CN109456396A - A kind of protein, molecular labeling and the application of Senescence of Rice and fringe type controlling gene HK73 and its coding - Google Patents
A kind of protein, molecular labeling and the application of Senescence of Rice and fringe type controlling gene HK73 and its coding Download PDFInfo
- Publication number
- CN109456396A CN109456396A CN201811636548.XA CN201811636548A CN109456396A CN 109456396 A CN109456396 A CN 109456396A CN 201811636548 A CN201811636548 A CN 201811636548A CN 109456396 A CN109456396 A CN 109456396A
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- plant
- fringe
- senescence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses protein, molecular labeling and the applications of a kind of Senescence of Rice and fringe type controlling gene HK73 and its coding；The present invention utilizes rice leaf early ageing and short fringe mutant, it is cloned into HK73 gene (Seq ID No:1) in rice for the first time by map-based cloning, it includes albumen (Seq ID No:2), adjusting and controlling rice Leaf senescence development and fringe type that the gene, which encodes an ATP functional domain,.By the functional analysis to HK73 gene, the genetic mechanism of plant especially Leaf-Blade of Poaceae aging course and leaf presenility, fringe development has been further clarified, for the photosynthetic efficiency for improveing crops, increasing production of rice potentiality has been improved and lays a good foundation.
Description
Technical field
The present invention relates to plant genetic engineering and breeding fields, regulate and control more particularly to a kind of Senescence of Rice and fringe type
The protein of gene HK73 and its coding, molecular labeling and application.
Background technique
Rice leaf is the important place of synthesis of organic substance matter, by delaying the aging of blade and extending the function of photosynthetic organs
Can, dry-matter accumulation can be increased；Especially in the late growth stage of rice, by extending the photosynthesis time of plant leaf, product
Tiring out more organic substances can be improved the potential of increasing production of rice.There is a kind of important leaf color mutants in rice -- and it is evergreen
Leaf, is a kind of evergreen mutant of functional form, and main phenotypic characteristic is growth anaphase blade Senescence, chlorophyll content
It is remained unchanged with photosynthetic capacity.Therefore, the production energy of rice not only can be improved in the effective use of leaf senile or development gene
Power provides new approaches and methods also for Super rice breeding from now on.
Rice panicle type feature includes grain number per spike, branch stalk number, spike length etc., be an important factor for determining rice yield formation it
One.The growth course of Rice Panicle includes two stages of morphogenesis and pollen development of young fringe.The morphogenesis of young fringe originates in
Transformation of the shoot apical meristem from nutrient growth to reproductive growth, then include the luxuriant idiophase, the Primary branch former base idiophase,
Secondary branch former base idiophase, spikelet sprimordium idiophase and the formation stage of pistil and stamen.Influence of the development of young fringe to rice yield is most
Directly be embodied in fringe size (length), number of branches number, fringe Spikelet density etc..Therefore, the development of Study On Rice fringe and
Morphological feature be not only development of plants in terms of basic theory problem, also improveing and improving rice grain number per spike, spike weight etc.
Aspect has important application value and realistic meaning.
Summary of the invention
The purpose of the present invention is to provide the protein of a kind of Senescence of Rice and fringe type controlling gene and its coding, divide
Son label and application.
To achieve the above object, the present invention adopts the following technical scheme:
On the one hand, the present invention provides the protein that a kind of Senescence of Rice and fringe type controlling gene HK73 are encoded, institutes
Protein is stated with the sequence as shown in (A) or (B):
(A) amino acid sequence shown in Seq ID No:2；
(B) in the amino acid sequence defined by (A) add and/or replace and/or lack one or several amino acid and
The protein as derived from (A) with Senescence of Rice and fringe type adjusting function.
It includes albumen that Seq ID No:2 and protein shown in fig. 6 in the present invention, which belong to ATP functional domain, wherein carrying out
One or several replacements, the purpose of the present invention can also be reached by being inserted into or lack functional analogue obtained.
On the other hand, the present invention provides a kind of genes for encoding above-mentioned protein.
Further, the gene have as (a), (b) or (c) shown in sequence:
(a) nucleotide sequence shown in Seq ID No:1；
(b) nucleotide sequence complementary with nucleotide sequence shown in Seq ID No:1；
(c) at (a) or (b) defined by add and/or replace and/or lack one or more nucleosides in nucleotide sequence
Sour and generation codified with the mutated gene of the protein of Senescence of Rice and fringe type adjusting function, allele or spreads out
Biology.
In another aspect, the present invention provides a kind of plasmid containing said gene, plant expression vector or host cell, it should
Host cell can be Bacillus coli cells, agrobatcerium cell or plant cell.
In another aspect, the present invention provides a kind of methods of adjusting and controlling rice leaf senile and fringe type, including with said gene
Rice transformation cell, then the rice cell after conversion is cultivated into plant.Specifically, the present invention provides with Seq ID
The gene of sequence shown in No:1 and Fig. 5 or the carrier of Gene Partial segment, wherein pCambia1300-HK73 as shown in Figure 3,
The carrier can express above-mentioned nucleotide sequence coded polypeptide fragment or its homologs.
In another aspect, answering the present invention provides above-mentioned protein, gene, plasmid, plant expression vector or host cell
With: (a1) regulates and controls plant leaf blade aging；Or (a2) regulates and controls plant fringe type；It can influence the leaf senile rate and fringe type of plant
(especially spike length is short).
In another aspect, the present invention provides a kind of molecule marks chain with Senescence of Rice and fringe type controlling gene HK73
Note, the upstream primer and downstream primer of the molecular labeling are respectively as follows:
(A) upstream primer is CTGGCCTCTAGCTACAACCTTGC, and downstream primer is
AAACTCTCGCTGGATTCGATAGG；
Or (B) upstream primer is ACGAGAGGGAGGAGAGAGAAACG, downstream primer is
GGAGAGCCACAGGAACAGATCG；
Or (C) upstream primer is AGCCAAAACCAAATCCAAAA, downstream primer CTTCGAGTTGGCCATATTCAC；
Or (D) upstream primer is GACCTTCTCCCTCCTCCAAC, downstream primer GTGTGGGACTTGAACACGG.
In another aspect, the molecular labeling is alone or in combination the present invention provides a kind of application of above-mentioned molecular labeling
It uses, breeding is carried out to plant leaf blade aging and/or fringe type character by plant molecular marker assisted selection.
Further, the fringe type is grain number per spike, branch stalk number and/or spike length.
Further, the plant is gramineae plant, and the gramineae plant is rice.
Realize that steps are as follows for particular technique of the invention:
(1) separation and genetic analysis of mutant hk73:
Rice leaf early ageing of the invention and short fringe mutant hk73 are from japonica rice variety force fortune No. 7 (Oryza of round-grained rice
Sativa L.cv Wuyunjing 7) EMS (Ethyl Methyl Sulfonate) mutagenesis generate mutation.By with it is wild
The reciprocal cross of type is tested, it was demonstrated that the mutant is controlled by Recessive genes, as shown in Figure 1.
(2) map based cloning HK73 gene:
1) the first positioning of HK73:
In order to separate HK73 gene, the present invention constructs a target group first, by mutant hk73 and rice variety
Local No. 1 hybridization combines F in platform2Target group.It, will using molecular labelings such as STS, SSR again by the method for map based cloning
The site HK73 Primary Location is in the region between the 12nd chromosome is marked between 12-26 and K73-22 (Fig. 2).
2) finely positioning of HK73:
Develop new STS label HK73 is accurately located on No. 12 chromosome between K73-24 and K73-31 label
(Fig. 2), by analyzing this section open reading frame (ORF), sequencing speculates candidate gene.
3) identification and functional analysis of HK73 gene:
Pass through transgenic technology, the results showed that present invention obtains the transgenosis water for making mutant hk73 restore normal phenotype
Rice (Fig. 4), it was demonstrated that of the invention correct to have cloned HK73 gene.
The present invention utilizes rice leaf early ageing and short fringe mutant, is cloned into rice for the first time by map-based cloning
HK73 gene, it includes albumen, adjusting and controlling rice Leaf senescence development and fringe size which, which encodes an ATP functional domain,.Pass through
Functional analysis to HK73 gene, further clarified plant especially Leaf-Blade of Poaceae aging course and leaf presenility,
The genetic mechanism of fringe development improves increasing production of rice potentiality and lays a good foundation for the photosynthetic efficiency for improveing crops.
Detailed description of the invention
The above is merely an overview of the technical solutions of the present invention, in order to better understand the technical means of the present invention, below
In conjunction with attached drawing, the present invention is described in further detail with specific embodiment.
Fig. 1 is heading stage blade (A) and the maturation that Senescence of Rice material hk73 and wild type material force transport round-grained rice 7
Phase fringe portion (B) phenotype；Box indicates leaf senile region；Scale=2 centimetre；
Fig. 2 is that the finely positioning of HK73 gene and clone scheme；
Fig. 3 is pCambia1300-HK73 Vector map；
Fig. 4 is transgenosis complementation T1For blade (A) in rice plant, WT lines WYJ7 and hk73 mutant plants and
Fringe portion (B) phenotype comparison diagram；Wherein in (A) and (B): left, wild type WYJ7；In, hk73 mutant；The right side, transgenosis complementation T1
Generation；Box indicates mutant leaf senile region；Scale=2 centimetre；
Fig. 5 is HK73 gene nucleotide series figure；
Fig. 6 is the amino acid sequence of HK73 gene coding.
Specific embodiment
Following embodiment further illustrates the contents of the present invention, but should not be construed limitation of the present invention.It is not carrying on the back
In the case where from spirit of that invention and essence, to modifications or substitutions made by the method for the present invention, step or condition, this hair is belonged to
Bright range.Unless otherwise specified, the conventional means that technological means used in embodiment is well known to those skilled in the art.
Unless otherwise specified, biochemical reagents used in embodiment, carrier, consumptive material etc. are commercially available products.
The clone of 1. Senescence of Rice of embodiment and fringe type controlling gene HK73
(1) rice material:
Rice mutant hk73, original wild material are that japonica rice variety force transports (the Oryza sativa L.cv of round-grained rice 7
Wuyunjing 7).As shown in Figure 1, mutant hk73 heading stage starts performance blade top early ageing, the maturity period shows fringe portion
Size becomes smaller.
(2) analysis and target group:
Local No. 1 is hybridized in homozygous hk73 mutant and wild type rice variety platform, F1Generation selfing, obtains F2Group
Body, and 1148 plants of hk73 phenotype individuals are therefrom selected as target group.It takes 1-2 grams or so of tender leaf for every plant in seedling stage, is used to
Extract plant genomic DNA.
(3) positioning of HK73 gene:
Using the hk73 phenotype individuals chosen from target group, the microcommunity of composition carries out ssr analysis, according to announcement
The molecular genetic linkage map of japonica rice and long-grained nonglutinous rice creation chooses approaches uniformity and is distributed in the progress PCR expansion of the SSR primer on each chromosome
Increase, using following amplification program: 95 DEG C initial denaturation 3 minutes；95 DEG C are denaturalized 30 seconds, and 55 DEG C are annealed 35 seconds, and 72 DEG C extend 10 seconds,
33 circulations；Last 72 DEG C re-extend 8 minutes.PCR product is dyed through the separation of 5% agarose gel electrophoresis and Ethidum Eremide, inspection
The polymorphism for surveying PCR product, by HK73 Primary Location between No. 12 chromosome 12-26 and K73-22 label.It is positioned just
On the basis of continue design SSR and STS label, HK73 is finally accurately located at molecular labeling K73-24 on No. 12 chromosome
Between K73-31 (Fig. 2), and isolated with K73-31.Primer sequence is as follows:
12-26F:AGAGAGCCCCTAAATTTCCG R:AGGTACGCTCACCTGTGGAC
K73-22F:ACGAGAGGGAGGAGAGAGAAACG R:GGAGAGCCACAGGAACAGATCG
K73-24F:AGCCAAAACCAAATCCAAAA R:CTTCGAGTTGGCCATATTCAC
K73-31F:GACCTTCTCCCTCCTCCAAC R:GTGTGGGACTTGAACACGG
(4) predictive genes and sequencing analysis:
According to finely positioning as a result, according to Rice Automated Annotation System in candidate range
(http://RiceGAAS.dna.affrc.go.jp) prediction, according to the two remaining recombination number of individuals of label and isolate mark
Note, we devise the sequencing primer of each gene, transport No. 7 genes of round-grained rice from hk73 and wild-type variety force respectively using PCR method
Each candidate gene is amplified in group carries out sequencing analysis.It was found that wherein in 1 DNA fragmentation of 1 candidate gene, mutant
The product of hk73 amplification has the replacement of 1 base guanine G to adenine A compared with transporting round-grained rice 7 with wild-type variety force.It will be above-mentioned
Sequencing procedure repeated authentication twice, obtains identical result.Therefore, which is named as HK73.It is infused according to gene
Information is released, predicts that candidate gene coding ATP functional domain includes albumen (Fig. 6).
Embodiment 2.pCAMBIA1300-HK73 plant expression vector construction
According to rice varieties OryzasativaLcv.Nipponbare (the Oryza sativa L cv.Nipponbare) full-length genome provided in NCBI
Sequence, the specificity amplification primer of design amplification HK73 candidate gene full length sequence, and expressed according to the pCambia1300 of selection
The feature of carrier and HK73 candidate gene sequence adds specific cleavage site (Fig. 3) at specific primer both ends.Specific design
Primer are as follows: forward primer (P1F) 5 ' end addition KpnI restriction enzyme site (GGTACC), reverse primer (P1R) 5 ' end addition SalI
Restriction enzyme site (GTCGAC), primer sequence is as follows:
P1F forward primer: 5 '-CTGGTACCAAATTTGTAATTGCCTCTAAT-3’
P1R reverse primer: 5 '-CAGTCGACGTGTATAAGGACTACTTTAG-3’
Then it extracts rice varieties force and transports No. 7 genomic DNAs of round-grained rice, and using force fortune No. 7 genomic DNAs of round-grained rice as template, utilize
Primer (P1F and P1R) the amplification HK73 candidate gene full length sequence designed above amounts to 6224bp: including HK73 genomic DNA
Overall length and its upstream and downstream sequence.Using following amplification program: 95 DEG C initial denaturation 3 minutes；98 DEG C are denaturalized 40 seconds, 55 DEG C of annealing 40
Second, 68 DEG C extend 7 minutes, 38 circulations；Last 72 DEG C re-extend 15 minutes.The target fragment for recycling PCR amplification, is connected
ZERO BLUNT TOPO carrier is connect to (Invitrogen), escherichia coli DH5a competent cell is converted, then passes through bacterium colony
PCR evaluation and screening positive colony, and send Hangzhou Shang Ya company to be sequenced positive colony.By by sequencing identification positive colony into
Row plasmid extracts, the plasmid KpnI and SalI double digestion of extraction, and recycles HK73 complementary fragment.Simultaneously using KpnI and
SalI carries out double digestion linearisation to pCambia1300, and recycles pCambia1300 skeleton, and the HK73 recycled after digestion is mutual
The pCambia1300 skeleton T4 ligase (being purchased from NEB company) recycled after sticking patch section and digestion is attached, and obtains HK73
Complementary expression vector pCAMBIA1300-HK73 (Fig. 3) is turned pCAMBIA1300-HK73 expression vector using electroporated method
Enter in agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105.
Embodiment 3. is by pCAMBIA1300-HK73 plant expression vector rice transformation callus
Method for transformation is disseminated using the Mature Embryos of Rice callus of mediated by agriculture bacillus, by recombinant expression carrier
PCAMBIA1300-HK73 is transferred in Mature Embryos of Rice, and method for transformation is as follows: (1) induction of Mature Embryos of Rice callus: will
Then mature hk73 mutant seeds decladding is shaken then with 70% alcohol surface sterilization 1-2min with 30%NaClO solution
15min is swung, and is repeated once, is then cleaned 5 times or more with aqua sterilisa.Then seed is placed in induced medium and is cultivated, 28
Degree is protected from light culture evoked callus for converting.(2) co-cultivation of Rice Callus and Agrobacterium: will implement to identify in 2
EHA105 bacterial strain containing pCAMBIA1300-HK73 expression vector is activated, is enriched with, is resuspended, and OD600=0.5- is adjusted
0.7.Callus is collected in 200ml sterilizing conical flask, the agrobacterium suspension being resuspended is poured into, disseminates callus.It impregnates
After 15-30min, suspension is outwelled, the callus disseminated is placed on aseptic filter paper and blots extra Agrobacterium bacterium solution.Then will
Callus is placed in the culture dish for being covered with aseptic filter paper, and 26 degree are protected from light culture 2-3 days.(3) it the screening of kanamycin-resistant callus tissue: co-cultures and completes
Afterwards, callus is transferred in the screening and culturing medium containing 50mg/ml hygromycin, kanamycin-resistant callus tissue is carried out under the conditions of 26-30 degree
Tissue screening.(4) differentiation of kanamycin-resistant callus tissue: the good callus of growth conditions in screening and culturing medium is placed in differential medium,
Under conditions of being placed in that 15 hours illumination/9 hour are dark, environment temperature is between 26-30 degree, differentiation culture, until differentiation is grown
Seedling.(5) break up small seedling rooting: when growing up to about 4cm or so wait break up seedling, seedling being transferred in root media, carry out
Culture of rootage.The small transplantation of seedlings for growing root system is grown in greenhouse or Transgene-safty garden.Plant is identified and is connected
It is continuous it has been observed that compared with mutant of the same period, transgenosis complementation T1For plant heading stage blade and maturity period fringe portion shape
State is restored to normal condition (Fig. 4).
It is of the invention based on a kind of rice mutant hk73 is independently obtained, construct target group based on this, go forward side by side
Row map based cloning is finally cloned into new gene HK73 and its albumen, and obtains the molecular labeling with the gene close linkage, on
Stating albumen, gene and molecular labeling can be used for molecular breeding, and above-mentioned molecular breeding can be assisted by transgenosis or molecular labeling
The ordinary operation mode well known to those skilled in the art such as selection and use carries out.
The above described is only a preferred embodiment of the present invention, be not intended to limit the present invention in any form, this
Field technical staff makes a little simple modification, equivalent variations or modification using the technology contents of the disclosure above, all falls within this hair
In bright protection scope.
Sequence table
<110>China Paddy Rice Inst
<120>protein, molecular labeling and the application of a kind of Senescence of Rice and fringe type controlling gene HK73 and its coding
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3408
<212> DNA
<213>Oryza rice (Oryza sativa)
<400> 1
atggcgcgga agaagatccg ggagtacgac tccaagcgcc tcctaaggga gcacctcaag 60
cgcctcgccg ccatcgacct ccacatcctc tccgcccagg tacaccacat ccatctacct 120
ctctgttcct cgcgcttgga tcggctcgtg gtttggtgga attccgcgtg gatctcggcg 180
ctcggggatc ggagcgtgtg gattcggcga cctctcgcgg tttggcctcg taggatcttc 240
gggggggggg ggggggggga gggggggtaa gggttggagt tctgaggtgt tttggactcg 300
gaggtgtgct ccgattaggc gaaattctgc tcaaagaggg ctcaatttcg tgttgtcaac 360
tggtgattgt agctgtggct gtagctgccg gctgatgtgg aagtatatgt gatttgttag 420
aatggttagt acctggcaac gaaatctgtt tgggtgattg ggcaaaatac atttgaattg 480
gataaaatga gaatggggaa ttgtttacag caatcgtaca cttccactgc tgctaagctt 540
ttcgcatatt tgatgcaacc tgcgatcatc ggagcatcct ttgtgctatg ggatctcatt 600
agtggtatga tggtatgatg cttttgtttg tgggttggat gggtcatgtg atgcacaagg 660
tgtgtcttag atctgttgcg atgatggtgt aaactctgtc tgaggtattg ctttattgtc 720
cttaccaagg ttttggtttc ggtgtctggt tttcctaatg aaattccact gctggtaggt 780
gaactggttg gtagcttttg acttggagtg ctctgctttt gatatttggt tacctttctt 840
ttgattttta accataatgg tagacgttta atgtgcgcta ccgaggtcca aagcttcatc 900
ttggatctga gattcaacat ctctagtttg ggttaggata atcttgctct gatggtgtag 960
gctcatgttg aatttcagta ccatctatga aaagctaagt gttgtcatat ttctaaatac 1020
cagataggaa caagcaatct attctgattt cctttgaact caaaagcaca ctcagctgtg 1080
ttagaatagc tacgcttatg ggtgaaaaag agtgaagtta gttttgatat attcttgact 1140
gcattagctt ttgttctgca gtagtttgtg tttaatagtg ccgcaatcca tgactaattt 1200
gaactgtact ttttcttagg tcacggaatc aactgatttc acagagctcg tcaaccaaga 1260
gccatggctc tcgtctatga agttggttgt gaaacccgac atgctgtttg gcaaacgtgg 1320
gaagagtggc cttgtggccc tcaacctaga tcttgctcaa gtccgccaat tcgtcaaaga 1380
gcggttggga gttgaggtag ttatacattt tcccatgctt tgcctctaaa accttgttag 1440
ttataactat tctaagctat ccggtatgcc tgttatgcag gttgagatgg gtggctgcaa 1500
ggctcctatt acaacattca tagttgagcc atttgttcca catgatcaag agtactatct 1560
ttctattgta tcagagaggc ttggttccac cattagcttc tcggagtgtg gaggtattga 1620
gatcgaggag aactgggata aggtcaagac agtttttctt cccaccgaga aagcaatgac 1680
acctgatgcg tgtgctccat tgattgccac cctaccgtta gaggtacgct tatacattgt 1740
atcaccttcc ccatgtcacg ttgttttttt tttaacatgt tgacttttct cccattctgg 1800
actcaattcc tctagtgtta gaacttatta ttgatgatac ctattttggt ctgcattagc 1860
catcttgtgc tcatgtcatt cacgtcttct gtctgaattt caggttcgga caaaaatagg 1920
tgatttcatc agaggtgtat attctgtttt ccaaggtaat tcacagttga aaaataaaaa 1980
taatctggaa ttgttgtttt ccaagataac tcagttcatt ctattgatct tctggcagac 2040
ttggatttct cattccttga gatgaatccg ttcaccatgg tgaatgggga accatatcct 2100
ctagacatga gaggagaatt ggacgacaca gctgccttta agaactttaa gaagtatgat 2160
tcaggctttt ttttttctag cttacatagt gtccagttca atcctttcac catgcttgtc 2220
atgctaacca gagcttccat ggcataggtg gggaaacatt cagttccctc tgcctttcgg 2280
aagagtcctc agcccctctg aaagctttat ccatgaactg gatgagaagg taacctcata 2340
tttctttctt tcccctctga agtctgctgc ctgttagtac atatcactta aatttggata 2400
caaattgaat ttcactgcct ctgcatgcaa aatattgaat cttgaattga ggttgatgta 2460
atttttcaga caagctcatc gctcaaattc acagtcctga acccgaaagg gcgcatttgg 2520
acaatggttg caggtggtgg tgctagtgtc atatatgctg atactgtaag tctaactcta 2580
tccagatctt ttttaggtta agttttgaag tttatcagtg ccattcacac actggacaat 2640
atcaccaggt tggagatttg ggatatgcgt cagagcttgg aaattatgca gaatacagcg 2700
gcgctcccaa cgaggaggag gttctgcagt atgctagagt ggttttggat gtaagggctc 2760
cagaggaacc ttttcggctg acagtttgat cattatgttt ccgctctgac aaaatgatat 2820
ttgaatcttt gtagtgtgcc actgctgatc ctgatggccg taagagagct cttctcattg 2880
gaggtggtat agcgaacttc actgatgtcg ctgctacatt cagtggcatc attcgagctt 2940
taagagagaa ggcaagtttc gattggatcg ttgttctgtc cccaaccact cccacttgtt 3000
gccattaaaa tcttcatcca tcttattatt gtctggcttc caaatctggt ggcaggaatc 3060
caaattgaag gctgcacgga tgaacattta cgttcggaga ggtggtccaa actaccaaac 3120
tggccttgcc aaaatgcgta cactaggtgc agaacttggt gttccaattg aggtatggac 3180
ctactggcta cttactatgt tcttccagca aaccttagct cagccatttc ctacactatt 3240
tatcagaatt cgtcagagat taactttatt agacatagga caccattgga ccatccccat 3300
gatcataacg gacgagctga attcactgaa ttgcaggtat atggaccaga ggcaacaatg 3360
actggaatct gcaagcaagc cattgattgc atcatggctg aagcataa 3408
<210> 2
<211> 423
<212> PRT
<213>Oryza rice (Oryza sativa)
<400> 2
Met Ala Arg Lys Lys Ile Arg Glu Tyr Asp Ser Lys Arg Leu Leu Arg
1 5 10 15
Glu His Leu Lys Arg Leu Ala Ala Ile Asp Leu His Ile Leu Ser Ala
20 25 30
Gln Val Thr Glu Ser Thr Asp Phe Thr Glu Leu Val Asn Gln Glu Pro
35 40 45
Trp Leu Ser Ser Met Lys Leu Val Val Lys Pro Asp Met Leu Phe Gly
50 55 60
Lys Arg Gly Lys Ser Gly Leu Val Ala Leu Asn Leu Asp Leu Ala Gln
65 70 75 80
Val Arg Gln Phe Val Lys Glu Arg Leu Gly Val Glu Val Glu Met Gly
85 90 95
Gly Cys Lys Ala Pro Ile Thr Thr Phe Ile Val Glu Pro Phe Val Pro
100 105 110
His Asp Gln Glu Tyr Tyr Leu Ser Ile Val Ser Glu Arg Leu Gly Ser
115 120 125
Thr Ile Ser Phe Ser Glu Cys Gly Gly Ile Glu Ile Glu Glu Asn Trp
130 135 140
Asp Lys Val Lys Thr Val Phe Leu Pro Thr Glu Lys Ala Met Thr Pro
145 150 155 160
Asp Ala Cys Ala Pro Leu Ile Ala Thr Leu Pro Leu Glu Val Arg Thr
165 170 175
Lys Ile Gly Asp Phe Ile Arg Gly Val Tyr Ser Val Phe Gln Asp Leu
180 185 190
Asp Phe Ser Phe Leu Glu Met Asn Pro Phe Thr Met Val Asn Gly Glu
195 200 205
Pro Tyr Pro Leu Asp Met Arg Gly Glu Leu Asp Asp Thr Ala Ala Phe
210 215 220
Lys Asn Phe Lys Lys Trp Gly Asn Ile Gln Phe Pro Leu Pro Phe Gly
225 230 235 240
Arg Val Leu Ser Pro Ser Glu Ser Phe Ile His Glu Leu Asp Glu Lys
245 250 255
Thr Ser Ser Ser Leu Lys Phe Thr Val Leu Asn Pro Lys Gly Arg Ile
260 265 270
Trp Thr Met Val Ala Gly Gly Gly Ala Ser Val Ile Tyr Ala Asp Thr
275 280 285
Val Gly Asp Leu Gly Tyr Ala Ser Glu Leu Gly Asn Tyr Ala Glu Tyr
290 295 300
Ser Gly Ala Pro Asn Glu Glu Glu Val Leu Gln Tyr Ala Arg Val Val
305 310 315 320
Leu Asp Cys Ala Thr Ala Asp Pro Asp Gly Arg Lys Arg Ala Leu Leu
325 330 335
Ile Gly Gly Gly Ile Ala Asn Phe Thr Asp Val Ala Ala Thr Phe Ser
340 345 350
Gly Ile Ile Arg Ala Leu Arg Glu Lys Glu Ser Lys Leu Lys Ala Ala
355 360 365
Arg Met Asn Ile Tyr Val Arg Arg Gly Gly Pro Asn Tyr Gln Thr Gly
370 375 380
Leu Ala Lys Met Arg Thr Leu Gly Ala Glu Leu Gly Val Pro Ile Glu
385 390 395 400
Val Tyr Gly Pro Glu Ala Thr Met Thr Gly Ile Cys Lys Gln Ala Ile
405 410 415
Asp Cys Ile Met Ala Glu Ala
420
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (12-26 F)
<400> 3
agagagcccc taaatttccg 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (12-26 R)
<400> 4
aggtacgctc acctgtggac 20
<210> 5
<211> 23
<212> DNA
<213>artificial sequence (K73-22 F)
<400> 5
acgagaggga ggagagagaa acg 23
<210> 6
<211> 22
<212> DNA
<213>artificial sequence (K73-22 R)
<400> 6
ggagagccac aggaacagat cg 22
<210> 7
<211> 20
<212> DNA
<213>artificial sequence (K73-24 F)
<400> 7
agccaaaacc aaatccaaaa 20
<210> 8
<211> 21
<212> DNA
<213>artificial sequence (K73-24 R)
<400> 8
cttcgagttg gccatattca c 21
<210> 9
<211> 20
<212> DNA
<213>artificial sequence (K73-31 F)
<400> 9
gaccttctcc ctcctccaac 20
<210> 10
<211> 19
<212> DNA
<213>artificial sequence (K73-31 R)
<400> 10
gtgtgggact tgaacacgg 19
Claims (10)
1. the protein of a kind of Senescence of Rice and fringe type controlling gene HK73 coding, it is characterised in that: the protein tool
Just like sequence shown in (A) or (B):
(A) amino acid sequence shown in Seq ID No:2；
(B) it is added in the amino acid sequence defined by (A) and/or replaces and/or lack one or several amino acid and have
The protein as derived from (A) of Senescence of Rice and fringe type adjusting function.
2. a kind of gene of protein described in coding claim 1.
3. gene according to claim 2, which is characterized in that the gene have as (a),
(b) or (c) sequence shown in:
(a) nucleotide sequence shown in Seq ID No:1；
(b) nucleotide sequence complementary with nucleotide sequence shown in Seq ID No:1；
(c) at (a) or (b) defined by add and/or replace and/or lack one or more nucleotide in nucleotide sequence and
The codified of generation has mutated gene, allele or the derivative of the protein of Senescence of Rice and fringe type adjusting function
Object.
4. a kind of plasmid containing gene described in Claims 2 or 3, plant expression vector or host cell.
5. a kind of method of adjusting and controlling rice leaf senile and fringe type, it is characterised in that: have the right to require described in 2 or 3 including apparatus
Genetic transformation rice cell, then the rice cell after conversion is cultivated into plant.
6. a kind of protein described in claim 1 or gene described in claim 2 or 3 or matter as claimed in claim 4
The application of grain, plant expression vector or host cell, it is characterised in that:
(a1) regulate and control plant leaf blade aging；
Or (a2) regulates and controls plant fringe type.
7. a kind of molecular labeling chain with Senescence of Rice and fringe type controlling gene HK73, which is characterized in that the molecule
The upstream primer and downstream primer of label are respectively as follows:
(A) upstream primer is CTGGCCTCTAGCTACAACCTTGC, downstream primer AAACTCTCGCTGGATTCGATAGG；
Or (B) upstream primer is ACGAGAGGGAGGAGAGAGAAACG, downstream primer GGAGAGCCACAGGAACAGATCG；
Or (C) upstream primer is AGCCAAAACCAAATCCAAAA, downstream primer CTTCGAGTTGGCCATATTCAC；
Or (D) upstream primer is GACCTTCTCCCTCCTCCAAC, downstream primer GTGTGGGACTTGAACACGG.
8. a kind of application of molecular labeling as claimed in claim 7, which is characterized in that the molecular labeling makes alone or in combination
With by plant molecular marker assisted selection to plant leaf blade aging and/or the progress breeding of fringe type character.
9. the application according to claim 6 or 8, which is characterized in that the fringe type is grain number per spike, branch stalk number and/or spike length.
10. the application according to claim 6 or 8, which is characterized in that the plant is gramineae plant, the grass family
Plant is rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811636548.XA CN109456396B (en) | 2018-12-29 | 2018-12-29 | Rice leaf senescence and panicle type regulation gene HK73, and protein, molecular marker and application encoded by gene HK73 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811636548.XA CN109456396B (en) | 2018-12-29 | 2018-12-29 | Rice leaf senescence and panicle type regulation gene HK73, and protein, molecular marker and application encoded by gene HK73 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109456396A true CN109456396A (en) | 2019-03-12 |
| CN109456396B CN109456396B (en) | 2021-05-25 |
Family
ID=65615646
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811636548.XA Active CN109456396B (en) | 2018-12-29 | 2018-12-29 | Rice leaf senescence and panicle type regulation gene HK73, and protein, molecular marker and application encoded by gene HK73 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109456396B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110684856A (en) * | 2019-08-08 | 2020-01-14 | 中国水稻研究所 | Molecular marker of rice flourishing related trait gene and application thereof |
| CN114574500A (en) * | 2022-03-22 | 2022-06-03 | 中国农业科学院深圳农业基因组研究所 | Clone and application of rice sword-leaf sheath and panicle whitening trait gene OsWSSP |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101421295A (en) * | 2006-02-09 | 2009-04-29 | 先锋高级育种国际公司 | Genes for enhancing nitrogen utilization efficiency in crop plants |
| CN107384947A (en) * | 2017-08-16 | 2017-11-24 | 中国水稻研究所 | The protein and application of rice citrate lyase genes ACL1 and its coding |
-
2018
- 2018-12-29 CN CN201811636548.XA patent/CN109456396B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101421295A (en) * | 2006-02-09 | 2009-04-29 | 先锋高级育种国际公司 | Genes for enhancing nitrogen utilization efficiency in crop plants |
| CN107384947A (en) * | 2017-08-16 | 2017-11-24 | 中国水稻研究所 | The protein and application of rice citrate lyase genes ACL1 and its coding |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110684856A (en) * | 2019-08-08 | 2020-01-14 | 中国水稻研究所 | Molecular marker of rice flourishing related trait gene and application thereof |
| CN110684856B (en) * | 2019-08-08 | 2021-06-04 | 中国水稻研究所 | Molecular marker of rice flourishing related trait gene and application thereof |
| CN114574500A (en) * | 2022-03-22 | 2022-06-03 | 中国农业科学院深圳农业基因组研究所 | Clone and application of rice sword-leaf sheath and panicle whitening trait gene OsWSSP |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109456396B (en) | 2021-05-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105602952B (en) | A kind of fertile gene and its application | |
| CN108239647A (en) | A kind of gene, molecular labeling and application for controlling rape plant type | |
| CN111172173B (en) | Method for reducing plant height of corn or delaying flowering | |
| CN107353332B (en) | Protein and the application of a kind of rice chloroplast developmental regulation Gene A HS1 and its coding | |
| CN103613649A (en) | Paddy rice leaf color control gene OscpSRP54 and protein encoded by same | |
| CN111235180A (en) | Method for shortening flowering phase of corn | |
| CN108503700B (en) | Rice grain type protein and coding gene and application thereof | |
| CN110903368B (en) | Gene for controlling female character of corn, kit for creating female sterile line of corn, mutant genotype and method | |
| CN109721649B (en) | Rice plant type regulation related gene, protein and application | |
| CN109234286B (en) | Rice leaf senescence regulation gene ELS6, protein coded by gene ELS6 and application of gene ELS6 | |
| CN107326035B (en) | Deubiquitinating enzyme gene UBP5 for regulating rice grain shape and leaf color and application thereof | |
| CN109456396A (en) | A kind of protein, molecular labeling and the application of Senescence of Rice and fringe type controlling gene HK73 and its coding | |
| CN101747420B (en) | Dominant dwarf rice related protein, encoding gene thereof and application | |
| CN114230648B (en) | Application of rice gene PANDA in improving plant yield | |
| CN110407921A (en) | From the plant seed development associated protein SGDW1 and its encoding gene of millet and application | |
| CN111172171B (en) | Gene for controlling plant height and flowering phase of corn and application thereof | |
| CN108864265A (en) | Application of the protein TabZIP60 in regulation plant root system development | |
| CN114703199A (en) | Plant drought resistance related gene TaCML46 and application | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN109609515B (en) | Gene for regulating growth and development of chloroplast and influencing leaf color under low-temperature stressCDE4And applications | |
| CN108690847B (en) | Application of protein nog1 in regulation and control of plant yield and grain number per ear | |
| CN112646013B (en) | Corn flowering phase gene and application thereof | |
| CN113308448B (en) | Rice leaf color regulation gene WSS1 and encoding protein and application thereof | |
| CN112080481B (en) | Spike-type related gene OsFRS5 and application and phenotype recovery method thereof | |
| CN110229801B (en) | Gene for controlling rice leaf senescence and protein coded by same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |