CN108130328A - The application of male sterility gene OsDPW3 and the method for rice fertility restorer - Google Patents

Abstract

The invention discloses a kind of methods of the application and fertility restorer of male sterility gene OsDPW3；Using conventional gene engineering method or based on CRISPR/Cas9 systems, knock out, change or inhibit OsDPW3 genes, so that OsDPW3 gene expressions water reduces in japonica rice background wild rice, and then obtain male sterible series of rice.The invention further relates to a kind of methods of rice fertility restorer, by primer amplification OsDPW3 genes, using the means untransformed mutants plant of genetic transformation, mutant can be made to be restored to wild type phenotype.Rice male-sterile plants prepared by the present invention, which tie up to vegetative growth of rice plants period phenotype without exception, to be occurred, but occur exception during the anther development in reproductive growth period.If applied in crossbreeding, the work of maternal emasculation can be exempted, greatly improve production efficiency, reduce cost of labor, there is important application in agricultural production.

Description

The application of male sterility gene OsDPW3 and the method for rice fertility restorer

Technical field

The present invention relates to the methods that a kind of rice strain of technical field of bioengineering formulates, and in particular to Yi Zhongxiong The application of property sterile gene OsDPW3 and the method for rice fertility restorer.

Background technology

Rice is the important cereal crops in the whole world, and using rice as staple food, rice is also the population there are about 50% in the world Process the raw material of numerous food product.Since the genome of rice is smaller, and rice conversion system is highly developed, can be used as list The model plant of leaf research, people need to be understood to rice reproductive development mechanism.The discovery of male sterible series of rice and its profit With the new era for having started paddy rice cross breeding breeding, great function has been played to improving rice yield.Due to current paddy rice cross breeding mistake The sterile line used in journey carries out male sterility of rice tune in a deep going way there are the shortcomings of fertility instability, cytoplasm negative effect The research of control mechanism, to obtaining novel rice sterile line, boosting agricultural yield etc. is of great significance.Simultaneously to disclosing plant life Growing molecular regulation mechanism of development etc. also has important theory significance.

Male sterile line：Refer to that a kind of male is degenerated (mainly pollen degenerate) but the normal female rice of gynoecium, due to flower The powerless life of powder, it is impossible to which self-pollination is solid, only by foreign pollen ability fertilization, therefore makees by this female rice For genetic tool, by the method for artificial supplementary pollination, a large amount of hybrid seeds just can be generated.From Breeding strategy, hybridize water The development of rice can be divided into three line method, two line method and one is three developing stage of method.It often enters a new phase, is all in breeding Primary breakthrough, so as to can be the output increased of rice a to New step.The hybrid rice in production belongs to three systems now The scope of method interbreed use of advantage, this ternary hybrid rice generally increase production 20% or so than conventional rice, currently still In period in the ascendant.But Three-line Hybrid rice paddy seed Heterosis is complicated, is limited by restorer and maintainer relationship System, the screening for making excellent combination are relatively difficult.Therefore, scientist is screening and is cultivating always new sterile line, thin to extend Cytoplasm background lays the foundation for distant hybridization and the utilization of hybrid vigour.

Invention content

The present invention provides application and the water of a kind of male sterility gene OsDPW3 for deficiencies of the prior art The method of rice fertility restorer (that is, restoring male sterility of rice).The present invention participates in regulation and control water using OsDPW3 genes and its albumen The characteristics of rice arrenotoky and its using transgenic technology control rice male reproductive development, by be mutated the protein sequence or The expression of the albumen is inhibited to generate new rice male-sterile plants system, there is highly important application in agricultural production.

The purpose of the present invention is what is be achieved through the following technical solutions：

In a first aspect, the present invention relates to a kind of application of male sterility gene OsDPW3, the male sterility gene As shown in SEQ ID NO.1, the application is the amino acid sequence of OsDPW3 codings：Using conventional method or it is based on CRISPR/Cas9 systems knock out, change or inhibit OsDPW3 genes so that the OsDPW3 gene expressions in conventional rice kind Level reduces, and then obtains rice male-sterile plants system.

Second aspect, the invention further relates to a kind of methods of rice infertility strain initiative, include the following steps：Selection is conventional Rice varieties, processing, are cultivated to get the rice male-sterile plants system；The processing is using conventional method or to be based on CRISPR/Cas9 systems so that the nucleotide sequence of amino acid as shown in SEQ ID No.1 is encoded in rice and is lacked, is become Exclusive or inhibits, so that the amino acid sequence corresponds to expression reduction or the loss of activity of polypeptide.

Preferably, the rice varieties are japonica rice variety 9522.

Preferably, the nucleotide sequence is as shown in SEQ ID No.2.

Preferably, the method for the rice male-sterile plants system initiative includes the following steps：Using the method for physical mutagenesis, It is SEQ ID No.9, and then obtain the rice to make the nucleotide sequence mutation as shown in SEQ ID No.2 in conventional rice kind Male sterility strain, i.e. osdpw3-1 mutant.

Preferably, the method for the rice male-sterile plants system initiative includes the following steps：Using the method for physical mutagenesis, It is SEQ ID No.10, and then obtain the water to make the Amino acid sequence mutants as shown in SEQ ID No.1 in conventional rice kind Rice male sterility strain, i.e. osdpw3-1 mutant.

Preferably, the processing based on CRISPR/Cas9 systems specifically includes：It is pinpointed using CRISPR/Cas9 systems The method of knockout knocks out OsDPW3 genes, inhibits the table of coding nucleotide sequence of amino acid sequence as shown in SEQ ID No.1 It reaches.

It is highly preferred that the method that the CRISPR/Cas9 systems fixed point knocks out includes the following steps：

A) synthesis mononucleotide aligning primer is as shown in SEQ ID No.3 and SEQ ID No.4；

OsDPW3CRISPRUP(SEQ ID No.3):TGGCGTAACATCGGGGGGAGTCTA

OsDPW3CRISPRDOWN(SEQ ID No.4):AAACTAGACTCCCCCCGATGTTAC

B) the mononucleotide sequence for making synthesis by annealing reaction forms dimeric structure, and (carrier comes from carrier segments Hundred lattice companies, article No. BGK03) reaction is attached, structure is containing rice Os DPW3 genes target sequence (such as SEQ ID No.5 institutes Show) OsDPW3-BGK03 plasmids；

C) rice varieties are infected with the Agrobacterium tumefaciems of the plasmid containing OsDPW3-BGK03；

D) by using the specific primer of the OsDPW3 genes as shown in SEQ ID No.11 and SEQ ID No.12, expand Increase genomic fragment to be sequenced, screen mutant plant.

Identify-F(SEQ ID No.11):TCGTAGGTGACCTCGTACTC

Identify-R(SEQ ID No.12):TGGTGGCAAGTGCCTATTCCTC

The rice Os DPW3 gene target sequences are as follows：

SEQ ID No.5:GTAACATCGGGGGGAGTCTA

The third aspect, the invention further relates to the rice males that a kind of method of the rice male-sterile plants system initiative obtains Sterile plant ties up to the purposes in the rice production of hybrid seeds, and the purposes includes：Using the rice male-sterile plants system as female parent, carry out miscellaneous Hand over breeding.

Fourth aspect, the invention further relates to a kind of method for the male-sterile character for restoring rice male-sterile plants system, packets Include following steps：Using conventional genetic means by the OsDPW3 genes, it is transferred to the rice male obtained such as the aforementioned application Sterile strain, so that mutant restores wild type phenotype.

Preferably, described method includes following steps：The Agrobacterium tumefaciems that complementation containing OsDPW3 is built (Agrobacterium tumefaciens) EHA105 is transferred to the rice male-sterile plants system, cultivate to get；Wherein Nucleotide sequence of the OsDPW3 complementations structure containing coding as shown in SEQ ID NO.6.

It is highly preferred that the method specifically comprises the following steps：

(a) genomic DNA is extracted from 9522 seedling leaves of wild type as template, with base sequence such as SEQ ID Primer amplification shown in No.7 and SEQ ID No.8 goes out the genome sequence as shown in SEQ ID NO.6 of OsDPW3 genes Segment；

(b) Agrobacterium tumefaciems (Agrobacterium for carrying expression OsDPW3 complementation carrier constructions is provided tumefaciens)EHA105；

(c) cell or tissue of rice male-sterile plants system or organ are contacted with the Agrobacterium in step (b), so as to make Coding nucleotide of amino acid as shown in SEQ ID NO.1 is transferred to rice cell, and be integrated on the chromosome of rice cell；

(d) selection is transferred to the rice cell or tissue of the nucleotide, and regeneration obtains the rice plant for restoring fertility.

Preferably, the nucleotide of coding amino acid as shown in SEQ ID NO.1 is as shown in SEQ ID No.2.

Compared with prior art, the present invention has following advantageous effect：

1st, the present invention is by controlling paddy pollen integrin like proteins OsDPW3 genes and its coding albumen to obtain rice male and give birth to The variant of development is grown, realizes control rice reproductive process；

2nd, rice male-sterile plants prepared by the present invention tie up to vegetative growth of rice plants period phenotype without exception and occur, with source Parent's no significant difference, but occur exception during the anther development in reproductive growth period, pollen abortion obtains complete infertility Plant, if applied in crossbreeding, the work of maternal emasculation can be exempted, greatly improve production efficiency, reduced artificial Cost has highly important application on hybrid rice structure and agricultural production.

Description of the drawings

Upon reading the detailed description of non-limiting embodiments with reference to the following drawings, other feature of the invention, Objects and advantages will become more apparent upon：

Fig. 1 is the morphological observation schematic diagram of osdpw3-1 mutant plants；Wherein, Figure 1A is 9522 He of wild type The whole strain phenotype of osdpw3-1 mutant；Figure 1B is wild type 9522 and osdpw3-1 mutant small ears；Fig. 1 C are wild type 9522 With osdpw3-1 mutant little Hua internal structures；Fig. 1 D are wild type 9522 and osdpw3-1 mutant mature pollens I₂/ KI contaminates Color result；Fig. 1 E are wild type 9522 and osdpw3-1 mutant fringe shapes；

Fig. 2 is the morphological observation schematic diagram of osdpw3-2 mutant plants；Wherein, Fig. 2A is the whole of wild type 9522 Strain phenotype；Fig. 2 B are the whole strain phenotype of osdpw3-2 mutant；Fig. 2 C are the little Hua internal structures of wild type 9522；Fig. 2 D are The little Hua internal structures of osdpw3-2 mutant；Fig. 2 E are the single stamen phenotype of wild type 9522；Fig. 2 F dash forward for osdpw3-2 The single stamen phenotype of variant；Fig. 2 G are the mature pollen I of wild type 9522₂/ KI coloration results；Fig. 2 H dash forward for osdpw3-1 The mature pollen I of variant₂/ KI coloration results；Fig. 2 I are the tassel of wild type 9522；Fig. 2 J are the fringe of osdpw3-2 mutant Son；

Fig. 3 obtains wild type phenotype schematic diagram for complementation osdpw3-1 mutant；Wherein, Fig. 3 A are small for wild type 9522 Flower internal structure chart；Fig. 3 B are the little Hua internal structure charts of osdpw3-1 mutant；Fig. 3 C is after complementation osdpw3-1 mutant The little Hua internal structure charts in generation；Fig. 3 D are wild-type mature pollen I₂/ KI coloration results；Fig. 3 E are spent for osdpw3-1 mutant Powder I₂/ KI coloration results；Fig. 3 F are the mature pollen I of complementation osdpw3-1 Mutant progenies₂/ KI coloration results；Fig. 3 G are open country 9522 small ear drawing of seeds of raw type, osdpw3-1 mutant and complementation osdpw3-1 Mutant progenies restore small ear seed during fertility Figure.

Specific embodiment

With reference to specific embodiment, the present invention is described in detail.Following embodiment will be helpful to the technology of this field Personnel further understand the present invention, but the invention is not limited in any way.It should be pointed out that the ordinary skill to this field For personnel, without departing from the inventive concept of the premise, various modifications and improvements can be made.These belong to the present invention Protection domain.

Test method without specific conditions in the following example, usually according to normal condition, such as Sambrook etc. Molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) described in Condition or according to the normal condition proposed by manufacturer.

The OsDPW3 genes are the nucleotide sequence SEQ ID of coding amino acid sequence as shown in SEQ ID NO.1 NO.2。

Embodiment 1, the method for rice male-sterile plants system initiative

1.1 formulate osdpw3 rice male-sterile plants system by conventional breeding means

The osdpw3-1 mutant materials of the present embodiment are to educate round-grained rice 7 (also known as 9522) by conventional by conventional japonica rice kind force Gene engineering method mutation and obtain.

Those skilled in the art know, other means mutagenesis rice conventional varieties such as radiation exposure can also be used to dash forward Become, if osdpw3-1 mutant is made to mutate, and then it is caused to encode the frameshit of albumen and terminate in advance, also result in water Rice male reproductive organ anther is unable to normal development.To the mutant third backcross generation of mutagenesis, recessive core Dominant gene is obtained Stablize the osdpw3-1 mutant of heredity.Osdpw3-1 mutant and 9522 are returned, the phenotypes of all F1 generations is all with 9,522 1 It causes, shows as fertile.The F2 that generates is in group after the selfing of the F1 generation of mutant and wild type crosses, fertile with sterile plant Segregation ratio is about 3:1, it is the phenotype of a mutant infertility as caused by being mutated Recessive genes to show this.

The clone of 1.2 rice fertilities control protein gene OsDPW3

Fertility control protein gene OsDPW3 (its nucleotide sequence such as SEQ ID No.2 are included using inventor's structure It is shown) and its mutator osdpw3-1 (its nucleotide sequence is as shown in SEQ ID No.9) compositions, technology people in the art Clear paddy gene positional cloning (map-based cloning or position cloning) group of member, by molecular labeling It is positioned in 1 small genomic fragment, such as in 100Kb.On this basis, the base of the segment is included with conventional method separation Because of a group DNA clone.Determine that one of them controls egg containing complete rice male reproductive development through sequencing and further hybridization identification White OsDPW3.

Through full nucleotide sequence analysis the result shows that：Rice male fertility OsDPW3 full length genes are 2572bp (SEQ ID NO.13 includes control region and introne).Through software analysis and cDNA clone, for ORF as shown in SEQ ID NO.2, coding is complete The rice male reproductive development control albumen of a length of 701 amino acid, sequence is as shown in SEQ ID NO.1.

The point mutation of 1.3 rice fertilities control protein gene OsDPW3

The osdpw3-1 mutant materials of the present embodiment are to educate round-grained rice 7 (also known as 9522) process pair by conventional japonica rice kind force The sequence variations of OsDPW3 genes obtain, and compare by the sequence to OsDPW3 mutators osdpw3, rice male reproduction hair Educating the frameshit of control albumen and terminating in advance can prevent rice male reproductive organs from normal development, to cause plant sterile；This Embodiment OsDPW3 mutators are that 6 base pair deletions (its sequence is as shown in SEQ ID NO.9) in code area cause water Rice arrenotoky development control protein translation must terminate in advance to be lost with function.

1.4 reduce the expression water of the OsDPW3 in rice varieties by CRISPR means (being based on CRISPR/Cas9 systems) It is flat

In order to be applied to OsDPW3 albumen, constructing the carrier of OsDPW3 gene Cs RISPR, (carrier is public from hundred lattice Department, article No. BGK03), and 9522 plant of wild type is converted, to reduce the expression of OsDPW3, change rice fertility so as to reach Purpose.

Synthesize mononucleotide aligning primer

OsDPW3CRISPRUP(SEQ ID No.3):TGGCGTAACATCGGGGGGAGTCTA

OsDPW3CRISPRDOWN(SEQ ID No.4):AAACTAGACTCCCCCCGATGTTAC

The mononucleotide sequence for making synthesis by annealing reaction forms dimeric structure, and (carrier comes from hundred with carrier segments Lattice company, article No. BGK03) reaction is attached, structure contains rice Os DPW3 gene target sequence OsDPW3-BGK03 plasmids；Institute It is as follows to state rice Os DPW3 gene target sequences：

SEQ ID No.5:GTAACATCGGGGGGAGTCTA

It in the flat lining outs of YEB containing Kan (50 μ g/ μ l), will be obtained containing the Agrobacterium that OsDPW3-BGK03 is built Single bacterium colony.It chooses single bacterium colony and is inoculated into YEB fluid nutrient mediums of the 3ml containing antibiotic and stayed overnight in 28 DEG C of shaken cultivations, pressed within the 2nd day 1% inoculum concentration is transferred in YEB fluid nutrient mediums of the 50ml containing antibiotic, and 200rpm continues shaken cultivation to OD₆₀₀For 0.4 to When 0.6 or so, by fresh Agrobacterium bacterium solution in 5000rpm, centrifugation 5 minutes, the AAM liquid of 1/3 volume is collected and is resuspended in In culture medium, the various acceptor materials of rice transformation are can be used at this time.

The present embodiment uses the rataria callus of conventional conversion method for agrobacterium rice transformation 9522.Take 12-15 after pollinating It 9522 immature seeds are after 70% ethyl alcohol impregnates 1 minute, (with water 1 in liquor natrii hypochloritis:3 mixing, add 2-3 drops Polysorbas20) disinfection 90 minutes or more, with aseptic water washing 4-5 times, then choose rataria with scalpel and tweezers and be transferred to Evoked callus on N6D2 culture mediums, 26 ± 1 DEG C, be protected from light under the conditions of cultivate, after 4 days can be used for convert.By rataria callus It is soaked into fresh AAM Agrobacterium bacterium solutions and shakes frequently, rice material is removed after twenty minutes, is sucked on aseptic filter paper Excessive bacterium solution is transferred to immediately on N6D2C culture mediums, is co-cultured 3 days in 26 DEG C.During co-cultivation, in culture medium is co-cultured Acetosyringone is added in, uses a concentration of 100 μM.After 3 days, callus is taken out on culture medium from co-culturing, cuts plumule simultaneously It is transferred on the Selective agar medium containing 25mg/L hygromycin and carries out selection culture.After 7-12 days by resistant calli go to containing Continue to screen on the Selective agar medium of 50mg/L Hyg.Eugonic resistant calli is transferred to pre- differentiation after 10-12 days It is cultivated one week or so on culture medium, then moves to differentiation (12 hours illumination/days) on differential medium.Regenerated seedling is in 1/2MSH Strong plantlets and rootage on culture medium is subsequently moved within phjytotron nutrient fluid cultivation.

Positive plant extracts blade total DNA, and transformed plant is further identified through PCR.Sequencing detection target point gene sequence, Using the specific primer of the OsDPW3 genes as shown in SEQ ID No.11 and SEQ ID No.12, amplification gene pack section into Row sequencing, screens mutant plant.OsDPW3 gene knockout plant osdpw3-2 is obtained by this method.

Identify-F(SEQ ID No.11):TCGTAGGTGACCTCGTACTC

Identify-R(SEQ ID No.12):TGGTGGCAAGTGCCTATTCCTC

1.5 OsDPW3 protein actives are lost or expression reduction leads to rice male dysplasia

To the morphological observation of osdpw3-1 mutant plants obtained by conventional breeding.Such as Fig. 1, wild type and mutation The phenotype of type osdpw3-1 does not have significant difference in vegetative growth stage, in reproductive growth period, wild type and saltant type The fringe shape of osdpw3-1, grain number per spike compare without notable difference and show that 9522 anther development of wild type is normal, and Osdpw3-1 saltant type anther bleaches become smaller (Fig. 1 C)；9522 iodine of wild type dye is normal, and saltant type osdpw3-1 anther iodine contaminates not The pollen grain (Fig. 1 D) of upper maturation, causing cannot be normally solid (Fig. 1 E).

The morphological observation of osdpw3-2 mutant plants obtained by CRISPR systems.Such as Fig. 2, wild type and The phenotype of CRISPR knockout mutations bodies osdpw3-2 does not have significant difference (Fig. 2A, 2B) in vegetative growth stage；During reproductive growth Phase anther bleaches become smaller (Fig. 2 C-2F) compared to wild type anther, and pollen grain iodine does not contaminate mature flower powder (Fig. 2 H), causes It cannot be normally solid (Fig. 2 J).

Application of the 1.6 OsDPW3 genes in other rice strain male sterility strains are formulated

Osdpw3-1 mutant is hybridized with rice variety 9311, Long Tefu or Guanglu ai 4 rice strain, in F2 generations Occur male sterility strain in plant with indica type feature, meet 3:1 law of segregation, and then prove that OsDPW3 genes exist When nucleotide sequence variation occurring in other rice varieties, male sterile plants can be equally generated.

The purposes of embodiment 2, osdpw3 mutant in the rice production of hybrid seeds

Sterile parent hybridization during osdpw3-1 mutant is combined as male parent with three systems or double-line hybrid, obtains F1 Generation.Screening has the plant of male sterility and sterile feature simultaneously in F2 generations, by plant guarantor corresponding with former sterile parent It is hybridization to hold.There is male sterility and the plant of sterile feature to hybridize with maintainer simultaneously for screening in F2 generations again, through mostly generation New male sterile line is obtained after screening by hybridization, suitable for as the female parent in cross combination.

Embodiment 3, the method for restoring osdpw3 mutant male-sterile characters

The genome nucleotide sequence for encoding OsDPW3 genes is transferred to osdpw3-1 mutant plants, mutant can be made It is restored to wild type phenotype.

Genomic DNA is extracted from 9522 seedling leaves of wild type as template, uses primer：

70025gDNAF (its sequence is as shown in SEQ ID NO.7)：

CCATGATTACGAATTCTATTGCCTGTTTGTGGCTGGAC；

70025gDNAR (its sequence is as shown in SEQ ID NO.8)：

ATTCGAGCTGGTCACCGCCGCTTACACGTTACTGTATTGG；

Amplify the genomic sequence fragment of the 9120bp as shown in SEQ ID NO.6 of OsDPW3 genes；

The DNA fragmentation of amplification is inserted into use by the segment by the In-Fusion transformation systems of Dalian treasured biotech firm In the binary vector pCAMBIA1301 carriers of rice transformation；Sequence verification is correct, which imports crown gall agriculture bar by electric shock Bacterium (Agrobacterium tumefaciens) EHA105 obtains OsDPW3 complementation Agrobacterium tumefaciems (Agrobacterium Tumefaciens) EHA105 is cured using the young fringe in genetic transformation means conversion osdpw3-1 mutant vegetative reproduction growth periods Wound, so as to which coding nucleotide of amino acid as shown in SEQ ID NO.1 be made to be transferred to rice cell, and be integrated into rice cell On chromosome；Regeneration obtains rice plant；To see whether mutant can be made to be restored to wild type phenotype.

T₀In generation, obtains complementary plant, and Fig. 3 shows T₀In generation, complementary plant can generate pollen, and by I₂/ KI is dyed, that is, is showed The wild type phenotype gone out.

In conclusion the present invention is by controlling rice integrin like proteins OsDPW3 genes and its coding albumen to obtain rice male The variant of reproductive development exception realizes control rice male reproductive development and fertility；The rice mutant that the present invention obtains exists Vegetative growth stage and source parent's no significant difference, into after generative growth phase, male reproductive organ dysplasia, pollen Abortion causes plant sterile, has highly important application in agricultural production.

Specific embodiments of the present invention are described above.It is to be appreciated that the invention is not limited in above-mentioned Particular implementation, those skilled in the art can make various deformations or amendments within the scope of the claims, this not shadow Ring the substantive content of the present invention.

Sequence table

<110>Shanghai Communications University

<120>The application of male sterility gene OsDPW3 and the method for rice fertility restorer

<130> 2017

<141> 2017-11-28

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 701

<212> PRT

<213> Oryza sativa

<400> 1

Met Arg Lys Arg Asp Leu Gly Ile Leu Leu Leu Ala Ala Phe Ala Val

1 5 10 15

Phe Phe Ser Leu Gln His Asp Gly Asp Leu Ser Phe Arg Glu Ala Trp

20 25 30

Tyr His Leu Ser Asp Ala Asp Tyr Pro Ile Lys His Asp Ala Asp Arg

35 40 45

Leu Pro Ser Pro Leu Val Ala Asp Leu Asn Gly Asp Gly Lys Pro Glu

50 55 60

Val Leu Ile Pro Thr His Asp Ala Lys Ile Gln Val Leu Gln Pro His

65 70 75 80

Pro Arg Pro Ser Pro Asp Asp Ala Ser Phe His Asp Ala Arg Leu Met

85 90 95

Ala Asp Val Ser Leu Leu Pro Ser Asn Val Arg Leu Ser Ser Gly Arg

100 105 110

Arg Pro Val Ala Met Ala Val Gly Thr Val Asp Arg His Tyr Ala His

115 120 125

Ala Pro Ser Pro Ser Lys Gln Leu Leu Val Val Val Thr Ser Gly Trp

130 135 140

Ser Val Met Cys Phe Asp His Asn Leu Lys Lys Leu Trp Glu Ala Asn

145 150 155 160

Leu Gln Asp Asp Phe Pro His Ala Ala His His Arg Glu Val Ala Ile

165 170 175

Ser Ile Thr Asn Tyr Thr Leu Lys His Gly Asp Ala Gly Leu Val Ile

180 185 190

Val Gly Gly Arg Met Glu Met Gln His His Ser Ala Glu Leu Phe Asp

195 200 205

Glu Phe Met Val Ser Glu His Asn Arg Glu Glu His Arg Arg Ser Ala

210 215 220

Ser Glu Lys Gln Ala Ser Glu Thr Gly Asn Thr Asp Leu Arg His Phe

225 230 235 240

Ala Leu Tyr Ala Phe Ala Gly Arg Thr Gly Glu Leu Arg Trp Ser Arg

245 250 255

Lys Asn Glu Asn Ile Pro Ser Gln Pro Ser Asp Ala Ser Val Leu Ile

260 265 270

Pro Gln His Asn Tyr Lys Leu Asp Ala His Ala Leu Asn Ser Arg His

275 280 285

Pro Gly Gln Phe Glu Cys Arg Glu Phe Arg Glu Ser Val Leu Gly Val

290 295 300

Met Pro His His Trp Asp Arg Arg Glu Asp Thr Phe Leu Gln Leu Ala

305 310 315 320

His Phe Arg Arg His Lys Arg Lys Ala Leu Lys Lys Thr Pro Gly Lys

325 330 335

Ala Val Val Asn Asn Val His Lys Pro Ser Glu His Asn Pro Pro Gly

340 345 350

Lys Asp Val Ser Asn Arg Leu Ala Asn Val Ile Gly Lys Ala Ala Asp

355 360 365

Met Ala Asn Ser Asn Lys Ile Lys Lys Ser Gln Arg Thr Leu Tyr Val

370 375 380

Pro Thr Ile Thr Asn Tyr Thr Gln Val Trp Trp Val Pro Asn Val Val

385 390 395 400

Val Ala His Glu Lys Glu Gly Ile Glu Ala Val His Leu Ala Ser Gly

405 410 415

Arg Thr Ile Cys Lys Leu His Leu Thr Glu Gly Gly Leu His Ala Asp

420 425 430

Ile Asn Gly Asp Gly Val Leu Asp His Val Gln Val Val Gly Ala Asn

435 440 445

Gly Ile Glu Gln Thr Val Val Ser Gly Ser Met Glu Val Leu Lys Pro

450 455 460

Cys Trp Ala Val Ala Thr Ser Gly Val Pro Val Arg Glu Gln Leu Phe

465 470 475 480

Asn Val Ser Ile Cys His Tyr Asn Asn Phe Asn Leu Phe His His Gly

485 490 495

Asp Phe Ser Arg Ser Phe Gly Arg Thr Phe Asp Thr Thr Gly Leu Glu

500 505 510

Val Ala Thr Pro Ile Leu Leu Gln Arg Asp Asp Gly His Lys His Arg

515 520 525

Arg Gly Ser His Gly Asp Ile Ile Phe Leu Thr Ser Arg Gly Glu Val

530 535 540

Thr Ser Tyr Ser Pro Gly Leu Leu Gly His Asp Ala Ile Trp Arg Trp

545 550 555 560

Gln Leu Ser Thr Gly Ala Thr Trp Ser Asn Leu Pro Ser Pro Ser Gly

565 570 575

Met Met Glu Asn Ile Val Val Pro Thr Leu Lys Ala Phe Ser Leu Arg

580 585 590

Ala Tyr Asp Pro Lys Gln Val Ile Ile Ala Gly Gly Asp Leu Glu Ala

595 600 605

Val Val Ile Ser Pro Ser Gly Gly Leu Leu Ala Ser Ile Glu Leu Pro

610 615 620

Ala Pro Pro Thr His Ala Leu Val Leu Glu Asp Phe Asn Gly Asp Gly

625 630 635 640

Leu Thr Asp Ile Ile Leu Val Thr Ser Gly Gly Val Tyr Gly Phe Val

645 650 655

Gln Thr Arg His Pro Gly Ala Leu Phe Phe Ser Thr Leu Val Gly Cys

660 665 670

Leu Ile Val Val Ile Gly Val Ile Phe Val Ser Leu His Leu Asn Ser

675 680 685

Ser Asn Ser Gly Lys Pro Arg Ala Ser Thr Asp Tyr Arg

690 695 700

<210> 2

<211> 2106

<212> DNA

<213> Oryza sativa

<400> 2

atgcggaagc gggatctggg catcctcctc ctcgccgcct tcgccgtctt cttctcgctc 60

cagcacgacg gcgacctctc cttccgcgag gcctggtacc acctctccga tgccgactac 120

cccatcaagc acgacgccga ccgcctcccc tctcccctag tcgccgacct caacggcgac 180

ggcaaacccg aggtcctcat ccccacccac gacgccaaga tccaggtcct ccagccccac 240

cccaggccct cccccgacga tgcctccttc cacgacgccc gcctcatggc tgatgtctcc 300

ctcctcccct ccaacgttcg cctctcctcc gggaggcgcc ccgtcgccat ggccgttggc 360

accgtcgacc gccactacgc ccacgccccc tccccctcca agcagctcct cgtcgtcgtc 420

acctccggat ggtccgtcat gtgcttcgac cacaacctca aaaagctctg ggaggctaat 480

ctccaggacg atttccccca cgccgcccac catcgcgagg ttgccatttc cattaccaac 540

tacactctca agcatgggga tgcaggtttg gtcatcgtcg gaggaaggat ggaaatgcaa 600

catcattcag cagagctttt cgatgaattt atggtgtcag aacacaacag ggaagagcac 660

cgtagaagcg ccagtgagaa gcaggcttct gagacaggca acacagacct gcgtcatttt 720

gccctttatg cttttgctgg ccgcactggt gaattaagat ggagccgaaa gaatgagaat 780

atcccatcgc aaccatccga tgcttcagtg ctgataccac aacacaatta caagcttgat 840

gcccatgccc ttaatagtcg tcatcctggt cagttcgaat gtcgggaatt tagagaatca 900

gttcttgggg tcatgcctca tcattgggat aggagagagg atacttttct gcaacttgcc 960

cattttagga ggcataaaag gaaagcactg aagaaaacac ctggaaaagc tgttgtaaat 1020

aacgtgcaca agcccagtga acataatcca cctggaaagg atgtttccaa taggttagca 1080

aatgtgattg ggaaagctgc agatatggct aattcaaata aaatcaagaa gtcacaaagg 1140

acgctttatg ttccgacaat caccaactat actcaagttt ggtgggttcc taatgttgtt 1200

gttgcccacg aaaaagaagg gatagaggct gttcatctag cttctggacg tacaatctgc 1260

aagcttcatt taacagaagg aggccttcat gcagatatta atggagatgg ggttctagac 1320

catgttcagg ttgttggtgc aaatggcatc gagcaaacag ttgttagtgg ttcaatggaa 1380

gtgctgaaac cttgttgggc agtagctaca tctggtgtgc cagtgcggga gcaacttttt 1440

aatgtttcta tctgccatta caacaatttc aatttgtttc atcatggtga cttttcaaga 1500

agttttggga ggacatttga tacaactggc ttagaggtgg cgactcctat tctgctccag 1560

agagatgatg gtcataaaca caggagagga agccacgggg atatcatctt tcttacgagt 1620

cgtggggagg tgacctcgta ctctccaggt ctacttggtc atgatgcaat atggagatgg 1680

caactgtcaa caggtgcaac atggtccaac cttccgtctc catcagggat gatggaaaac 1740

attgtagttc caactttgaa ggctttctct ctgcgagcct atgacccaaa acaggtaatc 1800

atcgcgggtg gtgatctgga ggctgtggtg atttctcctt ctggtggttt attggcatcc 1860

attgaactcc ctgcacctcc aacccatgcg ctggtacttg aagatttcaa tggtgatggt 1920

ttaactgata ttattctggt aacatcgggg ggagtctatg ggtttgtgca gacaagacat 1980

cctggggctc ttttcttcag cacgcttgtg ggttgcttga tagttgttat cggagtgata 2040

tttgtttcac tgcacctcaa ctcctcgaac agcggtaaac ctagggcttc aaccgactat 2100

aggtga 2106

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence

<400> 3

tggcgtaaca tcggggggag tcta 24

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<400> 4

aaactagact ccccccgatg ttac 24

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

gtaacatcgg ggggagtcta 20

<210> 6

<211> 9120

<212> DNA

<213> Oryza sativa

<400> 6

tgttttatta cccgtgtctc ttgagagtgt tagtggctct agctaattaa ttcccactac 60

tgagtgctaa taactcccgc taaagctaag ctaagctaag ctagctgcat ctttgtgcat 120

atactgtctg cgtctcctat tgttggcaac gtcgtaatta actttagcat cttatgatgg 180

tgcctgtctg cctgctcgaa atcgaaacgg atggatggca aattggcaat atggcatggc 240

taagcaagct agcttgatgc agcagcaaga aagcaataat tacttattta aggtggttgg 300

atatcctcct atattcttat cgtgcttgga tctgctctca gaatatccaa cctagctagc 360

ctgcaagcaa gagagtgtag ctactcgatc cgatccaatg tctctcatca cggatgagtc 420

tcctagggat tgctcctcct acaagcatca gcatcatcat cgcgccatcc atggtcgccg 480

aattagccgc cgcactctgg tggtggcgtc ctcagcggtg gtgtctctgg catcgctgtc 540

gctcatcctg tggctcgtcc tccgcccatc ccccccgcgc ttctcgctgc tcgccgccac 600

caccaccgcc aacgactctg cctctgtcgt cgccatcaac gccgccttcg ccgcccgcaa 660

ccccaactcc cacaccgccg ttctctacga ccgcctccag gctagcgcct cctacgccgg 720

gctccctctc accgccccct cgccgctgat cccgcccttc ttgccgcagc agggccaggg 780

cgacgccatg ctctccgcgt cgctcacgtc gccaccggca gcggctgctg tggcgggagg 840

gcgggcgctg ctgaggctgc gcgtggaggg gcagctccgc tggaaggtgg cggcgtgggt 900

caccggacgc cacgcgctca ccgtcgactg catcgccgtt gtggagctgc agccgacgcc 960

gacgccgtcg ccgagcgcga tcgtcggcgt cctccagccc caagatcagg ccggctcccg 1020

ctgctccacc accgtcgcct aataatataa tatccatcaa aaccaacacc acaaaccatg 1080

caaactgatc gatggatgca tggaggaaca gtcctagttc ttgtacatgt acatgtattc 1140

tctctcgcgt tatgtatgta tattgtcctg taccgcgcgc ggtaaacaag taataaatca 1200

aagcaatctg aatcgtacaa cgtatttcat gtgttgcttt gatttttttg gctttcagct 1260

gtggtgctct gtgtcccaaa agtaggagtg ccgtacttgc attttggttt taatttcttt 1320

tgttcaccac aggtctggtc tggtcactct cactcactct aattaaatcg attttttatt 1380

attactccag ttcattcggt gtgtgaatgt gaatctgcct gtgttgtgta tgcgactatg 1440

tgcttatgaa atttcctgga gtacacttaa gggcggccga ttttcgtcgt cataaggaac 1500

ggcgcaaagg aaatttcggc ccatacatat ggcccatcca taggccatct cagtgtctag 1560

gccagtccag tccagtccag tccaggacgg tccagtccgg tcccgtagag cgccggcgcg 1620

tgtagcttcc tcctccgctc caggctccag cgagggaggg agggagacca ccgtctccgc 1680

cggctttgag agagaaagag aaagagagag agagagagcg gcgagatgcg gaagcgggat 1740

ctgggcatcc tcctcctcgc cgccttcgcc gtcttcttct cgctccaggt cagtcctagc 1800

ttcttccttc cttggtacca aaccctaacc ctaaccctaa cccgcttgaa ttgatccatg 1860

gccacagcac gacggcgacc tctccttccg cgaggcctgg taccacctct ccgatgccga 1920

ctaccccatc aagcacgacg ccgaccgcct cccctctccc ctagtcgccg acctcaacgg 1980

cgacggcaaa cccgaggtcc tcatccccac ccacgacgcc aagatccagg tcctccagcc 2040

ccaccccagg ccctcccccg acgatgcctc cttccacgac gcccgcctca tggctgatgt 2100

ctccctcctc ccctccaacg ttcgcctctc ctccgggagg cgccccgtcg ccatggccgt 2160

tggcaccgtc gaccgccact acgcccacgc cccctccccc tccaagcagc tcctcgtcgt 2220

cgtcacctcc ggatggtccg tcatgtgctt cgaccacaac ctcaaaaagc tctgggaggc 2280

taatctccag gacgatttcc cccacgccgc ccaccatcgc gaggttgcca tttccattac 2340

caactacact ctcaagcatg gggatgcagg tttggtcatc gtcggaggaa ggatggaaat 2400

gcaacatcat gtaattatgc ttacttttcc tctttatacc actgctgctc atctacatgt 2460

tgtaaaacac acatcatact tcttttttta catgtgccca aatgattcga aaataataac 2520

catattacta gtttgtaatt caagttgcat tccagaataa ctcagggcca ccagcataga 2580

accatccctc gtttgtaatt caggcaaggc tacgcaaaaa tcgttttcct cctttgcagt 2640

aggatttatt cttttataga atttgctgtt atgtgtggat gcctttattt tttttgctac 2700

atttctacaa aattaatttt agatacttca aagttctaat tctatcatat aatgcttgac 2760

catcttgttg aatccttact gataataaca tcttattttc aaactttctc ttttggcttg 2820

aatatgttaa cttacggtag ttacttgttt gtcagtcagc agagcttttc gatgaattta 2880

tggtgtcaga acacaacagg gaagagcacc gtagaagcgc cagtgagaag caggttatct 2940

tgtatttgta agcttatcag ttagtttata ttctctgtgc cccatgaaaa aataaaactg 3000

tgggcaatat tttatatcga gaaaacaaca accagagtac gttgttgtat ccttgctcct 3060

tcacctgatg aaggcctaac ctgcgctggt attgcgcttt gatgtcatgc aggcttctga 3120

gacaggcaac acagacctgc gtcattttgc cctttatgct tttgctggcc gcactggtga 3180

attaagatgg agccgaaaga atgaggtgca cccatcctgt agtccatgac ttttacttta 3240

tagtttatac tactatttat ttcaaggatg ttgccacttc tgtgcatttt gtgtcatgca 3300

ttagcatgca caggacatga atagcttgga aagcttgcca tacattattc atgtgtttct 3360

gttttgacaa aacagaatat cccatcgcaa ccatccgatg cttcagtgct gataccacaa 3420

cacaattaca agcttgatgc ccatgccctt aatagtcgtc atcctggtca ggtgagaatt 3480

gtgcctagca ctcttgataa tggtatattt gccaacagaa gtcacagtta catacttaaa 3540

tctgagcaag tgttatgttt ctgttgatat ttgttctttg ttagcttggt ttaattatca 3600

tgatgtcgat catcttcagc cagtataggt ggctgtcttg actctttagc atattcagca 3660

ttcccactta tgtacaccag aatgatttgc gtgtgttcta caggaatgta ctttcaaatc 3720

catttgttct ttgttagcat ctttagccac gtttccttca attccttact cattctctgc 3780

atgttgctgc tgctaatatt tctgattgat gaaccaatag cctgaacatc tttgaacaaa 3840

atttagtgga ttggtaaata tcaaattctg ctgccatgtt gcttttgatt tggatttcaa 3900

tgtcaaatgt gctgttattt taccacaaga tgctacacag ttggttcttg tagtaaatat 3960

gatctcatta caagctaaca tggcatatat ggtttcagtt cgaatgtcgg gaatttagag 4020

aatcagttct tggggtcatg cctcatcatt gggtaagaat agatattaga taactactat 4080

atcatatttc tctaatttaa ttttttggga tgatcaactc agattgattt ttttttcctt 4140

ttcaggatag gagagaggat acttttctgc aacttgccca ttttaggagg cataaaagga 4200

aagcactgaa gaaaacacct ggaaaagctg ttgtaaataa cgtgcacaag cccagtgaac 4260

ataatccacc tggaaaggat gtttccaata ggttagcaaa tgtgattggg aaagctgcag 4320

atatggctaa ttcaaataaa atcaagaagg tataatgcat gcagacacaa acacatagtt 4380

cttacgcact agcatgttga ctgtgttgtt ctttttgtgt ttggtgtttt ggggaggggg 4440

gaggggggag ggggagttgc atgaacgcag tagtggtaac gtgcatgggc caacgtaggc 4500

accaggagca ggagcactcg tgattgcacg gcgcacagag ctactcaaga tggagaggat 4560

ggtggcgtgg ggaggggaga ggataggatt tgaaatgagg cagatcagtg gaggcagtgg 4620

tgctggcagt tactgggcca agatgacatt gtaggtggtc gggtagaagg aaaaagagaa 4680

gatggcaggg gcagtcgagg gttcttaaga gtggatttgg tgttcaccca gtaggaaatg 4740

ggtgaagatt tgcccagtag ggcctccctt actctcattt caaaatgtat cctctcaatt 4800

tatctgcaag tgtgttcgtc ttgaagatac tgtatacttt ccgatccatt tactgtactc 4860

tcaaaattag tgttaaattg tatccctgga actatattct aaataagtaa gaacagtcaa 4920

actttgaacc aaacatactt acctaacaag ttcatgtctc gtcctcagct ctacttatct 4980

gcatgattat gagactatgg gcacgtccta actggttgat tgtatagatt acggatagaa 5040

aaaaatgctc atttttggaa gtagcttaga aaaagttacc taagcaatgc tgatgtagaa 5100

agttttggga gaaatcatac tttgctggaa gcctggtatg aataatccat acctcacatt 5160

agctgtttag gacgcacact atatatactc atgagaacag atgcattatt tttctataga 5220

aatcaacgaa taacacacgt gtccatgtat ttgcactcaa aatatcgtga gtgggagtgg 5280

gtggagaata tgccatcgcc cccaattccc tattttgaag tgtataagat ataagataag 5340

attagattgg tgattggatt tactttcatc aatgatctgt gatctctagt acttaagtag 5400

tgtctctagc tttttttgat tggtacgtct ttcctggttc attttttgat tagtgtatgt 5460

ctttcctggt tcagtggtgt gaggtaggta ggtgatgtta atagcttgat gttggatgta 5520

ctttgtttat ggcattccat gttagtgtac ttcatgccta tgtgagtttg gcccttacta 5580

ttaaaatcgt tgcctctgat tagtgatcta atgcataaca atctaaagac tcactcggta 5640

attcattaag atacatctga tatcttttat gtgcatagtg cagtcctcct tcaattattg 5700

gcattcatca cttattcagg cgattcttac ataaattgca tgttgtttct ttgctgcatc 5760

ataattcttt ttcccccaat acaatcacag tggtctcaca ccaaaatttt atttacatat 5820

atcgtgttac tttatcatga aatgtaacat ctttcctcta ctgcagtcac aaaggacgct 5880

ttatgttccg acaatcacca actatactca agtttggtgg gttcctaatg ttgttgttgc 5940

ccacgaaaaa gaagggatag aggctgttca tctagcttct ggacgtacaa tctgcaaggt 6000

tgcaagatat atctcagtga tatttgtgtt ttcacgtccc tgccaaagct tgtctaatta 6060

gttcattgta aattatttat ttgtttatag aattttcatt gcctggtcca ctggctgaca 6120

tcaagctaca aatagtgttg aatactacct gaatggtcac taaaatcaat ctatgtttgc 6180

acttgcatat gtacacatta tgcatatatt ttttagcaat cattttcctt ctaaggaaat 6240

cataattcac gtgtgcgcat aatttacatg tctgtaatcc catcatacaa cttttctgtc 6300

tttgttttct gatttttttt tccatttcca gcttcattta acagaaggag gccttcatgc 6360

agatattaat ggagatgggg ttctagacca tgttcaggtg tgttgagcgt tgagattaga 6420

gagcaattta cacttttcat ttccattttt ttagaataca agtcttcatg ccactatatt 6480

ttgtctgcaa cttcaaggag aactgtggaa gtgtggatta gtccattaag cgagttagct 6540

gcttgagtca tgaggtgtta tggtgtactt tacatcttat aaagtcaatg aaaaaaataa 6600

ggggcaattg caaatttacc actgctttga atcgttattg caaggctacc actagaaaat 6660

tgcaaaaatg ccactagaac tgtcattcaa gtggcatcct tacaaaattg aaaaaactgg 6720

tggcaaattt gcaaatgccc caaaaaataa atgtttcagg attttcactt agttcaatta 6780

atcaatatga cctttagtga cactgaaatg ttcttttttt ctctcactag ttttgctatc 6840

ttttcacact agtatatact ttttaataaa gtgttagtta tgttatatgt atgccttttc 6900

tcataaatga ctgcaaaaaa aaaggtatgc aatgtccaaa caaaaatgtg aacaagaaca 6960

cccccttgtc actttgcaat aaataatcta ttttcatgtt taccacagga tgtgtactga 7020

attagatata caggtacaca agtccataat catatttctt tgctttcaat gtgcattcaa 7080

atttattgta gttgttttct ttagtagctt cacttgtgcc ctacttgtta ttgttatctt 7140

ccagtgtaaa actgagtgat aatgtcttct gtaggttgtt ggtgcaaatg gcatcgagca 7200

aacagttgtt agtggttcaa tggaagtgct gaaaccttgt tgggcagtag ctacatctgg 7260

tgtgccagtg cgggagcaac tttttaatgt ttctatctgc cattacaaca atttcaattt 7320

gtttcatcat ggtgactttt caagaagttt tgggaggaca tttgatacaa ctggcttaga 7380

ggtggcgact cctattctgc tccagagaga tgatggtcat aaacacagga gaggaagcca 7440

cggggatatc atctttctta cgagtcgtgg ggaggtcagc acatcactgt ttttccttgg 7500

aaattcctat cattaatgat aattatacat tgttgtcctt gttccacatg tgcatttctt 7560

ttcaactttc catacctccc tcttgtaatc tgcaatacac tgactttctt tattatcgta 7620

ggtgacctcg tactctccag gtctacttgg tcatgatgca atatggagat ggcaactgtc 7680

aacaggtgca acatggtcca accttccgtc tccatcaggg atgatggaaa acattgtagt 7740

tccaactttg aaggctttct ctctgcgagc ctatgaccca aaacaggtaa tcatcgcggg 7800

tggtgatctg gaggctgtgg tgatttctcc ttctggtggt ttattggcat ccattgaact 7860

ccctgcacct ccaacccatg cgctggtact tgaagatttc aatggtgatg gtttaactga 7920

tattattctg gtaacatcgg ggggagtcta tgggtttgtg cagacaagac atcctggggc 7980

tcttttcttc agcacgcttg tgggttgctt gatagttgtt atcggagtga tatttgtttc 8040

actgcacctc aactcctcga acagcggtaa acctagggct tcaaccgact ataggtgacg 8100

acattatgtc agtcgacaga attccttgtc aatattgagg tgttgttata gcatttgatt 8160

tagatttttc atataatcaa ctgccaactg ggttatgtaa acttgtgcgg cgaatgcatt 8220

tttggcgtaa catgttgtat gatttgggat gtatttctgg cttagctcat atttaaagag 8280

gaataggcac ttgccaccat gacatatcgt gctctgatcc ctaggacaat aaccagtgat 8340

ttttcgtgtg gttttggata ctatgtttgg tggttatatt attagtgtgg ttgtagttat 8400

cctgaaacca agtagcagat ggaacgaatt aagatttttc taatggaagc tatgagcttt 8460

ttattcatta attcttccca tcactcgtgt gctggataca cgtgagaacg ctaaccatga 8520

aaaaagaagg gttaatttga tccatgaagg ttccatttgc tgcgttcatc aattccgttt 8580

tgtgactatg ttgatgctgg ctccatcaac atgaatgaat catggctatg gcaagtcagc 8640

tacataatac gtactacgaa gtactccctc cattccaaaa tacaatgcat aaccacccat 8700

aatccaaaga ccaagaaata attatcatct tgtagtttgg atcatcctaa taaatacaat 8760

gcatatatcc aatagaatta gagaagaatt agagaacatg agagtggatg atttaaaaag 8820

gtaataattt aatggagaaa ggggtcatag ttaattgcct acatgcatac atgccttata 8880

ctattatgga acatctaaaa aaaagtggtt gtgccttata ttatgtaatt atattatgta 8940

atggagggag tagctatgta tccagtgcca ataaaagcat aataaggtaa aaaaaaattc 9000

cagcacatgc ctgttcaaga ggaccatgat cgactggaac aagaatagct tttgcaaatt 9060

gggctcatgc tgatgaacta gtctcaggga atatcaaact aacaaattta atacctcata 9120

<210> 7

<211> 40

<212> DNA

<213> Artificial sequence

<400> 7

ccatgattac gaattctgtt ttattacccg tgtctcttga 40

<210> 8

<211> 40

<212> DNA

<213> Artificial sequence

<400> 8

attcgagctg gtcaccttgc tcatatatct ttggtttcgt 40

<210> 9

<211> 2100

<212> DNA

<213> Oryza sativa

<400> 9

atgcggaagc gggatctggg catcctcctc ctcgccgcct tcgccgtctt cttctcgctc 60

cagcacgacg gcgacctctc cttccgcgag gcctggtacc acctctccga tgccgactac 120

cccatcaagc acgacgccga ccgcctcccc tctcccctag tcgccgacct caacggcgac 180

gccgaggtcc tcatccccac ccacgacgcc aagatccagg tcctccagcc ccaccccagg 240

ccctcccccg acgatgcctc cttccacgac gcccgcctca tggctgatgt ctccctcctc 300

ccctccaacg ttcgcctctc ctccgggagg cgccccgtcg ccatggccgt tggcaccgtc 360

gaccgccact acgcccacgc cccctccccc tccaagcagc tcctcgtcgt cgtcacctcc 420

ggatggtccg tcatgtgctt cgaccacaac ctcaaaaagc tctgggaggc taatctccag 480

gacgatttcc cccacgccgc ccaccatcgc gaggttgcca tttccattac caactacact 540

ctcaagcatg gggatgcagg tttggtcatc gtcggaggaa ggatggaaat gcaacatcat 600

tcagcagagc ttttcgatga atttatggtg tcagaacaca acagggaaga gcaccgtaga 660

agcgccagtg agaagcaggc ttctgagaca ggcaacacag acctgcgtca ttttgccctt 720

tatgcttttg ctggccgcac tggtgaatta agatggagcc gaaagaatga gaatatccca 780

tcgcaaccat ccgatgcttc agtgctgata ccacaacaca attacaagct tgatgcccat 840

gcccttaata gtcgtcatcc tggtcagttc gaatgtcggg aatttagaga atcagttctt 900

ggggtcatgc ctcatcattg ggataggaga gaggatactt ttctgcaact tgcccatttt 960

aggaggcata aaaggaaagc actgaagaaa acacctggaa aagctgttgt aaataacgtg 1020

cacaagccca gtgaacataa tccacctgga aaggatgttt ccaataggtt agcaaatgtg 1080

attgggaaag ctgcagatat ggctaattca aataaaatca agaagtcaca aaggacgctt 1140

tatgttccga caatcaccaa ctatactcaa gtttggtggg ttcctaatgt tgttgttgcc 1200

cacgaaaaag aagggataga ggctgttcat ctagcttctg gacgtacaat ctgcaagctt 1260

catttaacag aaggaggcct tcatgcagat attaatggag atggggttct agaccatgtt 1320

caggttgttg gtgcaaatgg catcgagcaa acagttgtta gtggttcaat ggaagtgctg 1380

aaaccttgtt gggcagtagc tacatctggt gtgccagtgc gggagcaact ttttaatgtt 1440

tctatctgcc attacaacaa tttcaatttg tttcatcatg gtgacttttc aagaagtttt 1500

gggaggacat ttgatacaac tggcttagag gtggcgactc ctattctgct ccagagagat 1560

gatggtcata aacacaggag aggaagccac ggggatatca tctttcttac gagtcgtggg 1620

gaggtgacct cgtactctcc aggtctactt ggtcatgatg caatatggag atggcaactg 1680

tcaacaggtg caacatggtc caaccttccg tctccatcag ggatgatgga aaacattgta 1740

gttccaactt tgaaggcttt ctctctgcga gcctatgacc caaaacaggt aatcatcgcg 1800

ggtggtgatc tggaggctgt ggtgatttct ccttctggtg gtttattggc atccattgaa 1860

ctccctgcac ctccaaccca tgcgctggta cttgaagatt tcaatggtga tggtttaact 1920

gatattattc tggtaacatc ggggggagtc tatgggtttg tgcagacaag acatcctggg 1980

gctcttttct tcagcacgct tgtgggttgc ttgatagttg ttatcggagt gatatttgtt 2040

tcactgcacc tcaactcctc gaacagcggt aaacctaggg cttcaaccga ctataggtga 2100

<210> 10

<211> 699

<212> PRT

<213> Oryza sativa

<400> 10

Met Arg Lys Arg Asp Leu Gly Ile Leu Leu Leu Ala Ala Phe Ala Val

1 5 10 15

Phe Phe Ser Leu Gln His Asp Gly Asp Leu Ser Phe Arg Glu Ala Trp

20 25 30

Tyr His Leu Ser Asp Ala Asp Tyr Pro Ile Lys His Asp Ala Asp Arg

35 40 45

Leu Pro Ser Pro Leu Val Ala Asp Leu Asn Gly Asp Ala Glu Val Leu

50 55 60

Ile Pro Thr His Asp Ala Lys Ile Gln Val Leu Gln Pro His Pro Arg

65 70 75 80

Pro Ser Pro Asp Asp Ala Ser Phe His Asp Ala Arg Leu Met Ala Asp

85 90 95

Val Ser Leu Leu Pro Ser Asn Val Arg Leu Ser Ser Gly Arg Arg Pro

100 105 110

Val Ala Met Ala Val Gly Thr Val Asp Arg His Tyr Ala His Ala Pro

115 120 125

Ser Pro Ser Lys Gln Leu Leu Val Val Val Thr Ser Gly Trp Ser Val

130 135 140

Met Cys Phe Asp His Asn Leu Lys Lys Leu Trp Glu Ala Asn Leu Gln

145 150 155 160

Asp Asp Phe Pro His Ala Ala His His Arg Glu Val Ala Ile Ser Ile

165 170 175

Thr Asn Tyr Thr Leu Lys His Gly Asp Ala Gly Leu Val Ile Val Gly

180 185 190

Gly Arg Met Glu Met Gln His His Ser Ala Glu Leu Phe Asp Glu Phe

195 200 205

Met Val Ser Glu His Asn Arg Glu Glu His Arg Arg Ser Ala Ser Glu

210 215 220

Lys Gln Ala Ser Glu Thr Gly Asn Thr Asp Leu Arg His Phe Ala Leu

225 230 235 240

Tyr Ala Phe Ala Gly Arg Thr Gly Glu Leu Arg Trp Ser Arg Lys Asn

245 250 255

Glu Asn Ile Pro Ser Gln Pro Ser Asp Ala Ser Val Leu Ile Pro Gln

260 265 270

His Asn Tyr Lys Leu Asp Ala His Ala Leu Asn Ser Arg His Pro Gly

275 280 285

Gln Phe Glu Cys Arg Glu Phe Arg Glu Ser Val Leu Gly Val Met Pro

290 295 300

His His Trp Asp Arg Arg Glu Asp Thr Phe Leu Gln Leu Ala His Phe

305 310 315 320

Arg Arg His Lys Arg Lys Ala Leu Lys Lys Thr Pro Gly Lys Ala Val

325 330 335

Val Asn Asn Val His Lys Pro Ser Glu His Asn Pro Pro Gly Lys Asp

340 345 350

Val Ser Asn Arg Leu Ala Asn Val Ile Gly Lys Ala Ala Asp Met Ala

355 360 365

Asn Ser Asn Lys Ile Lys Lys Ser Gln Arg Thr Leu Tyr Val Pro Thr

370 375 380

Ile Thr Asn Tyr Thr Gln Val Trp Trp Val Pro Asn Val Val Val Ala

385 390 395 400

His Glu Lys Glu Gly Ile Glu Ala Val His Leu Ala Ser Gly Arg Thr

405 410 415

Ile Cys Lys Leu His Leu Thr Glu Gly Gly Leu His Ala Asp Ile Asn

420 425 430

Gly Asp Gly Val Leu Asp His Val Gln Val Val Gly Ala Asn Gly Ile

435 440 445

Glu Gln Thr Val Val Ser Gly Ser Met Glu Val Leu Lys Pro Cys Trp

450 455 460

Ala Val Ala Thr Ser Gly Val Pro Val Arg Glu Gln Leu Phe Asn Val

465 470 475 480

Ser Ile Cys His Tyr Asn Asn Phe Asn Leu Phe His His Gly Asp Phe

485 490 495

Ser Arg Ser Phe Gly Arg Thr Phe Asp Thr Thr Gly Leu Glu Val Ala

500 505 510

Thr Pro Ile Leu Leu Gln Arg Asp Asp Gly His Lys His Arg Arg Gly

515 520 525

Ser His Gly Asp Ile Ile Phe Leu Thr Ser Arg Gly Glu Val Thr Ser

530 535 540

Tyr Ser Pro Gly Leu Leu Gly His Asp Ala Ile Trp Arg Trp Gln Leu

545 550 555 560

Ser Thr Gly Ala Thr Trp Ser Asn Leu Pro Ser Pro Ser Gly Met Met

565 570 575

Glu Asn Ile Val Val Pro Thr Leu Lys Ala Phe Ser Leu Arg Ala Tyr

580 585 590

Asp Pro Lys Gln Val Ile Ile Ala Gly Gly Asp Leu Glu Ala Val Val

595 600 605

Ile Ser Pro Ser Gly Gly Leu Leu Ala Ser Ile Glu Leu Pro Ala Pro

610 615 620

Pro Thr His Ala Leu Val Leu Glu Asp Phe Asn Gly Asp Gly Leu Thr

625 630 635 640

Asp Ile Ile Leu Val Thr Ser Gly Gly Val Tyr Gly Phe Val Gln Thr

645 650 655

Arg His Pro Gly Ala Leu Phe Phe Ser Thr Leu Val Gly Cys Leu Ile

660 665 670

Val Val Ile Gly Val Ile Phe Val Ser Leu His Leu Asn Ser Ser Asn

675 680 685

Ser Gly Lys Pro Arg Ala Ser Thr Asp Tyr Arg

690 695

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence

<400> 11

tcgtaggtga cctcgtactc 20

<210> 12

<211> 22

<212> DNA

<213> Artificial sequence

<400> 12

tggtggcaag tgcctattcc tc 22

<210> 13

<211> 2572

<212> DNA

<213> Oryza sativa

<400> 13

agtgtctagg ccagtccagt ccagtccagt ccaggacggt ccagtccggt cccgtagagc 60

gccggcgcgt gtagcttcct cctccgctcc aggctccagc gagggaggga gggagaccac 120

cgtctccgcc ggctttgaga gagaaagaga aagagagaga gagagagcgg cgagatgcgg 180

aagcgggatc tgggcatcct cctcctcgcc gccttcgccg tcttcttctc gctccagcac 240

gacggcgacc tctccttccg cgaggcctgg taccacctct ccgatgccga ctaccccatc 300

aagcacgacg ccgaccgcct cccctctccc ctagtcgccg acctcaacgg cgacggcaaa 360

cccgaggtcc tcatccccac ccacgacgcc aagatccagg tcctccagcc ccaccccagg 420

ccctcccccg acgatgcctc cttccacgac gcccgcctca tggctgatgt ctccctcctc 480

ccctccaacg ttcgcctctc ctccgggagg cgccccgtcg ccatggccgt tggcaccgtc 540

gaccgccact acgcccacgc cccctccccc tccaagcagc tcctcgtcgt cgtcacctcc 600

ggatggtccg tcatgtgctt cgaccacaac ctcaaaaagc tctgggaggc taatctccag 660

gacgatttcc cccacgccgc ccaccatcgc gaggttgcca tttccattac caactacact 720

ctcaagcatg gggatgcagg tttggtcatc gtcggaggaa ggatggaaat gcaacatcat 780

tcagcagagc ttttcgatga atttatggtg tcagaacaca acagggaaga gcaccgtaga 840

agcgccagtg agaagcaggc ttctgagaca ggcaacacag acctgcgtca ttttgccctt 900

tatgcttttg ctggccgcac tggtgaatta agatggagcc gaaagaatga gaatatccca 960

tcgcaaccat ccgatgcttc agtgctgata ccacaacaca attacaagct tgatgcccat 1020

gcccttaata gtcgtcatcc tggtcagttc gaatgtcggg aatttagaga atcagttctt 1080

ggggtcatgc ctcatcattg ggataggaga gaggatactt ttctgcaact tgcccatttt 1140

aggaggcata aaaggaaagc actgaagaaa acacctggaa aagctgttgt aaataacgtg 1200

cacaagccca gtgaacataa tccacctgga aaggatgttt ccaataggtt agcaaatgtg 1260

attgggaaag ctgcagatat ggctaattca aataaaatca agaagtcaca aaggacgctt 1320

tatgttccga caatcaccaa ctatactcaa gtttggtggg ttcctaatgt tgttgttgcc 1380

cacgaaaaag aagggataga ggctgttcat ctagcttctg gacgtacaat ctgcaagctt 1440

catttaacag aaggaggcct tcatgcagat attaatggag atggggttct agaccatgtt 1500

caggttgttg gtgcaaatgg catcgagcaa acagttgtta gtggttcaat ggaagtgctg 1560

aaaccttgtt gggcagtagc tacatctggt gtgccagtgc gggagcaact ttttaatgtt 1620

tctatctgcc attacaacaa tttcaatttg tttcatcatg gtgacttttc aagaagtttt 1680

gggaggacat ttgatacaac tggcttagag gtggcgactc ctattctgct ccagagagat 1740

gatggtcata aacacaggag aggaagccac ggggatatca tctttcttac gagtcgtggg 1800

gaggtgacct cgtactctcc aggtctactt ggtcatgatg caatatggag atggcaactg 1860

tcaacaggtg caacatggtc caaccttccg tctccatcag ggatgatgga aaacattgta 1920

gttccaactt tgaaggcttt ctctctgcga gcctatgacc caaaacaggt aatcatcgcg 1980

ggtggtgatc tggaggctgt ggtgatttct ccttctggtg gtttattggc atccattgaa 2040

ctccctgcac ctccaaccca tgcgctggta cttgaagatt tcaatggtga tggtttaact 2100

gatattattc tggtaacatc ggggggagtc tatgggtttg tgcagacaag acatcctggg 2160

gctcttttct tcagcacgct tgtgggttgc ttgatagttg ttatcggagt gatatttgtt 2220

tcactgcacc tcaactcctc gaacagcggt aaacctaggg cttcaaccga ctataggtga 2280

cgacattatg tcagtcgaca gaattccttg tcaatattga ggtgttgtta tagcatttga 2340

tttagatttt tcatataatc aactgccaac tgggttatgt aaacttgtgc ggcgaatgca 2400

tttttggcgt aacatgttgt atgatttggg atgtatttct ggcttagctc atatttaaag 2460

aggaataggc acttgccacc atgacatatc gtgctctgat ccctaggaca ataaccagtg 2520

atttttcgtg tggttttgga tactatgttt ggtggttata ttattagtgt gg 2572

Claims (10)

1. a kind of application of male sterility gene OsDPW3, which is characterized in that the male sterility gene OsDPW3 codings As shown in SEQ ID NO.1, the application is amino acid sequence：Using conventional gene engineering method or based on CRISPR/ Cas9 systems knock out, change or inhibit OsDPW3 genes, so that OsDPW3 gene expression water in japonica rice background wild rice Pancake is low, and then obtains rice male-sterile plants system.

A kind of 2. method of rice male-sterile plants system initiative, which is characterized in that include the following steps：Select conventional rice product Kind, processing is cultivated to get the rice male-sterile plants system；The processing is using conventional gene engineering method or to be based on CRISPR/Cas9 systems so that the nucleotide sequence that amino acid shown in SEQ ID NO.1 is encoded in rice lacks, and makes a variation Or inhibit, so that the amino acid sequence corresponds to expression reduction or the loss of activity of polypeptide.

3. the method for rice male-sterile plants system initiative as claimed in claim 2, it is characterized in that, the rice varieties are japonica rice Kind 9522.

4. the method for rice male-sterile plants system initiative as claimed in claim 2, it is characterized in that, the nucleotide sequence is such as Shown in SEQ ID NO.2.

5. the method for rice male-sterile plants system initiative as claimed in claim 2, which is characterized in that described to be based on CRISPR/ The processing of Cas9 systems specifically includes：It is pinpointed using CRISPR/Cas9 systems and knocks out OsDPW3 genes, inhibit coding such as SEQ ID The expression of the nucleotide sequence of amino acid sequence shown in No.1.

6. the method for rice male-sterile plants system initiative as claimed in claim 5, which is characterized in that the CRISPR/Cas9 The method that system fixed point knocks out includes the following steps：

A) synthesis mononucleotide aligning primer is as shown in SEQ ID No.3 and SEQ ID No.4；

B) the mononucleotide sequence for making synthesis by annealing reaction forms dimeric structure, is attached and reacts with carrier segments, Build the OsDPW3-BGK03 plasmids containing rice Os DPW3 gene target sequences；The target sequence is as shown in SEQ ID No.5；

C) rice varieties are infected with the Agrobacterium tumefaciems of the plasmid containing OsDPW3-BGK03；

D) by using the primer amplified base of the OsDPW3 genes as shown in SEQ ID No.11 and SEQ ID No.12 Because pack section is sequenced, mutant plant is screened.

7. the rice male-sterile plants that a kind of method of rice male-sterile plants system initiative as claimed in claim 2 obtains tie up to Purposes in the rice production of hybrid seeds, which is characterized in that the purposes includes：Using the rice male-sterile plants system as female parent, carry out Crossbreeding.

A kind of 8. method for the male-sterile character for restoring rice male-sterile plants system, which is characterized in that include the following steps：It adopts With conventional genetic means by the OsDPW3 genes, it is transferred to the rice male-sterile plants system that method as claimed in claim 2 obtains In, so that mutant restores wild type phenotype.

9. restore the method for the male-sterile character of rice male-sterile plants system as claimed in claim 8, which is characterized in that packet Include following steps：Agrobacterium tumefaciems (Agrobacterium tumefaciens) EHA105 of the structure of complementation containing OsDPW3 is turned Enter the rice male-sterile plants system, cultivate to get；Wherein OsDPW3 complementations structure contains coding as shown in SEQ ID NO.6 Nucleotide sequence.

10. restore the method for the male-sterile character of rice male-sterile plants system as claimed in claim 9, which is characterized in that The method specifically comprises the following steps：

(a) genomic DNA is extracted from 9522 seedling leaves of wild type as template, with base sequence such as SEQ ID No.7 with Primer amplification shown in SEQ ID No.8 goes out the genome sequence column-slice of the xxxbp as shown in SEQ ID NO.6 of OsDPW3 genes Section；

(b) Agrobacterium tumefaciems (Agrobacterium tumefaciens) for carrying expression OsDPW3 complementation carrier constructions is provided EHA105；

(c) rice cell or tissue or organ are contacted with the Agrobacterium in step (a), so as to make coding such as SEQ ID NO.1 The nucleotide of shown amino acid is transferred to rice cell, and is integrated on the chromosome of rice cell；

(d) selection is transferred to the rice cell or tissue of the nucleotide, and regeneration obtains the rice plant for restoring fertility.