-2 has the following mutations in 2 homologous chromosomes: "5'-CCCATGGAGACCCCCATATGTCA-3'" in the GmMTAb gene (corresponding to positions 851-873 of SEQ ID No.2 and positions 2619-2641 of SEQ ID No. 12) is mutated to "5'-CCCATGAGACCCCCATATGTCA-3'"; "5'-CCATTGGGGCCTAATGCACCAGG-3'" (corresponding to positions 976-998 of SEQ ID No.2 and positions 2744-2766 of SEQ ID No. 12) in the GmMTAb gene is mutated to "5'-CCATTGGGGCCTAACCAGG-3'". The mutation causes the deletion of nucleotide G at 857 position and the deletion of four nucleotides TGCA at 990-993 position in sequence 2 in a sequence table, the deletion of the nucleotides causes frame shift, leading to premature termination of translation and the deletion of GmMTAb protein functions, so that the GmMTAb gene is knocked out, and the sequencing result of the mutation site and the peripheral nucleotides is shown in the A in figure 1.

Compared with the wild type, the GmMTaa gene of Gmmtas-dm-1 has the following mutations in the GmMTaa genes in 2 homologous chromosomes: "5'-CCCCCATATGTCAGCATTGCAGC-3'" (corresponding to positions 861-883 of SEQ ID No.1 and positions 1682-1704 of SEQ ID No. 11) in the GmMTAa gene is mutated to "5'-CCCCCATGTCAGCATTGCAGC-3'". The mutation causes the deletion of nucleotide (AT) AT 868-869 in sequence 1 in the sequence table, the deletion of the nucleotide causes frame shift, leading to premature termination of translation and causing deletion of GmMTAa protein function, so that GmMTAa gene is knocked out, and the sequencing result of the mutation site and the peripheral nucleotide is shown in figure 2. For the GmMTAb gene, the following mutations were made in the GmMTAb gene in all 2 homologous chromosomes: the "5'-GATGGGAATGCAAATCAAAATCAAGTTCAGCAAATCACTCATAGTGGTCCTAATGTGAATGGTAGTTTGCTTGGGATGGGAAGGCCAGTTCTGAGGCCAATGTCTGATATGTGGATACCCCATGGAGACCCCCAT-3'" in the GmMTAb gene (corresponding to positions 733-867 of SEQ ID No.2 and 2501-2635 of SEQ ID No. 12) is deleted, the deletion of the nucleotide leads to the deletion of a large fragment of GmMTAb protein, the functional part of GmMTAb protein is deleted, and the sequencing result of the mutation site and the peripheral nucleotide is shown in FIG. 2A.

Compared with the wild type, the GmMTas-dm-2 has the following mutation on GmMTaa genes in 2 homologous chromosomes: "5'-CCAATGTTTTCAGGAGGACCAAG-3'" in the GmMTaa gene (corresponding to positions 883-905 of SEQ ID No.1 and positions 1704-1726 of SEQ ID No. 11) is mutated to "5'-CCAATGTTTTTCAGGAGGACCAAG-3'". "5'-CCTTCAATGCATAGACTCCCATT-3' (corresponding to positions 961-983 of SEQ ID No.1, positions 1782-1804 of SEQ ID No. 11) in the GmMTAa gene is mutated to" 5'-CCTTCATGCATAGACTCCCATT-3' ". The mutation causes the addition of the 893 th nucleotide and the deletion of the 967 th nucleotide in the sequence 1 in the sequence table, the addition and the deletion of the nucleotides cause frame shift, the translation is stopped in advance, and the GmMTAa protein is caused to have the function missing, so that the GmMTAa gene is knocked out, and the sequencing result of the mutation site and the peripheral nucleotides is shown in figure 2. For the GmMTAb gene, the following mutations were made in the GmMTAb gene in all 2 homologous chromosomes: the "5'-TTTTCAGGAGGACCAAGGGGAGCACCCAGACTAATGGGCATGATGGGGGCACATAGAGGTATAAGTATTCCTTCA-3'" in the GmMTAb gene (corresponding to 889-963 of SEQ ID No.2 and 2657-2730 of SEQ ID No. 12) is deleted, the deletion of the nucleotide results in deletion of a large fragment of GmMTAb protein, resulting in deletion of a functional part of GmMTAb protein, and the sequencing result of the mutation site and the peripheral nucleotide is shown in FIG. 2A.

Compared with the wild type, the GmMTas-dm-3 has the following mutation on GmMTaa genes in 2 homologous chromosomes: "5'-CCAATGTTTTCAGGAGGACCAAG-3'" in the GmMTaa gene (corresponding to positions 883-905 of SEQ ID No.1 and positions 1704-1726 of SEQ ID No. 11) is mutated to "5'-CCAATGTCAGGAGGACCAAG-3'". The "5 '-CCTTCAATGCATAGACTCCCATT" ("3'" (corresponding to positions 1782-1804 of SEQ ID No.11, positions 961-983 of SEQ ID No. 1) in the GmMTaa gene was mutated to "5'-CCTTCAGCATAGACTCCCATT-3'"). The mutation causes the nucleotide 'TTT' AT 890-892 and the nucleotide 'AT' AT 967-968 of the sequence 1 in the sequence table to be deleted, the deletion of the nucleotide causes translation to be stopped in advance, and the GmMTAa protein is caused to have function deletion, so that the GmMTAa gene is knocked out, and the sequencing result of the mutation site and the peripheral nucleotide is shown in figure 2. For the GmMTAb gene, the following mutations were made in the GmMTAb gene in all 2 homologous chromosomes: the "5'-TTTTCAGGAGGACCAAGGGGAGCACCCAGACTAATGGGCATGATGGGGGCACATAGAGGTATAAGTATTCCTTCA-3'" in the GmMTAb gene (corresponding to 889-963 of SEQ ID No.2 and 2657-2730 of SEQ ID No. 12) is deleted, the deletion of the nucleotide leads to deletion of a large fragment of GmMTAb protein, so that the GmMTAb protein is partially deleted in function, and the sequencing result of the mutation site and the peripheral nucleotide is shown in FIG. 2A.

Gmmas-dm-4 is hybridized by Gmmtaa-1 and Gmmtab-2 plants, the Gmmtaa gene mutation is the same as that of the Gmmtaa-1 plant, the Gmmtab gene mutation is the same as that of the Gmmtab-2 plant, and the sequencing result of the mutation site and the peripheral nucleotide is shown in figure 2A.

The gene structure diagrams of the above Gmmtaa-1, gmmtaa-2, gmmtab-1 and Gmmtab-2 mutants are shown in FIG. 1A, and the protein domain is shown in FIG. 1B. The gene structure diagrams of the Gmmmas-dm-1, gmmas-dm-2, gmmas-dm-3 and Gmmas-dm-4 mutants are shown in FIG. 2A, and the protein domains are shown in FIG. 2B.

To determine GmMTAa and GmMTAb over-expression positive plants, T for example 3 ₀ Basta detection is carried out on leaves of single plants of the generation transgenic plant line, if the leaves turn yellow and wither, the leaves are false positive transgenic plants, and eggs are extracted from plants resisting bastaWhite, western blot detection was performed, and the detection results are shown in fig. 5B. The result shows that: compared with the wild type, the GmMTAa has higher expression in the over-expression plants GmMTAa-GFP-1 and GmMTAa-GFP-2; the GmMTAb has higher expression in the over-expression plants GmMTAb-GFP-1 and GmMTAb-GFP-2.

Example 5, gmMTAs Gene knockout mutant plants and characterization of the phenotype of overexpressed plants

8 homozygous mutant single plant seeds of the GmMTAs gene obtained in example 4 and wild soybean variety Tianlong No. 1 (WT) seeds are planted in a Beijing artificial natural long-day greenhouse, the lengths of the epicotyl and the hypocotyl are observed and counted at 10 days, and the experiment of the statistical material is repeated 3 times, and more than 3 plants are measured for each strain.

Through phenotypic observation, the results are shown as C and D in FIG. 1, and C and D in FIG. 2, and the hypocotyls of Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1, gmmtas-dm-2, gmmtas-dm-3, and Gmmtas-dm-4 are significantly reduced compared with the wild type; and the epicotyls of Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1 and Gmmtas-dm-4 are also significantly reduced.

8 homozygous mutant individual seeds of the GmMTAs gene obtained in example 4 and wild soybean variety Tianlong No. 1 (WT) seeds are summer sown in Beijing (40 DEG 13 '28' N,116 DEG 33 '37' E), and plant heights, node numbers, effective branches, individual plant weights, individual plant numbers and hundred grain weights are observed and counted. The experiment with the statistical material was repeated 3 times, and 6 or more strains were measured for each strain.

The results are shown in FIG. 3A and B, and in FIG. 4A and B, the plant heights of Gmmtaa-1, gmmtaa-2, gmmtab-1, gmmtab-2, gmmtas-dm-1, gmmtas-dm-2 and Gmmtas-dm-3 have a significant reduction tendency, and the main stem number, the effective branching, the individual plant weight, the individual plant number and the hundred plant weight are not reduced compared with the wild type. Therefore, the deletion of the GmMTAs protein can lead to the reduction of plant height, and particularly, the phenotype of the GmMTAs double mutant is more obvious, so that the GmMTAs double mutant has good breeding potential for planting under close planting conditions.

GmMTAa and GmMTAb overexpressing plants GmMTAa-GFP-1, gmMTAa-GFP-2, gmMTAb-GFP-1, gmMTAb-GFP-2 and wild soybean variety Tianlong No. 1 (abbreviated as WT) seeds obtained in example 4 were planted in Beijing artificial long-day greenhouse, and epicotyl, hypocotyl and plant height were observed and counted at 15 days. The experiment with the statistical material was repeated 3 times, and 3 or more strains were measured for each strain.

By greenhouse phenotype observations (as A, C and D in fig. 5), the results indicate that: compared with the wild type, the hypocotyl of the GmMTAa and GmMTAb over-expression plants has a tendency of obviously increasing, but the upper hypocotyl and the plant height phenotype of the GmMTAa and GmMTAb over-expression plants are not obvious.

Example 6 identification of shade tolerance of GmMTAs double mutant plants

The soybeans are very sensitive to changes in light environment, and the main two factors causing the soybeans to generate shade-avoidance reaction in the field are reduced R: FR ratio and low blue light. We therefore simulated the effect of low R: FR conditions and low blue conditions on soybean under laboratory conditions by supplementing far-red light into white light and using yellow filters, respectively. The experiment was divided into three lighting conditions, WL (white light, effective photosynthetic radiation (PAR) par=500 μmol m ^-2 sec ^-1 ，R：FR＝8.26,Blue＝94.57μmol m ^-2 sec ^-1 ) LBL (hold par=500 μmol m ^-2 sec ^-1 Unchanged, R: fr=7.98, blue light intensity was reduced to 18.99 μm using a yellow filter ^-2 sec ^-1 ) And wl+fr (keeping par=500 μm ^-2 sec ^-1 Unchanged, by supplementing far-red light, the value of R: FR was reduced to 0.19, blue= 86.85. Mu. Mol m ^-2 sec ^-1 ). The lighting conditions are shown in fig. 6 a.

The plants Gmmas-dm-3 and Gmmas-dm-4 in example 4 were grown under long-day white light for 10 days to fully extend soybean seedling single leaves and fully perform photomorphogenesis. Soybean seedlings were then treated at WL, LBL and wl+fr for 10 days, respectively, and the main stem heights and fold differences were counted.

Results from phenotypic observations in the greenhouse (as B, C and D in FIG. 6) show that under WL, LBL and WL+FR conditions, the plant heights of both Gmmmas-dm-3 and Gmmmas-dm-4 were significantly lower than the wild type; under LBL conditions, the fold difference between the changes of Gmmas-dm-3 and Gmmas-dm-4 was lower than that of the wild type; under wl+fr conditions, the fold difference of Gmmtas-dm-3 was significantly lower than that of the wild type, and the fold difference of Gmmtas-dm-4 variation was comparable to that of the wild type, probably due to the fact that the Gmmtas-dm-4 plants were too low under white light. Therefore, the GmMTAs double mutant plant has good shade tolerance and has the potential of close planting in the field.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains.

Claims

1. A method for reducing soybean plant height comprising reducing plant height by knocking out a gene encoding a protein in the soybean genome;

the protein is protein A and/or protein B, wherein the protein A is a protein with an amino acid sequence of SEQ ID No.3, and the protein B is a protein with an amino acid sequence of SEQ ID No. 4;

m1) replacing positions 1-25 (corresponding to positions 822-846 of SEQ ID No. 11) of the gene encoding said protein A in soybean genomic DNA with a DNA molecule having a nucleotide sequence of the sequence 5'-ATGGAGACACAATCAGATGGTATG 3';

m2) replacing the 530 th to 549 th positions (corresponding to the 1351 th to 1370 th positions of SEQ ID No. 11) of SEQ ID No.1 in the gene encoding said protein A in soybean genomic DNA with a DNA molecule whose nucleotide sequence is the sequence 5 '-AGGAACTTGGAGGGGATCG-3';

M4) replacing positions 851-873 (corresponding to positions 2619-2641 of SEQ ID No. 12) of SEQ ID No.2 in the gene encoding said protein B in soybean genomic DNA with a DNA molecule having the nucleotide sequence of the sequence 5'-CCCATG AGACCCCCATATGTCA-3'; substitution of the nucleotide sequence 5'-CCATTGGGGCCTAACCAGG-3' DNA for SEQ ID No.2 at positions 976-998 (corresponding to positions 2744-2766 of SEQ ID No. 12) in the gene encoding said protein B in soybean genomic DNA;

m8) replacing positions 1-25 (corresponding to positions 822-846 of SEQ ID No. 11) of the gene encoding said protein a in soybean genomic DNA with a DNA molecule having a nucleotide sequence of the sequence 5'-ATGGAGACACAATCAGATGGTATG 3'; replacing positions 851-873 (corresponding to positions 2619-2641 of SEQ ID No. 12) of SEQ ID No.2 in the gene encoding said protein B in soybean genomic DNA with a DNA molecule whose nucleotide sequence is the sequence 5'-CCCATG AGACCCCCATATGTCA-3'; substitution of the nucleotide sequence 5'-CCATTGGGGCCTAACCAGG-3' molecular DNA for SEQ ID No.2 at positions 976-998 (corresponding to positions 2744-2766 of SEQ ID No. 12) in the gene encoding protein B in soybean genomic DNA.

2. Use of a protein or an expression substance of a regulatory gene or a substance regulating the activity or content of said protein in any of the following:

5) Use of a protein or an expression substance of a regulatory gene or a substance regulating the activity or content of said protein in plant breeding;

3. The use according to claim 2, characterized in that: a substance for regulating the expression of a gene or a substance for regulating the activity or content of the protein is a biological material related to the protein according to claim 1 or 2, the biological material being any of the following:

c1 A nucleic acid molecule encoding the protein A) or B) of claim 1;

c2 An expression cassette comprising c 1) said nucleic acid molecule;

e1 A nucleic acid molecule which inhibits or reduces or silences the expression of a gene encoding a protein A) or B) according to claim 1 or 2;

e2 An expression cassette comprising e 1) said nucleic acid molecule;

4. A use according to claim 3, characterized in that: c1 The nucleic acid molecule is a DNA molecule as shown in any one of,

d1 A DNA molecule with a nucleotide sequence shown as SEQ ID NO. 1;

f1 A DNA molecule with a nucleotide sequence shown as SEQ ID NO. 2;

f2 The coding region sequence is a DNA molecule shown as SEQ ID NO.2 in a sequence table.

5. A method for increasing plant height, comprising: the method comprises a step M, wherein the step M is used for enhancing, increasing or up-regulating the activity and/or content of the protein in the claim 1 or 2 in a target plant, or/and enhancing, increasing or up-regulating the expression level of the gene encoding the protein in the claim 1 or 2 so as to increase the plant height.

6. A method of reducing plant height, comprising: the method comprises a step P, wherein the step P is used for inhibiting or reducing or silencing the activity and/or content of the protein in the claim 1 or 2 in a target plant, or/and inhibiting or reducing or silencing the expression level of the gene encoding the protein in the claim 1 or 2, so as to reduce the plant height.

7. A method of breeding plants of reduced plant height, characterized by: comprising inhibiting or reducing or silencing the expression level of a gene encoding a protein as claimed in claim 1 or 2 in a plant of interest and/or the activity and/or content of said protein yielding a plant of reduced plant height which plant has a plant height which is lower than that of said recipient plant.

8. The method according to claim 7, wherein: the method comprises the following steps:

(1) Constructing a recombinant expression vector which inhibits or reduces or silences a gene encoding the protein of claim 1 or 2;

9. A protein as claimed in claim 1 or 2 and/or a biomaterial as claimed in claim 3 or 4.

10. The use according to any one of claims 1-4, the method according to any one of claims 5-8, characterized in that: the plant is any one of the following:

n1) dicotyledonous plants

N2) plants of the order fabaceae;

n3) leguminous plants;

n4) plants of the genus glycine;

n5) soybean.