CN111635906A

CN111635906A - Gossypium barbadense GbCYP72A2 gene, and coding protein and application thereof

Info

Publication number: CN111635906A
Application number: CN202010497476.6A
Authority: CN
Inventors: 徐剑文; 肖松华; 赵君; 刘剑光
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2020-06-03
Filing date: 2020-06-03
Publication date: 2020-09-08

Abstract

The invention discloses a Gossypium barbadense GbCYP72A2 gene, its coding protein and application, wherein the 1 st base from the 5' end of the gene is a transcription initiation site, the 1558-1560 th base is a transcription termination codon, the coding frame is 1557 bases, 519 amino acids are coded in total, the gene has 97% similarity with a homologous gene GbCYP72A1, but 3% sequence difference can endow plants with higher verticillium wilt resistance, can enrich disease-resistant gene resources, provide an effective new tool for breeding of cotton verticillium wilt resistance, and the overexpression of the gene can reduce the sensitivity of the plants to ABA in the germination period, and the downregulation expression can promote the growth of the plants.

Description

Gossypium barbadense GbCYP72A2 gene, and coding protein and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a gossypium barbadense GbCYP72A2 gene, a coded protein thereof and application thereof in plant verticillium wilt resistance.

Background

Cotton is one of the important commercial crops, and cotton fiber is the main raw material in the textile industry. With the reduction of arable land area and the deterioration of environment, cotton production is affected by various biological and non-biological factors, and especially, the frequent occurrence of blight and verticillium wilt causes great loss to the cotton production in China. The traditional breeding method is difficult to meet the requirements of modern agriculture, so that the method for improving the existing variety by genetic engineering is a main method for breeding in the future. Previous research results show that resistance mechanism of cotton verticillium wilt involves multiple signal pathways and substances. Research results have been obtained that show that terpene aldehydes and phenylpropanoids are involved in the process of cotton resistance to verticillium wilt. Results have been obtained showing that at least the signalling pathways of active oxygen, salicylic acid, jasmonic acid, ethylene, brassinolide, spermine and Camalexin (Johansson et al, 2006; Gao et al, 2013; Mo et al, 2015, 2016) are involved in the resistance process of cotton to verticillium wilt. In order to explore the resistance mechanism of cotton to verticillium wilt, a large number of genes related to plant verticillium wilt resistance are cloned by a plurality of researchers. Among them, the Ve1 gene in tomato is the most famous gene for resisting verticillium wilt cloned at present (Kawchuk et al, 2001; Fradin et al, 2011), but research shows that the gene has no resistance to verticillium wilt of cotton, which indicates that the resistance mechanism of cotton to verticillium wilt is greatly different from that of tomato (Liulin et al, 2014). Some Ve-related genes are also cloned in cotton, transgenic cotton shows different degrees of resistance to verticillium wilt, but the deep discovery of the disease resistance mechanism of the transgenic cotton has no related report (Zhang et al, 2011; Zhang et al, 2012). In addition to the Ve gene, researchers have cloned a number of other genes from the cotton genome that are associated with verticillium wilt resistance, including GbCAD1, GbSSI2(Gao et al, 2013), GbRLK (Zhao et al, 2015), GbSTK (Zhang et al, 2013), GbTLP1(Munis et al, 2010), GbERF1-like (Guo et al, 2016), ghdao (Mo et al, 2015), GhSAMDC (Mo et al, 2016), and Gbvdr5(Yang et al, 2015), among others. Meanwhile, some researchers have also shown that some exogenous genes can also improve the resistance of cotton to verticillium wilt, such as GAFPs (Wanget al, 2015) and Hpal_Xoo(Miao et al.，2010)、NaD1(Gaspar et al.，2014) P35 (Tianet al, 2010), and Hcm1(Zhang et al, 2016). The above research is still in the experimental stage, only the engineering plants with resistance to verticillium wilt are obtained, but no report on the development of resistant varieties by transgenic methods is available, and the production availability of the varieties is needed to be further explored.

CYP450 is a family of proteins that are widely found in microorganisms, plants, and animals. These proteins have monooxygenase activity and are capable of catalyzing a variety of different reactions, but the main mechanism of their catalytic action is: one oxygen atom in an oxygen molecule is inserted into the substrate and the other oxygen atom is reduced to a water molecule (Werck-Reichhart, Feyereisen, 2000). The CYP450 protein is one of the largest protein families in plants, and there are 272 CYP450 gene family members in arabidopsis thaliana, which are involved in the synthesis of various substances including not only macromolecular substances such as lignin, suberin, cutin, etc., but also small molecular substances such as hormones and signal molecules (Werck-Reichhart et al, 2002). However, due to the large number, the function of most CYP450 proteins has not been revealed. Some CYP450 genes play an important role in disease resistance of plants, and the disease resistance of the genes is reported in succession. For example, AtCYP76C2 can improve the resistance of Arabidopsis thaliana to Sclerotinia sclerotiorum (Chengxing et al, 2011), and OsCYP71Z2 can improve the resistance of rice to bacterial blight (Li et al, 2013). In recent years, studies have shown that some CYP450 genes also play an important role in plant verticillium wilt resistance. For example, the solanum torvum StoCYP77a2 gene can improve the resistance of tobacco to verticillium wilt (Yang et al, 2015); the cotton ghyp 82D protein-encoding gene SSN (silent-INDUCED stemmemminor) regulates systemic cell death via the octadecane fatty acid pathway, and silent expression thereof can improve resistance of cotton to verticillium wilt, while the disease resistance of over-expressed lines is reduced (Sun et al, 2014). The lignin synthesis pathway plays an important role in plant verticillium wilt resistance, some CYP450 proteins are key catalytic enzymes in the pathway, for example, AtCYP73A5 has a Cinnamate-4-carboxylase (C4H) function, and AtCYP98A3 has a p-coumaroyl shikimate 3 'hydroxylase (C3' H) function (Fraser, Chapple, 2011). In the verticillium wilt resistant cotton variety, the expression level of the coding genes of C4H and C3' H is obviously higher than that of the susceptible variety (Xu et al, 2011).

In the CYP450 gene family, some of the CYP72 subfamily members have been reported to be involved in plant response and resistance to pathogenic bacteria. In the CYP72A gene cluster in rice, the expression of 7 CYP724 genes is induced by infection with Pyricularia oryzae (Yaling et al, 2004). The expression of CYP72a14 in arabidopsis was induced by botrytis cinerea and potato late blight, while its EST sequence of the homologous gene in upland cotton (TC145315) was also detected to be infected with verticillium wilt (Xu et al, 2014). The npyp 72a2 gene in wrinkled tobacco can increase resistance of tobacco to pseudomonas (Smigocki, Wilson, 2004). However, the molecular functions and mechanisms of action of these CYP72A genes are not known.

Disclosure of Invention

The invention aims to provide a gossypium barbadense GbCYP72A2 gene, which can remarkably improve the resistance of cotton to verticillium wilt.

In order to achieve the purpose, the invention adopts the following technical scheme:

the DNA molecule of the gossypium barbadense GbCYP72A2 gene is the nucleotide sequence shown as SEQ ID NO.1 in the sequence table or the nucleotide sequence capable of hybridizing with the DNA sequence shown as SEQ ID NO.1 in the sequence table. The Gossypium barbadense GbCYP72A2 gene is from Gossypium barbadense sea 7124 and is located on chromosome D4 of a cotton chromosome group.

The protein coded by the sea island cotton GbCYP72A2 gene is an amino acid sequence shown in SEQ ID No. 2.

Wherein, SEQ ID NO.1 in the sequence consists of 1560 bases, the 1 st base from the 5' end is a transcription start site, the 1558-1560 th base is a transcription stop codon, the coding frame is 1557 bases, 519 amino acids are coded in total, the molecular weight is 127KD, and the isoelectric point is 5.0. The protein has 1 transmembrane domain, 1P 450 region.

The DNA of the sea island cotton variety H7124 is used as a template to amplify to obtain a genome sequence of GbCYP72A2 gene, then root tissue RNA of different periods after the sea island cotton variety H7124 is inoculated with verticillium wilt is extracted, reverse transcription is carried out to obtain cDNA which is used as a template, and a primer pair F: ATGGATTCAACAGCAAAGC and R: CTATAAAGGATGAAGCATTAC are used to amplify to obtain the GbCYP72A2 gene sequence of the sea island cotton variety H7124.

An important object of the invention is to provide an application of a gossypium barbadense GbCYP72A2 gene (which belongs to gossypium barbadense cytochrome P450 gene) and an expression vector or a host cell thereof in obtaining transgenic plants with verticillium wilt resistance. Among them, the most important effect is in the breeding process of cotton verticillium wilt resistance, besides the verticillium wilt resistance of plants can be improved, the over-expression of the verticillium wilt resistance can reduce the sensitivity of the plants to ABA in the germination period, and the down-regulation of the expression of the verticillium wilt resistance can promote the growth of the plants.

The GbCYP72A2 gene is induced by verticillium dahliae strain V991 to obviously increase the expression level, silence GbCYP72A2, obviously reduce the resistance of sea island cotton sea 7124 to the verticillium dahliae strain V991, construct an overexpression vector of the GbCYP72A2 gene, transform arabidopsis thaliana, and obviously improve the resistance of transgenic arabidopsis thaliana to the verticillium dahliae strain V991. The gene of the present invention may be used in constructing various plant expression vectors to raise the disease resistance of verticillium wilt related host plant or improve the resistance of cotton to verticillium wilt.

Expression vectors, recombinant strains or transgenic cell lines containing the above genes are all within the scope of the present invention.

Cloned genes comprising the nucleotide sequences provided herein or at least a portion of the nucleotide sequences can be expressed in a foreign host by a suitable expression system to increase disease resistance of a verticillium wilt-associated host plant.

A polypeptide comprising an amino acid sequence or at least a partial sequence provided by the present invention may still have biological activity or even new biological activity after removal or substitution of certain amino acids.

Genes comprising the nucleotide sequences provided by the invention or at least part of the nucleotide sequences can be expressed in heterologous hosts and their function in the metabolic chain of the host is understood by DNA chip technology.

Contains the protein coded by the nucleotide sequence provided by the invention and can synthesize the nucleotide sequence and the protein which are the same as or similar to the GbCYP72A2 gene in function.

The gene comprising the nucleotide sequence or at least part of the nucleotide sequence provided by the present invention can be used for constructing a recombinant plasmid through genetic recombination to obtain a novel biosynthetic pathway, and can also be used for obtaining a novel biosynthetic pathway through insertion, replacement, deletion or inactivation.

The inclusion of a non-ribosomal peptide synthetase provided by the present invention can generate novel polypeptide compounds by deleting, inserting or inactivating one or more non-ribosomal peptide synthetase domains, modules or genes from the same or different non-ribosomal peptide synthetase systems.

Fragments or genes comprising the nucleotide sequences or at least part of the nucleotide sequences provided by the invention can be used to construct libraries of non-ribosomal peptide synthetases or libraries derived from non-ribosomal peptide synthetases or combinations.

The gene can also be used in the aspects of gene engineering, protein expression, enzyme catalytic reaction and the like, and can also be used for searching and discovering compounds or genes for medicine, industry or agriculture so as to expand the source range of the GbCYP72A2 gene, thereby having higher application prospect.

The invention has the following advantages:

(1) the gene GbCYP72A2 obtained by the invention is a brand-new gene capable of endowing plants with verticillium wilt resistance, and the gene and the functions thereof in the plants are not reported. In different resistant and sensitive cotton varieties, the coding region of the gene and the expression mode after inoculation have obvious difference, the GbCYP72A2 gene is constructed into an over-expression vector and is introduced into Arabidopsis, and the disease resistance of the transgenic Arabidopsis is obviously improved. By comparison, the gene has a difference in sequence with a homologous gene GbCYP72A1 gene (disclosed in the invention patent with the publication number CN108588041A and the invention name "Gossypium barbadense cytochrome P450 gene, its coding protein and application"), and compared with the gene GbCYP72A2 gene, the gene GbCYP72A1 gene is stronger in improving the verticillium wilt resistance of plants. Therefore, the clone of the cytochrome GbCYP72A2 gene can enrich the disease-resistant gene resource and provide an effective new tool for breeding cotton with verticillium wilt resistance.

(2) The GbCYP72A2 gene obtained by the invention can further analyze the molecular mechanism of cotton verticillium wilt resistance. Whether the GbCYP72A2 gene is involved in a signal path related to disease resistance, what is the upstream gene and the downstream gene respectively, and what is the protein interacted with the upstream gene, and why the resistance is obviously different from the GbCYP72A1 gene sequence by a small difference, so that the knowledge of the anti-verticillium wilt mechanism of cotton can be theoretically expanded through further research on the gene.

(3) And the inventor carries out further research on the gene, and finds that the overexpression of the gene can reduce the sensitivity of the plant to ABA in the germination period and the down-regulation of the gene can promote the growth of the plant through experiments besides improving the verticillium wilt resistance of the plant.

Drawings

FIG. 1 shows the expression pattern of the GbCYP72A2 gene of the invention after inoculation of verticillium dahliae on different cotton species,^**：P＜0.01。

FIG. 2 is a cluster analysis of proteins encoded by the GbCYP72A1 gene and the GbCYP72A2 gene with the cytochrome P450 gene in Arabidopsis thaliana.

FIG. 3 is a comparative analysis of the sequences of proteins encoded by the GbCYP72A1 gene and the GbCYP72A2 gene. A: aligning the sequences of the GbCYP72A1 gene and the GbCYP72A2 gene coding proteins; b: aligning GbCYP72A1 gene GbCYP72A2 gene coding protein domains; c: the GbCYP72A1 gene and the GbCYP72A2 gene are aligned in three-dimensional structure.

FIG. 4 shows that the resistance to verticillium wilt is remarkably reduced by using VIGS to silence GbCYP72A2 gene in Gossypium barbadense H7124. A: no negative Control (CK) and positive control pTRV2 were injected: : phenotype observation of leaves 14 days after CLA 1; b: RT-PCR validation injection of pTRV2: :00 and pTRV2: : the expression condition of GbCYP72A2 gene in cotton seedlings after GbCYP72A 2; c: injection of pTRV2: :00 and pTRV2: : phenotype observation of GbCYP72A2 cotton plants 28 days after inoculation; d: no negative control CK injected, pTRV2 injected: :00 and injection of pTRV2: : carrying out statistics on disease index of GbCYP72A2 cotton plants 21 days after inoculation; e: injection of pTRV2: :00 and injection of pTRV2: : comparing stem longitudinal cutting of GbCYP72A2 cotton plants 21 days after inoculation; f: injection of pTRV2: :00 and injection of pTRV2: : the stem segments of GbCYP72A2 cotton plants are cultured on the PDA culture medium for 7 days after inoculation for 21 days, and hypha grows; standard deviation was calculated as 3 replicates, obtained for 20 seedlings each time,.: p is less than 0.01.

FIG. 5 is a identification of verticillium wilt resistance in GbCYP72A2 transgenic Arabidopsis thaliana. A: analyzing the expression of a target gene of transgenic arabidopsis; b: phenotype of transgenic Arabidopsis thaliana after 21 days of inoculation with Verticillium dahliae; c: disease index, disease incidence and ratio of each disease grade after transgenic arabidopsis is inoculated with verticillium wilt bacteria for 21 days are counted: p < 0.05, x: p is less than 0.01.

FIG. 6 shows germination identification of GbCYP72A2 transgenic Arabidopsis thaliana on 1/2MS medium containing 2. mu.M ABA. A: phenotype of GbCYP72A2 transgenic Arabidopsis 8 days after germination on 1/2MS medium containing 0. mu.M and 2. mu.M ABA; b: counting the germination rate of GbCYP72A2 transgenic Arabidopsis within 8 days on 1/2MS culture medium containing 2 mu M ABA; c: counting the ratio of the greening cotyledons of the GbCYP72A2 transgenic Arabidopsis thaliana after germinating for 8 days on 1/2MS culture medium containing 2 mu M ABA; standard deviation was calculated as 3 replicates, obtained for 50 seeds each: p is less than 0.01.

FIG. 7 is an analysis of the effect on plant growth by silencing the GbCYP72A2 gene in Gossypium barbadense H7124 using VIGS. A: injection of pTRV2: 00 and pTRV2: phenotypic observations of GbCYP72a2 cotton plants after 14 days; b: positive control pTRV2: : phenotype observation of leaves 14 days after CLA 1; c: injection of pTRV2: :00 and pTRV2: : statistics of cotyledon height and cotyledon to first true leaf length of GbCYP72A2 cotton plants after 14 days; the standard deviation was calculated as 3 replicates, obtained for 20 seedlings each, with different lower case letters: p is more than 0.01 and less than 0.05, and different capital letters: p is less than 0.01.

Detailed Description

The present invention will be described in detail below with reference to specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description which follows is a preferred embodiment of the invention, but is made for the purpose of illustrating the general principles of the invention and not for the purpose of limiting the scope of the invention. The scope of the present invention is defined by the appended claims.

1. Test materials

The upland cotton sugao No. 8 and the sea island cotton variety H7124 used in the experiment are introduced by agricultural academy of sciences of Jiangsu province, and are strictly selfed for years to breed and maintain purity. The invention relates to a scotch VR025 of a gossypium hirsutum introduction system, which is a disease-resistant material bred by the research laboratory for many years (the material is disclosed in the invention patent with the publication number of CN 105713976A and the invention name of the material is 'sea island cotton chromosome segment and molecular marker' capable of improving the verticillium wilt resistance of gossypium hirsutum), is a plant with the sea island cotton sea 7124 chromosome segment and with the background of the gossypium hirsutum 8, and has the verticillium wilt resistance which is obviously higher than that of the gossypium hirsutum 8 through 2-year disease nursery and greenhouse disease resistance identification. The Arabidopsis thaliana variety is Columbia (col-0) and is susceptible to verticillium wilt. The materials used in the present invention can be purchased from the market or obtained according to the methods disclosed in the prior art, and the methods used in the present experiments are conventional methods unless otherwise specified. The primers used were synthesized by Nanjing Kingsrei Biotech Ltd.

2. Test method

2.2 acquisition of GbCYP72A2 Gene

The total genome scanning is carried out on Sumiao No. 8 and SuVR 025 by using 3100 pairs of SSR primers distributed on 26 chromosomes of cotton, and polymorphic markers NAU3392, NAU6992, NAU6993, NAU3791, cgr6409, JESPR220, NAU5294, NAU7290, ZHX1, ZHX6 and ZHX29 are screened (the primers are disclosed in the patent publication No. CN 105713976A, the invention name is 'sea island cotton chromosome fragment and molecular marker capable of improving the verticillium wilt resistance of upland cotton'). The introduced fragment was anchored to chromosome D4 using published cotton D genome sequences and primer sequences. And extracting a target segment sequence according to a genomic database of cotton diploid D genome Raymond cotton, and developing an SSR marker. SSRs information mining is accomplished through SSRlocator I packages. The search criteria for SSRs are: the number of times of dinucleotide repetition is more than or equal to 9; the trinucleotide repetition time is more than or equal to 6; the number of the tetranucleotide repeats is more than or equal to 5; the number of times of the pentanucleotide repetition is more than or equal to 4; the number of times of repetition of the hexanucleotide is more than or equal to 3; the overall length of the composite SSR is not less than 24 bp. SSRs-labeled primers were designed by primer3 programming. The main parameters for primer design are: the length of the primer is 18-20bp, and the optimal length is 20 bp; the length of the PCR product is 100-280 bp; the Tm value is 55-65 ℃, and the optimal Tm value is 60 ℃; the GC content is 45-65%, most preferably 50%. The Nanjing Kinshire Biotechnology Ltd completes the synthesis of all primers.

Using F containing 1100 individuals₂(Su VR025 × Su Cotton No. 8) population linkage was constructed while F was treated in the greenhouse_2:3Inoculating non-defoliating Bp2 verticillium wilt, and using composite interval mapping method to locate disease-resistant gene or disease-resistant QTL. Disease resistance identification was performed 3 times in 3 different environments, QTL was detected between the markers ZHX57-ZXH70, with an average explained phenotypic variation of 22.4% and LOD values between 4.9 and 9.6 (Table 1).

TABLE 1 QTL associated with verticillium wilt resistance detected in 3 independent replicates using Composite Interval Mapping (CIM)

Note: e1, E2 and E3 represent 3 different environments, respectively.

Analyzing the sequences of the target segments of the gossypium barbadense variety Xinhai 21 and the gossypium hirsutum variety TM-1 according to the sequencing result of the cotton genome, and predicting the genes contained in the target segments. The results showed that the New sea 21 contained a total of 20 genes in the marker ZHX57-ZXH70 segment (Table 2). In order to narrow the scope of the selected genes, we selected 4 genes for expression analysis after inoculation according to the gene GO (Gene ontology) enrichment result and the existing research result, namely Cytochrome P450, Probableeper-like protein kinase, 6-phosphor purification 3 and ZZ-type finger-ligation protein. The three-leaf stage seedlings of Su VR025, sea 7124 and Su cotton No. 8 cotton are used as materials, verticillium wilt bacteria Bp2 are inoculated, the treatment time is 0h, 24h, 48h, 96h and 144h, and meanwhile, the same period of water treatment is used as a control. Taking 1. mu.g of total RNA, and performing reverse transcription according to TAKARA kit instructionsThe first strand cDNA was synthesized, 1 μ L of the reverse transcription product was diluted 10 times and subjected to qRT-PCR, 1 pair of primers specifically amplifying eukaryotic constitutive expression gene EF1 α (GenBank accession number AF120093) was subjected to parallel PCR as internal control, the Primer sequence was F AGACCACCAAGTACTACTGCAC, R: CCACCAACTTTGTACACAATCC, real-time quantitative PCR was performed using ABIPristm 7500 type fluorescent quantitative PCR instrument (ABI, USA), the method was SYBR Green I dye method, the reaction system was 20 μ L, cDNA,1 μ L, Primer F (10 μ M),1 μ L, Primer R (10 μ M),1 μ L, SYBR Green I mix, 10 μ L, water was supplemented to 20 μ L, the program was 95 ℃,10 min, 95 ℃,10 s, annealing was 58 ℃, 20s, 72 ℃, 30s, 40 Cycles, 72 ℃,10 min, and the final expression program was run 2- △△△ relative to the target expression program^CT，△△△CT＝[(Ct_{Target gene}-Ct_{Internal reference gene})_{Processing at a given time}-(Ct_{Target gene}-Ct_{Internal reference gene})_0h]_V.D-[(Ct_{Target gene}-Ct_{Internal reference gene})_{Processing at a given time}-(Ct_{Target gene}-Ct_{Internal reference gene})_0h]_CK. Wherein the primers used for detecting the expression of the GbCYP72A2 gene are F: CCCTTTTCGATGGGACCTCG and R: TCAGAACTTCAGGCATCACCC. The results show that the expression of the GbCYP72A2 gene has significant difference in resistant and susceptible varieties. In threv r025 and sea 7124, GbCYP72a2 gene was continuously up-regulated in 24h to 96h after inoculation. In Scobium peruvianum No. 8, the expression level of the gene was decreased after 48 hours (FIG. 1). Therefore, the gene is presumed to play a key role in the verticillium wilt resistance of cotton and is named as GbCYP72A 2.

TABLE 2 genetic information contained in the New sea 21 target segment

2.2 sequence analysis of GbCYP72A2 Gene

According to the genome sequence of the GbCYP72A2 gene, a specific primer is designed, and the DNA of sea island cotton sea 7124 is used as a template to amplify to obtain the genome sequence. Root RNA of verticillium dahliae inoculated by sea 7124 of sea island cotton is extracted, cDNA obtained by reverse transcription is used as a template, and the open reading frame of GbCYP72A2 gene in sea island cotton 7124 is obtained by amplification. The result shows that the GbCYP72A2 gene has 3678bp length in the sea island cotton sea 7124 genome sequence. The ORF of the gene is 1560bp in length (SEQ ID NO. 1). Through further analysis of the gene sequence GbCYP72A2 in sea island cotton sea 7124, the gene codes 519 amino acids (SEQ ID NO.2), the molecular weight is 127KD, and the isoelectric point is 5.0. The protein has 1 transmembrane domain, 1P 450 domain. Clustering analysis with the Arabidopsis CYP450 gene revealed that the gene belongs to the CYP72A subgroup (FIG. 2).

Further, the amino acid sequence of the encoded protein was compared between the gene GbCYP72A2 and the gene GbCYP72A1 (disclosed in the patent publication CN108588041A entitled "Gossypium barbadense cytochrome P450 gene, its encoded protein and its use"), and it was found that the protein sequences encoded by the two genes had 11 amino acid differences (FIG. 3A). After analysis of the two protein domains, the domains of the two proteins were highly similar, both containing a transmembrane domain and a P450 domain of the same size (fig. 3B). However, after analyzing the three-dimensional structures of the two proteins by using a homologous modeling method in the swiss-model database, the protein encoded by the gene GbCYP72A2 has a significant bulge structure compared with the protein encoded by the gene GbCYP72A1 (FIG. 3C). Although the two genes are similar, but have different positions and different structures, whether the difference affects the disease resistance of the genes, whether the GbCYP72a1 gene has an unknown function, further, the inventors compared the disease resistance of the two genes, as detailed in fig. 2.3, and further analyzed the other functions, as detailed in fig. 2.4 and 2.5.

2.3 GbCYP72A2 Gene disease resistance analysis

In the present invention, we analyzed the resistance of the GbCYP72a2 gene to cotton verticillium wilt using the following two methods.

The method is characterized in that the resistance of cotton to verticillium wilt after gene silencing of GbCYP72A2 is verified by using a virus-mediated gene silencing method. Vectors used for virus-mediated gene silencing were pTRV1 and pTRV2, respectively, and cotton albino gene (ghcia 1) was used as a control (wangxiyu)Etc., 2014). Primers are designed at the 3' end of the GbCYP72A2 gene, and a 398bp fragment is amplified and subcloned into a pTRV2 vector. Positive pTRV1, pTRV2 (negative control) and pTRV2 are selected, CLA1 (positive control) and single colony of pTRV2 plasmid Agrobacterium GV3101 containing GbCYP72A2 gene are cultured until the bacterial liquid OD600 is about 0.5. The cells were collected by centrifugation at 4,000rpm for 10 minutes at room temperature, and resuspended in an appropriate volume (10mM MgCl. RTM.)₂10mM MES and 200 mu M syringone acylate are resuspended to the final concentration of 2.0, the resuspended solution is stood for 3H at room temperature, the recovery solution of TRV1 and TRV2 is mixed evenly according to the volume ratio of 1:1, after two cotyledons of cotton seedlings are completely unfolded, an inoculation experiment of agrobacterium is carried out, the bacterial solution is injected into the cotyledons by adopting a blade syringe injection method, when the cotton seedlings of CLA1 show albinism (figure 4A), the expression condition of GbCYP72A2 gene in cotton bodies of silenced CYP72A2 gene is detected, the disease resistance condition of cotton plants is inoculated with verticillium wilt bacteria simultaneously by using cotton EF-1 α as internal reference gene (figure 4B), and after the disease resistance condition of cotton plants is investigated, after inoculation of the plant GbEF 72A2 gene is detected, after inoculation of GbRV 72A 5392, after the plant bodies of cotton seedlings show that the plant bodies of the cotton plants of the plant bodies of the cotton plants of the cotton trees of the plants.

Secondly, the resistance of the GbCYP72A2 gene to cotton verticillium wilt is verified by utilizing transgenic arabidopsis thaliana, and the verticillium wilt resistances of the GbCYP72A1 gene and the GbCYP72A2 gene are compared. Respectively constructing overexpression vectors of GbCYP72A1 gene and GbCYP72A2 gene, wherein the used plant expression vector is 35S-pCAMBIA2301-NORs, designing primers carrying XmaI and SacI enzyme cutting sites, amplifying and recovering target fragments, connecting the target fragments with a pMD-19(sample) vector, transforming Top10 competence, sequencing to obtain positive clones with correct sequences, carrying out enzyme cutting on the cloning vector and the plant expression vector of the target genes, respectively recovering target fragments of 2.3kb and 13kb, connecting the target fragments with T4 ligase, transforming Top10 competence to obtain the positive clones, namely recombinant vectors containing a CaMV35S promoter, the target genes GbCYP72A1 gene and GbCYP72A2 gene fragments, and naming pCAMBIA2301-35S-GbCYP72A1 gene and pCAMBIA2301-35S-GbCYP72A2 gene. The recombinant vector is transformed into agrobacterium GV3101 by a freeze-thaw method, arabidopsis is transformed by a flower dip-dyeing method, and seeds are harvested in a mixed mode. After sterilization, screening on MS culture medium containing kanamycin with the concentration of 50mg/L, and transplanting positive plants into a nutrient medium for growth. Taking leaves to extract DNA and RNA, and detecting whether the target gene is successfully transferred and expressed. And (3) carrying out continuous selfing for 2 generations to obtain homozygous strains, and carrying out anti-verticillium wilt identification on 3 strains transformed with GbCYP72A1 gene and GbCYP72A2 gene respectively (shown in figure 5A) by PCR detection. Digging out the arabidopsis thaliana growing in the sterilized soil for four weeks, firstly cleaning a culture substrate carried by the root of the arabidopsis thaliana in the sterilized water, then immersing the root of the arabidopsis thaliana in a conidium suspension of verticillium wilt pathogen, and transplanting the arabidopsis thaliana into the sterilized substrate after 2 minutes. Water was taken as a control for simulation, and fresh sterilized water and verticillium dahliae were changed for 20 strains of each inoculum. 40 strains are inoculated to each family, the environmental temperature of arabidopsis thaliana is kept at 23-25 ℃ after inoculation, and the soil humidity is kept to be beneficial to disease attack.

The result shows that the transgenic arabidopsis thaliana can obviously improve the resistance to verticillium dahliae of cotton. 21 days after inoculation of verticillium dahliae V991, disease index of GbCYP72a1 transgenic arabidopsis lines OE1, OE2 and OE3 were 61.1%, 56.9% and 55.6%, respectively, and disease incidence was 88.9%, 83.3% and 83.4%, disease index of GbCYP72a2 transgenic arabidopsis lines OE1, OE2 and OE3 were 33.3%, 34.7% and 33.4%, disease incidence was 61.1%, 61.2% and 66.7%, respectively, while disease index of non-transgenic control was 91.7%, and disease incidence was 100% (fig. 5B, C). The above results indicate that GbCYP72a2 gene can confer higher resistance to verticillium wilt in recipient plants than GbCYP72a1 gene.

The verticillium dahliae used in the invention is V991, can be introduced by scientific research units and is cultured by the following method: verticillium dahliae V991 was spread on a solid potato medium (potato 200g, agar 1) at 25 deg.C7g, 20g of sucrose and 1000ml of distilled water), transferring the mixture to a liquid potato culture medium (200 g of potatoes, 20g of sucrose and 1000ml of distilled water) after two weeks, carrying out shake culture at room temperature for 5 days, filtering the cultured pathogen solution, measuring the concentration of pathogen spores by using a blood counting plate, and diluting the concentration to 6 × 10⁷Spores per ml.

The investigation of the disease progression of the verticillium wilt is carried out according to the following standard, wherein the disease progression is 0: the plants are healthy, have no diseased leaves and grow normally; level 1: less than one fourth of the leaves of the plant are diseased, become yellow and wilted; and 2, stage: more than one fourth of the plant, less than one half of the plant leaves are diseased, and become yellow and wilted; and 3, level: more than one half of the plant leaves and less than three fourths of the plant leaves are diseased, and become yellow and wilted; 4, level: more than three fourths of the leaves of the plant are diseased, or the plant is withered. Disease Index (DI) of each strain was calculated based on the results of the survey.

DI＝[∑(Ni×i)/(N×4)]×100；i＝0～4,Ni＝plant number of reaction i

Function analysis of 2.4 GbCYP72A2 gene in ABA signaling pathway

3 GbCYP72A2 gene-transferred Arabidopsis strains were respectively sown on 1/2MS medium containing 0. mu.M and 2. mu.M ABA, and 100 seeds were sown per strain with 3 repeats using wild type Arabidopsis col-0 as negative control. After sowing, culturing in the dark at 4 ℃ for 3 days, then placing in a plant illumination incubator (24 ℃, 16h illumination/8 h dark), counting the germination rate, and the result shows that the germination rate of the transgenic line on 1/2MS culture medium containing 2 muM ABA is higher than that of the wild type control, and the germination rate is obviously improved at 9-11d (fig. 6A, B). The cotyledons that became green 14d after germination were counted and the results showed that the cotyledons greening ratio of the transgenic lines was significantly higher than that of the wild-type control (fig. 6A, C). The results indicate that overexpression of the GbCYP72a2 gene can reduce the sensitivity of plants to ABA during germination.

2.5 GbCYP72A2 Gene in-plant functional analysis

Referring to the VIGS silencing method in 2.3, the GbCYP72a2 gene in H7124 was silenced. 7d after emergence of albino phenotype of cotton seedlings injected with TRV:: CLA1, the cotyledon height and cotyledon to first true leaf length of H7124 plants (pTRV2:: GbCYP72A2) after silencing of GbCYP72A2 gene, H7124(Mock) not injected, and H7124 injected with empty vector (pTRV2::00) were measured. The results show that there is no significant difference in cotyledon height of each treated plant; after the cotyledon is damaged by injection, the length from the cotyledon to the first true leaf of the plant is obviously shortened; the cotyledon to first true leaf length of the silenced GbCYP72a2 gene was significantly longer than the control injected with the empty vector (fig. 7). The results show that the downregulation expression of the GbCYP72a2 gene can promote plant growth.

Although the invention has been described in detail above with reference to a general description and specific examples, it will be apparent to one skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> agricultural science and academy of Jiangsu province

<120> sea island cotton GbCYP72A2 gene, and coding protein and application thereof

<130>2020

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>1560

<212>DNA

<213>Gossypium barbadense Linn.

<400>1

atggattcaa cagcaaagct tttaatcttt ctggcaagtt ctttaacctt atttctactg 60

aaattccttc ataagtactg gtggatacct ttcaaaatac aaagagcact gagtttacaa 120

ggaatcaaag gacctccata tgagttcatc catggcaaca acaaagcctc cacccgtttc 180

agatacgaag ctttaagcaa acccatggct tccttaactc ataatatagt ccccagagtt 240

attcctcaga ttcattcatg gatcaacact tatgggaaga attatcttac gtgggagggg 300

aatcgagctc aactggtgat atccgaaccc gaattaatca aagagatact gaaaaccaac 360

gacggatctt ttccgaaaag gaaggatgat tcgagtatta ttcataagat cgtcggggaa 420

ggcctcgtga cctccgaagg tgcgaaatgg gcgaagcaaa ggaagttggc gaatcatgct 480

ttccatggag agagcttgaa aaatatgaat ccagcagtga ttgctagcgt tgagacgatg 540

ttggagaagt ggaaaggtcg agaaggcgaa gagatcgaag tgtttaacga gttcaggttg 600

ttgacttcgg aagttatatc gagaacggct ttcggtagta attacttgga agggaagaag 660

attttcgaca tgttgacgaa attggcgata ctagttagtc gaaattattt caaaactccg 720

attcctggca tcagcaagat atggaaaact gcggatgaaa tagaatcgga gaaacttgcc 780

aatggaattc atgattgtgt gatggaaatg gttaagagaa gggaaaagaa agtagagaca 840

ggagaatctg acggttttgg caatgatttt ctaggattac ttataaatgc ttatcgcgat 900

ttcgacgaga aaaatcgatt ttccatcgag gatctagtgg atgagtgcaa aacattctac 960

tttgccggtc aagaaacaac caactccttg cttgcgtgga cgatccttgt tttagcaatt 1020

catactaaat ggcaagaaaa aacaaggcaa gaggtgtttg aggtatttgg ggaccaaaat 1080

cctaattctg aaggcattgc caaattaaaa attatgaaca tggtcgtcaa tgaaaccttg 1140

agattgtatt ctcctgtagc tgccgtgatc cgaaagatca aaaaagaagt tcgattggga 1200

aagctcgttt tgcctgcaaa tctggagata ttgatcccaa tcatagcact tcaccatgac 1260

cctcaactat ggggagacga tgtacatctt ttcaaaccgg agagattcgt tgaaggcatc 1320

gctagtgcta ccaaatacaa ccctgcagca ttcattccct tttcgatggg acctcgatct 1380

tgcgttggca tgagctttgc aaccacagaa acaaaggttg ctctctcaat gattctccaa 1440

cgctacgcct ttactctctc cccgacctac gttcatgcgc catttcctgt aatcacgctt 1500

caaccacaac acggaattca agtaatgctt catcctttac accaccacca ccaccactag 1560

<210>2

<211>519

<212>PRT

<213>Gossypium barbadense Linn.

<400>2

Met Asp Ser Thr Ala Lys Leu Leu Ile Phe Leu Ala Ser Ser Leu Thr

1 5 10 15

Leu Phe Leu Leu Lys Phe Leu His Lys Tyr Trp Trp Ile Pro Phe Lys

20 25 30

Ile Gln Arg Ala Leu Ser Leu Gln Gly Ile Lys Gly Pro Pro Tyr Glu

35 40 45

Phe Ile His Gly Asn Asn Lys Ala Ser Thr Arg Phe Arg Tyr Glu Ala

50 55 60

Leu Ser Lys Pro Met Ala Ser Leu Thr His Asn Ile Val Pro Arg Val

65 70 75 80

Ile Pro Gln Ile His Ser Trp Ile Asn Thr Tyr Gly Lys Asn Tyr Leu

85 90 95

Thr Trp Glu Gly Asn Arg Ala Gln Leu Val Ile Ser Glu Pro Glu Leu

100 105 110

Ile Lys Glu Ile Leu Lys Thr Asn Asp Gly Ser Phe Pro Lys Arg Lys

115 120 125

Asp Asp Ser Ser Ile Ile His Lys Ile Val Gly Glu Gly Leu Val Thr

130 135 140

Ser Glu Gly Ala Lys Trp Ala Lys Gln Arg Lys Leu Ala Asn His Ala

145 150 155 160

Phe His Gly Glu Ser Leu Lys Asn Met Asn Pro Ala Val Ile Ala Ser

165 170 175

Val Glu Thr Met Leu Glu Lys Trp Lys Gly Arg Glu Gly Glu Glu Ile

180 185 190

Glu Val Phe Asn Glu Phe Arg Leu Leu Thr Ser Glu Val Ile Ser Arg

195 200 205

Thr Ala Phe Gly Ser Asn Tyr Leu Glu Gly Lys Lys Ile Phe Asp Met

210 215 220

Leu Thr Lys Leu Ala Ile Leu Val Ser Arg Asn Tyr Phe Lys Thr Pro

225 230 235 240

Ile Pro Gly Ile Ser Lys Ile TrpLys Thr Ala Asp Glu Ile Glu Ser

245 250 255

Glu Lys Leu Ala Asn Gly Ile His Asp Cys Val Met Glu Met Val Lys

260 265 270

Arg Arg Glu Lys Lys Val Glu Thr Gly Glu Ser Asp Gly Phe Gly Asn

275 280 285

Asp Phe Leu Gly Leu Leu Ile Asn Ala Tyr Arg Asp Phe Asp Glu Lys

290 295 300

Asn Arg Phe Ser Ile Glu Asp Leu Val Asp Glu Cys Lys Thr Phe Tyr

305 310 315 320

Phe Ala Gly Gln Glu Thr Thr Asn Ser Leu Leu Ala Trp Thr Ile Leu

325 330 335

Val Leu Ala Ile His Thr Lys Trp Gln Glu Lys Thr Arg Gln Glu Val

340 345 350

Phe Glu Val Phe Gly Asp Gln Asn Pro Asn Ser Glu Gly Ile Ala Lys

355 360 365

Leu Lys Ile Met Asn Met Val Val Asn Glu Thr Leu Arg Leu Tyr Ser

370 375 380

Pro Val Ala Ala Val Ile Arg Lys Ile Lys Lys Glu Val Arg Leu Gly

385 390 395 400

Lys Leu Val Leu Pro Ala Asn Leu Glu IleLeu Ile Pro Ile Ile Ala

405 410 415

Leu His His Asp Pro Gln Leu Trp Gly Asp Asp Val His Leu Phe Lys

420 425 430

Pro Glu Arg Phe Val Glu Gly Ile Ala Ser Ala Thr Lys Tyr Asn Pro

435 440 445

Ala Ala Phe Ile Pro Phe Ser Met Gly Pro Arg Ser Cys Val Gly Met

450 455 460

Ser Phe Ala Thr Thr Glu Thr Lys Val Ala Leu Ser Met Ile Leu Gln

465 470 475 480

Arg Tyr Ala Phe Thr Leu Ser Pro Thr Tyr Val His Ala Pro Phe Pro

485 490 495

Val Ile Thr Leu Gln Pro Gln His Gly Ile Gln Val Met Leu His Pro

500 505 510

Leu His His His His His His

515

Claims

1. The gossypium barbadense GbCYP72A2 gene is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.

2. The protein encoded by the GbCYP72A2 gene of claim 1, wherein the amino acid sequence thereof is represented by SEQ ID No. 2.

3. An expression vector, recombinant strain or transgenic cell line comprising the gene of claim 1.

4. A host cell comprising the expression vector of claim 3.

5. Use of the GbCYP72a2 gene according to claim 1 or 2 to obtain a transgenic plant with verticillium wilt resistance.

6. The GbCYP72A2 gene of claim 5, plays a role in breeding cotton for verticillium wilt resistance.

7. Use of the expression vector of claim 3 or the host cell of claim 4 for transforming plants to obtain transgenic plants with verticillium wilt resistance.

8. Use of overexpression of the GbCYP72a2 gene according to claim 1 to reduce sensitivity of a plant to ABA during germination.

9. Use of the downregulated expression of the GbCYP72a2 gene of claim 1 to promote plant growth.