CN117701593A

CN117701593A - Poplar sugar transport protein gene PagSWEET15b, and encoding protein and application thereof

Info

Publication number: CN117701593A
Application number: CN202410091857.2A
Authority: CN
Inventors: 王丽娟; 郝心怡; 胡建军; 王哲舒; 范志斌
Original assignee: Research Institute of Forestry of Chinese Academy of Forestry
Current assignee: Research Institute of Forestry of Chinese Academy of Forestry
Priority date: 2024-01-23
Filing date: 2024-01-23
Publication date: 2024-03-15

Abstract

The invention discloses a poplar sugar transport protein gene PagSWEET15b, a coded protein and application thereof, belonging to the technical field of plant genetic engineering, wherein the nucleotide sequence of the gene is shown as SEQ ID NO.3, and the amino acid sequence of the coded protein is shown as SEQ ID NO. 4. The invention creates and obtains PagSWEET15b over-expression plants and gene knockout mutants, and the experiment shows that the disease resistance of the gene knockout mutants is obviously improved through Fusarium putrescens infection, and the over-expression plants are more sensitive to Fusarium putrescens, so that PagSWEET15b genes are key genes involved in the interaction process of poplar and Fusarium putrescens. The invention has good application prospect in cultivating new varieties of Fusarium solani resistant poplar, has important significance in guaranteeing healthy development of poplar industry, and has profound value in the fields of tree disease-resistant molecular breeding and forestry genetic engineering.

Description

Poplar sugar transport protein gene PagSWEET15b, and encoding protein and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a poplar sugar transport protein gene PagSWEET15b, and a coding protein and application thereof.

Background

Poplar is an important economic and energy source species, has the characteristics of high growth speed, wide planting area, strong environmental adaptability and the like, and plays an important role in industry, agriculture, forestry and the like. However, as the demand of market materials is continuously increased, the poplar planting area is further enlarged, and diseases are frequently caused by the influence of factors such as environment, climate and the like. However, at present, means for preventing and treating poplar diseases still depend on physical or chemical means, so that not only are manpower, material resources and financial resources wasted, but also serious environmental pollution can be caused by long-term use of chemical products such as pesticides and the like. The cultivation of disease-resistant varieties is the most economical, environment-friendly and effective measure for preventing and treating poplar diseases at present. Fusarium solani (Mart.) Sacc belonging to the genus Fusarium of the phylum Deuteromycotina. The poplar disease caused by the bacteria has the characteristics of high infectivity, high incidence rate and the like. The disease is a soil-borne fungus disease, is mainly invaded from the root of a host of the plant in a seedling stage with low plant defense capacity, and then is spread to the whole plant to cause stem rot and leaf wilt, and finally leads to death of the plant. The genetic engineering means is adopted to cultivate a new variety of the Fusarium solani-resistant poplar, which has important significance for guaranteeing the healthy development of the poplar industry.

When the plant encounters pathogen invasion, the sugar can be used as a competing object of the two, is a main target of nutrition competition of the two, can also be used as a sugar signal molecule, is perceived by the immune system of the plant, and activates disease-resistant response of the plant. Sugar transporters are responsible for sugar transport and play a key role in plant-pathogen interactions. SWEETs (Sugars Will Eventually Be Exported Transporters) is a class of plant sugar transport proteins found in recent years. Studies on herbs have shown that Arabidopsis AtSWEET2 is involved in the resistance response to Pythium infection. In contrast, rice OsSWEETI1 and OsSWEET13 are induced to be expressed by TAL effectors PthXo1 and PthXo2, respectively, and mediate susceptibility to bacterial blight. It follows that SWEET exhibits different roles in different plant-pathogen interactions. Compared with herbaceous plants, the perennial woody plant SWEET gene family is expanded, and the gene functions are differentiated, but at present, researches on SWEET participating in woody plant-pathogenic bacteria interaction are not reported yet.

Disclosure of Invention

The invention aims to provide a poplar sugar transport protein gene PagSWEET15b, and a coding protein and application thereof, so as to solve the problems in the prior art.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides a poplar sugar transport protein gene PagSWEET15b, the nucleotide sequence of which is shown as SEQ ID NO. 3.

The invention also provides a coding protein of the poplar sugar transport protein gene PagSWEET15b, and the amino acid sequence of the coding protein is shown as SEQ ID NO. 4.

The invention also provides an application of the poplar sugar transport protein gene PagSWEET15b in regulating and controlling the sensitivity of plants to Fusarium solani.

Further, up-regulating the expression level of the poplar sugar transport protein gene PagSWEET15b improves the sensitivity of the plant to Fusarium solani.

Further, the expression level of the poplar sugar transport protein gene PagSWEET15b is down-regulated, and the sensitivity of the plant to Fusarium solani is reduced.

Further, a CRISPR/Cas9 method is utilized to construct a knockout vector of the poplar sugar transport protein gene PagSWEET15b, and the knockout vector is transferred into a receptor material so as to reduce the sensitivity of plants to Fusarium solani.

Further, the plant comprises poplar.

The invention also provides a method for improving the disease resistance of plants against Fusarium solani, which comprises the step of down-regulating the expression level of the poplar sugar transport protein gene PagSWEET15 b; the nucleotide sequence of the poplar sugar transport protein gene PagSWEET15b is shown as SEQ ID NO. 3.

Further, a CRISPR/Cas9 method is utilized to construct a knockout vector of the poplar sugar transport protein gene PagSWEET15b, and the knockout vector is transferred into a receptor material so as to improve the performance of resisting Fusarium solani diseases of plants.

Further, the plant comprises poplar.

The invention discloses the following technical effects:

the invention clones PagSWEET15b gene by using 84K silver poplar as material. Meanwhile, pagSWEET15b over-expression plants and gene knockout mutants are created and obtained. Through Fusarium putrescens infection experiments, the disease resistance of the gene knockout mutant plant is obviously improved, and the over-expression plant is more sensitive to Fusarium putrescens, which indicates that PagSWEET15b gene is a key gene involved in the interaction process of poplar and Fusarium putrescens. The invention has good application prospect in cultivating new varieties of Fusarium solani resistant poplar, has important significance in guaranteeing healthy development of poplar industry, and has profound value in the fields of tree disease-resistant molecular breeding and forestry genetic engineering.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram showing analysis of tissue expression characteristics of the poplar PagSWEET15b gene in example 1 of the present invention;

FIG. 2 is a flow chart of construction of the overexpression vector of poplar pMDC32-PagSWEET15b in example 1 of the present invention;

FIG. 3 is a graph showing the analysis of the expression level of the poplar PagSWEET15b overexpressing plant in example 1 of the present invention;

FIG. 4 is a gene-edited form of mutants KO-6 and KO-12 in example 1 of the present invention;

FIG. 5 shows the overall phenotype of non-transgenic 84K poplar, over-expressed transgenic plants and mutant plants 5 days after infection with Fusarium solani in example 1 of the present invention; 84K, OE-4, OE-31, KO-6 and KO-12, respectively, from left to right.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

Example 1

1. Tissue expression analysis of poplar PagSWEET15b gene

1. Cloning of the poplar PagSWEET15b Gene

Extracting 84K total RNA by using silver poplar 84K as a material and using a RNeasy Plant mini Kit kit (Tiangen, beijin, china); 1.0 μg of RNA was taken per sample and the first strand of cDNA was synthesized using SuperScript III first-strand synthesis system (Invitrogen) (Takara, dalia, china). Full-length gene amplification was performed using Primer 3 software designed with reference to published populus trichocarpus genome sequences (Tuskan, g.a., diFazio, s., jansson, s., bohlmann, j., grisoriev, i., hellsten, u., … Rokhsar, d. (2006) The Genome of Black Cottonwood, populus trichocarpa (Torr. & Gray) & Science,313 (5793), 1596-1604.). Wherein, the forward primer of PagSWEET15b is PagSWEET15b-CDS-F, which is shown as SEQ ID NO.1 in the sequence table, and the reverse primer PagSWEET15b-CDS-R is shown as SEQ ID NO.2 (Table 1).

TABLE 1

Name of the name	Sequence (5 '-3')
		PagSWEET15b-CDS-F	ATGGCAGTGACGAGCATT(SEQ ID NO.1)
PagSWEET15b-CDS-R	TCAAACTGCACATTCATT(SEQ ID NO.2)

The high-fidelity PCR reaction system is as follows: taKaRa high-fidelity amplification enzyme PrimeSTAR 10.0. Mu.l, forward primer (10. Mu.M) 1. Mu.l, reverse primer (10. Mu.M) 1. Mu.l, template (84K poplar cDNA) 1. Mu.l, ddH ₂ O was made up to 20. Mu.l. The reaction procedure: pre-denaturation at 95℃for 5min;95 ℃ for 20s;52 ℃ for 20s;68 ℃,1min,35 cycles; 68 ℃ for 7min. The nucleotide sequence of the PagSWEET15b gene is shown as SEQ ID NO.3, and the amino acid sequence of the compiled expression protein is shown as SEQ ID NO.4 (Table 2).

TABLE 2

Analysis of PagSWEET15b Gene tissue expression profiling

Plant material was taken from roots, stems and leaves of 84K Yang Zhizhu grown in a tissue culture chamber for 20 days. Each sample contains 3 biological repeats, all plant materials are frozen by liquid nitrogen and then stored in a refrigerator at-80 ℃ for standby, RNA of the samples is extracted, cDNA is synthesized by reverse transcription, pagActin is used as an internal reference gene, the tissue expression characteristics of PagSWEET15b genes are analyzed by adopting a qRT-PCR method, and amplification primers are qPagSWEET15b-F (CAGAAGGTTGAAGAGAAAAAGAAGC (SEQ ID NO. 5)) and qPagSWEET15b-R (CTCCATTCACGTCAGGTTTTGC (SEQ ID NO. 6)). The fluorescent quantitative PCR reaction procedure was: 95 ℃ for 5min;95℃10s,60℃10s,72℃10s,45 cycles. By 2 ^-△△ The relative expression levels of the genes were calculated by CT method. Each treatment was set up with 3 biological replicates and each biological replicate was set up with 4 technical replicates.

FIG. 1 is a diagram showing analysis of tissue expression characteristics of the poplar PagSWEET15b gene in example 1 of the present invention. The PagSWEET15b was found to be most expressed in roots by fluorescent quantitative PCR analysis, followed by leaves and finally stems. Bioinformatics analysis showed that PagSWEET15b may be involved in the poplar-microorganism interaction process and that Fusarium solani invades primarily from the host root, and therefore, pagSWEET15b is presumed to be involved in the poplar-Fusarium solani interaction process.

2. Construction of PagSWEET15b Gene overexpression vector

Creating an over-expression vector of the PagSWEET15b gene by using Gateway cloning technology, amplifying the PagSWEET15b gene coding region sequence from 84K poplar cDNA by designing PagSWEET15b gene specific primers, and re-entering the pDOR 207 vector, wherein the primer sequences are shown in SEQ ID NO.7-8, and the reaction system is as follows: 80ng of Fresh PCRrproduct; pDOR 207 vector 0.4. Mu.l; BP close II enzyme mix 0.6. Mu.l; ddH ₂ O was made up to 5. Mu.l. The reaction procedure is: the reaction was carried out at 25℃for 6 hours to obtain an entry clone.

PagSWEET15b-207-F：ggggacaactttgtacaaaaaagttggaATGGCAGTGACGAGCATTC(SEQ ID NO.7)；

PagSWEET15b-207-R：ggcggccgcacaactttgtacaagaaagttgggtaAACTGCACATTCATT(SEQ ID NO.8)。

After the correct detection of the entry clone by sequencing, the entry vector with PagSWEET15b gene is linearized by mlu I restriction endonuclease, and then recombined into a plant expression vector pMDC32 to carry out LR reaction, wherein the reaction system is as follows: linearized entry clone 50ng; purified destination vector 75ng; LR close II enzyme mix 0.6 μl; ddH ₂ O was made up to 5. Mu.l. Reaction conditions: the reaction was carried out at 25℃for 6h. After LR reaction, pagSWEET15b gene is led into a plant expression vector pMDC32, and then transformed by escherichia coli and sequenced, thus obtaining the pMDC32-PagSWEET15b over-expression vector. As shown in FIG. 2, the gene is located after the promoter 35S, can be efficiently expressed in poplar, and NOS can effectively terminate the transcription of PagSWEET15 b.

3. Construction of PagSWEET15b Gene knockout vector

Cloning PagSWEET15b genome sequence with 84K poplar genome DNA as template, designing gRNA based on PAM sequence (NGG), and the gRNA sequences 15b-AtU dT1F, 15b-AtU dT1R are shown in the following table.

TABLE 3 Table 3

Name of the name	Sequence (5 '-3')
		15b-AtU3dT1F	gtcaCCATGAGATAAGGCAACGAT(SEQ ID NO.9)
15b-AtU3dT1R	aaacATCGTTGCCTTATCTCATGG(SEQ ID NO.10)

Diluting the gRNA sequence primer into 1 mu M mother solution by double distilled water, taking 10 mu L of each of the upstream and downstream target sequence primers, uniformly mixing, denaturing for 30s at 90 ℃, then moving to room temperature, gradually cooling and annealing to form double chains, and obtaining the target sequence connector. A10. Mu.l of a 1 XBsaI ligation reaction solution was prepared, and the system was as shown in Table 4. The PCR reaction procedure was: 37 ℃ for 5min; and (3) carrying out 5min and 5 cycles at 20 ℃, namely, cutting the ligation product.

TABLE 4 Table 4

System of	Volume of
		pYLsgRNA-AtU3d plasmid (20 ng/. Mu.l)	1.0μl
Target sequence linker	0.5 μl (final concentration of 0.05-0.1 μM)
		BsaⅠ(5U/μl))	1.0μl
10 XNEBT 4DNA ligase buffer (1.0 mM TP)	0.5μl
		T4DNA ligase (ligase) (35U/. Mu.l)	1.0 μl (containing 35U finally)
CutSmart buffer	1.0μl
		ddH ₂ O	5μl

Then 2 rounds of PCR were performed to obtain stable specific target products and avoid amplification of empty products. In the first round of PCR amplification, 1 mu l of the enzyme digestion connection product obtained in the last step is taken as a template for respectively carrying out two PCR reactions for amplification aiming at a forward target sequence and a reverse complementary target sequence, and the primer concentration is 10 mu M.

TABLE 5

The reaction conditions of both reaction 1 and reaction 2 are: 95 ℃ for 15s;60 ℃ for 15s;72 ℃,15s;25-28 cycles, 5. Mu.l of the PCR product was taken and subjected to 2% agarose gel electrophoresis, and 1. Mu.l of each of the PCR products of reaction 1 and reaction 2 was taken and subjected to ddH ₂ O was diluted 10-fold and used as template for the second round of PCR reaction.

TABLE 6

Name of the name	Sequence (5 '-3')
		U-F	CTCCGTTTTACCTGTGGAATCG(SEQ ID NO.11)
gRNA-R	CGGAGGAAAATTCCATCCAC(SEQ ID NO.12)

Second round PCR reaction:

TABLE 7

The second round of PCR reaction procedure is the same as the first round of PCR reaction procedure, 5 μl of the obtained PCR product is detected by agarose gel electrophoresis, and the remaining 45 μl is purified and recovered by using a TaKaRa purification kit for the next enzyme digestion and ligation reaction.

TABLE 8

Name of the name	Sequence (5 '-3')
		B1’	TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG(SEQ ID NO.13)
BL	AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC(SEQ ID NO.14)

pYLCRISPR/Cas9-DH final vector cleavage ligation reaction:

TABLE 9

The reaction procedure is: 37 ℃ for 2min;10 ℃ for 3min;20 ℃,5min,10-15 cycles; 37 ℃ for 2min; namely, the enzyme digestion is connected with the reaction liquid. Finally, the enzyme digestion connection reaction liquid is subjected to competent cell transformation of the escherichia coli, and the pYLCRISPR/Cas9-DH vector plasmid containing the connection target sequence is obtained after sequencing and identification.

4. Genetic transformation and detection of PagSWEET15b Gene

1. Genetic transformation

The constructed pMDC32-PagSWEET5b overexpression vector and the pYLCRISPR/Cas9-DH vector carrying gRNA are respectively transferred into agrobacterium GV3101 by an electric shock method, and transferred into poplar by agrobacterium mediation, and the transformation steps are as follows:

84K tissue culture seedling for genetic transformation has the temperature of 23-25 ℃, the illumination of 16/8h (day/night) and the illumination intensity of 50 mu M M ^-2 ·s ^-1 Is cultured under the condition of (2). Agrobacterium containing pMDC32-PagSWEET15b overexpression vector and pYLCRISPR/Cas9-DH vector at OD ₆₀₀ When the leaf disc is=0.6-0.8, the leaf disc is infected with 84K. Co-culturing the infected leaf disk on adventitious bud induction medium (SIM, murashige-Skoog (MS) minimal medium added with 0.5mg/l 6-benzyl aminopurine (6-BA) and 0.05mg/l naphthaleneacetic acid (NAA)) at 22+ -2deg.C under dark conditionAnd (3) days. Transferring the cocultured leaf disk onto SIM containing 3mg/L hygromycin B and 200mg/LTimentin, culturing at 23-25deg.C under 16/8 hr (day/night) and light intensity of 50μm.m ^-2 ·s ^-1 Inducing and screening resistant adventitious buds under the condition of (1). After about 30 days of induction culture, the resistant adventitious shoots were transferred to rooting medium containing 3mg/Lhygromycin B and 200mg/L Timentin (RIM, 1/2MS minimal medium supplemented with 0.05mg/L IBA and 0.02mg/L NAA) until adventitious roots were induced. And extracting the DNA of the rooted plant leaves, and determining whether the rooted plant leaves are positive strains by PCR verification.

Identification of expression level of PMDC32-PagSWEET15b overexpressing plant

Extracting RNA of each strain of the over-expressed plant, and carrying out qRT-PCR identification by taking cDNA synthesized after reverse transcription as a template. The detection primer is shown in SEQ ID NO.5-6, and PagACTIN is used as an internal reference gene. As shown in FIG. 3, the expression level of PagSWEET15b in the over-expressed transgenic plants OE-4 and OE-31 was increased 80-fold and 1200-fold, respectively, compared with the control 84K plant.

3. Identification of the PagSWEET15b Gene editing form of mutant plants

Extracting DNA of each strain of the gene editing plant as a template, designing mutant plant detection primers PagSWEET15b-gF and PagSWEET15b-gR, carrying out PCR amplification by using PrimeSTAR high-fidelity enzyme, connecting the obtained PCR product to a T vector (Aidelai zero background pTOPO-TA/Blunt universal cloning kit, aidelai, beijing) and converting the obtained PCR product into competent cells of the escherichia coli, identifying positive clones by bacterial liquid PCR, and sequencing the clones to a sequencing company. More than 10 single clones were selected for sequence alignment analysis to identify the gene editing form. FIG. 4 is a gene editing form of mutants KO-6 and KO-12 in example 1 of the present invention. Successful knockout of the PagSWEET15b gene sequence by mutants KO-6 and KO-12 was confirmed.

Table 10

Name of the name	Sequence (5 '-3')
		PagSWEET15b-gF	TTCTCCATTTGGCATTCACA(SEQ ID NO.15)
PagSWEET15b-gR	GCATCCGAAGATTCAATTCC(SEQ ID NO.16)

5. Bacterial phenotype observation of PagSWEET15b transgenic plants

Fusarium solani (F.solani (Mart.) Sacc, provided by China center for culture Collection of microorganisms, with a culture Collection number of CFCC 51703) grows on PDA culture medium for 5 days, and spores are collected by washing the cake with sterile water to obtain spore liquid with a concentration of 1×10 ⁷ And each mL. Then, the strain with different transgenes obtained by the method is subjected to inoculation phenotype observation, so that PagSWEET15b over-expressed strain OE-4 and OE-31 are more sensitive to Fusarium solani, leaves begin to wither after 3 days of infection, leaves wither after 5 days of non-transgenic 84K plants, and the leaves of mutants KO-6 and KO-12 still do not wither after 7 days of inoculation, and the resistance to Fusarium solani is obviously enhanced. FIG. 5 shows 84K, over-expressed plants and mutant plant phenotypes 7 days after inoculation. The research results prove that PagSWEET15b plays a key role in the interaction process of poplar and Fusarium putrescens, and the PagSWEET15b mutant with stable inheritance has important application value in the breeding of poplar disease-resistant molecules.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims

1. The poplar sugar transport protein gene PagSWEET15b is characterized in that the nucleotide sequence is shown in SEQ ID NO. 3.

2. The protein encoded by the poplar sugar transport protein gene PagSWEET15b as claimed in claim 1, wherein the amino acid sequence of the protein encoded by the protein is shown in SEQ ID NO. 4.

3. Use of the poplar sugar transport protein gene PagSWEET15b according to claim 1 for regulating sensitivity of plants to fusarium solani.

4. The use according to claim 3, characterized in that up-regulating the expression level of the poplar sugar transporter gene PagSWEET15b increases the sensitivity of the plant to fusarium putrescence.

5. The use according to claim 3, characterized in that the expression level of the poplar sugar transporter gene PagSWEET15b is down-regulated, reducing the sensitivity of the plant to fusarium putrescence.

6. The use according to claim 5, characterized in that the knock-out vector of the poplar sugar transport protein gene PagSWEET15b is constructed by using CRISPR/Cas9 method, and transferred into a recipient material to reduce the sensitivity of plants to fusarium putrescens.

7. The use according to claim 3, wherein the plant comprises poplar.

8. A method for improving the disease resistance of plants against fusarium solani, comprising the step of down-regulating the expression level of the poplar sugar transport protein gene PagSWEET15 b; the nucleotide sequence of the poplar sugar transport protein gene PagSWEET15b is shown as SEQ ID NO. 3.

9. The method of claim 8, wherein the knock-out vector of the poplar sugar transport protein gene PagSWEET15b is constructed by using a CRISPR/Cas9 method, and is transferred into a receptor material to improve the resistance of plants to fusarium solani disease.

10. The method of claim 8, wherein the plant comprises poplar.