CN113637681B

CN113637681B - Sea island cotton transmembrane protein GbTMEM214-A07/D07 gene and application

Info

Publication number: CN113637681B
Application number: CN202110883401.6A
Authority: CN
Inventors: 赵君; 刘剑光; 肖松华; 徐剑文
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2021-08-02
Filing date: 2021-08-02
Publication date: 2023-04-11
Anticipated expiration: 2041-08-02
Also published as: CN113637681A

Abstract

The invention discloses a sea island cotton transmembrane protein gene GbTMEM214-A07/D07 and application thereof, wherein the gene consists of 2414 bases, the 283 th base from the 5' end is a transcription initiation site, the 2025 th base is a transcription termination site, the total length of a coding region is 1743bp, the gene is a gene participating in the resistance process of cotton to verticillium wilt, the disease-resistant gene resource can be enriched, and an effective new tool is provided for the analysis of a cotton verticillium wilt resistance mechanism and disease-resistant breeding.

Description

Sea island cotton transmembrane protein GbTMEM214-A07/D07 gene and application

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a sea island cotton transmembrane protein gene sequence and application thereof.

Background

Cotton is one of the important commercial crops, and cotton fiber is the main raw material in the textile industry. Along with the reduction of arable land area and the deterioration of environment, cotton production is influenced by various biological and non-biological factors, and especially, the frequent occurrence of verticillium wilt causes great loss to the cotton production in China. Because the conventional upland cotton cultivated varieties lack immunity or high verticillium wilt resistance sources and are difficult to meet the requirements of modern agriculture through the traditional breeding method, the improvement of the existing varieties through a genetic engineering method is a main method for breeding in the future.

Research has shown that resistance mechanisms of cotton to verticillium wilt involve signal pathways such as active oxygen, salicylic acid, jasmonic acid, ethylene, brassinolide, spermine and Camalexin (Johansson et al, 2006, gao et al, 2013 mo et al, 2015, 2016). To date, a number of researchers have cloned a number of genes associated with plant resistance to verticillium wilt. The Ve1 gene in tomato is the most famous verticillium wilt resistant gene cloned at present (Kawchuk et al, 2001, fradin et al, 2011), but research shows that the gene has no resistance to verticillium wilt of cotton due to the fact that cotton verticillium wilt strains and tomato verticillium wilt strains are different, which shows that the disease resistance mechanism of cotton to verticillium wilt is different from that of tomato (liulin et al, 2014). A large number of verticillium wilt resistance related genes including GbCAD1 and GbSSI2 (Gao e) are also cloned in cottont al, 2013), gbRLK (Zhao et al, 2015), gbSTK (Zhang et al, 2013), gbTLP1 (Munis et al, 2010), gbERF1-like (Guo et al, 2016), ghao (Mo et al, 2015), ghSAMDC (Mo et al, 2016), and Gbvdr5 (Yang et al, 2015), and the like. Meanwhile, some researchers have also demonstrated that some exogenous genes can also improve the resistance of cotton to verticillium wilt, such as GAFPs (Wang et al, 2015), hpal _xoo (Miao et al, 2010), naD1 (Gaspar et al, 2014), p35 (Tian et al, 2010), and Hcm1 (Zhang et al, 2016). The above research is still in the experimental stage, only the engineering plants with resistance to verticillium wilt are obtained, but no report on the development of resistant varieties by transgenic methods is available, and the production availability of the varieties is needed to be further explored.

The cloned gene is a transmembrane protein gene in sea island cotton. Transmembrane proteins are special proteins existing on a biological membrane, are positioned at the junction of a cell and the outside, mediate signal conduction between the cell and the outside, sense plant pathogenic signals, participate in anti-stress reactions and are indispensable in the life activities of organisms. In the process of plant disease resistance, transmembrane proteins can recognize and accept pathogen signals, activate intracellular responses, transduce extracellular signals into cells, and induce defense responses (Ma et al, 2005). Such as rice bacterial blight-resistant gene Xa21 (Song et al, 1995), rice blast-resistant gene Pi-d2 (Chen et al, 2006), arabidopsis FLS2 gene (Robatzek et al, 2006), tomato verticillium wilt-resistant gene Vel (Fradin et al, 2011) and the like. The Transmembrane protein (TMEM) family is the main subject of research in the age of human functional genome, and no relevant report has been reported in plants. In combination with the reports on the existing functions of animal TMEM, it was found that they are mostly related to intercellular and intracellular signaling, immune-related diseases, tumorigenesis, development, etc., and that such proteins were typed and protein families were established, such as MS4A family, anocta min family, etc. (Katoh et al, 2004 christopher et al, 2006. TMEM is involved in a variety of physiological processes, such as ion channels that make up the plasma membrane, activation of signal transduction pathways, mediation of cell chemotaxis, adhesion, apoptosis, autophagy, and the like. But few documents report on the function of family members, indicating that research on them is still in the first stage, and also providing extensive space for research in this field (Gregersen et al, 2014, lee et al, 2017).

In the previous research stage, the inventor of the invention discloses a gossypium barbadense Transmembrane protein gene in Chinese invention patent with publication number CN107254474A, which is from gossypium barbadense sea 7124 and is located on chromosome D4 of cotton chromosome group, on the basis of the previous research, the invention carries out more intensive research on the transmurane protein214 gene in gossypium barbadense, and discovers a new gossypium barbadense Transmembrane protein gene transmurane protein214A gene which is named as GbTMEM214-A07/D07 gene and also has the function of anti-verticillium wilt, thereby enriching the gene resource of anti-verticillium wilt of cotton.

Disclosure of Invention

The invention aims to provide a novel sea island cotton transmembrane protein GbTMEM214-A07/D07 gene, which participates in a verticillium wilt resistance path of cotton and has application in cultivation of transgenic plants resistant to verticillium wilt.

In order to achieve the purpose, the invention adopts the following technical scheme:

the nucleotide sequence of the gossypium barbadense transmembrane protein gene GbTMEM214-A07/D07 can be shown as SEQ ID NO.1 in a sequence table. The gossypium barbadense transmembrane protein gene GbTMEM214-A07/D07 is derived from gossypium barbadense sea 7124 and is located on chromosome A07/D07 of a cotton chromosome group.

The amino acid sequence of the protein coded by the sea island cotton transmembrane protein gene is shown as SEQ ID No. 2.

Wherein, SEQ ID NO.1 in the sequence consists of 2414 bases, the 283 th base from the 5' end is a transcription starting site, the 2025 th base is a transcription termination site, the whole coding frame is 1743 bases, 580 amino acids are coded, the molecular weight is 64.36KD, and the isoelectric point is 9.45. The protein has 1 TMEM214 domain and 3 Low complexity.

An important purpose of the invention is to provide an application of the gossypium barbadense transmembrane protein gene, an expression vector or a host cell thereof in obtaining transgenic plants with verticillium wilt resistance. Among them, the most important role is in the breeding process of cotton against verticillium wilt.

The transmembrane protein gene GbTMEM214-A07/D07 related by the invention is obviously improved after being induced by verticillium dahliae, the GbTMEM214-A07/D07 gene is silenced, and the resistance of sea island cotton sea 7124 to cotton verticillium wilt strains Bp2 and V991 is obviously reduced. The gene of the present invention may be used in constructing various plant expression vectors to raise the disease resistance of verticillium wilt related host plant or improve the resistance of cotton to verticillium wilt.

The invention also discloses a method for cultivating transgenic plants, which is to specifically introduce the gene GbTMEM214-A07/D07 into ovule cells of target plants to obtain the transgenic plants. Specifically, the GbTMEM214-a07/D07 gene may be specifically introduced into the target plant through the recombinant expression vector. In the method, the recombinant expression vector can transform plant cells or tissues by using a conventional biological method such as Ti plasmid, ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium mediation, etc., and culture the transformed plant tissues into plants.

Expression vectors, recombinant strains or transgenic cell lines containing the above genes are all within the scope of the present invention.

The cloned gene comprising the nucleotide sequence or at least part of the nucleotide sequence provided by the invention can be expressed in a foreign host through a proper expression system to improve the disease resistance of host plants related to verticillium wilt.

Polypeptides comprising the amino acid sequences or at least partial sequences provided by the invention may still have biological activity or even new biological activity after removal or substitution of certain amino acids.

Genes comprising the nucleotide sequences provided by the invention or at least part of the nucleotide sequences can be expressed in heterologous hosts and their function in the metabolic chain of the host is understood by DNA chip technology.

Contains the protein coded by the nucleotide sequence provided by the invention and can synthesize the nucleotide sequence and the protein which are identical or similar to GbTMEM214-A07/D07 in function.

The gene comprising the nucleotide sequence or at least part of the nucleotide sequence provided by the invention can construct a recombinant plasmid through genetic recombination to obtain a novel biosynthesis pathway, and can also obtain the novel biosynthesis pathway through insertion, replacement, deletion or inactivation.

The inclusion of a non-ribosomal peptide synthetase provided by the present invention can generate novel polypeptide compounds by deleting, inserting or inactivating one or more non-ribosomal peptide synthetase domains, modules or genes from the same or different non-ribosomal peptide synthetase systems.

Fragments or genes comprising the nucleotide sequences or at least part of the nucleotide sequences provided by the invention can be used to construct libraries of non-ribosomal peptide synthetases or libraries derived from non-ribosomal peptide synthetases or combinations.

The gene can also be used in the aspects of gene engineering, protein expression, enzyme catalytic reaction and the like, and can also be used for searching and discovering compounds or genes used in medicine, industry or agriculture to enlarge the source range of the GbTMEM214-A07/D07 gene, and has higher application prospect.

In the present invention, there is no particular limitation on the plant suitable for use in the present invention, as long as it is suitable for carrying out a gene transformation operation, such as various crops, flowering plants, or forestry plants. The plant may be, for example (without limitation): dicotyledonous, monocotyledonous, or gymnosperm.

In the present invention, there is no particular limitation on the plant suitable for use in the present invention, as long as it is suitable for carrying out a gene transformation operation, such as various crops, flowering plants, or forestry plants. Said plant may for example (without limitation): dicotyledonous, monocotyledonous, or gymnosperm.

As an embodiment, the "plant" includes but is not limited to: the gene is suitable for cotton, arabidopsis thaliana and any gene with the gene or the gene homologous with the gene. The gene is particularly suitable for plants needing to improve verticillium wilt resistance, and strains transformed into the gene can be cultivated in a transgenic mode for the plants needing to improve verticillium wilt resistance in the practical application process.

As used herein, "plant" includes whole plants, parent and progeny plants thereof, and various parts of the plant, including seeds, fruits, shoots, stems, leaves, roots (including tubers), flowers, tissues and organs, having the gene or nucleic acid of interest in each of these various parts. Reference herein to "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, and likewise wherein each of the foregoing comprises a gene/nucleic acid of interest.

The present invention includes any plant cell, or any plant obtained or obtainable by the methods therein, as well as all plant parts and propagules thereof. The present patent also encompasses transfected cells, tissues, organs or whole plants obtained by any of the foregoing methods. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics, and that the progeny obtained using the methods of this patent have the same characteristics.

The invention also extends to harvestable parts of a plant as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. It also relates to other post-harvest derivatives of the plant, such as dry granules or powders, oils, fats and fatty acids, starches or proteins. The invention also relates to food products or food additives obtained from the relevant plants.

The invention has the following advantages:

(1) The invention discloses a sea island cotton Transmembrane protein gene which is from sea island cotton sea 7124 and is positioned on chromosome D4 of a cotton chromosome group, on the basis of the previous research, the invention carries out more intensive research on Transmembrane protein214 genes in the sea island cotton, discovers a new sea island cotton Transmembrane protein GbTMEM214-A07/D07 gene and also has the function of anti-verticillium wilt, and the function of the gene in plants is fresh and reported, thereby enriching the cotton anti-verticillium wilt gene resource.

(2) The GbTMEM214-A07/D07 gene has obvious difference in expression modes after inoculation of the gene in different resistant and sensitive cotton varieties, and the resistance of a silenced plant to verticillium wilt is obviously reduced after the GbTMEM214-A07/D07 gene is silenced; transgenic Arabidopsis with GbTMEM214-A07/D07 gene has obviously raised verticillium wilt resistance. Therefore, the gene GbTMEM214-A07/D07 participates in the resistance process of cotton to verticillium wilt, can enrich disease-resistant gene resources for the cloning of the gene, and provides an effective new tool for breeding cotton with verticillium wilt resistance.

(3) The GbTMEM214-A07/D07 gene obtained by the invention can further analyze the molecular mechanism of cotton verticillium wilt resistance. Whether the gene GbTMEM214-A07/D07 is involved in signal pathways related to disease resistance, what is the upstream gene and the downstream gene respectively, and what is the protein interacting with the upstream gene, so that the understanding of the anti-verticillium wilt mechanism of cotton can be theoretically expanded through further research on the gene.

Drawings

Fig. 1 shows the expression pattern of transmembrane protein gene GbTMEM214-a07/D07 of the present invention after different resistant and susceptible cotton species are inoculated with verticillium wilt bacteria: p < 0.01, x: p is less than 0.05.

FIG. 2 is a drawing showing that the resistance of sea island cotton to verticillium wilt is significantly reduced by silencing transmembrane protein gene GbTMEM214-A07/D07 in sea island cotton using VIGS;

in the figure, A: phenotype observation 14 days after positive control pTRV2-GbCLA1 cotton plant injection; b: injection of pTRV2:00 and pTRV2-GbTMEM214-A07/D07 (T1, T2 and T3) cotton seedlings were analyzed for resistance to verticillium wilt; c: RT-PCR validation injection of pTRV2:00 (CK) and pTRV2-GbTMEM214-A07/D07 (T1, T2 and T3) in cotton seedlings; d: counting the disease grade index of cotton seedlings 35 days after verticillium wilt bacterium inoculation; standard deviation was calculated as 3 replicates, obtained for 20 seedlings each time,.: p is less than 0.01.

FIG. 3 shows the molecular detection and disease resistance identification of the transformed Arabidopsis progeny by constructing an overexpression vector of the transmembrane protein gene GbTMEM 214-A07/D07;

in the figure, A: carrying out PCR detection on a transgenic arabidopsis gene specific primer (P is an amplification result by taking a plasmid as a template, N is an amplification condition by taking non-transgenic arabidopsis DNA as a template, and T2, T4 and T5 are transgenic homozygous strains respectively); b: analyzing the expression of a target gene of transgenic arabidopsis; c: identifying the disease resistance of transgenic arabidopsis; d: the transgenic arabidopsis thaliana is inoculated with verticillium wilt

pathogen Bp2

15, 30, 45 and 60 days later, disease fingers (T2, T4 and T5 are transgenic homozygous lines respectively, CK1 is transgenic arabidopsis thaliana, and CK2 is empty vector arabidopsis thaliana). Standard deviation was calculated as 3 replicates, obtained for 30 seedlings each time,.: p is less than 0.01.

Detailed Description

The present invention will be described in detail below by way of specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description which follows is a preferred embodiment of the invention, but is made for the purpose of illustrating the general principles of the invention and not for the purpose of limiting the scope of the invention. The scope of the invention is to be determined by the claims appended hereto.

1. Test materials

The sea island cotton variety H7124 and the upland cotton standard line TM-1 used in the experiment are introduced by agricultural academy of sciences of Jiangsu province, and are strictly inbred for years to breed and keep the purity. The arabidopsis variety is Columbia type and is susceptible to verticillium wilt. The materials used in the present invention can be purchased from the market or obtained according to the methods disclosed in the prior art, and the methods used in the present experiments are conventional methods unless otherwise specified. The primers used were synthesized by Nanjing Kingsrie Biotech Ltd.

The verticillium dahliae used in the experimental process is BP2, can be purchased from the market, and can also be cultured by the following method, and the culture method comprises the following steps: coating Verticillium dahliae BP2 on the surface of solid potato culture medium (potato 200g, agar 17g, sucrose 20g, distilled water 1000m 1) at 25 deg.C, transferring into liquid potato culture medium (potato 200g, sucrose 20g, distilled water 1000m 1) after two weeks, shake culturing at room temperature for 5 days, filtering the cultured pathogen solution, measuring the concentration of pathogen spore with blood counting plate, and diluting to 5 × 10 ⁷ Spores per ml.

The investigation of the number of verticillium wilt disease stages in the following experiments is carried out according to the following standards, 0 stage: the plants are healthy, have no diseased leaves and grow normally; stage 1: less than one fourth of the leaves of the plant are diseased, become yellow and wilted; stage 2: more than one fourth of the plant, less than one half of the plant leaves are diseased, and become yellow and wilted; and 3, stage: more than one half of the plant leaves and less than three fourths of the plant leaves are diseased, and become yellow and wilted; and 4, stage 4: more than three quarters of the leaves of the plant develop diseases, or the plant withers. Disease Index (DI) of each strain was calculated based on the results of the survey.

DI＝[∑(Ni×i)/(N×4)]×100；i＝0～4，Ni＝plant number of reaction i

2. Test method

2.1 GbTMEM214 gene family analysis

The GbTMEM214 gene family in the whole genome of Gossypium barbadense H7124 is predicted by utilizing recently released cotton genome information. The Fgene program in MolQuest software (version 2.3.3) is used for carrying out genome-wide ORF prediction on Scaffold from H7124 genome of Gossypium barbadense, and the predicted result is annotated by using Pfam and Hmmer for GbTMEM214 gene. Wherein the seed file of Pfam comes from a sanger center website (http:// Pfam. Sanger. Ac. Uk /), and the seed file of GbTMEM214 gene is encoded as: PF10151. The Hmmer software comes from the website: http:// hmmer. Janelia. Org/, version 3.0. A total of 6 GbTMEM214 genes are predicted to be located on chromosomes A01/D01, A04/D04, and A07/D07, respectively. The gene GbTMEM214 located on chromosome A07/D07 was named GbTMEM214-A07/D07.

2.2 GbTMEM214-407/D07 gene expression analysis

In order to detect the correlation between the predicted gene and verticillium wilt pathogen stress, TM-1 and sea 7124 cotton seedlings in the trefoil stage are used as materials, verticillium wilt pathogen Bp2 is inoculated for 0h, 24h, 48h, 96h and 144h, and meanwhile, the same stage of water treatment is used as a reference. Mu.g of total RNA was collected and subjected to the procedure of TAKARA reverse transcription kit. First strand cDNA was synthesized. The reverse transcription product was diluted 10 times and 1. Mu.L of the diluted product was subjected to qRT-PCR. 1, carrying out parallel PCR reaction on primers for specifically amplifying eukaryotic constitutive expression gene EF1 alpha (GenBank accession number AF 120093) as an internal control, and introducingThe sequence of the substance is F: agacacacaagtacctactgcac, R: CCACCAACTTTGTACACAATCC. The real-time fluorescent quantitative PCR is operated by an ABI Prism7500 type fluorescent quantitative PCR instrument (ABI, USA), and the method is a SYBR Green I dye method. The reaction system is 20 mul, cDNA,1 mul; primer F (10. Mu.M), 1. Mu.l; primer R (10. Mu.M), 1. Mu.l; SYBR green I mix, 10. Mu.l, water supplemented to 20. Mu.l. The procedure is as follows: at 95 ℃ for 10min;95 ℃,10s, annealing: at 58 ℃ for 20s;72 ℃ for 30s;40 Cycles;72 ℃,10min, and finally running the dissolution program.

△△△CT＝[(Ct _{Target gene} -Ct _{Internal reference gene} ) _{Processing at a given time} -(Ct _{Target gene} -Ct _{Internal reference gene} ) _oh ]V.D-[(Ct _{Target gene} -Ct _{Reference gene} ) _{Processing at a given time} -(Ct _{Target gene} -Ct _{Internal reference gene} ) _0h ] _CK . The GbTMEM214-A07/D07 gene located on chromosome A07/D07 uses primers F: cacattttccagcaccctcag, R: TTCCAGGAGAACCAGCAAGCAAGG. The result shows that GbTMEM214-A07/D07 gene can respond to verticillium wilt, in an infected variety TM-1, 24h and GbTMEM214-A07/D07 gene expression level after inoculation are obviously reduced, 144h expression level starts to be increased, and the up-regulation multiple is 1.9 times (figure 1A); in the sea 7124, the up-regulation starts to be 1.4 at 48h after inoculation, reaches a maximum value at 96h, and is 2.1 times, and continues to be 144h (fig. 1B). The research result shows that the expression mode of GbTMEM214-A07/D07 gene has obvious difference in resistant (sea 7124) and sensitive (TM-1) strains.

2.3 GbTMEM214 gene disease resistance analysis

In the present invention, we analyzed the resistance of the GbTMEM214-A07/D07 gene to cotton verticillium wilt using the following two methods.

The method is characterized in that the resistance of cotton to verticillium wilt after gene silencing of GbTMEM214-A07/D07 is verified by utilizing a virus-mediated gene silencing method. Vectors used for virus-mediated gene silencing were pTRV1 and pTRV2, respectively, and cotton albino gene (ghcia 1) was used as a control (wangxiyu et al, 2014). Primers were designed at the 3' end of the gene GbTMEM214-A07/D07, and 415bp fragments were amplified and subcloned into pTRV2 vector. Positive pTRV1, pTRV2 (negative control) and pTRV2 were picked: CLA1 (positive control) and a single colony of pTRV2 plasmid Agrobacterium GV3101 containing GbTMEM214-A07/D07 gene were cultured until the OD600 of the bacterial liquid was about 0.5. 4,000rpm was centrifuged at room temperature for 10 minutes to collect the somatic cells, and the cells were resuspended in an appropriate volume of a resuspension solution (10mM MgCl2, 10mM MES and 200. Mu.M syringone) to a final concentration of 2.0, and the resuspension solution was allowed to stand at room temperature for 3 hours, and the recovery solutions of TRV1 and TRV2 were mixed at a volume ratio of 1: 1. And (4) carrying out an inoculation experiment of the agrobacterium after two cotyledons of the cotton seedling are completely unfolded. Injecting the bacterial liquid into cotyledon by adopting a blade cylinder injection method. Using pTRV1/pTRV2 and pTRV1/pTRV2: CLA1 served as negative and positive controls for the silencing treatment. To be injected TRV: when the albino phenotype appears in cotton seedlings of CLA1, the expression situation of GbTMEM214-A07/D07 genes in cotton bodies silencing GbTMEM214-A07/D07 genes is detected, and cotton EF-1 alpha is used as an internal reference gene (figure 2A, 2C). Meanwhile, verticillium wilt is inoculated, and the disease resistance of the silenced cotton is investigated. The results show that the disease index of plants after 28 days of verticillium wilt germ inoculation and silencing of GbTMEM214-407/D07 gene reaches 74.8 (pTRV 2: gbTMEM 214-A07/D07), which is significantly higher than that of empty vector control (pTRV 2:00, 41.2) and H7124 (CK, 39.7) without injection (FIG. 2B, 2D).

And secondly, the resistance of the gene GbTMEM214-A407/D07 to cotton verticillium wilt is verified by using transgenic arabidopsis thaliana. Constructing an overexpression vector of GbTMEM214-A407/D07 gene, using a plant expression vector of 35S-pCAMBIA2301-NORs, designing primers carrying XmaI and SacI enzyme cutting sites, amplifying and recovering target fragments, connecting with a pMD-19 (sample) vector, transforming Top10 competence, sequencing to obtain positive clones with correct sequences, carrying out enzyme cutting on a cloning vector and the plant expression vector carrying the target gene, respectively recovering target fragments of 2.3kb and 13kb, connecting by using T4 ligase, transforming Top10 competence to obtain positive clones, namely a recombinant vector containing a CaMV35S promoter and the target gene GbTMEM214-A07/D07 fragment, and naming as pCAMBIA2301-35S-GbTMEM214-A407/D07. The recombinant vector is transformed into agrobacterium GV3101 by a freeze-thaw method, arabidopsis is transformed by a flower dip-dyeing method, and seeds are harvested in a mixed mode. After sterilization, screening on MS culture medium containing kanamycin with the concentration of 50mg/L, and transplanting positive plants into a nutrient medium for growth. Taking leaves to extract DNA and RNA, carrying out reverse transcription on the RNA to obtain cDNA, and detecting whether the target gene is successfully transferred and expressed. Wherein the primers for detecting by taking DNA as a template are as follows: f: ACTGTACTCGTGGGCACATC; r: the length of the amplified fragment is 789bp; taking cDNA as a template, amplifying by taking arabidopsis RuBisCo gene as an internal standard, and designing a primer as F: GCAAGTGTTGGGTTCAAAGCTGGTG and R: CCAGGTTGA GGAGTTACTCGGAATGCTG, and the length of an amplification product is 120bp; the gene primers are F: TGAGTCAGATGCTGCTACAC, R: the amplification length of the GAGCTGATAACTACAG is 198bp. Finally, 3 homozygous lines (T2, T4 and T5) were obtained for identification of resistance to verticillium wilt by PCR detection (FIG. 3A, FIG. 3B). The results showed that after 15, 30, 45, and 60 days after inoculation of verticillium dahliae BP2, the disease index of arabidopsis after inoculation was investigated, and the results showed that arabidopsis thaliana transformed with GbTMEM214-a07/D07 gene could significantly improve the resistance to verticillium dahliae (fig. 3C, fig. 3D). The above results indicate that the GbTMEM214-A07/D07 gene can confer resistance to verticillium wilt in recipient plants.

Although the invention has been described in detail above with reference to a general description and specific examples, it will be apparent to one skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> agricultural science and academy of Jiangsu province

<120> sea island cotton transmembrane protein GbTMEM214-A07/D07 gene and application

<130> 2021

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2414

<212> DNA

<213> Gossypium barbadense Linn.

<400> 1

gaaaattgat ttccaaatta gcagataata gaatgggaag aaaaatattt agcaaaggat 60

aatataaata ataattaatg tccgtttttc tgaatcgttt gtctcgtctc ctccgtccgc 120

aatgcatccc taatctgagc aaaagtattt acgcgttttg cgttgcttaa ttccttatta 180

tccattccct tttctccttt tctttcctta tttatatttc cttttctcac tattttcctc 240

tccaattttc cttctttcat ttctctccaa attttcccaa caatggagtc cgtcgatctt 300

cacgaaacca ccaatgccaa ccacgttgac cacggctggc aaaaggtctc ttatcccaaa 360

cgtcaacgca agaccaagcc caacgccgat cccaacctcc cccgtcctaa cggaacccta 420

actaatggct ccgccagcgt tttccattcc ctcgagcaac agtccgatga tcgccgtcgt 480

cggattgttg aagctcaaag agcttacgct gctgctgcca ttgatgccga tgccaagcat 540

aagcctaaaa gatcggtcat cgatgattcc gacgatgacg atggcagtga tctggatggc 600

cttaaaccta acgggaagcc agcagatgag gagaagaagg cgaagcaaaa gaagccgaag 660

aagcctaagg ttacggttgt agaagccgct gcgaagatcg atcccactga tctctctgct 720

tatttcgctg aatggaatgg cgaacagcaa gaaattcaaa tgcagaagtt tgcggattac 780

tatggtaagg tatttcagct agtggtagcg gggcagtttc cttggttgaa gcttttcagg 840

gagagtaccg ttgccaagct tgctgatata ccactttcac atatttctga tgctgtttat 900

aagacctcag ctgactggat aagccaacga tcccttgagg cacttggttt ctttgtatta 960

tggtctttag acatcattct tgaggacttg gcggcccaac aagcaggtgc taagggctcc 1020

aaaaaaggtg cgcaacagac atcattgaag tctaaggttg gtatatttgt ggcattaggt 1080

atggtattgc agcgtaaacc tgatgcttta attagtgtat tgccaaagtt gagagaaaat 1140

tccaagtatc aaggacaaga taagctcccc atttttgcgt ggacgatagt tcaggcatcc 1200

aaaggagatc ttgctgtggg actgtactcg tgggcacatc tcctcttgcc tgtacttagt 1260

agcaaaaact gtaatccaca atccagagat ctaattttac aactggtgga atggatctta 1320

tccgtctcaa aagctcgttc aattttagta aataatgctg ttagaaaagg ggaacgtttg 1380

gtgcctccat cttcatttga gatactgatg cgagctacct tccctgcatc ttcatctagg 1440

gtgaaggcga ctgaaaggtt tgaggccata tatcccacag taaaggaagt tgcacttgct 1500

ggtgctcacg gaagcaaagc aatgagacaa gtggctcttc agatgttcgc ctttgctatc 1560

aaagcagcag gagaaagctc tcctgagtta tccaaagagg cagctggaat agtcatatgg 1620

tgtttgaacc agaacgctga gtgctacaag cagtgggaca aggtttatct cgataatctg 1680

gaagcgagtg tgagtgttct tagaaggctt tcagatgaat ggaaagaaca ctccacaaaa 1740

cttactactc ttgacccttt gagggaaacc atcaagaatt ttaggaacaa gaatgagaaa 1800

gaaatgggca atgagtcaga tgctgctaca caggcactgt ttcaggatgc agacaagtac 1860

tgtaagctta tagctggaag actatcgcga ggccctgggt gcctaaaagc attggccttt 1920

ctcgttgtcg catttggtgt gggtgctgct gttgtagctc ccaacatgga tgattgggac 1980

tggaacaaac tgtatgtagt tatcagctct caaatccctg tctaaagact tcggttaggt 2040

accgtctttc tcggttaagt gcattttgat ctggagtttc taactggtaa ggggaaaaga 2100

aaaaaggaag tgttataatg tgggatttag gagaatagtg ttgagaacac aggctcttgt 2160

cttaaagaag cgaagcctaa ggatgagtga aaccttattg cgaggagttg ggtttagagc 2220

aactacatgt atttcaagta attaatattc tgaagactgt tgtagaattg aaataatttg 2280

aggattaatc ttttcagaaa atcaagttga ttggatttgt tacttctccg tatctgcttt 2340

tctattaaac atttcatctg caatttgctt ttcaggactc ggatgagtac ctaaaaataa 2400

taattatagt attt 2414

<210> 2

<211> 580

<212> PRT

<213> Gossypium barbadense Linn.

<400> 2

Met Glu Ser Val Asp Leu His Glu Thr Thr Asn Ala Asn His Val Asp

1 5 10 15

His Gly Trp Gln Lys Val Ser Tyr Pro Lys Arg Gln Arg Lys Thr Lys

20 25 30

Pro Asn Ala Asp Pro Asn Leu Pro Arg Pro Asn Gly Thr Leu Thr Asn

35 40 45

Gly Ser Ala Ser Val Phe His Ser Leu Glu Gln Gln Ser Asp Asp Arg

50 55 60

Arg Arg Arg Ile Val Glu Ala Gln Arg Ala Tyr Ala Ala Ala Ala Ile

65 70 75 80

Asp Ala Asp Ala Lys His Lys Pro Lys Arg Ser Val Ile Asp Asp Ser

85 90 95

Asp Asp Asp Asp Gly Ser Asp Leu Asp Gly Leu Lys Pro Asn Gly Lys

100 105 110

Pro Ala Asp Glu Glu Lys Lys Ala Lys Gln Lys Lys Pro Lys Lys Pro

115 120 125

Lys Val Thr Val Val Glu Ala Ala Ala Lys Ile Asp Pro Thr Asp Leu

130 135 140

Ser Ala Tyr Phe Ala Glu Trp Asn Gly Glu Gln Gln Glu Ile Gln Met

145 150 155 160

Gln Lys Phe Ala Asp Tyr Tyr Gly Lys Val Phe Gln Leu Val Val Ala

165 170 175

Gly Gln Phe Pro Trp Leu Lys Leu Phe Arg Glu Ser Thr Val Ala Lys

180 185 190

Leu Ala Asp Ile Pro Leu Ser His Ile Phe Asp Ala Val Tyr Lys Thr

195 200 205

Ser Ala Asp Trp Ile Ser Gln Arg Ser Leu Glu Ala Leu Gly Phe Phe

210 215 220

Val Leu Trp Ser Leu Asp Ile Ile Leu Glu Asp Leu Ala Ala Gln Gln

225 230 235 240

Ala Gly Ala Lys Gly Ser Lys Lys Gly Ala Gln Gln Thr Ser Leu Lys

245 250 255

Ser Lys Val Gly Ile Phe Val Ala Leu Gly Met Val Leu Gln Arg Lys

260 265 270

Pro Asp Ala Leu Ile Ser Val Leu Pro Lys Leu Arg Glu Asn Ser Lys

275 280 285

Tyr Gln Gly Gln Asp Lys Leu Pro Ile Phe Ala Trp Thr Ile Val Gln

290 295 300

Ala Ser Lys Gly Asp Leu Ala Val Gly Leu Tyr Ser Trp Ala His Leu

305 310 315 320

Leu Leu Pro Val Leu Ser Ser Lys Asn Cys Asn Pro Gln Ser Arg Asp

325 330 335

Leu Ile Leu Gln Leu Val Glu Trp Ile Leu Ser Val Ser Lys Ala Arg

340 345 350

Ser Ile Leu Val Asn Asn Ala Val Arg Lys Gly Glu Arg Leu Val Pro

355 360 365

Pro Ser Ser Phe Glu Ile Leu Met Arg Ala Thr Phe Pro Ala Ser Ser

370 375 380

Ser Arg Val Lys Ala Thr Glu Arg Phe Glu Ala Ile Tyr Pro Thr Val

385 390 395 400

Lys Glu Val Ala Leu Ala Gly Ala His Gly Ser Lys Ala Met Arg Gln

405 410 415

Val Ala Leu Gln Met Phe Ala Phe Ala Ile Lys Ala Ala Gly Glu Ser

420 425 430

Ser Pro Glu Leu Ser Lys Glu Ala Ala Gly Ile Val Ile Trp Cys Leu

435 440 445

Asn Gln Asn Ala Glu Cys Tyr Lys Gln Trp Asp Lys Val Tyr Leu Asp

450 455 460

Asn Leu Glu Ala Ser Val Ser Val Leu Arg Arg Leu Ser Asp Glu Trp

465 470 475 480

Lys Glu His Ser Thr Lys Leu Thr Thr Leu Asp Pro Leu Arg Glu Thr

485 490 495

Ile Lys Asn Phe Arg Asn Lys Asn Glu Lys Glu Met Gly Asn Glu Ser

500 505 510

Asp Ala Ala Thr Gln Ala Leu Phe Gln Asp Ala Asp Lys Tyr Cys Lys

515 520 525

Leu Ile Ala Gly Arg Leu Ser Arg Gly Pro Gly Cys Leu Lys Ala Leu

530 535 540

Ala Phe Leu Val Val Ala Phe Gly Val Gly Ala Ala Val Val Ala Pro

545 550 555 560

Asn Met Asp Asp Trp Asp Trp Asn Lys Leu Tyr Val Val Ile Ser Ser

565 570 575

Gln Ile Pro Val

580

Claims

1. The application of an expression vector containing a sea island cotton transmembrane protein gene GbTMEM214-A07/D07 or a host cell containing the expression vector in transforming plants to obtain transgenic plants with verticillium wilt resistance, wherein the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. Application of gossypium barbadense transmembrane protein gene GbTMEM214-A07/D07 in obtaining transgenic plants with verticillium wilt resistance, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 1.

3. The application of the sea island cotton transmembrane protein gene GbTMEM214-A07/D07 in the breeding process of anti-verticillium wilt of cotton, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 1.