WO2020007002A1

WO2020007002A1 - Method for acquiring and creating sterile mutant

Info

Publication number: WO2020007002A1
Application number: PCT/CN2018/124189
Authority: WO
Inventors: 刘佳音; 米铁柱; 张国栋; 张彦荣; 李继明; 邹丹丹; 邵晓宇; 丁锦燕; 刘鹏飞; 万吉丽; 王克响; 罗碧
Original assignee: 青岛袁策集团有限公司
Priority date: 2018-07-05
Filing date: 2018-12-27
Publication date: 2020-01-09

Abstract

Provided in the present application is a method for acquiring a sterile mutant, for which an existing mutant is utilized and hybridized with other varieties, a sterile gene serves as a marker for screening an offspring, the offspring is also rehybridized, and each instance of hybridization undergoes a detection for the sterile gene. Also provided in the present application is a method for creating a common nuclear sterile mutant, comprising the following steps: 1. utilizing a gene knockout technique, constructing a gene knockout vector; and 2. utilizing an agrobacterium-mediated method, mediating the vector into an embryogenic cell, thus acquiring a cell of which a fertility gene is silenced. The present invention, with a rice nuclear fertility gene serving as a target gene, utilizes CRISPR/Cas9 gene silencing for a gene knockout, the gene loses the function thereof when silenced, and cells develop and grow into a complete plant but lacking developed pollens having normal functions; this is used for creating a sterile line.

Description

Obtaining and Creating Methods of Sterile Line Mutants

Technical field

The invention relates to the technical field of bioengineering molecular genetic breeding, in particular to a method for obtaining and creating a mutant of a sterile line.

Background technique

Rice is the staple food of more than half of China's population. Therefore, the stability and high yield of rice have seriously affected China's food supply security. With the large-scale promotion of hybrid rice, it has made great contributions to ensure the security of China's food supply and ensure that the total rice output remains unchanged or further increased.

The first generation of hybrid rice in China was a three-line hybrid rice using a cytoplasmic male sterility line as a genetic tool; the second generation of hybrid rice was a two-line hybrid rice using a photothermogenic male sterility line as a genetic tool; , Chinese hybrid rice research has entered the third generation of research, that is, genetically engineered male sterile lines as a genetic tool for hybrid rice. The first generation of hybrid rice, the three-line hybrid rice is a classic method of hybrid rice breeding, which does not Fertility performance is relatively stable, but its fertility is restricted by the relationship between the restorer and maintainer lines, and the chance of screening for good combinations is low; the second-generation hybrid rice, which is a two-line hybrid rice, has a higher degree of freedom in mating Almost all conventional rice varieties can restore their fertility, but their fertility is greatly affected by the environment, and weather factors are beyond the control of manpower. If extreme weather such as abnormal low temperature or abnormal high temperature is encountered, the research results will fail.

The third-generation hybrid rice technology is a successful combination of traditional breeding methods and modern biotechnology, which will increase the utilization of rice male recessive nuclear sterility genes. The intelligent sterility source in this technology can quickly transform the sterile lines (or male parents) of excellent conventional rice, "three lines" and "two lines" into intelligent sterility lines. Intelligent sterile lines can be freely grouped and crossbreeding is safe.

Compared with conventional transgenic breeding and conventional cross breeding, the "third-generation hybrid technology" has a more stable sterility, and has less influence on genetic background and environmental factors. The safety risks of pollen-fertile and two-line genic male sterile lines due to the instability of fertility induced by low-temperature fertility.

In addition, the sterile behavior of this sterility line is simple, and it is not affected by the genetic background, which is convenient for the aggregation breeding of excellent traits, so as to quickly breed high-quality, high-yield, multi-resistance and suitable for various ecological conditions Expanding the adaptation area of hybrid rice; third, because fertility restoration genes and pollen abortion genes are tightly linked during the transgene process, which prevents the transgenic components from drifting through pollen, and thus realizes the use of transgenic methods to produce non-transgenic sterile lines Seeds and hybrid rice seeds.

At present, the creation of the third generation of intelligent sterile lines is mostly realized by genetic engineering methods. The main technical process is as follows: first, a fertility mutant is obtained by using EMS mutagenesis or gene editing technology, and then the fertility is restored. A third-generation intelligent sterility line can be obtained by introducing a foreign three-linked gene including a gene into a mutant. In practice, we have found that the availability of fertile mutants is the biggest constraint on genetic engineering to create third-generation intelligent sterile lines. EMS mutagenesis and gene editing are both insufficient in creating fertile mutants, such as using EMS. During induction, different rice varieties may have different induction doses. When screening after induction, multiple generations of screening are often required to obtain a stable sterile mutant, and similar problems exist when gene editing obtains fertile mutants.

The existing technology cannot overcome the problems existing in the creation of fertile mutants. These defects will lengthen the creation cycle of the third-generation intelligent sterile lines and thus affect the third-generation hybrid rice breeding process.

Summary of the invention

The technical problem to be solved by the present invention is to provide a method for obtaining a male sterile mutant of rice, which is aimed at overcoming the existing shortcomings of the present invention. Taking rice cell nuclear fertility gene as the target gene, CRISPR / cas9 gene silencing was used to knock out the gene. After the gene silencing, the function was lost, and the cell developed into a complete plant, but it did not have the pollen that developed into a normal function. Object, used to create sterile lines.

In order to solve the above technical problems, the present invention provides a method for obtaining a mutant of a male sterile line, which uses the existing mutant to cross with other varieties, and uses the male sterile gene as a marker to screen offspring, and the offspring are also backcrossed at the same time. .

Each backcross was tested for the sterile gene.

In order to solve the above technical problems, the present invention further provides a method for obtaining a mutant of a male sterile line, which includes the following steps: using one or more ordinary genic male sterile male rice lines with EAT1 gene mutation as a female parent, and the line to be modified as a parent The F1 generation was obtained by cross-breeding, and then the inbred line was used as the recurrent parent to carry out backcrossing. Each backcross generation selected the individual containing the EAT1 mutation gene as the next-generation parent and backcrossed 2-6 generations.

Each backcross generation selects the individual containing the EAT1 mutation gene as the next-generation parent, and the aforementioned individual as the next-generation parent is a single plant that is biased towards the recurrent parent in genetic background and field performance.

To solve the above technical problems, the present invention also provides a method for creating a common nuclear sterility mutant, which includes the following steps:

T1. Use gene knockout technology to construct a gene knockout vector;

T2. Using the Agrobacterium-mediated method, the vector is introduced into embryonic cells to obtain cells in which fertility genes are silenced.

The method for creating an ordinary nuclear sterility mutant further includes:

T3. Knockout detection.

The method for creating an ordinary nuclear sterility mutant further includes:

T4. Phenotypic identification of transgenic plants.

The T1. Using a gene knockout technology to construct a gene knockout vector, the sgRNA sequence is designed as follows:

5’-ggcaCACAATGGCTCCAGCATTCC-3 ’

5'-AAACGGAATGCTGGAGCCATTGTG-3 '.

The T2. Using an Agrobacterium-mediated method, the vector is introduced into embryonic cells, thereby obtaining cells in which fertility genes are silenced, according to the method in the Vitals kit (Catelog.NO.Vk005-103). The experimental steps complete the construction of the vector and complete the transformation of Agrobacterium.

To solve the above technical problems, the present invention also provides a method for preparing a plant mutant, which includes the following steps:

S1. Construct a CRISPR / cas9 gene knockout vector and knock out the CYP78A13 gene;

S2. Agrobacterium transformation;

S3. Knockout detection;

S4. Phenotypic identification of transgenic plants.

20. The method for preparing a plant mutant according to claim 19, wherein in step S1, a CRISPR / cas9 gene knockout vector is constructed, and the CYP78A13 gene is knocked out, and the sgRNA sequence is as follows:

5’-ggcaCACAATGGCTCCAGCATTCC-3 ’

5'-AAACGGAATGCTGGAGCCATTGTG-3 '.

To solve the above technical problems, the present invention also provides an sgRNA sequence used in a knockout gene, the sequence structure of which is as follows:

5’-ggcaCACAATGGCTCCAGCATTCC-3 ’

5'-AAACGGAATGCTGGAGCCATTGTG-3 '.

In order to solve the above technical problem, the present invention also provides an application of the sgRNA sequence used in the aforementioned knockout gene in constructing a gene knockout vector.

The beneficial effects of the present invention include: The method of the present invention solves the limitation that in the past when fertile mutants were obtained, the creation cycle was long and batches could not be obtained in parallel, and multiple mutants of different varieties and types were obtained at the same time. The method of the invention is simple and easy to operate, avoids the uncertainty of EMS mutagenesis, saves the tedious process of gene editing, and can simultaneously backcross and breed multiple rice varieties, greatly improving fertility mutations. The efficiency of body acquisition is conducive to the creation of the third generation of intelligent sterile lines and accelerates the application of the third generation of hybrid rice breeding. The method for creating a common nuclear sterility mutant of the present invention takes rice cell nuclear fertility gene as a target gene, uses CRISPR / cas9 gene silencing for gene knockout, loses function after gene silencing, and the cell develops into a complete plant, but does not have development It becomes a normal function pollen and can be used as a research object to create sterile lines.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is the pollen viability test result according to the embodiment of the present invention; wherein, the left picture is a control plant, and the right picture is a transgenic plant;

FIG. 2 is a fertility performance map according to an embodiment of the present invention; wherein, the left picture is a control plant, and the right picture is a plant in which the CYP78A13 gene has been knocked out.

detailed description

The present invention is described in detail below with reference to examples. In order to make the objectives, technical solutions, and advantages of the present invention clearer and more specific, the present invention is further described in detail below, but the present invention is not limited to these embodiments.

In an embodiment of the present invention, the method for obtaining a mutant of the male sterile line of the present invention is: using the existing mutant to cross with other varieties, using the male sterile gene as a marker, and selecting the progeny, and the progeny simultaneously performing a backcross experiment , Each backcross was tested for sterility.

In an embodiment of the present invention, the method for obtaining a sterile line mutant of the present invention is: using an ordinary genic male sterile line rice material with an EAT1 gene mutation as a female parent, and the line to be modified is a male parent to obtain F1 generation, and then Backcrossing was carried out using the material to be improved as the recurrent parent. Each backcross generation was selected for a single plant containing the EAT1 mutation gene, and its genetic background and field performance were biased towards the recurrent parent. Normally, backcrossing 2- In 4 generations, ordinary rice lines can be transformed into male sterile lines with EAT gene mutations.

The principle of the invention is as follows:

The rice EAT1 gene is a member of the bHLH transcription factor. The bHLH (basic Helix-Loop-Helix) transcription factor constitutes a large family of eukaryotic proteins, and its members play an extremely important role in the regulation of biological growth and development, and they participate in Regulates neuron generation, myogenesis, hematogenesis, sex determination, and intestinal tissue development. The bHLH transcription factor is named after the bHLH motif in its structure. The bHLH motif contains approximately 60 amino acids, and consists of a basic region that binds to DNA and a Helix 1-Loop-Helix 2 where the lengths of the loops vary. There will be differences in bHLH protein.

Most of bHLH transcription factors are involved in the development of anther tapetum or microspore development. The anther tapetum is very important for the growth and development of pollen. The enzymes secreted by the tapetum can timely decompose the pollen mother cells and the callus wall of the tetrad to ensure that the microspores are separated from each other. However, the mutation of rice EAT1 gene will cause the tapetum cells to not degrade in time and the programmed death will be delayed, so the enzymes secreted by the tapetum layer will affect the development and isolation of microspores, and will eventually manifest as infertility. And this fertility change is controlled by a single gene of the EAT1 gene. Therefore, a new fertility mutant can be obtained by transferring a sterile gene into a rice line to be transformed by means of backcross transfer.

Example 1: Obtainment of Rice Flower Sterile Mutants

We used the EAT1 mutant male sterile line Wuyunjing 7 as the donor parent and Dahuaxiang as the recipient parent. Through one cross and two backcrosses, supplemented by phenotypic screening, only a small amount of The human cost is to obtain the rice floral male sterility mutant. Field identification showed that the male sterility rate was over 99.5%.

Example 2: Obtaining a Japanese Harm sterile mutant

We used the EAT1 mutant male sterile line Wuyunjing 7 as the donor parent and Nihon Haru as the recipient parent. Through one cross and two backcrosses, supplemented by phenotypic screening, only a small amount of time was spent in one year. The labor cost is obtained by the Japanese Hariri male sterility mutant. Field identification showed that the male sterility rate was over 99.5%.

DNA extraction

Take 0.5g rice leaves of each BC1 plant and place them in a cold-freezing laboratory at -20 ° C. Add liquid nitrogen to grind into a white powder and put it into a 2mL centrifuge tube. While grinding, turn on the water bath to heat to 65 ° C.

Add 700 μL of CTAB lysate pre-heated at 65 ° C for 1 hour to the centrifuge tube, invert and shake several times, and then put it into a 65 ° C thermostatic water bath for 40min (every 20min, invert and shake several times)

Allow the sample to cool at room temperature for 5 min, add 700 μL of phenol-chloroform-isoamyl alcohol (25: 24: 1), add it against the wall, shake it several times, and check for leaks

Press the tube cover with your hand and turn it slowly several times. Then place a newspaper on the shaker, place the tubes, and shake at 30 rpm for 5-10 minutes at room temperature.

Place in a refrigerated centrifuge and centrifuge at 12000 rpm for 5 min at 4 ° C.

Pipette the supernatant against the wall, add 700 μL of phenol-chloroform-isoamyl alcohol (25: 24: 1) again, and extract again. Extract the supernatant and add 10 μL Rnase (10 mg / mL). Leave at room temperature for 30 minutes. put. If the supernatant is clear, skip this step and proceed to the next step.

Add an equal volume of 700 μL (-20 ° C) isopropanol to the wall, slowly invert 15 times, flocculent precipitates appear, put it in a -20 ° C refrigerator, take it out after 30min, and use a refrigerated centrifuge to evenly centrifuge (4 ° C, 12000rpm, 10min)

The supernatant was decanted, 700 μL of pre-cooled 70% ethanol was added, and the DNA was blown with a 200 μL pipette tip to wash the DNA. After the ethanol was aspirated, it was placed in a sterile operating table and dried with a lid.

Add 50 μL of ddH2O.

DNA test

1. Weigh 1.4g of agarose (50-well gel tank), add 140mL (70 / 35mL) of 1 × TAE, heat in a microwave oven to boil at high temperature, there is no flocculent turbidity in the bottle, and it is clear and clear.

2. Soak in cold water or flush with faucet for 1min, then add ethidium bromide (100mL TAE plus 6μL), slowly pour into the gel tank, insert the comb, and place the gel for 20min.

TAE formula: use liquid (1 times) 0.04mol / L Tris-acetic acid + 0.001mol / L EDTA

Stock solution (50 times) Tris-base 242.2 g, glacial acetic acid 57.1 ml, 0.5 mol / L EDTA (PH = 8.0) and the volume was adjusted to 1 L.

3. Use a PCR plate to add 6 × Loading buffer 3μL, add 3μL of the extracted DNA, and point it into the gel well with a gun. Twelve blank spaces can be distinguished. You can also mark the DNA on the blank grid points and change the voltage. Set to about 140V and start electrophoresis.

6 × Loading Buffer formula: bromine Finland 0.015g + xylene cyanide FF 0.015g + 0.5M / L EDTA 100μL + polysucrose 4g, add water to volume to 10ml)

4. Look at the position of the indicator, you can take out the glue after running to about 1.5cm, and put it in the photographic imager to take a picture.

Suitable DNA concentration for PCR is 50ng / Ml

PCR amplification

1. Primer mother liquor: add ddH2O to the dry powder, multiply the number after the OD value by the OD value to add the milligram of water. Centrifuge the dry powder primer at 13,000 rpm before use to allow the dry powder to sink to the bottom. Tap enzyme is also centrifuged.

2. Primer mix: When in use, take 10μl each of the upstream and downstream primers, and add 480μl deionized water to mix. (This is a dilution of the primer mother solution)

3.PCR reaction system: The following system is inserted into each well of the PCR special plate

A total of 20 μl, one PCR well, everything must be loaded on ice, because the enzyme is easily inactivated.

4.PCR amplification reaction program:

Mix the PCR system in advance: Buffer 200μl, dNTP 30μl, Tap enzyme 20μl, ddH2O1ml, upstream and downstream primers 1: 1 and add 300μl, add DNA. The reaction mixing system is as follows:

Buffer 200 μl + dNTP 30 μl + Tap enzyme 20 μl + ddH2O 1 ml + 6 μl each of the upstream and downstream primers (6 μl is the primer mother solution), ddH 2 O 288 μl

After adding all reaction systems to the PCR plate, add a drop of paraffin (20 μl) to seal. Add the primer mix to the PCR plate on ice.

Store the added PCR sample at -20 ° C and wait for PCR. Otherwise, the enzyme is easily inactivated.

5.PCR amplification reaction program:

After amplification, add 8ml loading buffer (agarose can be used to detect DNA bands after PCR is completed), denatured at 94 ° C for 10min, and stored in a refrigerator at 4 ° C. The next step is polyacrylamide gel electrophoresis.

Polyacrylamide gel electrophoresis

1. First spray alcohol on the glass ears, and then wipe it clean with a paper towel to ensure that there is no paper scraps. Then put it in a ventilated kitchen and use 2% stripping silane (the solvent is chloroform. Formula: add 10mL stripping silane and add 490mL (Mixed with chloroform) Apply evenly, the amount is about 10mL, it is suitable to feel smooth after rubbing. This step is very important, it directly affects whether it is sticky in the future, and then it is left for about 10min.

2. During the placement of the ear plate, spray the bottom plate with alcohol once, wipe it clean with a paper towel to ensure that there is no dust on it, and then use affinity silane (50 μL of affinity silane, 50 μL of acetic acid), and add alcohol to 5 mL (5 mL vial filled) Pour on the floor and spread evenly. (Be careful not to touch the glass when applying gloves, pull up your sleeves, otherwise you will waste the rubber).

3. After soaking the side strips in clean water, wipe them with paper towels, and put one on each side of the bottom plate (the thickness of the side strips is roughly the thickness of the glue), and align the bottom edges of the two sides of the bottom plate.

4. Remove the dried ear plate from the ventilated kitchen, apply the silane side, align the bottom side with the affinity silane side, press the plate and the plate together, and then clip the left and right sides of the large plate. Clips, clips on the side strips, a total of 4 clips, clips firmly.

5. Fill the 6% PA glue with a plastic bottle. A large plate is about 70mL (weighing with a measuring cylinder), and 10% APS 400μL and TEMED 40μL are added first. Then inject the glue, and start to spray the glue a little distance from the plate at the gap of the ear plate. Tap the large plate while pouring the glue to ensure that the glue advances at a uniform speed, and tap gently to remove air bubbles. When pouring the glue to the bottom of the glass plate, tap the bottom glass plate a few times until the glue comes out but does not drip. After the filling is finished, check whether there is air bubbles at the filling mouth. If there are hooks, you can also tap and squeeze, and then refill the glue.

6. The tooth comb is also immersed in water, cleaned and wiped dry. Put the flat head with no teeth on the gap of the ear plate, first immerse it in the glue, and insert it into the large plate with clever force. Be sure to ensure that there are no air bubbles and the depth of insertion is too large. The horizontal line on the board is best (about 1cm). After inserting the tooth comb, make up the glue again, then clamp the two large clips and adjust the level with a level ruler (the base can be inserted into the gun head pad level)

7. Wait for the gel (about 2h)

8. After gelling, remove all the clips, remove the teeth on the plate, put it on the water tank, and brush off the residual glue on the surface of the upper and lower plates.

9. Brush the groove of the ear plate on the large plate. This step is important and related to whether the glue runs successfully.

10. Place the large plate on the electrophoresis rack, and place the ear plate facing the wall. Tighten the three buttons at the same time (twice both sides at the same time, and then the middle buttons, don't tighten too tightly, otherwise it will leak. Don't rather tighten too much, you will fry the board.) Then the two sides of the big board are also fixed with button clips, and the buttons on the two sides of the button clips are fixed to the wall.

11. Pour the upper tank solution into the upper tank. The upper tank solution does not pass the surface of the glue. Use a straw to push the glue hole in the groove to blow off the broken glue to prevent the glue from blocking. Add the Loading-Buffer level. Electrophoresis for 20 min.

(Sink preparation: 0.33 times TBE, take 30ml of 10 times TBE and add water to 900ml)

(Sewage solution preparation: 1 times TBE, take 1000ml of 10 times TBE and add water to 1000ml)

12. After the Loading-Buffer has run to a certain position (about 5cm), pause the electrophoresis, and then slowly insert the toothed side of the tooth comb into the glue gap. Note that the tooth comb must stay a little outside the glass plate, otherwise it cannot be spotted. However, the tooth comb must also be inserted into the gel to separate each DNA sample.

13. Wipe the glass on the outer surface clean, and then draw the line with a red pen.

14. Take out the samples after PCR (save at 4 ℃), and place 6μL of each well into the holes of the electrophoretic tooth comb.

15. After the point is clicked, turn on the electrophoresis instrument and set your own voltage, current and power (generally the voltage is stable, choose 1500V ～ 1800V) for electrophoresis. The first run is about 8cm (three fingers wide). Click on the second layer of DNA sample and run for about 1 hour.

16. Run the glue correctly: The indicator drops neatly and goes straight down. End of running gel: It is advisable for the second blue band of the running gel (the one that moves slowly) to reach the bottom of the plate, which can be regarded as the end of running electrophoresis. (Fast blue belt ---- bromophenol blue, slower belt ---- xylene blue)

17. Turn off the electrophoresis instrument, remove the large plate, and then perform silver staining and development.

18. Gel electrophoresis removal, silver staining, development steps:

(1) First remove the upper tank liquid, then remove the clips fixed on the side, and then remove the fixing of the base. Take the board and put it in the water tank for soaking.

(2) Use a spatula to pry the two glass plates apart (run the glue correctly, the glue sample should be on the bottom plate, prepare silver stain)

Shake well. Put the large plate in it for 10min, and avoid silver staining for too long, otherwise it will be degummed.

After silver staining, remove the slab and rinse it with distilled water to develop.

Fully shake and evenly, develop the silver-stained slab in a developing solution, and wash the alkaline taste in water after development.

Observe the DNA band in the luminous plate and take a picture.

As shown in the Sequence Listing SEQ1, it is the EAT1 nucleic acid sequence.

EAT1 Mutation Sterility Gene Eat Selection

eat primer primer

Upstream primer TACAGGAGTAGCAGCGGTTC

Downstream primer TGGTACCTAACTGGAGAGCTGA

Product size: 78bp

As shown in the sequence listing SEQ2, it is a wild-type sequence.

The sequence of the mutant strain is shown in the sequence listing SEQ2.

Table 1.SSR primer sequences for background selection

The invention relates to the creation of a plant sterility mutant, and particularly relates to a gene knockout vector using a gene knockout technology, and an Agrobacterium-mediated method to introduce the vector into embryonic cells, thereby obtaining a fertility gene. A method of silencing cells and developing into complete mutants.

The invention provides a method for creating a common nuclear sterility mutant, which includes the following steps:

T1. Use gene knockout technology to construct a gene knockout vector;

The method for creating an ordinary nuclear sterility mutant further includes:

T3. Knockout detection.

The method for creating an ordinary nuclear sterility mutant further includes:

T4. Phenotypic identification of transgenic plants.

5’-ggcaCACAATGGCTCCAGCATTCC-3 ’

5'-AAACGGAATGCTGGAGCCATTGTG-3 '.

Said T2. Using an Agrobacterium-mediated method to introduce a vector into embryonic cells, thereby obtaining cells in which fertility genes have been silenced, and according to the experimental steps in the Vesselide kit, complete the construction of the vector, and Complete Agrobacterium transformation.

In step T2, the medium used in the rice transgenic process includes:

Induction medium: NB; 2,4-D 1.8-2.0mg / mL; 6-BA 0.1-0.2mg / mL; agar powder 10-15g / L;

Subculture medium: NB; 2,4-D 1.8-2.0mg / mL; CH 0.2-0.3g / L; sucrose 28-30g / L; agar powder 10-15g / L;

Co-culture medium: NB; AS 100-200umol / L.

In step T2, the operation steps of rice transgene include:

1) Induction: After husking and disinfection of rice seeds, mature embryos are inoculated into induction medium to induce embryogenic callus;

2) Infection: Isolate the obtained callus from endosperm and buds and inoculate Agrobacterium obtained in 2 (Agrobacterium containing a knockout vector plasmid, that is, the strain obtained in step 2 on page 8 of the specification) Infection in suspension and then air-dried for use;

3) Co-cultivation: Transfer the dried callus to the co-culture medium and cultivate until the bacterial cells appear on the surface of the callus;

4) Screening: The co-cultured callus is washed and inoculated into the screening medium for resistance screening to obtain the resistant callus;

5) Differentiation: The obtained resistant callus is inoculated onto a differentiation medium and cultured until a seedling is differentiated.

In step T3, the gene knockout detection further includes:

Take the regenerated seedlings, cut out 100 mg of fresh leaves, and use the CTAB method to extract DNA. The specific steps are as follows:

(1) Take the material, grind it into powder with liquid nitrogen, and quickly transfer it into a 1.5ml Eppendorf tube;

(2) Add 800 μl of CTAB extraction buffer, mix well, and gently shake several times every 5 min. After 20 min, 12000 r / min, centrifuge for 15 min;

(3) Carefully aspirate the supernatant, add an equal volume of phenol: chloroform solution, mix well, 4 ° C, 12000r / min, and centrifuge for 10min;

(4) Carefully suck the supernatant, add an equal volume of chloroform, mix well, and centrifuge at 4 ° C, 12000 r / min, and centrifuge for 10 min;

(5) Repeat step (4) 1-2 times until the protein layer does not appear;

(6) Take the supernatant, precipitate at -20 ° C for 1h, 4 ° C, 12000r / min, and centrifuge for 10min;

(7) Discard the supernatant and wash the pellet twice with 70% ethanol;

(8) After drying at room temperature, dissolve in 30-50 μl of DEPC deionized water and store at -20 ° C or -70 ° C for later use.

The present invention also provides a method for detecting gene knockout of a plant sterility mutant, comprising the following steps:

(5) Repeat step (4) 1-2 times until the protein layer does not appear;

(7) Discard the supernatant and wash the pellet twice with 70% ethanol;

In step T3, the gene knockout detection further includes: using the extracted DNA as a template to perform fragment amplification, and detecting a positive plant;

Amplification procedures include:

Mutation vector creation experiment steps

1.Construction of CRISPR / cas9 vector

(1) The gene used in the embodiment of the present invention is the CYP85A5 gene, and the sgRNA sequence is designed as follows:

5’-ggcaCACAATGGCTCCAGCATTCC-3 ’

5’-AAACGGAATGCTGGAGCCATTGTG-3 ’

2. Complete the construction of the vector and complete the transformation of Agrobacterium according to the experimental steps in the Vesalide kit.

3.The recipe of the medium used in the rice transgenic process

Co-culture medium: NB; AS 100-200umol / L;

Screening medium: NB; 2,4-D 1.8-2.0mg / mL; 6-BA 0.1-0.2mg / mL; Hyg20-25mg / L, Timentin 200-400mg / L, agar powder 10-15g / L;

Differentiation medium: NB; Pro 0.3-0.5g / L; CH 0.2-0.3g / L; 6-BA 1.8-2.0mg / mL; KT 0.8-1.0mg / mL; NAA 0.3-0.5mg / mL, IAA 0.4 -0.5mg / mL; Hyg 20-25mg / L; Timentin 200-400mg / L; Sucrose 25-30g / L; Agar powder 10-15g / L;

Rooting medium: NB; NAA 0.4-0.7mg / L; sucrose 25-30g / L; agar powder 10-15g / L

YEB medium required for Agrobacterium culture: yeast extract 0.8-1.2g / L; peptone 4.5-5.0g / L; beef extract 4.5-5.0g / L; sucrose 4.0-6.0g / L; magnesium sulfate 0.3-0.5 g / L; agar 12-15g / L; pH 6.8-7.2;

4. The operation steps of rice transgenic experiment are:

2) Infection: Isolate the obtained callus from endosperm and bud, inoculate in the Agrobacterium suspension obtained in 2 to infect, and then air dry for use;

5) Differentiation: the obtained resistant callus is inoculated on a differentiation medium and cultivated until a seedling is differentiated;

6) Rooting: Inoculate the seedlings on the rooting medium to take root, and perform PCR detection, and select plants that are positive as the transformed plants;

After the Agrobacterium containing the CYP78A13 gene knockout vector plasmid was dark-cultured on a solid YEB medium at 28C for 2 days, the Agrobacterium was eluted with an appropriate amount of a medium supplemented with 100 M / L acetylsyringone. Adjust the concentration of the bacterial solution to OD600nm = 0.1-1.0, and let it stand for 1 hour to allow the Agrobacterium to form a suspension. Take the pre-cultured callus into a sterilized culture bottle, add the above-mentioned Agrobacterium liquid, shake it a little for 30 minutes, dry it on sterile filter paper, and inoculate the co-culture medium at 25 ° C. Dark culture for 3 days.

After 3 days, pick up the co-culture callus in a wide-mouth culture bottle, rinse it with sterile water 3-5 times, and shake several times each time until no filamentous bacteria are found in the water. The last time with 250mg / L carbenicillin in sterile water was left for 1 hour, and then placed on sterile filter paper to dry. The next day, they were transferred to a selection medium (with 250 mg / L carbenicillin, and 30 mg / L hygromycin) to screen for resistant calluses.

The callus is transferred to the new selection medium every two weeks, and it takes about three weeks to see the tumor-like callus grow from the brown and dried callus. The resistant callus continued to be subcultured in selective medium supplemented with hygromycin 50mg / l (without addition of carbapenicillin), and its color was observed. After one week, the resistant callus with bright yellow color was transferred to the differentiation medium , Matte, dim callus is eliminated.

After the resistant callus is selected for 3-5 days on the selection medium, a portion is selected and transferred to the differentiation medium. After 2 weeks, green shoots began to appear in the resistant callus, and after 3 weeks, young shoots could develop, followed by roots. The seedlings were transferred to rooting medium. After the seedlings have taken root, the culture flask is removed, the culture medium on the roots is washed, and then transferred to the field for planting.

4.Knockout detection

(2) Add 800 μl of CTAB extraction buffer and mix (CTAB preheated at 65 ° C in a water bath), shake gently every 5 minutes, 12000 r / min after 20 minutes, and centrifuge for 15 minutes;

(3) Carefully suck the supernatant and add an equal volume of a phenol: chloroform (400 μl each) solution, mix well, 4 ° C, 12000 r / min, and centrifuge for 10 min;

(4) Carefully suck the supernatant, add an equal volume of chloroform, mix well, and centrifuge at 12000 r / min at 4 ° C for 10 min.

(5) Repeat step (4) 1-2 times until the protein layer does not appear;

(7) Discard the supernatant and wash the pellet twice with 70% ethanol;

(8) After drying at room temperature (usually 5-15min), dissolve in 30-50μl DEPC deionized water and store at -20 ° C or -70 ° C for later use.

(2) Using the extracted DNA as a template, use 5'AGGGAGCTCTCTTGCGCCGC3 '/ R5'CGTCCTCGCCGCGCTCCTCCTG3' to perform fragment amplification according to the following system and procedure, and detect positive plants.

Experimental results

After the amplification was completed, the PCR products were sequenced, and the sequencing results were compared with the original series. It was found that there were two base mutations in the target site setting region.

5. Phenotypic identification of transgenic plants

Pollen viability was detected, and pollen activity of transgenic positive plants was lost. From the perspective of plant type, transgenic plants showed prolonged vegetative growth, slow heading or incomplete heading.

(1) Take the mature anther on the positive plant on the slide, add a drop of distilled water

(2) Smash the anthers with tweezers to release the pollen grains, add a drop of I2-KI solution, cover with a cover glass, and observe under a microscope. Any pollen stained with blue is a strong starch-containing pollen. Grains, yellowish brown are stunted pollen grains. The microscopy results are shown in Figure 1. FIG. 1 is a result of pollen viability detection in an embodiment of the present invention. Among them, the left picture is a control plant and the right picture is a transgenic plant. Figure 2 is the fertility performance map, in which: the left is a control plant; the right is a plant in which the CYP78A13 gene has been knocked out. The CYP78A13 gene sequence is shown in the sequence listing SEQ4.

The above are just a few embodiments of the present invention, and are not intended to limit the present invention in any form. Although the present invention is disclosed in the preferred embodiment as above, it is not intended to limit the present invention. Any person skilled in the art, Without departing from the scope of the technical solution of the present invention, making some changes or modifications by using the technical content disclosed above is equivalent to an equivalent implementation case, and all fall within the protection scope of the technical solution of the present invention.

Claims

A method for obtaining a sterile line mutant is characterized in that the existing mutant is used to cross with other varieties, the sterile line is used as a marker, and the progeny are selected, and the progeny are simultaneously backcrossed.
The method for obtaining a sterile line mutant according to claim 1, wherein each backcross is tested for the sterile line.
A method for obtaining a sterile line mutant, which comprises the steps of: using an ordinary genic male sterile line rice material with one or more EAT1 gene mutations as a female parent, and crossing the line to be modified to obtain a F1 generation, Then, the line to be transformed was used as a recurrent parent for backcrossing. Each backcross generation selected an individual containing the EAT1 mutation gene as the next-generation parent and backcrossed 2-6 generations.
The method according to claim 3, wherein each backcross generation selects an individual containing the EAT1 mutant gene as the next-generation parent, and the aforementioned individual as the next-generation parent is in the genetic background and field The performances are biased towards individual plants of recurrent parents.
The method for obtaining a sterile line mutant according to claim 3, further comprising the following steps:

DNA extraction steps;

Steps for DNA testing;

PCR amplification steps;

Steps of polyacrylamide gel electrophoresis.
The method according to claim 5, wherein the step of DNA extraction further comprises: taking 0.5g rice leaves of each BC1 plant and placing them in a low-temperature frozen research chamber at -20 ° C; Nitrogen was ground into a white powder and placed in a 2 mL centrifuge tube. While grinding, turn on the water bath to heat to 65 ° C.
The method for obtaining a mutant of a sterile line according to claim 5, wherein the step of extracting DNA further comprises: adding 700 μL of CTAB lysate pre-heated at 65 ° C. for 1 h to a centrifuge tube, shaking it a few times, and then Put it into a 65 ° C thermostatic water bath for 40 minutes, and shake it several times every 20 minutes.
The method for obtaining a mutant of a sterile line according to claim 5, wherein the step of extracting the DNA further comprises: cooling the sample at room temperature for 5 minutes, and adding 700 μL of phenol-chloroform-isoamyl alcohol (25: 24: 1), add it against the wall, shake it several times and check for leaks.
The method for obtaining a mutant of a sterile line according to claim 5, wherein the step of DNA extraction further comprises: pressing the tube cover by hand, slowly turning it several times, and then placing a newspaper on a shaker, Orient each tube and shake at 30 rpm for 5-10 minutes at room temperature.
The method for obtaining a mutant of a sterile line according to claim 5, wherein the step of extracting the DNA further comprises: placing the DNA into a refrigerated centrifuge and centrifuging at 12000 rpm for 5 minutes at 4 ° C.
A method for creating a common nuclear sterility mutant, which comprises the following steps:

T1. Use gene knockout technology to construct a gene knockout vector;

T2. Using the Agrobacterium-mediated method, the vector is introduced into embryonic cells to obtain cells in which fertility genes are silenced.
The method for creating a common nuclear sterility mutant according to claim 11, further comprising:

T3. Knockout detection.
The method for creating a common nuclear sterility mutant according to claim 12, further comprising:

T4. Phenotypic identification of transgenic plants.
The method for creating a common nuclear sterility mutant according to claim 11, wherein the T1. Utilizes gene knockout technology to construct a gene knockout vector, and the sgRNA sequence is designed as follows:

5’-ggcaCACAATGGCTCCAGCATTCC-3 ’

5'-AAACGGAATGCTGGAGCCATTGTG-3 '.
The method for creating a common nuclear sterility mutant according to claim 11, wherein the T2. Uses an Agrobacterium-mediated method to introduce a vector into embryonic cells, thereby obtaining cells in which fertility genes are silenced In accordance with the experimental steps in the Vishay Leader kit, the construction of the vector is completed, and the transformation of Agrobacterium is completed.
The method of claim 11, wherein in step T2, the culture medium used in the rice transgenic process comprises:

Induction medium: NB; 2,4-D 1.8-2.0mg / mL; 6-BA 0.1-0.2mg / mL; agar powder 10-15g / L;

Subculture medium: NB; 2,4-D 1.8-2.0mg / mL; CH 0.2-0.3g / L; sucrose 28-30g / L; agar powder 10-15g / L;

Co-culture medium: NB; AS 100-200umol / L.
The method for creating a common nuclear sterility mutant according to claim 11, characterized in that, in the step T2, the operation steps of rice transgene include:

1) Induction: After husking and disinfection of rice seeds, mature embryos are inoculated into induction medium to induce embryogenic callus;

2) Infection: Isolate the obtained callus from endosperm and buds, inoculate in Agrobacterium suspension for infection, and then air dry for use;

3) Co-cultivation: Transfer the dried callus to the co-culture medium and cultivate until the bacterial cells appear on the surface of the callus;

4) Screening: The co-cultured callus is washed and inoculated into the screening medium for resistance screening to obtain the resistant callus;

5) Differentiation: The obtained resistant callus is inoculated onto a differentiation medium and cultured until a seedling is differentiated.
A method for detecting gene knockout of a plant sterility mutant, which comprises the following steps:

Take the regenerated seedlings, cut out 100 mg of fresh leaves, and use the CTAB method to extract DNA. The specific steps are as follows:

(1) Take the material, grind it into powder with liquid nitrogen, and quickly transfer it into a 1.5ml Eppendorf tube;

(2) Add 800 μl of CTAB extraction buffer, mix well, and gently shake several times every 5 min. After 20 min, 12000 r / min, centrifuge for 15 min;

(3) Carefully suck the supernatant, add an equal volume of phenol: chloroform solution, mix well, 4 ° C, 12000r / min, and centrifuge for 10min;

(4) Carefully suck the supernatant, add an equal volume of chloroform, mix well, and centrifuge at 4 ° C, 12000 r / min, and centrifuge for 10 min;

(5) Repeat step (4) 1-2 times until the protein layer does not appear;

(6) Take the supernatant, precipitate at -20 ° C for 1h, 4 ° C, 12000r / min, and centrifuge for 10min;

(7) Discard the supernatant and wash the pellet twice with 70% ethanol;

(8) After drying at room temperature, dissolve in 30-50 μl of DEPC deionized water and store at -20 ° C or -70 ° C for later use.
A method for preparing a plant mutant includes the following steps:

S1. Construct a CRISPR / cas9 gene knockout vector and knock out the CYP78A13 gene;

S2. Agrobacterium transformation;

S3. Knockout detection;

S4. Phenotypic identification of transgenic plants.
The method for preparing a plant mutant according to claim 19, wherein in step S1, a CRISPR / cas9 gene knockout vector is constructed, and the CYP78A13 gene is knocked out.

5’-ggcaCACAATGGCTCCAGCATTCC-3 ’

5'-AAACGGAATGCTGGAGCCATTGTG-3 '.
A sgRNA sequence used in a knockout gene is characterized in that the sequence structure is as follows:

5’-ggcaCACAATGGCTCCAGCATTCC-3 ’

5'-AAACGGAATGCTGGAGCCATTGTG-3 '.
An sgRNA sequence used in a knockout gene according to claim 21, for use in constructing a knockout vector.
The method for preparing a plant mutant according to claim 19, wherein the medium used in step S2 comprises:

Screening medium: NB; 2,4-D 1.8-2.0mg / mL; 6-BA 0.1-0.2mg / mL; Hyg 20-25mg / L, Timentin 200-400mg / L, agar powder 10-15g / L;

Differentiation medium: NB; Pro 0.3-0.5g / L; CH 0.2-0.3g / L; 6-BA 1.8-2.0mg / mL; KT 0.8-1.0mg / mL; NAA 0.3-0.5mg / mL, IAA 0.4 -0.5mg / mL; Hyg 20-25mg / L; Timentin 200-400mg / L; Sucrose 25-30g / L; Agar powder 10-15g / L;

Rooting medium: NB; NAA 0.4-0.7mg / L; sucrose 25-30g / L; agar powder 10-15g / L.