CN116103322A - Functional gene for enhancing resistance of plants to botrytis cinerea infection and application thereof - Google Patents

Abstract

The invention relates to a functional gene for enhancing the tolerance of plants to botrytis cinerea and application thereof, belonging to the technical field of bioengineering. The DNA sequence of the functional gene for enhancing the resistance of plants to botrytis cinerea infection is shown as SEQ ID No. 1. An application of a functional gene for enhancing the resistance of plants to botrytis cinerea infection, wherein the DNA sequence table SEQ ID No: the functional gene shown in l is transferred into a plant, wherein the plant is Arabidopsis thaliana, and the Arabidopsis thaliana is subjected to the expression of the functional geneATCHiC‑OEIs an over-expression vector. Plants exhibit stress tolerance traits to botrytis cinerea. The functional gene of the plant for enhancing the stress tolerance of the botrytis cinerea can provide new gene resources and technical support for the stress-tolerant genetic improvement of crops and is appliedIt can cultivate plant seeds with enhanced disease resistance and disease resistance.

Description

Functional gene for enhancing resistance of plants to botrytis cinerea infection and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to application of a gene serving as a positive regulatory factor for enhancing plant resistance to botrytis cinerea infection.

Background

Plants are exposed to various threats from the ecological environment during growth and development, and many injuries are derived from pathogenic fungi, bacteria, viruses and other microorganisms. The serious injury of the plants can affect the normal growth and maturation of the plants, thereby causing the loss of the quality and the yield of crops and causing the agricultural production to face serious dilemma.

Gray mold is an important disease caused by Botrytis cinerea (b.cinerea) that can damage various plants such as vegetables, fruit trees, flowers, etc. Botrytis cinerea infects 240 or more plants including Arabidopsis thaliana, a very important model fungus for the study of saprophytic fungi. The spore amount produced by the botrytis cinerea is very large, and the problem of drug resistance produced by using a single chemical agent for a long time is also very remarkable, so that chemical control is difficult, and huge economic losses of melons, fruits and vegetables are often caused, thereby being an important germ widely existing and endangering agricultural production.

Arabidopsis is used as a classical model plant, the whole genome of Arabidopsis is sequenced, and the Arabidopsis is widely applied to the research fields of plant genetics, crop biology, developmental biology, molecular biology and the like. In addition, the arabidopsis has the characteristics of simple structure, short growth period, high propagation coefficient, strong vitality, self-pollination and easy transformation, the arabidopsis can be used as a research object to achieve the expected target of experiments faster and better, the experimental time can be shortened to a great extent, the experimental conditions can be simplified, and the superiority which is incomparable with other organisms is shown. The research of the mechanism of plants responding to the stress of botrytis cinerea by using model organism Arabidopsis thaliana provides new gene resources for stress-tolerant genetic improvement of crops. According to the south of the pseudo-southThe mustard sequencing database (www.arabidopsis.org) is one of the hot spots in the field of international botanic research, and is also the focus of technological competition between different countries, in finding and finding new functional genes with independent intellectual property rights. Arabidopsis thaliana shares about 1.3 hundred million base pairs, 2.9 ten thousand genes. The functional studies of most genes are still unclear, and some functional genes that regulate and control infection with pathogens have been discovered, such as:MEB2、THE1、GLE1、RPS2、RPS5、RPS6、RPM1、RPP4、RPP7、RPW8、CPR30、BON1、EDS4etc.

Based on the published genomic sequences of the Arabidopsis database,ATCHiC(AT 4G 19810) is a member of the Arabidopsis chitinase 18 family, which, according to amino acid sequence characteristics,ATCHiCbut also belongs to V-type chitinase. Plant chitinase is mainly distributed in seeds, stems and leaves, the molecular weight of protein is mostly between 20-40 kDa, and most of plant chitinase exists in a monomer form, and the plant chitinase is stable to heat and resistant to hydrolysis of protease. Chitinase has been shown to be one of the major plant disease process related proteins, and a number of reports have shown that chitinase expression in plants is induced by biotic and abiotic stresses. For the followingATCHiCOnly the genes have been studied to dateATCHiCGenes may play a role in defense and developmental regulation, however, their specific role in regulating plant defense has been studied very limited.

The new disease control method and approach are discussed, such as utilizing molecular and genetic engineering means to discover the related gene for resisting gray mold and research the disease-resistant mechanism, and the rapid cultivation of disease-resistant vegetable variety has important theoretical and practical significance for gray mold control in production.

Disclosure of Invention

One of the purposes of the invention is to provide a functional gene for enhancing the resistance of plants to botrytis cinerea infection, and the second purpose of the invention is to provide an application of the functional gene as a positive regulatory factor in regulating and controlling the resistance of plants to botrytis cinerea infection.

The DNA sequence of the functional gene for enhancing the resistance of plants to botrytis cinerea infection is shown as SEQ ID No. 1.

The DNA sequence table SEQ ID No: functional gene transfer shown in lInto a plant, said plant being Arabidopsis thaliana, said Arabidopsis thalianaATCHiC-OEIs an over-expression vector.

The DNA sequence table SEQ ID No: the functional gene shown in the formula I is transferred into a wild plant by a flower dipping method, so that the wild plant is over-expressed in the wild plant, and the plant shows tolerance property to Botrytis cinerea.

The invention relates to the plant disease-resistant related protein coding gene in plantsATCHiCThe method for over-expression is constructed by using genetic engineering technology35S: ATCHiCThe over-expression vector is transferred into a wild plant by a flower dipping method, so that the over-expression vector is over-expressed in the wild plant, and the plant is tolerant to Botrytis cinerea. Will beATCHiCWhen the gene is constructed into a plant expression vector, an enhanced promoter or an inducible promoter can be added before the transcription initiation nucleotide. To facilitate identification and selection of transgenic plant cells or plants, vectors are used which are processed to render them resistant to antibiotic markers (e.g., kanamycin). The plant host to be transformed may be either monocotyledonous or dicotyledonous plants such as rice, wheat, maize, cucumber, tomato, turf grass or alfalfa plants, etc. By using Ti plasmid, ri plasmid, plant virus vector, direct DNA transformation, microinjection, electric conduction, agrobacterium-mediated and other conventional biological methodsATCHiCThe expression vector of the gene transforms plant cells or tissues and the transformed plants are tissue-cultured into plants.

The beneficial technical effects of the invention are as follows:

1. based on the published genomic sequences of the Arabidopsis database,ATCHiCis a member of the Arabidopsis chitinase family, and the applicant has found thatATCHiCThe plants showed tolerance to botrytis cinerea stress under the treatment of botrytis cinerea stress after the gene is over-expressed, which indicates thatATCHiCRegulation of genes in response to botrytis cinerea stress.

Further studies of the function of this gene have shown that,ATCHiCthe colonization amount of botrytis cinerea mycelium and hydrogen peroxide (H) in the plant body with the gene over-expression ₂ O ₂ ) Lower than wild type plants, which is said to beMing overexpressionATCHiCCan improve the resistance of arabidopsis thaliana to botrytis cinerea, and is shown to be tolerant to the stress of botrytis cinerea.

2. According to the inventionATCHiCAfter the gene is over-expressed, the tolerance of the plant to botrytis cinerea stress can be enhanced, new gene resources and technical support are provided for stress-resistant genetic improvement of crops, and plant seeds with enhanced disease resistance and disease resistance can be cultivated by using the gene.

Drawings

FIG. 1 is a schematic view ofATCHiCThe gene is induced to express by botrytis cinerea stress in wild type arabidopsis thaliana.

FIG. 2 is a schematic view ofATCHiCScreening of over-expressed plants and mRNA expression level profile.

FIG. 3 is a schematic view ofATCHiCComparison photo of the gene over-expressed plants with wild plants (WT) after 4 weeks of soil culture after 24h treatment with Botrytis cinerea discs.

FIG. 4 is a schematic representation of T-DNA insertion sites.

FIG. 5 is a schematic view of a displayatchicIn mutantsATCHiCIdentification map of the transcription level of the gene.

FIG. 6 is a diagram ofatchicComparison photo of mutant and wild type plants (WT) after 4 weeks of soil culture after 24h treatment of rosette leaves with botrytis cinerea discs.

FIG. 7 shows WT plants under induction of Salicylic Acid (SA), jasmonic Acid (JA), ethylene precursor (ACC)ATCHiCGene expression profile, the experiment was performed with water as control.

Detailed Description

The invention is further described below with reference to examples.

The DNA sequence of the functional gene for enhancing the resistance of plants to botrytis cinerea infection is shown as SEQ ID No. 1.

The DNA sequence table SEQ ID No: the functional gene shown in l is transferred into a plant, wherein the plant is Arabidopsis thaliana, and the Arabidopsis thaliana is subjected to the expression of the functional geneATCHiC-OEIs an over-expression vector.

The DNA sequence table SEQ ID No: the functional gene shown in the formula I is transferred into a wild plant by a flower dipping method, so that the wild plant is over-expressed in the wild plant, and the plant shows tolerance property to Botrytis cinerea.

The experimental methods in the following examples are conventional methods unless otherwise specified.

EXAMPLE 1 cultivation of A. Cinerea resistant Arabidopsis thaliana

1. Determination ofATCHiCWhether the gene is involved in plant response to botrytis cinerea stress

Respectively extracting RNA of Wild Type (WT) Arabidopsis thaliana subjected to stress treatment of Botrytis cinerea at different time points, performing reverse transcription to obtain cDNA, and performing real-time quantitative PCR techniqueATCHiCAnalysis of the transcriptional level of the Gene, foundATCHiCThe gene expression level is obviously induced by botrytis cinerea stress relative to the control group, and the result shows thatATCHiCIs used as a positive regulator to respond to botrytis cinerea stress, see figure 1.

2、ATCHiCGene over-expression transgenic linesATCHiC-OE1、OE2Is obtained by (a)

To verify the function of the gene in the stress regulation of botrytis cinerea, construction is carried outATCHiCGene over-expression vector35S: ATCHiC). First, target fragment amplification is performed. The wild arabidopsis is normally cultured on an MS culture medium for two weeks, total RNA of plants is extracted, cDNA is synthesized by reverse transcription, PCR is performed by taking the synthesized cDNA as a template, and a sufficient amount of target products are amplified, wherein the target products are shown in a figure 2A. And then taking the PCR product as a template to carry out secondary amplification, wherein the purpose is to introduce enzyme cutting sites. And (3) carrying out enzyme digestion and recovery on the PCR product and a vector pCAMBIA 1301. The recovered and purified target DNA fragment and the vector were then ligated overnight with T4 DNA ligase. Transferring the connecting solution into DH5 alpha, detecting and screening out positive clones, and sequencing. After the sequencing result is determined to be correct, the agrobacterium GV3101 is transformed by using an electric shock transformation method. The agrobacteria GV3101 after electric shock transformation are activated and then spread on LB medium plates containing double antibodies (kanamycin, gentamicin). Single colonies were randomly picked, amplified in LB medium containing double antibodies (kanamycin, gentamicin) and PCR identified using vector primers, see FIG. 2B. After the size of the PCR amplified fragment is consistent with the target gene, the wild type plant of the arabidopsis is transformed by adopting a flower dipping method, thereby obtainingATCHiCGeneThe transgenic lines were overexpressed, see C in FIG. 2. Wherein, the liquid crystal display device comprises a liquid crystal display device,

primer 1:

F 5' GAGAACACGGGGGACGGTACCATGTCTTCAACAAAACTCATATCGC 3'；

primer 2:

R 5' CCTAGGTGCGGCCGCCTCGAGTTAAACCTTCTGTATAGTTCTGGTGGTTG 3'。

3、ATCHiCidentification of transcription level of over-expressed transgenic plant and comparison of disease resistance with wild type plant

Quantitative PCR pairATCHiCThe transcriptional level of the overexpressing transgenic plants was identified and finally OE1 and OE2 were selected for further experiments, see fig. 2D. Wild Type (WT) andATCHiC-OE1andOE2simultaneously, the seeds are planted in nutrient soil and placed in a constant temperature illumination incubator at 22 ℃ for 4 weeks (16 hours illumination and 8 hours darkness are taken as the photoperiod). The rosette leaves with the same growth vigor and size are sterilized by sodium hypochlorite of 1%, placed in a fresh-keeping box which is clean and paved with proper moist filter paper, and a bacterial tray with the diameter of 0.5 cm is punched out by using a puncher, and carefully placed on the leaves. After 24 hours, it was observed that: over-expressed plants compared to wild type WTATCHiC-OE1AndOE2shows a tolerance phenotype to Botrytis cinerea, see FIG. 3A. Quantitative PCR is utilized to detect the content of botrytis cinerea mycelium,ATCHiCthe number of botrytis cinerea mycelium colonization in the over-expressed leaf is smaller than that of WT, see B in FIG. 3. Dyeing the blade by using DAB dyeing method, and observing blade H ₂ O ₂ The condition of the accumulation of the water,ATCHiCover-expressed leaves stained to a lesser extent than WT, H ₂ O ₂ Less accumulation, see C in fig. 3. DAB staining greyscale analysis is shown in FIG. 3D. These results indicate that forATCHiCThe overexpressed plants were more tolerant to botrytis infection than WT.

Example 2ATCHiCMutant acquisition

1. Mutant bioinformatic determination and transcriptional level identification

Referring to FIG. 4, to further investigate the role of genes in plant response to Botrytis cinerea stress, two were obtained from the American Arabidopsis germplasm resource poolATCHiCGene functional deletion mutants, respectively designated asatchic-1、atchic-2The seed numbers are SALK_061610 and SALK_204213, respectively. Referring to FIG. 4, since the seeds are T-DNA insertion mutation, PCR amplification and sequencing are performed by specific primers, sequencing results are compared in NCBI database Blast, and comprehensive analysis is performed to obtain T-DNA insertion site information. Referring to FIG. 5, the quantitative PCR was used for the reactionatchic-1Andatchic-2mutant materials were identified at the transcriptional level and found in both mutantsATCHiCThe expression level of the gene was significantly lower than that of the Wild Type (WT).

2. Comparison of disease resistance of mutant plants with wild type plants

Wild Type (WT) andatchic-1andatchic-2simultaneously, the seeds are planted in nutrient soil and placed in a constant temperature illumination incubator at 22 ℃ for 4 weeks (16 hours illumination and 8 hours darkness are taken as the photoperiod). The rosette leaves with the same growth vigor and size are sterilized by sodium hypochlorite of 1%, placed in a fresh-keeping box which is clean and paved with proper moist filter paper, and a bacterial tray with the diameter of 0.5 cm is punched out by using a puncher, and carefully placed on the leaves. After 24 hours, it was observed that: mutant plants compared to wild type WTatchic-1Andatchic-2the leaves of (a) exhibit a susceptible phenotype to botrytis cinerea, see figure 6 a. Quantitative PCR is utilized to detect the content of botrytis cinerea mycelium,atchicthe number of botrytis cinerea mycelium colonization in the mutant leaves was greater than that of WT, see B in FIG. 6. Dyeing the blade by using DAB dyeing method, and observing blade H ₂ O ₂ The condition of the accumulation of the water,atchicmutant leaves stained to a greater extent than WT, H ₂ O ₂ More accumulated, see C in fig. 6. DAB staining greyscale analysis is shown in FIG. 6D. These results indicate that foratchicMutant plants are more susceptible to botrytis infection than WT.

3. In wild plantsATCHiCGene hormone signaling pathway analysis

Phytohormones play a vital role in the disease-resistant process of plants, with Salicylic Acid (SA), jasmonic Acid (JA) and Ethylene (ET) being particularly prominent. To studyATCHiCAnd the signal path of the gene in the disease-resistant process is selected from three hormones SA, JA and ET, and the wild WT is sprayed and induced respectively. Referring to FIG. 7, the time is 0h, 3h, 6h, 9h, 12hSampling at intervals, extracting RNA, reverse transcribing into cDNA, and real-time quantitative PCRATCHiCAnalysis of the transcriptional level of the Gene, foundATCHiCThe gene expression level was significantly induced by SA relative to the control group, and the result indicates thatATCHiCIt is possible to respond to botrytis cinerea stress by participating in the SA signaling pathway.

Claims (3)

1. A functional gene for enhancing the resistance of a plant to botrytis cinerea infection, characterized in that: the DNA sequence of the functional gene is shown as SEQ ID No. 1.

2. The use of a functional gene for enhancing plant resistance to botrytis cinerea infection according to claim 1, wherein: the DNA sequence table SEQ ID No: the functional gene shown in l is transferred into a plant, wherein the plant is Arabidopsis thaliana, and the Arabidopsis thaliana isATCHiC-OEIs an over-expression vector.

3. The use of a functional gene for enhancing plant resistance to botrytis cinerea infection according to claim 2, wherein: the DNA sequence table SEQ ID No: the functional gene shown in the formula I is transferred into a wild plant by a flower dipping method, so that the wild plant is over-expressed in the wild plant, and the plant shows tolerance property to Botrytis cinerea.

Images