CN114591984B

CN114591984B - Application of OsAP79 gene in inducing rice to resist brown planthoppers

Info

Publication number: CN114591984B
Application number: CN202210341609.XA
Authority: CN
Inventors: 邱永福; 李晶莹; 曹振宇
Original assignee: Guangxi University
Current assignee: Guangxi University
Priority date: 2022-03-29
Filing date: 2022-03-29
Publication date: 2023-09-19
Anticipated expiration: 2042-03-29
Also published as: CN114591984A

Abstract

The application belongs to the technical field of biology, and relates to application of a rice OsAP79 gene to induction of rice brown planthopper resistance. According to the application, a CaMV35S promoter is added at the upstream of the OsAP79 gene, and an OE super-expression vector is constructed to transform the pest-sensing rice variety, so that the OsAP79 gene is transcribed and translated in a large quantity, the over-expression of a gene product is realized, and the resistance of the rice to brown planthoppers is enhanced. It was demonstrated that OsAP79 can be transferred into plants by adding this fragment to the CaMV35S promoter, and that the resistance of transgenic plants to brown planthoppers is significantly enhanced.

Description

Application of OsAP79 gene in inducing rice to resist brown planthoppers

[ field of technology ]

The application relates to the technical field of biology, in particular to application of OsAP79 gene to induction of brown planthopper resistance of rice.

[ background Art ]

The rice insect pest causes huge yield loss every year, and brown planthoppers are one of the most serious insect pests for rice production. The discovery of the brown planthopper resistance gene and related insect resistance mechanisms of rice is by far the most economical and effective measure for controlling the insect pest.

Brown planthoppers belong to the family Homoptera of the family Delphacidae (Homoptera: delphacidae) and are typical piercing and sucking insect types in rice. It uses its mouth organ to directly pierce the phloem of vascular bundle of rice plant and suck juice. At the same time, it is also of the host-specific insect type. When brown planthoppers directly harm rice in a seedling stage, the brown planthoppers can cause a great amount of nutrients in plants to be lost, so that leaves turn yellow, the plants grow slowly and are short, and finally the plants possibly die and other characters are possibly caused. If brown planthoppers harm the rice in the booting stage or the heading stage, the leaves of the plant become yellow and withered until the plant lodging phenomenon occurs, and the plant hopper burning ('hopterburn') phenomenon can also appear in the field when the damage is serious. In recent years, along with the development of molecular markers and the construction of a high-density linkage map of rice, a plurality of main genes for resisting brown planthopper of rice are respectively positioned on the 2 nd, 3 rd, 4 th, 6 th, 11 th and 12 th chromosomes of the rice, and a plurality of main genes for resisting brown planthopper of the rice are cloned. In addition, researchers have also discovered a number of genes related to brown planthopper resistance and studied their functions initially.

Aspartic Proteases (APs) are very important subfamily members of the four large family of proteolytic enzymes, involved in metabolism and biological regulation in the body. APs are ubiquitous in animal and plant cells and are expressed in different organs of plants, such as seeds, stems, leaves, flowers, and the like. In recent years, more and more isolated plant aspartic proteases have been investigated for their function by in vivo experiments. Currently 69 and 96 APs genes are found in the model plant arabidopsis and rice genomes, respectively. APs in plants are mainly involved in the processes of precursor protein processing, protein degradation, apoptosis and the like, and are also involved in the processes of plant disease resistance, stress resistance, leaf senescence and the like. As early as the 90 s of the 20 th century, rodrigo et al isolated extracellular-localized APs in tobacco and tomato leaves, which were associated with the degradation of proteins associated with the course of the disease. Some rice AP genes are also involved in biotic stress responses. The expression level of the OsCDR1 is obviously up-regulated after the rice is treated by plant disease resistance inducer salicylic acid and Benzothiadiazole (BTH), which shows that the OsCDR1 can be related to rice disease resistance. To study the function of the OsAP77 gene, rice plants were subjected to various treatments. It is found that OsAP77 expression in rice vascular tissue is obviously enhanced after infection by bacteria, fungi, viruses and the like. Although there are many studies showing that the AP gene is involved in various biological functions, there have been no reports of studies on the involvement of this family gene in insect-resistant functions in plants.

[ application ]

In view of the development of the research, the application of OsAP79 gene in inducing rice to resist brown planthoppers is necessary, and the research can illustrate the role of OsAP79 in resisting brown planthoppers of rice, so that a theoretical basis is provided for rice resistance breeding by utilizing the OsAP79 gene.

In order to achieve the above purpose, the technical scheme adopted by the application is as follows:

the application of the OsAP79 gene in inducing the resistance of brown planthoppers of rice is provided, and the nucleotide sequence of the OsAP79 gene is shown as SEQ ID NO. 1.

Furthermore, the protein sequence of the OsAP79 gene is shown as SEQ ID NO. 2.

Further, the rice is Fuling summer orange.

The application also comprises application of the over-expression OsAP79 gene in improving the resistance of brown planthoppers of rice, and the over-expression vector contains the nucleic acid sequence.

The application also comprises a method for constructing an overexpression OsAP79 gene vector, which comprises the following specific steps:

(1) Designing gene specific primers SEQ ID NO.3 and SEQ ID NO.4 according to the OsAP79 gene coding region, cloning the complete CDS region of the OsAP79 gene, and recovering and purifying PCR amplification products;

(2) Cloning the amplified product of the step (1) into escherichia coli with the vector name pCAMBIA1301A controlled by a CaMV35S promoter, and extracting plasmids after detection and sequencing to obtain the vector for over-expressing the OsAP79 gene.

The application also comprises a research on inducing the resistance of brown planthoppers by using the overexpression OsAP79 gene, and the method comprises the following steps:

(1) Transforming the agrobacterium competent cell EHA105 with the constructed overexpression vector of claim 4 by a chemical transformation method;

(2) Infecting rice plants with the agrobacterium containing the target plasmid obtained in the step (1).

The application also comprises a rice breeding method for obtaining brown planthopper resistance, which comprises the following steps: constructing an over-expression vector of the rice OsAP79 gene, and transferring the OsAP79 gene into a genome of the rice by an agrobacterium-mediated method to obtain a transgenic plant with brown planthopper resistance.

The application has the following beneficial effects:

the application analyzes transcriptome analysis of the resistance and susceptibility materials before and after feeding of brown planthoppers, the gene Os10g39300 is obviously up-regulated in insect-resistant varieties, and the OsAP79 gene is obtained by combining PCR (polymerase chain reaction) technology separation; performing transcriptome analysis on the expression of endogenous Os10g39300 of the plant by using 9311 susceptible plants and RBPH16 resistant plants after the brown planthopper insect grafting treatment, and determining the induction of the expression of Os10g39300 after the brown planthopper infection; the biological function of the OsAP79 gene is verified by using a transgenic technology, and the OsAP79 gene is found to play an important role in the resistance of rice to brown planthoppers.

[ description of the drawings ]

Fig. 1: the rice genetic transformation plasmid T-DNA frame structure containing the OsAP79 gene is shown in the schematic diagram;

fig. 2: expression of OsAP79 gene of over-expressed transgenic T0 plant with Japanese sunny (NIP) as background;

fig. 3: comparison of the results of T2 family and NiP (Nip) seedling stage brown planthopper resistance after OsAP79 gene overexpression and knockout; in the graph, A is the initial state of the rice seedling stage inoculated brown planthopper, B is the growth state of the plant after the rice seedling stage inoculated brown planthopper, and C is the result graph of the expression condition of OsAP79 genes of different family plants; the diagrams A-C are from left to right in sequence: a disease-causing plant (NIP), two overexpressing OsAP79 gene family plants, and two knockout OsAP79 gene family plants;

fig. 4: the initial state of rice seed inoculation brown planthoppers; 3 seedlings in the pot are sequentially from left to right: overexpressing OsAP79 gene family plants (OE), susceptible varieties (NIP), knocking out OsAP79 gene family plants;

fig. 5: the adult stage state of the rice after being inoculated with brown planthoppers; 3 seedlings in the pot are sequentially from left to right: overexpressing OsAP79 gene family plants (OE), susceptible varieties (NIP), knocking out OsAP79 gene family plants;

fig. 6: an OsAP79 gene expression condition result graph of plants of different families; the method comprises the following steps in sequence from left to right: the expression of the infected variety (NIP), the expression of the over-expressed OsAP79 gene of 2-3 and the expression of the knocked-out OsAP79 gene of 4-5.

[ detailed description ] of the application

In order that the above objects, features and advantages of the application will be readily understood, a more particular description of the application will be rendered by reference to the appended drawings. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application. The application may be embodied in many other forms than described herein and similarly modified by those skilled in the art without departing from the spirit or scope of the application, which is therefore not limited to the specific embodiments disclosed below.

Example 1:

discovery of plant insect-resistance related genes:

in order to discover the related genes of rice against brown planthoppers, transcriptome analysis is carried out on an insect-resistant variety RBPH16 and an insect-sensitive variety 9311 after 24 hours of insect connection, and as a result, compared with the insect-sensitive variety 9311, the expression quantity of the resistant material RBPH16 is more than 5 times higher than that of the sensitive material 9311 after 24 hours of infection of the brown planthoppers by the Os10g 39300.

Example 2:

construction of cDNA over-expression vector containing OsAP79 coding region:

the application designs a pair of amplification primers of an Os10g39300 gene by taking a corresponding Os10g39300 gene sequence in a Japanese sunny (NIP) genome as a reference. To construct the overexpression structure of OsAP79, full-length cDNA of the successful transcript was obtained from the resistant material. The PCR product was cloned into E.coli under the vector name pCAMBIA1301A controlled by the CaMV35S promoter (FIG. 1). The plasmid is extracted after enzyme digestion detection and sequencing.

The cDNA amplification primer sequences were as follows:

OsAP79-F:5’—ATGGGAAGGCCAGTGGCAA—3’(SEQ ID NO.3)

OsAP79-R:5’—CTAGGAGAGTTTAGTGCAGTCTGC—3’(SEQ ID NO.4)；

2. construction of CRISPR/Cas9 vectors

A binary expression vector pYL-Cas9-gOsAP79 containing two targets is constructed by using a CRISPR/Cas9 system. The information parameters of the plasmids pYLCRISPR/Cas9, the promoters pYLgRNA-OsU6a and pYLgRNA-OsU b used for vector construction are shown in Table 1. The PCR product purification recovery kit, DH5 alpha escherichia coli competent cells and the plasmid extraction kit used in the experiment are purchased from Beijing Bomaide biotechnology Co., ltd, and the operation steps are referred to the kit instruction.

Table 1 carrier information used

Carrier name	Function of	Prokaryotic resistance	Eukaryotic resistance
				pYLCRISPR/Cas9	Gene editing	Karna	HPT
pYLgRNA-OsU6a	Providing U6a templates	Amp	_
				pYLgRNA-OsU6b	Providing U6b templates	Amp	_

The CDS sequence of the OsAP79 is obtained through sequencing and is used as a target sequence, the target primer design website CRISPR-GE is logged in to analyze the sequence, the position, the GC content, the potential off-target position and other information of all candidate targets, and target points meeting the requirements and promoter design expression cassette primers are selected from all the targets. To increase targeting success rate and reduce the risk of unsuccessful editing of single target, we designed 1 target in each of two different CDS regions of OsAP79, target 1 and target 2 were designated as U6a-N1 and U6b-N2, respectively, where U6a-N1 uses U6a promoter, U6b-N2 uses U6b promoter, and the linker primers of U6a-N1 were designated as gRT-N1 and U6a-N1, and the linker primers of U6b-N2 were designated as gRT-N2 and U6b-N2, respectively (Table 2).

TABLE 2 primer used in CRISPR/Cas9 vector construction

And purifying the second PCR product by using a PCR product purification recovery kit to obtain a pure sgRNA expression cassette section, and connecting the sgRNA to a pYLCRISPR/Cas9 vector in a side-by-side cutting mode by adopting a gold-gate connecting method combining restriction enzyme BsaI-HF enzyme cutting and T4 DNA ligase connecting to obtain a complete plasmid U6a-N1+U6b-N2+Cas9 carrying U6a-N1 and U6b-N2, wherein the complete plasmid is named as pYL-Cas9-gOsAP79 vector. Referring to DH5 alpha escherichia coli competent cell transformation instruction, pYL-Cas9-gOsAP79 is transferred into DH5 alpha escherichia coli competent cells, and the transformed escherichia coli is plated on LB solid medium plates containing Kana antibiotics (50 ng/. Mu.L) and cultured at a constant temperature of 37 ℃ for 12 hours. Single colony is picked up, single colony PCR is carried out by using carrier detection primers Sp-L1 and Sp-R, target bands are detected by 1% agarose gel electrophoresis, single colony shaking bacteria carrying positive clones are screened for 12h for propagation, and plasmids are extracted by using a plasmid extraction kit.

3. Agrobacterium-mediated transformation

The OsAP79 gene recombinant vector constructed above and pYL-Cas9-gOsAP79 were introduced into the susceptible variety NIP using Agrobacterium strain EHA105 (purchased from the United states of America, jun.) as a medium.

(1) Culturing recombinant agrobacterium at 8deg.C for 16hr, collecting thallus, and diluting to concentration of OD600 ≡0.5 in N6 liquid culture medium containing 100 μmol/L to obtain bacterial liquid;

(2) Mixing and infecting the mature embryo embryogenic callus of the rice cultivated to one month with the bacterial liquid for 30min, sucking the bacterial liquid by filter paper, transferring into a co-culture medium (N6 solid co-culture medium, purchased by Sigma company), and co-culturing for 3 days at 24 ℃;

(3) The above calli were inoculated on N6 solid screening medium containing 150mg/L hygromycin B (purchased from Sigma Co.) and screened for 16 days for the first time;

(4) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium of 200mg/L hygromycin B for second screening, and carrying out secondary transfer every 15 days;

(5) Selecting resistant callus, and transferring the callus to a differentiation medium containing 150mg/L hygromycin B for differentiation;

(6) The regenerated rice plants differentiated into seedlings are the obtained overexpression of the OsAP79 gene and the CAS-9 transgenic T0 generation plants.

4. Analysis of expression level of over-expressed T0 transgenic plants

And (3) extracting the OsAP79 over-expression transgenic plant with NIP as a background, inverting the transgenic plant into cDNA, and carrying out the expression level analysis of the OsAP79 gene by qRT-PCR by taking the cDNA as a template. The result shows that the expression level of OsAP79 in the transgenic plant is up-regulated by more than 3 times compared with the background parent NIP. The above results indicate that the expression level of the gene in the OsAP79 transgenic plant is significantly increased (FIG. 3).

The qRT-PCR primer sequences were as follows:

OsAP79 RT-F:5’—TGCTTCGAGCAGGACACGCCC—3’

OsAP79 RT-R:5’—TTGCCGGAGCAGTTGCGGCT—3’

5. sequencing of CRISPR/Cas9 transgenic T0 generation plant target sequences

Extraction of the NIP-based pYL-Cas9-gOsAP79 transgenic plant was inverted to cDNA, the pYL-Cas9-gOsAP79 vector was successfully inserted into the plant genome, 19 independent mutants were edited near the PAM (protospacer adjacent motif) region, and the editing efficiency was 90.48%. By comparing the OsAP79 reference sequences of the WT and mutant plants, the genomic editing pattern of the T0 editing strain resulted in homozygous, monoallelic, and biallelic mutations. There were 2 WT plants on the first target, 6 homozygotes, and 15 WT plants on the 2 nd target. The mutant strain has at least one nucleotide deletion, insertion or substitution mutation, resulting in translational shift, early termination of the coding sequence and deletion of amino acid residues. Various types of mutations have deletions and insertions.

The target 1 primer sequence is as follows:

OsAP79 B1-F:

5’—GCATCGCTGGTTGATACTAAACT—3’

OsAP79 B1-R:

5’—CGTGCCGATGGTGAAGTTC—3’

the target 2 primer sequence is as follows:

OsAP79 B2-F:

5’—CCAACTCGAAGGGCTGAAAG—3’

OsAP79 B2-R:

5’—GATTTCGGGAAGCAGAGGTC—3’

6. insect resistance identification of T2 generation transgenic plants

And respectively soaking the T2 generation transgenic material of which the overexpression and knockout of the transgenic OsAP79 to be identified and the insect-susceptible variety NIP into seeds to accelerate germination, and respectively carrying out insect resistance identification in a seedling stage and a adult plant stage.

1. Insect resistance identification in seedling stage

Adopts a brown planthopper resistant phenotype identification method of rice population in seedling stage, namely a seedling stage group method. Sowing in plastic cups with the diameter of 10cm, and ensuring 7-8 seedlings per cup, wherein each part of the seedlings is 3 cups. When the plant grows to the 3-leaf period, weak seedlings and dead seedlings are removed, and 7 heads of each plant are inoculated with brown planthopper nymphs of 2-3 years. And counting the survival rate of the plant when the insect-resistant phenotype difference of the three materials is obvious.

The seedling-stage insect-resistant experiment results show (shown in figure 3) that the survival rate of the over-expressed transgenic materials is over 90 percent, the survival rate of the transgenic knockout materials is under 30 percent, and the average survival rate of the insect-sensing varieties NIP is 45 percent. The expression of the OsAP79 gene can be up-regulated by the result, so that the resistance of brown planthopper can be obviously improved.

2. Adult plant period insect resistance identification

The rice material is transplanted to the field in the seedling stage. According to normal daily management in the field, when the material is heading, carefully digging out the whole plant, transplanting the whole plant into a plastic barrel with the diameter of 20cm, and culturing the whole plant for 7 days under the greenhouse condition. And then covering the plants with transparent gauze to prevent brown planthoppers from escaping, and inoculating 100 brown planthopper adults into each plant seedling to ensure the normal growth and enough moisture of the plants in the barrel. When the three insect-resistant phenotypes are obvious, the gauze is detached, the green stem condition is observed, and the photo is taken. The stem loses green, which indicates that the plant is susceptible to brown planthoppers in the adult plant period, and the stem remains green, which indicates that the plant is resistant to brown planthoppers in the adult plant period. Each material was repeated 3 times.

The plant-period insect-resistance experiment result shows (shown in figure 4) that the green stem rate of the over-expressed transgenic material is over 80 percent, the green stem rate of the transgenic knockout material is 0, and the average green stem rate of the insect-sensing variety NI is 63 percent. The results also show that up-regulating OsAP79 gene expression can obviously improve brown planthopper resistance.

In conclusion, the overexpression of the OsAP79 gene can obviously improve the brown planthopper resistance of rice, and provides theoretical support for constructing brown planthopper resistance-related breeding of rice.

The above examples merely represent a few embodiments of the present application, which are described in more detail and are not to be construed as limiting the scope of the present application. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application. Accordingly, the scope of the application should be assessed as that of the appended claims.

Sequence listing

<110> university of Guangxi

<120> application of OsAP79 gene to induction of brown planthopper resistance of rice

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1185

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgggaaggc cagtggcaac gctgctcgtg ctgtgcttca tctctgtcac ggcgcgcgcc 60

gccgcgttcc gcgtgcacgg ccgcctcctc gccgacgccg cgacggaggg aggcgccgtc 120

gtgcccatcc actggaccca ggcaatgaac tacgtcgcga acttcaccat cggcacgccg 180

ccgcagccgg cgtcggcggt catcgacctc gccggggagc tcgtctggac gcagtgcaag 240

cagtgcagcc gctgcttcga gcaggacacg cccctgttcg acccgaccgc gtcgaacacc 300

taccgggcgg agccgtgcgg caccccgctc tgcgagtcca tcccgagcga cagccgcaac 360

tgctccggca acgtgtgcgc gtaccaggcg tccaccaatg ccggggacac cggcggcaag 420

gtcggcaccg acaccttcgc cgtcgggacg gccaaggcga gcctcgcgtt cgggtgcgtc 480

gtggcgagcg acatcgacac catgggcggg ccttccggga tcgtcgggct agggaggacg 540

ccgtggtcgc tcgtcaccca gacgggcgtc gccgcgttct cctactgcct ggcgccgcac 600

gacgccggga agaacagcgc gctgttcctc ggctcctccg cgaagctcgc cggcggcggc 660

aaggccgcct cgacgccgtt cgtcaacatc tccggcaacg gcaatgacct gagcaactac 720

tacaaggtcc agctcgaagg gctgaaggcc ggcgacgcga tgatcccgct gccgccgagc 780

ggcagcaccg tcctgctcga caccttttcg ccgatcagct tcctcgtcga cggcgcctac 840

caggccgtca agaaggcagt gacggtcgcc gtcggcgcac cgccgatggc gacgccggtg 900

gagccgttcg acctctgctt cccgaaatcg ggggccagcg gcgcggcgcc ggacctcgtg 960

ttcacgttcc ggggcggcgc cgccatgacg gtggcggcgt cgaactacct gctcgactac 1020

aagaacggca cggtgtgcct cgccatgctg agctcggcgc ggctgaactc gacgacggag 1080

ctgagcttgc tgggaagctt gcagcaggag aacatccatt tcctcttcga cctcgacaag 1140

gagacgctct ccttcgagcc tgcagactgc actaaactct cctag 1185

<210> 2

<211> 394

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Met Gly Arg Pro Val Ala Thr Leu Leu Val Leu Cys Phe Ile Ser Val

1 5 10 15

Thr Ala Arg Ala Ala Ala Phe Arg Val His Gly Arg Leu Leu Ala Asp

20 25 30

Ala Ala Thr Glu Gly Gly Ala Val Val Pro Ile His Trp Thr Gln Ala

35 40 45

Met Asn Tyr Val Ala Asn Phe Thr Ile Gly Thr Pro Pro Gln Pro Ala

50 55 60

Ser Ala Val Ile Asp Leu Ala Gly Glu Leu Val Trp Thr Gln Cys Lys

65 70 75 80

Gln Cys Ser Arg Cys Phe Glu Gln Asp Thr Pro Leu Phe Asp Pro Thr

85 90 95

Ala Ser Asn Thr Tyr Arg Ala Glu Pro Cys Gly Thr Pro Leu Cys Glu

100 105 110

Ser Ile Pro Ser Asp Ser Arg Asn Cys Ser Gly Asn Val Cys Ala Tyr

115 120 125

Gln Ala Ser Thr Asn Ala Gly Asp Thr Gly Gly Lys Val Gly Thr Asp

130 135 140

Thr Phe Ala Val Gly Thr Ala Lys Ala Ser Leu Ala Phe Gly Cys Val

145 150 155 160

Val Ala Ser Asp Ile Asp Thr Met Gly Gly Pro Ser Gly Ile Val Gly

165 170 175

Leu Gly Arg Thr Pro Trp Ser Leu Val Thr Gln Thr Gly Val Ala Ala

180 185 190

Phe Ser Tyr Cys Leu Ala Pro His Asp Ala Gly Lys Asn Ser Ala Leu

195 200 205

Phe Leu Gly Ser Ser Ala Lys Leu Ala Gly Gly Gly Lys Ala Ala Ser

210 215 220

Thr Pro Phe Val Asn Ile Ser Gly Asn Gly Asn Asp Leu Ser Asn Tyr

225 230 235 240

Tyr Lys Val Gln Leu Glu Gly Leu Lys Ala Gly Asp Ala Met Ile Pro

245 250 255

Leu Pro Pro Ser Gly Ser Thr Val Leu Leu Asp Thr Phe Ser Pro Ile

260 265 270

Ser Phe Leu Val Asp Gly Ala Tyr Gln Ala Val Lys Lys Ala Val Thr

275 280 285

Val Ala Val Gly Ala Pro Pro Met Ala Thr Pro Val Glu Pro Phe Asp

290 295 300

Leu Cys Phe Pro Lys Ser Gly Ala Ser Gly Ala Ala Pro Asp Leu Val

305 310 315 320

Phe Thr Phe Arg Gly Gly Ala Ala Met Thr Val Ala Ala Ser Asn Tyr

325 330 335

Leu Leu Asp Tyr Lys Asn Gly Thr Val Cys Leu Ala Met Leu Ser Ser

340 345 350

Ala Arg Leu Asn Ser Thr Thr Glu Leu Ser Leu Leu Gly Ser Leu Gln

355 360 365

Gln Glu Asn Ile His Phe Leu Phe Asp Leu Asp Lys Glu Thr Leu Ser

370 375 380

Phe Glu Pro Ala Asp Cys Thr Lys Leu Ser

385 390

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgggaaggc cagtggcaa 19

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ctaggagagt ttagtgcagt ctgc 24

Claims

1.OsAP79The application of gene induction of brown planthopper resistance of rice is characterized in thatOsAP79The nucleotide sequence of the gene is shown as SEQ ID NO. 1.

2. Overexpression ofOsAP79The use of a gene to induce brown planthopper resistance in rice, characterized in that the overexpression vector comprises the nucleotide sequence according to claim 1.

3. Use of the overexpression according to claim 2OsAP79A method for the use of genes effective in inducing brown planthopper resistance in rice, the method comprising the steps of:

(1) Construction of Rice by chemical transformationOsAP79Transformation of Agrobacterium competent cell EHA10 with Gene overexpression vector5；

(2) Infecting the plant of the rice with the agrobacterium of the step (1).

4. A breeding method for obtaining brown planthopper resistant rice, which is characterized by comprising the following steps: construction of RiceOsAP79Gene overexpression vector, method for preparing the same by agrobacterium-mediated methodOsAP79The gene is transferred into a genome of rice to obtain a transgenic plant with brown planthopper resistance; the saidOsAP79The nucleotide sequence of the gene is shown as SEQ ID NO. 1.