CN111875689A

CN111875689A - Method for creating male sterile line by using tomato green stem close linkage marker

Info

Publication number: CN111875689A
Application number: CN202010787253.3A
Authority: CN
Inventors: 张从省; 王喜萍; 公小君; 张婷
Original assignee: Weifang Xingwang Bioseed Co ltd
Current assignee: Weifang Xingwang Bioseed Co ltd
Priority date: 2020-08-07
Filing date: 2020-08-07
Publication date: 2020-11-03
Anticipated expiration: 2040-08-07
Also published as: CN111875689B

Abstract

The invention discloses a method for creating a male sterile line by utilizing a tomato green stem close linkage marker. The invention develops a tomato male sterility linkage marker by using a brand new combination of a fertility gene MS15 and a green stem gene F3H, and can be used for screening a sterile line and a maintainer line in the sterile line maintaining and expanding propagation process. The genetic distance between the fertility gene MS15 and the green stem gene F3H used in the invention is only 1.35cM, which theoretically can generate lower genetic and phenotypic separation rate, and can greatly reduce the error rate of screening the existing tomato visible linkage marker sterile line.

Description

Method for creating male sterile line by using tomato green stem close linkage marker

Technical Field

The invention relates to the field of plant breeding, in particular to a method for creating a male sterile line by utilizing a tomato green stem close linkage marker.

Background

Tomatoes are one of the most widely consumed vegetables worldwide, with a yield of 1.82 million tons in 2017 and a value of over 600 million dollars. China is the country with the largest tomato cultivation area and the largest total production amount in the world, and the annual output is more than 5000 million tons. Tomato is a strict closed-flower pollination crop, the heterosis is obvious, the heterosis refers to the phenomenon that two varieties with different genetic bases or similar species are hybridized in the plant, and the first filial generation of the hybrid is superior to the parents in the aspects of growth vigor, vitality, adaptability, yield and the like. The key to heterosis utilization is the development and utilization of a controllable pollination system to prevent self-pollination failure due to self-pollination. In order to ensure the purity of the hybrid, the female parent must be rendered male-incompetent. The main methods adopted at present include manual or mechanical emasculation, chemical emasculation and the adoption of a male sterile line as a female parent. The artificial emasculation means that the male flowers of female parents are artificially removed before the pollination period, a large amount of manpower and material resources are consumed, and the artificial emasculation is more difficult for the crops with strict self-pollination, such as tomatoes and the like. Mechanical detasseling and chemical detasseling have a large impact on the normal growth of plants. Therefore, the creation of the male sterile line can reduce the cost and improve the purity of the hybrid, and has important significance for the hybrid breeding.

The male sterility includes cytoplasmic sterility and nuclear sterility, and the instability of cytoplasmic sterility is easily affected by environment, so that the creation of stable nuclear sterile line is the development direction of male sterile line. With the development of molecular biology, more and more nuclear fertility genes have been cloned, including Lat52 (tween et al, 1989), Ps-2(Gorguet et al, 2009), Style 2.1(Chen et al, 2007), Ms10-35(Jeong et al, 2014), MPK20(Chen et al, 2018), Ms15(Cao et al, 2019), PIF3(CN 109456979a), LAP3(CN 109207505 a), and the like, and the reasons why most of these genes have not been used include: 1) the sterility is not thorough, which can lead to impure hybrid seeds; 2) there is no efficient maintainer line or simple method of distinguishing between sterile and maintainer lines.

The visible marker is a phenotype which can be effectively distinguished from a control strain by naked eyes or simple treatment, and comprises the characteristics of leaf shape, leaf color, stem color, epidermal villi, seed size, seed villi and the like. The linkage visible marker refers to that the marker is tightly linked with a target gene, and the offspring can indirectly judge the genotype of the target gene through the visible marker.

Third generation gene editing (CRISPR/Cas9) is a new technology aiming at site-directed modification of genome, and is a technology which can generate modification such as base deletion, insertion, and substitution in a genome DNA sequence of a cell living body by artificially constructed engineered nuclease, specifically recognizing and cutting a target interval sequence of the genome, generating double-strand break, and connecting a DNA damage repair mechanism through homologous recombination or non-homologous end of a cell endogenous gene (Hsuet et al, 2014). The gene editing technology can theoretically operate any gene of any variety, realize the rapid and accurate improvement of target characters of core parents without the problems of linkage drag and the like common in traditional backcross breeding, and can realize simultaneous mutation of multiple genes, thereby greatly improving the efficiency of multi-character polymerization.

The existing tomato visible linkage marker sterile line utilizes fertility gene MS10 and green stem gene F3H/GST (Zhang et al, 2016; CN 105525016A), the genetic distances of the MS10 gene and the F3H/GST gene are respectively 5.8cM and 2.2cM, the genetic distances are in positive correlation with a recombination exchange value, the MS10 gene and the F3H/GST gene are separated during meiosis, phenotype is not linked, and about 1% -6% of fertile plants exist in a green stem, so that the operation and purity influence is brought to hybrid production.

Disclosure of Invention

The first purpose of the invention is to provide new application of MS15 protein and F3H protein.

The present invention provides the use of the MS15 protein and the F3H protein in any one of the following (1) to (5):

(1) cultivating a tomato male sterile line;

(2) cultivating a tomato maintainer line;

(3) propagating tomato male sterile line;

(4) distinguishing a sterile line and a maintainer line in the process of propagating the tomato male sterile line;

(5) tomato breeding;

the MS15 protein is a1) or a2) or A3) as follows:

A1) a protein consisting of an amino acid sequence shown in SEQ ID No. 6;

A2) a protein derived from tomato and having 98% or more identity and the same function as A1);

A3) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID NO.6 and has the same function;

the F3H protein is B1) or B2) or B3) as follows:

B1) a protein consisting of the amino acid sequence shown in SEQ ID No. 7;

B2) protein derived from tomato and having more than 98% identity with B1) and having the same function;

B3) and (b) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO.7 and has the same function.

The second purpose of the invention is to provide a new application of the biological material related to the MS15 protein and the biological material related to the F3H protein.

The invention provides application of biological materials related to MS15 protein and biological materials related to F3H protein in any one of the following (1) to (5):

(1) cultivating a tomato male sterile line;

(2) cultivating a tomato maintainer line;

(3) propagating tomato male sterile line;

(5) tomato breeding;

the biological material related to the MS15 protein is any one of the following C1) to C8):

C1) a nucleic acid molecule encoding the MS15 protein;

C2) an expression cassette comprising the nucleic acid molecule of C1);

C3) a recombinant vector comprising the nucleic acid molecule of C1);

C4) a recombinant vector comprising the expression cassette of C2);

C5) a recombinant microorganism comprising the nucleic acid molecule of C1);

C6) a recombinant microorganism comprising the expression cassette of C2);

C7) a recombinant microorganism comprising the recombinant vector of C3);

C8) a recombinant microorganism comprising the recombinant vector of C4).

The biological material related to the F3H protein is any one of the following D1) to D8):

D1) a nucleic acid molecule encoding the F3H protein;

D2) an expression cassette comprising the nucleic acid molecule of D1);

D3) a recombinant vector comprising the nucleic acid molecule of D1);

D4) a recombinant vector comprising the expression cassette of D2);

D5) a recombinant microorganism comprising the nucleic acid molecule of D1);

D6) a recombinant microorganism comprising the expression cassette of D2);

D7) a recombinant microorganism comprising the recombinant vector of D3);

D8) a recombinant microorganism comprising the recombinant vector of D4).

The nucleic acid molecule encoding the MS15 protein is the DNA molecule described in any one of the following c1) -c 3):

c1) DNA molecule shown in SEQ ID No. 1;

c2) a DNA molecule which hybridizes under stringent conditions with the DNA molecule defined in c1) and encodes a plant fertility-associated protein;

c3) a DNA molecule which has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% of identity with the DNA sequence defined by c1) or c2) and encodes a plant fertility-related protein.

The nucleic acid molecule encoding the F3H protein is a DNA molecule described in any one of the following d1) -d 3):

d1) DNA molecule shown in SEQ ID No. 2;

d2) a DNA molecule which is hybridized with the DNA molecule defined by d1) under strict conditions and codes a protein related to the synthesis of plant anthocyanin;

d3) a DNA molecule which has more than 99 percent, more than 95 percent, more than 90 percent, more than 85 percent or more than 80 percent of identity with the DNA sequence limited by d1) or d2) and codes the protein related to the synthesis of the plant anthocyanin.

The stringent conditions may be as follows: 50 ℃ in 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 2 XSSC, 0.1% SDS at 50 ℃; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing at 50 ℃ in 1 XSSC, 0.1% SDS; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 0.5 XSSC, 0.1% SDS at 50 ℃; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 50 ℃; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 65 ℃; can also be: in a solution of 6 XSSC, 0.5% SDS at 65 ℃ and then washed once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

The third purpose of the invention is to provide a method for cultivating the male sterile line of the tomato.

The method for cultivating the tomato male sterile line provided by the invention is X1) or X2);

x1) to make the function of MS15 protein and F3H protein in tomato lose or inhibit the activity of MS15 protein and F3H protein in tomato, to obtain tomato male sterile line;

x2) knocking out or silencing the gene coding the MS15 protein and the gene coding the F3H protein in tomato or inhibiting the expression of the gene coding the MS15 protein and the gene coding the F3H protein in tomato to obtain a tomato male sterile line.

In the above method for breeding tomato male sterile line, in the step X2), the gene coding for MS15 protein and the gene coding for F3H protein in the knockout tomato are mutated in the gene coding for MS15 protein and the gene coding for F3H protein in tomato; the mutation is a homozygous mutation (mutations occurring in both chromosomes are identical).

It is a fourth object of the present invention to provide a method for breeding tomato maintainers.

The method for cultivating the tomato maintainer line provided by the invention is Y1) or Y2);

y1) to make the function of MS15 protein and F3H protein in tomato lose or inhibit the activity of MS15 protein and F3H protein in tomato, to obtain tomato maintenance line;

y2) knocking out or silencing the gene coding the MS15 protein and the gene coding the F3H protein in tomato or inhibiting the expression of the gene coding the MS15 protein and the gene coding the F3H protein in tomato to obtain the tomato maintainer line.

In the above method for breeding tomato maintainer line, in Y2), the gene encoding MS15 protein and the gene encoding F3H protein in the knockout tomato are mutated in the gene encoding MS15 protein and the gene encoding F3H protein in tomato; the mutation is a heterozygous mutation (only one of the two chromosomes is mutated, and the other chromosome is not mutated).

Further, the substance for mutating the gene encoding the MS15 protein and the gene encoding the F3H protein in the tomato is a CRISPR/Cas9 system; the CRISPR/Cas9 system includes Cas9 nuclease and sgrnas; the sgrnas include a sgRNA targeting a gene encoding MS15 protein and a sgRNA targeting a gene encoding F3H protein.

Further, the target sequence of the sgRNA targeting the gene coding the MS15 protein is 432-454 th site from the 5' end of SEQ ID NO. 1; the target sequence of the sgRNA targeting the gene coding the F3H protein is shown as position 331-353 from the 5' end of SEQ ID NO. 2.

In a specific embodiment of the invention, the CRISPR/Cas9 system is specifically a double-gene knockout vector YBK-MS 15-F3H-Target. The double-gene knockout vector YBK-MS15-F3H-Target comprises sgRNA (the Target sequence is 432 th and 454 th positions from 5 'end of SEQ ID NO. 1) driven by AtU6 promoter and targeting a gene coding MS15 protein, sgRNA (the Target sequence is 331 st and 353 th positions from 5' end of SEQ ID NO. 2) driven by AtU6 promoter and targeting a gene coding F3H protein, Cas9 nuclease coding gene driven by pYao promoter and kanamycin screening gene driven by 35S promoter.

The method for breeding the tomato male sterile line or breeding the tomato maintainer line further comprises the step of screening tomato mutants with mutation of MS15 gene and F3H gene.

The tomato mutant plant in which the MS15 gene and the F3H gene are homozygously mutated is a tomato male sterile line;

the tomato mutant plant with heterozygous mutation of the MS15 gene and the F3H gene is a tomato maintainer line (tomato restorer line).

In a specific embodiment of the invention, the tomato male sterile line is mutant T1-5. The mutant T1-5 differed from the genomic DNA of the wild type tomato Ailsa Craig only in that in the gene encoding the MS15 protein, a fragment deletion had occurred in both chromosomes, the deletion fragment being located at position 444-448 of SEQ ID NO.1 and in the gene encoding the F3H protein, a fragment deletion had occurred in both chromosomes, the deletion fragment being located at position 341-347 of SEQ ID NO. 2.

The tomato maintainer line is mutant T1-1. The mutant T1-1 differed from the genomic DNA of the wild type tomato Ailsa Craig only in that in the gene coding for the MS15 protein a fragment deletion had been made in one chromosome which was located at position 444 and 448 of SEQ ID NO.1 and in the other chromosome which was not mutated, and in the gene coding for the F3H protein a fragment deletion had been made in one chromosome which was located at position 341 and 347 of SEQ ID NO.2 and in the other chromosome which was not mutated.

It is a fifth object of the present invention to provide a method for propagating tomato male sterile lines.

The method for propagating the tomato male sterile line comprises the following steps: and hybridizing the tomato male sterile line obtained by cultivating according to the method for cultivating the tomato male sterile line as a female parent and the tomato maintainer line obtained by cultivating according to the method for cultivating the tomato maintainer line as a male parent to realize the propagation of the tomato male sterile line.

Further, the method for expanding propagation of the tomato male sterile line also comprises the step of distinguishing the tomato male sterile line from the tomato maintainer line in filial generations by observing the color of the stems through naked eyes. The filial generation with green stem is male sterile line of tomato; the hybrid progeny with purple stem color is tomato maintainer line.

A sixth object of the present invention is to provide any one of the following M1) -M4):

m1) substances which either disable the function of the MS15 protein and F3H protein in tomato or inhibit the activity of the MS15 protein and F3H protein in tomato;

m2) knocking out or silencing the gene encoding MS15 protein and the gene encoding F3H protein in tomato or suppressing the expression of the gene encoding MS15 protein and the gene encoding F3H protein in tomato;

m3) the CRISPR/Cas9 system described above;

m4) the sgRNA described above.

In the product, the substance of the gene coding for MS15 protein and the gene coding for F3H protein in the knockout tomato is specifically the CRISPR/Cas9 system.

The application of the product in any one of the following (1) to (5) also belongs to the protection scope of the invention:

(1) cultivating a tomato male sterile line;

(2) cultivating a tomato maintainer line;

(3) propagating tomato male sterile line;

(5) and (5) tomato breeding.

Any of the above tomato maintainers can also be used as a tomato restorer line.

The tomato material may be Ailsa Craig.

The invention develops a tomato male sterility linkage marker by using a brand new combination of a fertility gene MS15 and a green stem gene F3H, and can be used for screening a sterile line and a maintainer line in the sterile line maintaining and expanding propagation process. The genetic distance between the fertility gene MS15 and the green stem gene F3H used in the invention is only 1.35cM (as shown in figure 1), which theoretically can generate lower genetic and phenotypic separation rate, and can greatly reduce the error rate of screening the existing tomato visible linkage marker sterile line.

Drawings

FIG. 1 is a schematic diagram of the genetic distance between a fertility gene and a visible linked marker gene of green stem.

FIG. 2 is a schematic diagram of a double knockout vector.

FIG. 3 shows the genotype identification of the ms15ms15/f3hf3h mutant.

FIG. 4 shows the fertility phenotype of the ms15ms15/f3hf3h mutant.

FIG. 5 shows phenotype observed in the progeny of the MS15MS15/F3Hf3h mutant in cross with the MS15MS15/F3Hf3h mutant.

FIG. 6 shows the propagation strategy of the sterile line with visible linkage markers in green stems.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

The CPB supports in the following examples are described in the literature: zhao et al (2016.) An alternative strategy for targeted gene replacement in using a dual-sgRNA/case 9design. scientific reports,6,23890.; the public is available from Weifang-flourishing biological species industry Co., Ltd.

The tomato variety Ailsa Craig in the examples below was purchased from the vegetable and flower institute, Chinese academy of agricultural sciences.

Example 1 creation of a sterile line of tomato Green Stem visible linkage marker

Construction of one-gene and double-gene knockout vectors

1. Selection of target sequences

Tomato MS15 gene (Solyc02g084630) is fertility gene, its mutant can produce complete abortion and stigma exsertion phenotype, can be used in production as sterile line, its nucleotide sequence is shown in SEQ ID No. 1; the tomato F3H gene (Solyc02g083860) is an important gene in an anthocyanin synthesis path, the mutant can cause the stem of a seedling to be green and can be used as a visible marker, and the nucleotide sequence of the mutant is shown as SEQ ID NO. 2.

According to the analysis of the comprehensive efficiency and off-Target condition of the Target site, the 432. sup. th and 454. sup. th positions from the 5 'end of SEQ ID NO.1 are selected as MS15 Target sites (MS15-Target), and the 331. sup. st and 353. sup. th positions from the 5' end of SEQ ID NO.2 are selected as F3H Target sites (F3H-Target).

2. Construction of the YBK vector

CPB vector is used as a basic vector, and the promoter pUBI of Cas9 is replaced by a pYao promoter (the nucleotide sequence of the pYao promoter is shown as SEQ ID NO. 5) by the method in the references of Yan et al, 2015, High-efficiency genetic encoding in Arabidopsis using YAO promoter-drive CRISPR/Cas9 system, molecular weight lan, 8(12) and 1820-efficiency 1823, and the modified vector is named as YBK vector.

3. Construction of MS15-Target-U6-sgRNA and F3H-Target-U6-sgRNA

Primers were designed based on YBK vectors as follows:

MS15-U6-F：5’-CCTGTCAAACACTGATAGTTTCATTCGGAGTTTTTGTATCTTG-3’；

MS15-U6-R：5’-AGTGCACTCTGATACTGATCAATCACTACTTCGACTCTAGCTG-3’；

MS15-sgRNA-F：5’-ATCAGTATCAGAGTGCACTGTTTCAGAGCTATGCTGGAAA-3’；

MS15-sgRNA-R：5’-TTTCCCGCCTTCAGTTTAAACAAAAAAGCACCGACTCGGT-3’；

F3H-U6-F：5’-CACCGAGTCGGTGCTTTTTTGTTTCATTCGGAGTTTTTGTATCT-3’；

F3H-U6-R：5’-AAGCTTTTCCTCAGGAGGCCAATCACTACTTCGACTCTAGCTG-3’；

F3H-sgRNA-F：5’-GCCTCCTGAGGAAAAGCTTGTTTCAGAGCTATGCTGGAAAC-3’；

F3H-sgRNA-R：5’-TTTCCCGCCTTCAGTTTAAACAAAAAAGCACCGACTCGGT-3’；

the nucleotide sequence shown in SEQ ID NO.3 is taken as a template, and MS15-U6-F, MS15-U6-R primer is adopted for PCR amplification to obtain a segment (named as MS 15-Target-U6). The nucleotide sequence shown in SEQ ID NO.3 is taken as a template, and F3H-U6-F, F3H-U6-R primer is adopted for PCR amplification to obtain a fragment (named as F3H-Target-U6).

The nucleotide sequence shown in SEQ ID NO.4 is taken as a template, and MS15-sgRNA-F, MS15-sgRNA-R primer is adopted for PCR amplification to obtain a fragment (named as MS 15-sgRNA-U6). A nucleotide sequence shown in SEQ ID NO.4 is taken as a template, and F3H-sgRNA-F, F3H-sgRNA-R primer is adopted for PCR amplification to obtain a fragment (named as F3H-sgRNA-U6).

Overlapping PCR is carried out by taking MS15-Target-U6 and MS15-Target-sgRNA as templates to obtain a product (named as MS 15-Target-U6-sgRNA).

The products (named F3H-Target-U6-sgRNA) were obtained by performing overlap PCR using F3H-Target-U6 and F3H-Target-sgRNA as templates.

The reaction system for the above-mentioned overlap PCR amplification is shown in Table 1, and the PCR amplification procedure is as follows: 94 ℃ for 2 min; 15s at 94 ℃, 30s at 55 ℃, 30s at 68 ℃ and 35 cycles; 10min at 68 ℃.

Table 1 the reagents were from KOD Plus, purchased from eastern american (shanghai) biotechnology limited, cat # s: KOD-201.

TABLE 1

Components	Volume (μ l)
		Form 1	5
Form 2	5
		MgSO ₄	2
10×KOD Plus buffer	5
		dNTPs	5
KOD Plus	1
		Upstream primer U6-F	1.5
Downstream primer sgRNA-R	1.5
		H₂O	24
Total of	50

Note: the upstream primer U6-F is MS15-U6-F or F3H-U6-F; the downstream primer sgRNA-R is MS15-sgRNA-R or F3H-sgRNA-R.

4. Construction of double-gene knockout vector YBK-MS15-F3H-Target

The YBK vector is cut by restriction endonuclease Pme I to obtain a large fragment YBK-Pme I (about 16876bp), an overlapped PCR product MS15-Target-U6-sgRNA and the cut large fragment YBK-Pme I are recombined by a recombinase Kit (pEASY-UniSeamless Cloning and Assembly Kit, all formula gold), the recombination is carried out for 15min at 50 ℃, and then the transformation and sequencing are carried out to obtain a knockout vector YBK-MS 15-Target. The YBK-MS15-Target vector is subjected to enzyme digestion by using a restriction enzyme Pme I to obtain a large fragment YBK-MS15-Target-Pme I, and F3H-Target-U6-sgRNA is connected by using the same method to obtain a double-gene knockout vector YBK-MS15-F3H-Target (the structural schematic diagram of important elements of the vector is shown in figure 2). The knockout vector comprises sgRNA (the target sequence is 432-454 sites from the 5 'end of SEQ ID NO. 1) driven by AtU6 promoter recognized by RNA polymerase III and targeting a gene coding MS15 protein, sgRNA (the target sequence is 331-353 sites from the 5' end of SEQ ID NO. 2) driven by AtU6 promoter recognized by RNA polymerase III and targeting a gene coding F3H protein, a Cas9 nuclease coding gene driven by pYao promoter and a kanamycin screening gene driven by 35S promoter.

Second, tomato genetic transformation

1. Sterile explant acquisition

Tomato receptor seeds (Ailsa Craig, the invention is also applicable to other materials) are soaked in sterile water at 42 ℃ for 2h, sterilized by 75% alcohol for 1min, sterilized by 10% sodium hypochlorite for 5min, washed by sterile water for 4-5 times, inoculated in an MS culture medium, cultured in dark at 25 ℃ until germination, and transferred to the light for 1 week. The distal axis end and hypocotyl of the cotyledon are cut off by a knife, and the proximal axis end is left as an explant.

2. Infection with Agrobacterium

Transforming the YBK-MS15-F3H-Target constructed in the step one into the competence of the GV3101 agrobacterium tumefaciens, selecting a positive colony to culture to the middle logarithmic phase, centrifuging, and suspending to 0D by using an MS culture medium_600nmThe value was 0.2, the explants were soaked in the suspension for 5min and co-cultured in the dark at 25 deg.C (MS medium: 4.3g/L, sucrose 30g/L, zeatin 1mg/L, 1 Xnixu vitamin, 0.8% agar) for 2 days.

3. Regeneration and screening

The co-cultured explants were transferred to regeneration medium (MS medium 4.3g/L, sucrose 30g/L, zeatin 2mg/L, inositol 100mg/L, 1 Xnixu vitamins, 0.8% agar) containing 15mg/L Hyg and subcultured every two weeks until resistant shoots developed.

4. Rooting

The resistant buds are transferred to a rooting culture medium (MS culture medium 4.3g/L, sucrose 30g/L, 1 XNixu vitamin, 0.8% agar) for about 20 days, and the rooted seedlings are transferred to a seedling pot.

Third, mutant molecular identification

1. Obtaining tomato positive plants

Using the genome DNA of the resistant strain developed by the tomato resistant bud as a template, and using a positive identification primer Cas 9-F: 5'-TTCCAGAATGTCCTCGTTT-3' and Cas 9-R: 5'-CGGCACAGCATCAAGAA-3', PCR identification, and re-screening PCR positive seedlings with 1734bp bands by a Bar test strip to obtain tomato positive strains.

2. Obtaining homozygous mutants

1) Enzyme cutting identification of MS15 site

Using the genomic DNA of the tomato positive strain as a template, and performing amplification by using an amplification primer MS 15-F: 5'-TCCCGATATAGTTTCTCTACTAACCCA-3', MS 15-R: 5'-TTAGCCCTACCTCATAAGCATAAAGCA-3' and carrying out PCR amplification, carrying out enzyme digestion on the PCR product by using a restriction enzyme ApaL I, and detecting the enzyme digestion product by electrophoresis. If the amplified fragment which is not edited at the MS15 site is cut by enzyme, the amplified fragment can be completely cut to obtain two bands of 302bp and 407 bp; if the amplified fragment of the MS15 site with homozygous mutation can not be cut after enzyme digestion, a 709bp band is obtained; if the amplified fragment with heterozygous mutation at the MS15 locus is cut by enzyme, the bands of the wild type and the homozygous mutant can be simultaneously generated, and three bands of 302bp, 407bp and 709bp are obtained. The detection result of the enzyme digestion product is shown in FIG. 3A.

2) Enzyme cutting identification of F3H site

Using the genomic DNA of the tomato positive strain as a template, and respectively using amplification primers F3H-F: 5'-GCTTGTGAAGATTGGGGTGTTT-3', F3H-R: 5'-CTCTAGCTCGAATGGGGTATGA-3' and performing PCR amplification, cutting the PCR product by restriction enzyme Hind III, and detecting the cut product by electrophoresis. If the amplified fragment which is not edited at the F3H site is cut by enzyme, the amplified fragment can be completely cut to obtain two bands of 116bp and 740 bp; if the amplified fragment of the F3H site which has homozygous mutation can not be cut after enzyme digestion, a 856bp band is obtained; if the amplified fragment with the heterozygous mutation at the F3H locus is cut by enzyme, the bands of the wild type and the homozygous mutant can be generated at the same time, and three bands of 116bp, 740bp and 856bp are obtained. The detection result of the enzyme digestion product is shown in FIG. 3A.

Through identification, mutant T1-5 strains (the genotype is MS15MS15/F3Hf3h) with homozygous mutation at the MS15 locus and the F3H locus (the mutation at the two chromosomes is consistent) and mutant T1-1 strains (the genotype is MS15MS15/F3Hf3h) with heterozygous mutation at the MS15 locus and the F3H locus (only one of the two chromosomes is mutated, and the other chromosome is not mutated) are finally obtained.

The mutant T1-5 strain is a tomato male sterile line; the mutant T1-1 line is a tomato maintainer line (which can also be used as a tomato restorer line).

3. Sequencing of mutants

Mutant T1-5 was selected for sequencing. The sequencing result shows that: the mutant T1-5 differed from the genomic DNA of the wild type tomato Ailsa Craig only in that in the gene encoding the MS15 protein, a fragment deletion had occurred in both chromosomes, the deletion fragment being located at position 444-448 of SEQ ID NO.1 and in the gene encoding the F3H protein, a fragment deletion had occurred in both chromosomes, the deletion fragment being located at position 341-347 of SEQ ID NO. 2. The specific deletion base is shown in FIG. 3B.

Mutant T1-1 was selected for sequencing. The sequencing result shows that: the mutant T1-1 differed from the genomic DNA of the wild type tomato Ailsa Craig only in that in the gene coding for the MS15 protein a fragment deletion had been made in one chromosome which was located at position 444-448 of SEQ ID NO.1 and in the other chromosome which was not mutated, and in the gene coding for the F3H protein a fragment deletion had been made in one chromosome which was located at position 341-347 of SEQ ID NO.2 and in the other chromosome which was not mutated.

Fourth, identification of fertility phenotype

And performing fertility phenotype identification on the mutant T1-5 strain. Also control was a wild type tomato Ailsa Craig.

The results are shown in FIG. 4, with FIG. 4A and FIG. 4C showing flower and pollen activity of wild type tomato Ailsa Craig, and FIG. 4B and FIG. 4D showing flower and pollen activity of mutant T1-5 line. Mutant T1-5 lines showed stigma exsertion and complete pollen inactivity compared to wild type tomato Ailsa Craig.

Phenotypic identification of visible marker of five-green stem

The mutant T1-5 strain (genotype MS15MS15/F3Hf3h) and the mutant T1-1 strain (genotype MS15MS15/F3Hf3h) were hybridized, the resulting seeds were germinated in an incubator (dark condition) at 28 ℃ for 2 days, and then transferred to a light culture room for 2 days, and then observed.

The results show that: the progeny of the cross appeared in green-stem tomatoes (MS15MS15/F3Hf3h) and purple-stem tomatoes (MS15MS15/F3Hf3h), with a clear color difference (as shown in FIG. 5).

Example 2 tomato Green Stem visible linkage marker sterile line propagation

The visible marker sterile line created by the invention solves the screening problem of the maintainer line and the sterile line in the actual production sterile line propagation process. The sterile line created by the method can be screened by observing the color of the stem with naked eyes, and the method is convenient and accurate and does not need cost. The specific propagation method comprises the following steps:

the tomato male sterile line is used as a female parent, and the tomato maintainer line is used as a male parent for hybridization. Wherein, the tomato male sterile line is a tomato mutant (mutant T1-5 line obtained in example 1) with homozygous mutation at MS15 locus and F3H locus and MS15MS15/F3Hf3h genotype, and the tomato maintainer line is a tomato mutant (mutant T1-1 line obtained in example 1) with heterozygous mutation at MS15 locus and F3H locus and MS15MS15/F3Hf3h genotype. In the filial generation, 50% is tomato male sterile line (green stem) and 50% is tomato maintainer line (purple stem), and the sterile line and maintainer line can be distinguished by observing the color of the stem with naked eyes (figure 6).

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Weifang Shawang biological species industry Co Ltd

<120> a method for creating a male sterile line by using tomato green stem close linkage markers

<160>7

<170>PatentIn version 3.5

<210>1

<211>3771

<212>DNA

<213>Artificial Sequence

<400>1

cttatagtag tgcagttgct acccttcaat ctttcttttc ccgatatagt ttctctacta 60

acccacccca tatctcttca ctttttcctc tctttaactt caacaatgaa catgaccctt 120

gttgattcac ctcaatttct acttcttcaa aaatgggccg tggaaaaatt gagatcaaga 180

agattgaaaa ctcgacaaac aggcaggtca cttactccaa gagaagaaac ggtattttca 240

agaaagctaa agaacttact gttctttgtg acgctaagat ctctctcatc atgctatcaa 300

gcaccaggaa gtatcatgag tacacaagcc caaacactac gtatgttatg ttctcaacac 360

aaaaaaattt actttattga aatcaaaaag aggtttaatt tttttttcct atcaggacaa 420

aaaagatgat tgatcagtat cagagtgcac ttggagttga tatctggagc attcactacg 480

aggtataatt ttagcgttga ttttgtatac tcttacccta gaaattgaaa tcagtttgta 540

cattgaattt atgtgtacag aaaatgcaag aaaacttgaa gagattgaaa gagatcaata 600

acaagctaag aagagagata aggtaattat tttgtatccg ttactgttct gtactactct 660

gcatatcatt catgttactt cacccatatt tttattccct ttttcaaaac tatttgaaaa 720

tgctttatgc ttatgaggta gggctaagat atgtgtgcac tctacccttc ccctaaaccc 780

taaccctact ggtggggtta cattgaatat gttttatatt aataacacag tttttaactt 840

tctaatttga gcaattgaag gatggttaat gagtcatgtg atcagttttt tttggtatgt 900

gtaatcaagc aatgataatg aaatgtctga tgttggtgtc tgttgatagg cagagaacag 960

gggaagacat gagcggacta aatttgcagg aactatgtca cttgcaggag aacatcactg 1020

aatctgttgc tgagattcgt gaacgaaagg ttattgttca taccttactc tttacatttt 1080

ttgggttatg ttagtctaga ataaattgta tccatttctg aagttaaatg gacctaaatt 1140

aacttaagta atcaggatat attcttttat caaaatgtga aatagtgtat gttaaatgtt 1200

aggttaaatt cactttattt tgagtcttga gaacagaaaa gtgttcaaca tttatttgaa 1260

gtataggcaa tgaatctttt cagcttggac caatttaatt taaacattag tgaatacaac 1320

aatagttctt caagctggtc ttgtttctac ttgccaaaaa tgcctataac attttgtgac 1380

aggtgaggat tcaaggttag actcaaggtt atttgtaata cgtttaggtc caacgaagag 1440

tgtctgggtg tctaaatatg aatttataaa agtcatgacc acttctatca caaaaatgat 1500

tatgtttgaa agaattgcta ctgtgactaa ttgataagtc gacttgccta aattaggttt 1560

gtcactctta gaattcattt cagttgacta acctgagcca gtccagtaat ctatgttcat 1620

tttattagtg atagagtgat acgtagacct actagaggca ggtttgtcac tggcaagatt 1680

ttgactggtt gacttcatat cgtgattgga ttggttagat ctgatagagc tatgaacaaa 1740

ggatttgtgc atgctattaa cttgcatttg caattcctaa atatcttcct gaagaaaaaa 1800

gtattttcta ttccacatac ttgcaatctt atttcctact ctttctttcc aagaataagt 1860

gtagagcttt cacatgcagc cgttgagtaa gtcttcatag tcttcaattg gtcttgatta 1920

gcttctagag ttttggaaag aaataggtgc tttgatactt gtttccatag aggccttttg 1980

attactgcct tgagatcttg agctttaata agtgcagaat cttgttattc agttttgctc 2040

tctcgagatg attccttctt taacagatgt tgattgagtt cttcccatac agatatatta 2100

gcatatagct attttactcg acttcccttc atatgcttct atgtgttaag ctgcatgatc 2160

ctgcatacat agaaagcact tatattaaac tcgtcatcat aaaattaatt aaatagaaga 2220

aaccaatgct tcaacccgtt gagcagcagc agcattagtg tccacaacaa ttttcagaac 2280

atctgcttca acccgttgag cagccgcagc attagtgtcc acaacaattt tcagaacctc 2340

tccaacatca taatcacaac acacttcaaa taccttctcc gtaagccatg tagctagttt 2400

gtgccacaca caatgcgtga cacacttgat ctttcaaaca cagccctctg ctcaaccctc 2460

aatctccaca agcccaaatc attgggcttt cacgcaacaa tagcaacttg tacacccaaa 2520

cattcactaa gcttaacaag cctttaaaac agttggcgac actacaacta cgttgaggcc 2580

caattctagt tttgttgaag cagtatttca cattgcatca taagaaagct catttagaac 2640

tgtgtaagtc gggggatgat accattaggg cctgttgaag aggcttagta caatctcaaa 2700

aatggtctct gtctatgtaa gtggtagcta tggagtgagc taatgtgctt tcttctgtac 2760

ctggatggcc ttccattgct ataatttttt gtctcgctac aatattttgc tcccccattt 2820

tgaatcagta cttggtagag aagaccattt aaacgaaaag aatagtacag tagtaatatt 2880

ttggtgactc attcatgtaa ttgatcatat gataggtcaa tcaaacttcg ctttggtgtt 2940

ctttttttgt gttttacatc gtcagcaaat gaaattagaa ttagttttcc acatgtatta 3000

ttgacgtact taactataag agtctctctg atttcctaca gtaccacgtg atcaagaatc 3060

aaacagacac ctgcaagaag aaggtaagtt tttcattgtt aatattttat atgaattcct 3120

ttcttttcat tttgcctggg cattttacaa agtgcaatgg gttcttctat aatgacaaaa 3180

ataggcgagg aacttagaag agcaaaatgg aaaccttgta cttgacttgg taagtatctc 3240

tttataaatt cagttcatat gctgatttat ttgtttttag ttgattaatg ggggttgttt 3300

actaacacaa aaagtaacgt aattgcttca tcaaaggaag caaaatgtga agatccaaag 3360

tatggtgttg tggaaaatga ggggcattac cactctgctg tggcatttgc gaatggagta 3420

cacaatcttt atgcttttcg cctacaacca ttgcacccca atcttcaaaa cgaaggagga 3480

tttggttctc gtgatctacg tctctcctga agatatcagt tcacagtaat ggcgttaaac 3540

attaatgctg agttacttat tcaaatcaac ttcccgaatt atatcttatt cctaaaaaaa 3600

attaaatatt gcaagctgca aacactactt tatctaacta atttgctccg agtctggatt 3660

tggttctgtg ttaagcactc tattattcta ggtgtttcaa ctcctttcta tatatgaatt 3720

atgatgcctt gaacgcatgt tcaattaatc aattttcctt ttcgacttga t 3771

<210>2

<211>2064

<212>DNA

<213>Artificial Sequence

<400>2

caacatttaa aaagggcacc tcataactct tttgaacaaa acaaaaaatg gcaccttcaa 60

cactaacagc tttagctaat gaaaagaccc ttgaaacaag ttttattagg gatgaagaag 120

aacgtccaaa agttgcttac aataaattta gtgacgaaat tccagtaata tcgttgcaag 180

gtattgatga tgttaatgga agaagaagtg aaatatgtga gagaatcgta aatgcttgtg 240

aagattgggg tgtttttcag gtaattgatc atggggttga tgctcaatta atatcacaaa 300

tgacaaaatt agcgaaggaa tttttcgaat tgcctcctga ggaaaagctt cggtttgaca 360

tgtctggtgg caagaaaggt ggcttcattg tctcaagcca cttacaggta acaattattt 420

caccgcaact tattttttat tttgatttat aggaataaat agaaaaaaag ttagtgataa 480

atttctaaat acagaaaaga tatacctacg gatgaaaaag tgtttgtaac agatcccctt 540

tttttccgag gtagccgttg tatcgatagt ttgaaaaata taaagtttgt tttaattgtt 600

atttaaattc tatgatattg tatatgtaga tgaaaaaaaa atattttttt aacgacaatt 660

tgataggatc atgttattat tttagtattt tcagttaatt ttgtctttat ttattattga 720

gttattttat tttatctatt tacaccattt ttattagtag ctcatcatag cagtggcgga 780

ttaccggggt caacctgacc tccaggcggg aaattatagg gttgaaatta ttttttaggt 840

agatgtatat agttaatgtc aaatttcttc agctacttcg tgtatctatt gaacctctta 900

tttaaaattg gctccaccat tatttcgtac tttacttttt cttgtagatt cattattcaa 960

aatatgggtg tataacgata taatataatt tatcaattta ctataacact acaattgttt 1020

tgtagggtga agtggttcaa gactggcgtg aaatagtgac ttacttttca taccccattc 1080

gagctagaga ctattctaga tggccagaca aaccacaagg ctggataggt gtaactgagc 1140

aatacagtga aaagttgatg gatttggctt gcaaattatt agaagtacta tcagaggcaa 1200

tgggcttaga gaaagaggct ttaaccaagg catgtgtcga tatggaccaa aaagtagttg 1260

tgaattttta cccaaagtgt ccagagcctg accttactct tgggctcaaa cgacacaccg 1320

atccaggaac cattacctta ttgttacaag accaagttgg tgggcttcaa gccactaaag 1380

ataatggcaa aacatggatc actgttcagc ccgttgaagg tgcttttgtg gttaatcttg 1440

gcgatcacgg tcatgtaagt tggtactaca tattccgata aaattaaaat tatgtgaatt 1500

taattatgtg aattttggac agtatttgag caatggaagg ttcaagaatg ctgatcatca 1560

agcagtggtg aattcgaata gcagtagatt atcgatagcc acattccaga atccagcacc 1620

agatgcaaaa gtgtatccgt taaaaattag agaaggagag aagtcaataa tggatgagcc 1680

gattacattt gcagaaatgt acaggaggaa aatgagtaag gatcttgagc tagctaggct 1740

gaagaaactg gccaaggaag agaagataca aactgaagag gccaagttgg agtccaagcc 1800

cattgaggaa attcttgctt aagtgtttta acacttgaaa caacaagcta tgcgcgtaat 1860

ttcttttatc agtattgtct tgaataacaa tcaatcatgt tcttgtgaat tggtgatgtt 1920

tttaatctta ttacaaaaca aacttagtgt tcctttattc aaattaaagt cttttagatg 1980

atgcataacg ccatttccta cggaggaagg taaaattata aaattggata tacataaaac 2040

tatactcgta gatccataag actt 2064

<210>3

<211>293

<212>DNA

<213>Artificial Sequence

<400>3

cattcggagt ttttgtatct tgtttcatag tttgtcccag gattagaatg attaggcatc 60

gaaccttcaa gaatttgatt gaataaaaca tcttcattct taagatatga agataatctt 120

caaaaggccc ctgggaatct gaaagaagag aagcaggccc atttatatgg gaaagaacaa 180

tagtatttct tatataggcc catttaagtt gaaaacaatc ttcaaaagtc ccacatcgct 240

tagataagaa aacgaagctg agtttatata cagctagagt cgaagtagtg att 293

<210>4

<211>92

<212>DNA

<213>Artificial Sequence

<400>4

gtttcagagc tatgctggaa acagcatagc aagttgaaat aaggctagtc cgttatcaac 60

ttgaaaaagt ggcaccgagt cggtgctttt tt 92

<210>5

<211>982

<212>DNA

<213>Artificial Sequence

<400>5

gatgggaaat tcattgaaaa ccctaaaccc aaatcaacag ctgcaattca aaaggggact 60

aattgacaaa caaaaattga taacaaatag aggtagggggagagtttcgt acgcgacaat 120

gagattgagc tcttgaggac ttgtgaagtt gccaacgcac gagtgagtga cactggtcgg 180

tttgtgagcc gtaacaacgt agttccatga gctcatcttc ctcttctttg tctccaggga 240

atttgagttc gactttctac gcgagggccc tcgaggaagc ttctagattt ctgaatcgag 300

ctttcggaat tttaacatag agaagttaga gagagaatga aaagccaaag gaggcgaaaa 360

tcgaacaagg aagaagaaag acaactttcg acaaagactg gtcggtcggt tttggtagac 420

aattgaaatt agatggatgg tccggttcgg tatactataa gattaaaaac agttttaaat 480

tcagctaaac cgaactcatt tgattttatt aaaccggaat catccgattc gagtttgtaa 540

aaaataccga aattgaaaac actaaacaaa aactgtatta aactgttact gaaataagag 600

aatctcccaa ttcggtttac gtactactct tcagaaatca gaaccaaaaa ttcagaaatc 660

ggattgaacc aaacttaaat tgacggtccg gttagtcttc ggctctacaa attaaaggcc 720

caagtttctg ctttaaaaga acgaaatagt taatgggctc aaaccataga ccaggtaagt 780

catgggcttg gttagtccgg gtcaacccgg tagacccgat tcctgaagaa aacctagtgg 840

aaggtttaaa gttgtaaact ttccgaccaa ataaacaaaa tcgttttcca gcttcttccg 900

tcgccactaa accctgaggc taaacctaga cgagtcaaag tgtaaaatcg ttaaacccta 960

agagggagtg agagagagaa ga 982

<210>6

<211>225

<212>PRT

<213>Artificial Sequence

<400>6

Met Gly Arg Gly Lys Ile Glu Ile Lys Lys Ile Glu Asn Ser Thr Asn

1 5 10 15

Arg Gln Val Thr Tyr Ser Lys Arg Arg Asn Gly Ile Phe Lys Lys Ala

20 25 30

Lys Glu Leu Thr Val Leu Cys Asp Ala Lys Ile Ser Leu Ile Met Leu

35 40 45

Ser Ser Thr Arg Lys Tyr His Glu Tyr Thr Ser Pro Asn Thr Thr Thr

50 55 60

Lys Lys Met Ile Asp Gln Tyr Gln Ser Ala Leu Gly Val Asp Ile Trp

65 70 75 80

Ser Ile His Tyr Glu Lys Met Gln Glu Asn Leu Lys Arg Leu Lys Glu

85 90 95

Ile Asn Asn Lys Leu Arg Arg Glu Ile Arg Gln Arg Thr Gly Glu Asp

100 105 110

Met Ser Gly Leu Asn Leu Gln Glu Leu Cys His Leu Gln Glu Asn Ile

115 120 125

Thr Glu Ser Val Ala Glu Ile Arg Glu Arg Lys Tyr His Val Ile Lys

130 135 140

Asn Gln Thr Asp Thr Cys Lys Lys Lys Ala Arg Asn Leu Glu Glu Gln

145 150 155160

Asn Gly Asn Leu Val Leu Asp Leu Glu Ala Lys Cys Glu Asp Pro Lys

165 170 175

Tyr Gly Val Val Glu Asn Glu Gly His Tyr His Ser Ala Val Ala Phe

180 185 190

Ala Asn Gly Val His Asn Leu Tyr Ala Phe Arg Leu Gln Pro Leu His

195 200 205

Pro Asn Leu Gln Asn Glu Gly Gly Phe Gly Ser Arg Asp Leu Arg Leu

210 215 220

Ser

225

<210>7

<211>362

<212>PRT

<213>Artificial Sequence

<400>7

Met Ala Pro Ser Thr Leu Thr Ala Leu Ala Asn Glu Lys Thr Leu Glu

1 5 10 15

Thr Ser Phe Ile Arg Asp Glu Glu Glu Arg Pro Lys Val Ala Tyr Asn

20 25 30

Lys Phe Ser Asp Glu Ile Pro Val Ile Ser Leu Gln Gly Ile Asp Asp

35 40 45

Val Asn Gly Arg Arg Ser Glu Ile Cys Glu Arg Ile Val Asn Ala Cys

50 55 60

Glu Asp Trp Gly Val Phe Gln Val Ile Asp His Gly Val Asp Ala Gln

65 70 75 80

Leu Ile Ser Gln Met Thr Lys Leu Ala Lys Glu Phe Phe Glu Leu Pro

85 90 95

Pro Glu Glu Lys Leu Arg Phe Asp Met Ser Gly Gly Lys Lys Gly Gly

100 105 110

Phe Ile Val Ser Ser His Leu Gln Gly Glu Val Val Gln Asp Trp Arg

115 120 125

Glu Ile Val Thr Tyr Phe Ser Tyr Pro Ile Arg Ala Arg Asp Tyr Ser

130 135 140

Arg Trp Pro Asp Lys Pro Gln Gly Trp Ile Gly Val Thr Glu Gln Tyr

145 150 155 160

Ser Glu Lys Leu Met Asp Leu Ala Cys Lys Leu Leu Glu Val Leu Ser

165 170 175

Glu Ala Met Gly Leu Glu Lys Glu Ala Leu Thr Lys Ala Cys Val Asp

180 185 190

Met Asp Gln Lys Val Val Val Asn Phe Tyr Pro Lys Cys Pro Glu Pro

195 200 205

Asp Leu Thr Leu Gly Leu Lys Arg His Thr Asp Pro Gly Thr Ile Thr

210 215 220

Leu Leu Leu Gln Asp Gln Val Gly Gly Leu Gln Ala Thr Lys Asp Asn

225 230 235 240

Gly Lys Thr Trp Ile Thr Val Gln Pro Val Glu Gly Ala Phe Val Val

245 250 255

Asn Leu Gly Asp His Gly His Tyr Leu Ser Asn Gly Arg Phe Lys Asn

260 265 270

Ala Asp His Gln Ala Val Val Asn Ser Asn Ser Ser Arg Leu Ser Ile

275 280 285

Ala Thr Phe Gln Asn Pro Ala Pro Asp Ala Lys Val Tyr Pro Leu Lys

290 295 300

Ile Arg Glu Gly Glu Lys Ser Ile Met Asp Glu Pro Ile Thr Phe Ala

305 310 315 320

Glu Met Tyr Arg Arg Lys Met Ser Lys Asp Leu Glu Leu Ala Arg Leu

325 330 335

Lys Lys Leu Ala Lys Glu Glu Lys Ile Gln Thr Glu Glu Ala Lys Leu

340 345 350

Glu Ser Lys Pro Ile Glu Glu Ile Leu Ala

355 360

Claims

Use of the MS15 protein and the F3H protein in any one of the following (1) to (5):

(1) cultivating a tomato male sterile line;

(2) cultivating a tomato maintainer line;

(3) propagating tomato male sterile line;

(4) distinguishing a sterile line and a maintainer line in the process of propagating the tomato male sterile line;

(5) tomato breeding;

the MS15 protein is a1) or a2) or A3) as follows:

A1) a protein consisting of an amino acid sequence shown in SEQ ID No. 6;

A2) a protein derived from tomato and having 98% or more identity and the same function as A1);

A3) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID NO.6 and has the same function;

the F3H protein is B1) or B2) or B3) as follows:

B1) a protein consisting of the amino acid sequence shown in SEQ ID No. 7;

B2) protein derived from tomato and having more than 98% identity with B1) and having the same function;

B3) and (b) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO.7 and has the same function.
2. Use of a biomaterial related to MS15 protein and a biomaterial related to F3H protein in any one of the following (1) to (5):

(1) cultivating a tomato male sterile line;

(2) cultivating a tomato maintainer line;

(3) propagating tomato male sterile line;

(4) distinguishing a sterile line and a maintainer line in the process of propagating the tomato male sterile line;

(5) tomato breeding;

the biological material related to the MS15 protein is any one of the following C1) to C8):

C1) a nucleic acid molecule encoding the MS15 protein of claim 1;

C2) an expression cassette comprising the nucleic acid molecule of C1);

C3) a recombinant vector comprising the nucleic acid molecule of C1);

C4) a recombinant vector comprising the expression cassette of C2);

C5) a recombinant microorganism comprising the nucleic acid molecule of C1);

C6) a recombinant microorganism comprising the expression cassette of C2);

C7) a recombinant microorganism comprising the recombinant vector of C3);

C8) a recombinant microorganism comprising the recombinant vector of C4).

The biological material related to the F3H protein is any one of the following D1) to D8):

D1) a nucleic acid molecule encoding the F3H protein of claim 1;

D2) an expression cassette comprising the nucleic acid molecule of D1);

D3) a recombinant vector comprising the nucleic acid molecule of D1);

D4) a recombinant vector comprising the expression cassette of D2);

D5) a recombinant microorganism comprising the nucleic acid molecule of D1);

D6) a recombinant microorganism comprising the expression cassette of D2);

D7) a recombinant microorganism comprising the recombinant vector of D3);

D8) a recombinant microorganism comprising the recombinant vector of D4).
3. A method for cultivating a tomato male sterile line, which is X1) or X2);

x1) to make the function of MS15 protein and F3H protein in tomato lose or inhibit the activity of MS15 protein and F3H protein in tomato, to obtain tomato male sterile line;

x2) knocking out or silencing the gene coding the MS15 protein and the gene coding the F3H protein in tomato or inhibiting the expression of the gene coding the MS15 protein and the gene coding the F3H protein in tomato to obtain a tomato male sterile line.
4. A method for breeding tomato maintainer lines, which is Y1) or Y2);

y1) to make the function of MS15 protein and F3H protein in tomato lose or inhibit the activity of MS15 protein and F3H protein in tomato, to obtain tomato maintenance line;

y2) knocking out or silencing the gene coding the MS15 protein and the gene coding the F3H protein in tomato or inhibiting the expression of the gene coding the MS15 protein and the gene coding the F3H protein in tomato to obtain the tomato maintainer line.
5. The method according to claim 3 or 4, characterized in that: the X2), the gene coding for MS15 protein and the gene coding for F3H protein in the knockout tomato are used for mutating the gene coding for MS15 protein and the gene coding for F3H protein in tomato; the mutation is a homozygous mutation;

or, Y2), the gene encoding MS15 protein and the gene encoding F3H protein in the knockout tomato are such that the gene encoding MS15 protein and the gene encoding F3H protein in tomato are mutated; the mutation is a heterozygous mutation.
6. The method of claim 5, wherein: the substance which mutates the gene coding for MS15 protein and the gene coding for F3H protein in tomato is CRISPR/Cas9 system;

or, the CRISPR/Cas9 system comprises a Cas9 nuclease and a sgRNA; the sgrnas include a sgRNA targeting a gene encoding MS15 protein and a sgRNA targeting a gene encoding F3H protein;

or, the target sequence of the sgRNA of the gene targeting the coding MS15 protein is 432-454 th site from the 5' end of SEQ ID NO. 1; the target sequence of the sgRNA targeting the gene coding the F3H protein is shown as position 331-353 from the 5' end of SEQ ID NO. 2.
7. The method for propagating the tomato male sterile line comprises the following steps: and hybridizing the tomato male sterile line obtained by the method of any one of claims 3-6 as a female parent and the tomato maintainer line obtained by the method of any one of claims 4-6 as a male parent to realize the propagation of the tomato male sterile line.
8. The method of claim 7, wherein: the method further comprises the step of distinguishing the tomato male sterile line from the tomato maintainer line in the progeny of the cross by visually observing the color of the stems.
9. Any one of the following M1) -M4):

m1) substances which either disable the function of the MS15 protein and F3H protein in tomato or inhibit the activity of the MS15 protein and F3H protein in tomato;

m2) knocking out or silencing the gene encoding MS15 protein and the gene encoding F3H protein in tomato or suppressing the expression of the gene encoding MS15 protein and the gene encoding F3H protein in tomato;

m3) the CRISPR/Cas9 system as described in claim 6;

m4) the sgRNA described in claim 6.
10. Use of the product of claim 9 in any one of the following (1) to (5):

(1) cultivating a tomato male sterile line;

(2) cultivating a tomato maintainer line;

(3) propagating tomato male sterile line;

(4) distinguishing a sterile line and a maintainer line in the process of propagating the tomato male sterile line;

(5) and (5) tomato breeding.