CN117265002A - Application of disease-resistant gene NtTBWRG1 in prevention and treatment of tobacco bacterial wilt - Google Patents

Abstract

The invention provides application of a disease-resistant gene NtTBWRG1 in tobacco bacterial wilt prevention and treatment, and belongs to the technical field of genetic engineering. The invention provides application of a disease-resistant gene NtTBWRG1 in prevention and treatment of tobacco bacterial wilt caused by Ralstonia solanacearum, and the coding sequence of the gene is shown as SEQ ID NO: 1. The disease-resistant gene can be effectively used in the cultivation of tobacco bacterial wilt resistant varieties, achieves the aim of obviously enhancing the bacterial wilt resistance of tobacco, achieves the disease resistance level by the bacterial wilt disease index of 20-30 of transgenic plants, and has important application value and good development prospect.

Description

Application of disease-resistant gene NtTBWRG1 in prevention and treatment of tobacco bacterial wilt

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to application of a disease-resistant gene NtTBWRG1 in tobacco bacterial wilt prevention and treatment.

Background

Bacterial wilt of tobacco is a bacterial disease caused by ralstonia solanacearum, is a typical vascular bundle disease, and can occur in roots, stems and leaves. Tobacco bacterial wilt is widely distributed in China, and in recent years, the hazard range of the tobacco bacterial wilt is gradually expanded and spread from south to north in China, and dead tobacco plants in the whole field are caused when serious, so that great economic loss is caused for tobacco production. At present, no effective control method for tobacco bacterial wilt exists, and the development of disease-resistant genes is a fundamental way for solving the harm of bacterial wilt.

At present, bacterial wilt resistance-related genes have been obtained in a plurality of solanaceae crops such as tomatoes, eggplants, potatoes, peppers and the like, and model plants such as arabidopsis thaliana. However, tobacco is one of the most important commercial crops in China, and the development and research work of the bacterial wilt resistance gene is relatively lagged. In recent years, through transcriptome analysis before and after bacterial wilt of tobacco, genes which are subjected to bacterial wilt infection induction expression are discovered, and after the genes are over-expressed in tobacco, bacterial wilt resistance of transgenic tobacco can be enhanced to a certain extent. For example, overexpression of transcription factors NtWRKY50 and NtPR-Q can induce up-regulation of plant hormone SA and JA synthesis related gene expression, and enhance plant resistance to diseases; overexpression of NtPR1a can activate the expression of related defense genes and enhance the bacterial wilt resistance of transgenic plants; overexpression of NtNF 217 can reduce bacterial wilt propagation in transgenic tobacco, etc. However, most of these genes are transcription factors, and their induced bacterial wilt-resistant effects are limited. Therefore, more disease-resistant genes with stronger functions need to be discovered from tobacco, and new gene resources and strategies are provided for breeding bacterial wilt-resistant tobacco varieties, so that the method has important application prospects.

Disclosure of Invention

The invention provides application of a disease-resistant gene NtTBWRG1 in tobacco bacterial wilt prevention and treatment, the disease-resistant gene can be effectively used in cultivation of tobacco bacterial wilt resistant varieties, the purpose of remarkably enhancing bacterial wilt resistance of tobacco is achieved, bacterial wilt disease index of transgenic plants is 20-30, disease resistance level is achieved, and important application value and good development prospect are achieved.

In order to achieve the aim, the invention provides application of a disease-resistant gene NtTBWRG1 in prevention and treatment of tobacco bacterial wilt caused by Ralstonia solanacearum, and the coding sequence of the gene is shown as SEQ ID NO: 1.

The invention provides an application of an over-expressed NtTBWRG1 gene in obviously enhancing bacterial wilt resistance of tobacco, and the coding sequence of the gene is shown as SEQ ID NO: 1.

The invention provides a construction method of a transgenic tobacco plant with bacterial wilt resistance, which comprises the following steps:

constructing an expression vector 35S of an anti-disease gene NtTBWRG1, wherein the expression vector is NtTBWRG1;

the 35S:NtTBWRG1 expression vector is transferred into a tobacco susceptible variety Cubi No. CB-1 by using an agrobacterium strain LBA4404 mediated leaf disc transformation method, and the transgenic tobacco plant with bacterial wilt resistance is obtained through screening by hygromycin screening markers.

Preferably, the expression level of NtTBWRG1 in the transgenic tobacco plant is improved by 1.25-7.22 times compared with that of a non-transgenic control CB-1.

Preferably, the bacterial wilt disease index of the transgenic tobacco plant is 20-30.

The invention provides application of a disease-resistant gene NtTBWRG1 in preparation of a preparation for promoting tobacco plant growth, wherein the coding sequence of the gene is shown in SEQ ID NO: 1.

Preferably, the tobacco plant growth promoting agent is a microbial agent or microbial fertilizer.

Compared with the prior art, the invention has the advantages and positive effects that:

under the background that high-efficiency specific disease resistance genes are absent in the current tobacco bacterial wilt breeding, the invention provides effective disease resistance genes for the functional research and biological breeding of the tobacco bacterial wilt resistance genes, and can be used for cultivating tobacco bacterial wilt resistance varieties, thereby realizing the purpose of remarkably enhancing the bacterial wilt resistance of tobacco, and the bacterial wilt disease index of transgenic plants is 20-30, thereby reaching the disease resistance level. Therefore, the disease-resistant gene has important application value and good development prospect in tobacco biological breeding.

Drawings

FIG. 1 is a schematic diagram of the bands of the PCR products obtained according to the examples of the present invention;

FIG. 2 is a schematic diagram of the construction process of the vector pCAMBIA1300 according to the embodiment of the present invention;

FIG. 3 is a diagram showing the acquisition of transgenic plants provided by an embodiment of the present invention;

FIG. 4 shows the detection of the expression level of the NtTBWRG1 gene in transgenic plants according to the examples of the present invention;

FIG. 5 is a schematic view of disease resistance at seedling stage according to an embodiment of the present invention;

FIG. 6 is a schematic view of a seedling stage disease index according to an embodiment of the present invention;

FIG. 7 is a schematic diagram of adult plant disease resistance provided by an embodiment of the present invention;

FIG. 8 is a schematic diagram of the disease index of the adult plant according to the embodiment of the present invention.

Detailed Description

The following description of the technical solutions in the embodiments of the present invention will be clear and complete, and it is obvious that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1 obtaining of PCR product of disease resistance Gene NtTBWRG1

Extracting RNA of root system of tobacco variety Cuibi No. (CB-1) by using reverse transcription kitOne-Step gDNARemoval and cDNASynthesis SuperMix reverse transcribes RNA into cDNA. Wherein: the reverse transcription reaction system is as follows: 1. Mu.g of total RNA, 1. Mu.L of an anchor Oligo (dT) 18primer, 10. Mu.L of a 2 XS reaction mix,RT/RI Enzyme mix 1μL，gDNA remover 1μL，RNase-free H ₂ o makes up a total volume of 20. Mu.L. The reaction procedure is: 30min at 42 ℃; and 5s at 85 ℃.

The cDNA was used as a template, and the gene coding sequence was amplified using a gene amplification primer using high fidelity enzyme TransStart FastPfu Fly DNA. Wherein: the PCR reaction system is as follows: cDNA 2. Mu.L, forward primer 1. Mu.L, reverse primer 1. Mu.L, 5 XFly buffer 10. Mu.L, dNTP mix 10. Mu.L, pfu Fly 2. Mu.L, ddH ₂ O24. Mu.L, total volume 50. Mu.L. The gene amplification primers are as follows:

NtTBWRG1-F：GGTACCaATGGCTGAAGCAGCAGTTTCC

NtTBWRG1-R：GGTACCTCAATCAGTATTGACATTCGT

the amplification procedure was: 3min at 95 ℃;95℃15s,55℃15s,72℃3min,35 PCR cycles, 72℃10min.

Agarose gel electrophoresis is carried out on the amplified product, and after the electrophoresis is finished, the DNA fragment recovery kit produced by the full gold company is utilizedPCR Purification Kit) recovering the target band, wherein the size of the target band is 2856bp, and the coding sequence of the gene is shown as SEQ ID NO: 1. Specific steps for gel recovery are described in the specification.

Example 2 vector pCAMBIA1300 construction

The recovered target band is connected to a binary vector pCAMBIA1300 vector by an enzyme cutting connection method. The product and the vector were first purified and subjected to cleavage treatment using KpnI restriction enzyme. The enzyme digestion reaction system is as follows: DNA 20. Mu.L, 5 Xbuffer 10. Mu.L, kpnI 5. Mu.L, ddH ₂ O15. Mu.L, total volume 50. Mu.L. The enzyme digestion reaction conditions are as follows: 30min at 37℃and 5s at 85 ℃. After enzyme digestion, the DNA fragment recovery kit produced by the whole golden company is utilizedPCR Purification Kit) recovering the DNA fragments and linearized vector fragments, the gel recovery being described in detail in the description thereof.

The obtained digested gene DNA fragment was ligated with a linearized vector fragment (using T4 DNA ligase from Thermo Fisher Scientific, see the instructions of the company for ligation systems). The ligation reaction was gently mixed and reacted overnight at 16℃and then transformed by adding 5. Mu.L of the constructed vector to 50. Mu.L of competent cells by heat shock transformation. The conversion conditions are as follows: placing on ice for 30min, heat-shocking at 42 deg.C for 30s, placing on ice for 5min, adding 500 μL of liquid LB culture medium, activating thallus at 37 deg.C for 1 hr, and finally uniformly coating on solid LB culture medium containing 50mg/L kanamycin, and culturing at 37 deg.C for 8-10 hr. After single colony is grown, positive clone is identified by adopting a PCR and sequencing method, and the fact that the escherichia coli contains a 35S:NtTBWRG1 expression vector with correct construction is confirmed, wherein the construction process is shown in figure 2.

EXAMPLE 3 transgenic plant acquisition

Agrobacterium LBA4404 has the ability to infect plants and transfer genes, so a constructed 35S: ntTBWRG1 expression vector needs to be transferred into Agrobacterium. The correctly sequenced vector was transformed into Agrobacterium competent LBA4404 by freeze thawing. mu.L of the carrier was added to 50. Mu.L of competent cells, and the mixture was left on ice for 5min. Treating in liquid nitrogen for 5min, adding 500 μl of liquid LB culture medium after ice-laying for 5min, culturing at 28deg.C for 2 hr, uniformly coating on solid LB culture medium containing 50mg/L kanamycin and rifampicin, and standing at 28deg.C for 2-3d. After single colony was grown, positive clones were identified by PCR and sequencing to confirm that 35s:nttbwrg1 expression vector was transferred into agrobacterium LBA4404.

The 35S:NtTBWRG1 expression vector is transferred into a tobacco susceptible variety Cubi No. (CB-1) by using an agrobacterium strain LBA4404 mediated leaf disc transformation method, and a transgenic positive plant is obtained through screening by a hygromycin screening marker. Further extracting DNA of the transgenic plant as a template, performing PCR amplification by using a 35S specific promoter primer, and finally identifying 14 positive plants. Wherein: the PCR reaction system is as follows: 1. Mu.L of DNA, 1. Mu.L of forward primer, 1. Mu.L of reverse primer, 10. Mu.L of 5 Xbuffer, 10. Mu.L of dNTP mix, and goldDNAPolymerase 2μL，ddH ₂ O25. Mu.L, total volume 50. Mu.L. The 35S specific promoter primer sequence is as follows:

35S-F：GAATTTCGACCTGCAGGT；

35S-R：GATAGTGGGATTGTGCGT。

the amplification procedure was: 3min at 95 ℃;95℃15s,55℃15s,72℃30s,35 PCR cycles, 72℃10min. Agarose gel electrophoresis is carried out on the amplified product, after the gel is dyed by EB, ultraviolet light is used for detecting electrophoresis bands, as shown in figure 3, DNA bands with 582bp size are amplified in transgenic positive plants, and non-transgenic empty control (CB-1) has no amplified bands.

Example 4 detection of expression level of NtTBWRG1 Gene in transgenic plants

Extracting total RNA of transgenic plant root system by using reverse transcription kitOne-Step gDNA Removal and cDNA Synthesis SuperMix reverse transcribes RNA into cDNA. Wherein: the reverse transcription reaction system is as follows: total RNA 1. Mu.g, anchor Oligo (dT) 18primer 1. Mu.L, 2 XS reaction mix 10. Mu.L, & lt/EN & gt>RT/RI Enzyme mix 1μL，gDNA remover 1μL，RNase-free H ₂ O makes up a total volume of 20. Mu.L. The reaction procedure is: 42 ℃ for 15min; and 5s at 85 ℃.

The cDNA was used as a template, and the expression level of the NtTBWRG1 gene was detected by a real-time fluorescent quantitative PCR (qPCR) technique, and 3 biological repeats were set. By using whole goldGreen qPCR SuperMix qPCR reactions were performed. The system is as follows: 1. Mu.L of DNA, 0.4. Mu.L of forward primer, 0.4. Mu.L of reverse primer, & lt/EN & gt>Green qPCR SuperMix 10μL，ddH ₂ O8.2. Mu.L, total volume 20. Mu.L. The ABI7500 PCR instrument is adopted for PCR reaction, and the conditions are as follows: 94 ℃ for 30s;94℃for 5s,60℃for 34s,40 PCR cycles. The expression level of NtTBWRG1 in the non-transgenic control variety CB-1 was set to 1.

As shown in the qPCR results of FIG. 4, the expression level of NtTBWRG1 in transgenic plants #1- #14 was increased by 1.25-7.22 times compared with that of the non-transgenic control.

EXAMPLE 5 seedling disease resistance

And taking a susceptible variety CB-1 as a control, selecting #3 and #9 transgenic plants with relatively high expression level of NtTBWRG1 for seedling stage inoculation identification of bacterial wilt disease resistance, and setting 3 biological repetitions for experiments, wherein 25 plants are repeated. Culturing tobacco seedlings to a four-leaf one-heart period in a climatic chamber at 25 ℃, and inoculating bacterial wilt by a root irrigation inoculation method.

The inoculation conditions are as follows: activating strain GMI1000 (NCBI accession number AF 295251) on TTC solid culture medium by streaking, culturing in 30 deg.C incubator for 2-3 days, picking colony, culturing in LB liquid culture medium, culturing at 30deg.C and 200rpm to OD ₆₀₀ =1.0, dilute the bacterial solution to OD ₆₀₀ =1.0 ready for use. 10mL of diluted bacterial liquid is inoculated at four weeks of the root of each strain, and the strain is cultured for 2 weeks after inoculation. The culture conditions were 35℃and 80% relative humidity.

As shown in FIG. 5, the results demonstrate that most plants of the non-transgenic control variety CB-1 have been fatigued 14 days after inoculation, while most plants of transgenic plants #3 and #9 still grew normally, exhibiting higher resistance to bacterial wilt.

EXAMPLE 6 Miao national disease index

The disease conditions of the plants 14 days after inoculation were counted, and the results are shown in Table 1. The statistical criteria are:

level 0: tobacco seedlings have no disease symptoms;

stage 1: 1-2 leaves wilt, or the stem base green strip spot is less than 1/3 of the plant height;

3 stages: 2-3 leaves wilt or stem base green strip spot is 1/3-1/2 of plant height;

5 stages: 1-2 healthy leaves, or 1/2-2/3 of the plant height of the stem basal part green strip removing spots;

7 stages: leaf wilting or stem basal green strip spot removing accounts for more than 2/3 of plant height;

stage 9: the whole plant dies.

TABLE 1 seed stage plant disease conditions

Disease level	0	1	3	5	7	9
							CB-1	0	0	5	11	24	35
#3	16	22	19	18	0	0
							#9	35	25	12	3	0	0

The disease index calculation formula is as follows:

as a result, as shown in FIG. 6, for the disease index at seedling stage, the control strain CB-1 was 83, and the transgenic plant #3 was 25 and #9 was 11. This also indicates that the higher the expression level of the NtTBWRG1 gene, the more resistant the transgenic plants to bacterial wilt.

Example 7 adult plant disease resistance

And selecting #3 and #9 transgenic plants with relatively high expression quantity of NtTBWRG1 by taking the infected variety CB-1 as a control to carry out bacterial wilt disease resistance identification in the adult stage. The experiment was set up with 3 biological replicates of 25 strains each. In the test field, tobacco seedlings naturally grow to 7 months of high temperature and high humidity, and bacterial wilt is inoculated by a root irrigation inoculation method on 7 months and 1 day.

The inoculation conditions are as follows: activating strain GMI1000 (NCBI accession number AF 295251) on TTC solid culture medium by streaking, culturing in 30 deg.C incubator for 2-3 days, picking colony, culturing in LB liquid culture medium, and culturing at 30 deg.C and 200rpm to OD ₆₀₀ =1.0, dilute the bacterial solution to OD ₆₀₀ =1.0 ready for use. 100mL of diluted bacterial liquid is inoculated at four weeks of the root of each plant tobacco, and the disease condition of the plant is observed and counted 60 days after inoculation.

As can be seen from the results shown in FIG. 7, the non-transgenic control strain CB-1 has been desiccated and dead for a majority of plants 60 days after field inoculation, while the transgenic plants #3 and #9 have grown normally for a majority of plants, with leaves kept green, showing better resistance to bacterial wilt.

Example 8 adult plant disease index

The disease conditions of the plants 60 days after inoculation were counted, and the results are shown in Table 2. The statistical criteria are:

level 0: the whole plant has no disease symptoms;

stage 1: the basal part of the stem is occasionally chlorosis;

3 stages: the basal part of the stem has fading spots or a few leaves wilting at the side with strip spots;

5 stages: the stem part has black streak, but does not reach the top end of the plant, or leaves wilting more than half of the disease measurement;

7 stages: the black streak of the stem reaches the top end of the plant, or more than 2/3 of the leaves wilt;

stage 9: the whole plant is basically dead.

TABLE 2 plant disease conditions at the adult stage

The disease index calculation formula is as follows:

as can be seen from the results shown in FIG. 8, the control strain was 90, and the transgenic plants #3 and #9 were 32 and 19, respectively, for the adult stage disease index. This also shows that the overexpression of the NtTBWRG1 gene significantly enhances bacterial wilt resistance of tobacco.

Claims (7)

1. The application of the disease resistance gene NtTBWRG1 in the prevention and treatment of tobacco bacterial wilt caused by Ralstonia solanacearum is characterized in that the coding sequence of the gene is shown as SEQ ID NO: 1.

2. The application of the over-expressed NtTBWRG1 gene in obviously enhancing the bacterial wilt resistance of tobacco is characterized in that the coding sequence of the gene is shown in SEQ ID NO: 1.

3. A method of constructing a transgenic tobacco plant having bacterial wilt resistance comprising the steps of:

constructing an expression vector 35S of an anti-disease gene NtTBWRG1, wherein the expression vector is NtTBWRG1;

the 35S:NtTBWRG1 expression vector is transferred into a tobacco susceptible variety Cubi No. CB-1 by using an agrobacterium strain LBA4404 mediated leaf disc transformation method, and the transgenic tobacco plant with bacterial wilt resistance is obtained through screening by hygromycin screening markers.

4. The method according to claim 3, wherein the expression level of NtTBWRG1 in the transgenic tobacco plant is increased by 1.25-7.22 times as compared to the non-transgenic control CB-1.

5. The method according to claim 3, wherein the bacterial wilt disease index of the transgenic tobacco plant is 20-30.

6. The application of the disease resistance gene NtTBWRG1 in the preparation of a preparation for promoting tobacco plant growth is characterized in that the coding sequence of the gene is shown in SEQ ID NO: 1.

7. The use according to claim 6, wherein the agent for promoting tobacco plant growth is a microbial agent or microbial fertilizer.