CN110903368B - Gene for controlling female character of corn, kit for creating female sterile line of corn, mutant genotype and method - Google Patents

Abstract

The invention discloses a gene for controlling female traits of corn, a kit for creating a female sterile line of corn, a mutant genotype and a method. The invention provides a Zm00001d000204 gene nucleic acid and amino acid sequence, a method for editing the Zm00001d000204 gene sequence by using a CRISPR-Cas9 method to realize the creation of female sterility of corn, and a corn genotype sequence with female sterility character after editing. The invention discloses a method for mutating a corn sulfate transporter encoding gene Zm00001d000204 by using a CRISPR/Cas9 method, and discovers a regulation function of the Zm00001d000204 gene on female traits of corn. By using the CRISPR/Cas9 gene editing method, a corn female sterile line can be created, so that the method is used for corn hybrid seed production and improves the seed production efficiency. The invention also provides Zm00001d000204 mutant genotypes with female sterility traits, and the mutant genotype sequences can cause female sterility of corn and can be used for creating a new female sterile line.

Description

Gene for controlling female character of corn, kit for creating female sterile line of corn, mutant genotype and method

Technical Field

The invention belongs to the field of molecular genetics, and particularly relates to a gene for controlling female traits of corn, a method for creating a female sterile line of corn, a kit and a mutant genotype. The invention provides a method for editing a Zm00001d000204 gene sequence by using CRISPR-Cas9 to create a corn female sterile line, and also discloses a genotype sequence with a corn female sterile character after editing.

Background

Fertility is a key agronomic trait of crops, and the occurrence mechanism and genetic basis of the fertility are hot research hotspots in developmental biology. Sterility can be divided into male sterility and female sterility. Female sterility is much lagged in research than male sterility due to the difficulty in identifying traits, difficulty in obtaining mutants, complex internal mechanisms and the like.

The female sterility has great application value in the aspects of genetic breeding and hybrid seed production. In recent years, some female fertility genes in rice are discovered successively (Kao Rong village, Jiang Cheng xi, Wei Xiaoxing, etc.. Rice female sterile mutant research progress and application prospect [ J ]. Zhejiang agricultural science, 2009, (5): 853 + 855. Yunnan agricultural university female sterile gene FST method for hybrid rice breeding: CN200910094988.1[ P ].2010-03-03 ], Beijing university rice female sterile gene and application thereof in hybrid rice seed production: CN201210096970.7[ P ]. 2012-10-17.). The hybrid rice combination suitable for large-scale mechanized seed production can be developed by using the rice female sterile line, the rice female fertile gene and the pollen inactivation and fluorescence screening marker gene (Hunan hybrid rice research center, a method for rapidly creating an engineering female sterile line suitable for mechanized seed production by using a genome editing technology, CN201811388237.6[ P ] 2019-03-19.).

However, the gene controlling female development and the expression and regulation mechanism of the gene related to female sterility in corn are not clear, and related female sterile lines are fewer, which seriously restricts the efficiency and application range of corn hybrid seed production. Therefore, the corn female fertility related gene and the method for artificially creating the corn female sterile line have great application prospects.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a gene for controlling female characters of corn, a kit for creating a female sterile line of corn, a mutant genotype and a method, which can be used for creating the female sterile line of corn so as to be applied to corn hybrid seed production.

In order to achieve the above object, the present invention provides a protein characterized in that: the amino acid sequence of the protein is shown as SEQ ID NO.1 or SEQ ID NO. 2; or the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 is subjected to substitution and/or deletion and/or addition of one or more amino acids, and has the same function as the sequence shown in SEQ ID NO.1 or SEQ ID NO. 2. It is generally expected that these homologous proteins from different plants or different corn material will have the same or similar function, and thus the agronomic traits of the plants may be improved using these genes as well. Further, even if the function of these proteins cannot be predicted, one of ordinary skill in the art can determine whether they have the function of controlling female fertility in plants based on the methods provided by the present invention and the prior art.

In another aspect, the present invention also provides a nucleic acid characterized in that: the nucleic acid encodes the protein described above; in some embodiments, the sequence of the nucleic acid is as set forth in SEQ ID NO.3-SEQ ID NO. 6.

In another aspect, the present invention also provides a method for creating a maize female sterile line, characterized in that: inhibiting the expression and/or activity of the protein in corn, and selecting female sterile corn plants.

In some embodiments, the method of inhibiting protein expression and/or activity comprises any one of gene editing, RNA interference, T-DNA insertion, physical or chemical mutagenesis.

In some embodiments, the above gene editing employs the CRISPR/Cas9 method.

In some embodiments, the DNA sequence of the genomic target region in maize of the CRISPR/Cas9 method described above is shown as SEQ ID No.7 or SEQ ID No. 8.

Furthermore, the invention also provides a kit for creating a corn female sterile line, which is characterized in that: including any of the following:

(1) the sequence of the sgRNA molecule is shown as SEQ ID NO.9 or SEQ ID NO. 10;

(2) a DNA molecule encoding the sgRNA;

(3) a vector expressing the sgRNA.

The method or the kit can be used for artificially creating the female sterile line in various corn materials and even other plant materials.

In another aspect, the invention also provides a corn female sterility mutant genotype, wherein the genotype sequence is shown as any one of SEQ ID NO.11-SEQ ID NO. 15. The genotype sequences can be introduced into corn materials with different genetic backgrounds in a sexual hybridization mode, so that a new corn female sterile line is created.

The invention has the following advantages and beneficial effects: the Zm00001d000204 gene and the encoded protein regulate maize female fertility has not been previously reported. The invention discloses a corn gene Zm00001d000204 mutant by using a CRISPR/Cas9 method, and discovers a regulation function of the Zm00001d000204 gene on female traits of corn. By using the CRISPR/Cas9 gene editing method and the edited mutant genotype sequence, a corn female sterile line can be created, so that the method can be applied to corn hybrid seed production.

Drawings

FIG. 1 is a physical map of the p000204_1F expression vector of the present invention. Wherein English and each abbreviation of each element are listed as follows:

RB T-DNA repeat T-DNA right border repeat

M13 fwd M13 primer sequence (Forward)

p000204_1F target gRNA sequence

Ubi promoter ubiquitin promoter

3 × FLAG tag sequence

SV40NLS Simian Virus 40 Nuclear localization Signal

Cas9 Cas9 gene sequence

Nucleoplasm in NLS nuclear localization Signal

NOS terminator of nopaline synthase

lac promoter lactose promoter

M13 rev M13 primer sequence (reverse)

lac operator lactose operon

CAP biding site CAP binding site

CaMV35S promoter (enhanced) enhanced cauliflower mosaic virus 35S promoter

BlpR-encoded Bar protein confers glufosinate tolerance in plants

CaMV35S polyA single cauliflower mosaic virus 35S polyadenylation sequence

LB T-DNA repeat T-DNA left border repeat

Kan R kanamycin resistance sequence

Ori initiation region sequence

Bom framework region sequence

pVS1 RepA pVS1 replicon

pVS1 StaA pVS1 transcriptional initiation region

FIG. 2 shows the phenotype of the plant edited by the target 1 gene of the present invention.

From left to right are: 000204-01, 000204-03, 000204-05, 000204-06, 000204-04 positive transformants were unedited and wild type controls. Photographs were taken 40 days after pollination.

FIG. 3 shows the phenotype of the target 2 gene-edited plant of the present invention.

From left to right are: 000204-2, 000204-07 positive transformants were unedited and wild type controls. Photographs were taken 40 days after pollination.

FIG. 4 shows the 24 Chinese maize inbred line materials and B73 genome sequence evolutionary tree analysis of the present invention.

FIG. 5 shows the sequence of target 1 (bold) of the present invention in different maize material.

FIG. 6 shows the sequence of target 2 (bold) of the present invention in different maize material.

Detailed Description

As used herein, "maize" is any maize plant and includes all plant varieties that can be bred with maize, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like. Unless otherwise indicated, nucleic acids are written from left to right in the 5 'to 3' direction; amino acid sequences are written from left to right in the amino to carboxy direction. Amino acids may be referred to herein by their commonly known three letter symbols or by the one letter symbols recommended by the IUPAC-IUB Biochemical nomenclature Commission. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include the numbers defining the range. As used herein, "nucleic acid" includes reference to deoxyribonucleotide or ribonucleotide polymers in either single-or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encode" or "encoded" when used in the context of a particular nucleic acid means that the nucleic acid contains the necessary information to direct translation of the nucleotide sequence into a particular protein. The information encoding the protein is represented using a codon. As used herein, "full-length sequence" in reference to a particular polynucleotide or protein encoded thereby refers to the entire nucleic acid sequence or the entire amino acid sequence having a native (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the particular protein. The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogues of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). The amino acid can be a naturally occurring amino acid, and unless otherwise limited, can include known analogs of natural amino acids that can function in a similar manner as naturally occurring amino acids.

In some embodiments, changes may be made to the nucleotide sequences of the present application to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, substitutions that do not alter the amino acid sequence of the nucleotide sequences of the present application can be made in accordance with the codon preferences disclosed for monocots, e.g., codons encoding the same amino acid sequence can be substituted with monocot preferred codons without altering the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application is replaced with a different codon that encodes the same amino acid sequence, such that the nucleotide sequence is not altered while the amino acid sequence encoded thereby is not altered. Conservative variants include those sequences that, due to the degeneracy of the genetic code, encode the amino acid sequence of one of the proteins of the embodiments. In some embodiments, a partial nucleotide sequence herein is replaced according to monocot preferred codons. One skilled in the art will recognize that amino acid additions and/or substitutions are generally based on the relative similarity of the amino acid side-chain substituents, e.g., hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituent groups having various of the foregoing properties are known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance as to suitable amino acid substitutions that do not affect the biological activity of the Protein of interest can be found in the model of the Atlas of Protein sequences and structural Atlas (Natl.biomed.Res.Foundation., Washington, D.C.) (1978), incorporated herein by reference. Conservative substitutions such as exchanging one amino acid for another with similar properties may be made. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., a genomic library or cDNA library) from a selected organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32P or other detectable marker. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on the sequence of the embodiment. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. Hybridization of the sequences may be performed under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target sequence to a detectably greater degree (e.g., at least 2-fold, 5-fold, or 10-fold over background) than to other sequences. Stringent conditions are sequence dependent and differ in different environments. By controlling the stringency of hybridization and/or the washing conditions, target sequences can be identified that are 100% complementary to the probes (homologous probe method). Alternatively, stringency conditions can be adjusted to allow some sequence mismatches in order to detect lower similarity (heterologous probe method). Typically, probes are less than about 1000 or 500 nucleotides in length. Typically, stringent conditions are conditions in which the salt concentration is less than about 1.5M Na ion, typically about 0.01M to 1.0M Na ion concentration (or other salt) at pH 7.0 to 8.3, and the temperature conditions are: when used with short probes (e.g., 10 to 50 nucleotides), at least about 30 ℃; when used with long probes (e.g., greater than 50 nucleotides), at least about 60 ℃. Stringent conditions may also be achieved by the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization at 37 ℃ using 30% to 35% formamide buffer, 1M NaCl, 1% SDS (sodium dodecyl sulfate), washing at 50 ℃ to 55 ℃ in 1 × to 2 × SSC (20 × SSC ═ 3.0 mnaacl/0.3M trisodium citrate). Exemplary moderately stringent conditions include hybridization in 40% to 45% formamide, 1.0M NaCl, 1% SDS at 37 ℃ and washing in 0.5X to 1 XSSC at 55 ℃ to 60 ℃. Exemplary high stringency conditions include hybridization in 50% formamide, 1M NaCl, 1% SDS at 37 deg.C, and a final wash in 0.1 XSSC at 60 deg.C to 65 deg.C for at least about 20 minutes. Optionally, the wash buffer may comprise about 0.1% to about 1% SDS. The duration of hybridization is generally less than about 24 hours, and typically from about 4 hours to about 12 hours. Specificity usually depends on the post-hybridization wash, the critical factors being the ionic strength and temperature of the final wash solution. The Tm (thermal melting point) of a DNA-DNA hybrid can be approximated by the formula of Meinkoth and Wahl (1984) anal. biochem.138: 267-284: tm 81.5 ℃ +16.6(logM) +0.41 (% GC) -0.61 (% formamide) -500/L; where M is the molar concentration of monovalent cations,% GC is the percentage of guanosine and cytosine nucleotides in the DNA,% formamide is the percentage formamide of the hybridization solution, and L is the base pair length of the hybrid. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Washing is typically performed at least until equilibrium is reached and a low background level of hybridization is achieved, such as for 2 hours, 1 hour, or 30 minutes. Decrease Tm by about 1 ℃ per 1% mismatch; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of desired identity. For example, if a sequence with > 90% identity is desired, the Tm can be lowered by 10 ℃. Typically, stringent conditions are selected to be about 5 ℃ lower than the Tm for the specific sequence and its complement under defined ionic strength and pH. However, under very stringent conditions, hybridization and/or washing can be performed at 4 ℃ below the Tm; hybridization and/or washing may be performed at 6 ℃ below the Tm under moderately stringent conditions; under low stringency conditions, hybridization and/or washing can be performed at 11 ℃ below the Tm.

The term "trait" refers to a physiological, morphological, biochemical or physical characteristic of a plant or a particular plant material or cell. In some cases, this property is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch or oil content of the seed or leaf, or by observing metabolic or physiological processes, for example by measuring tolerance to water deprivation or specific salt or sugar or nitrogen concentrations, or by observing the expression levels of one or more genes, or by agronomic observations such as osmotic stress tolerance or yield.

By "transgenic" is meant any cell, cell line, callus, tissue, plant part or plant whose genome has been altered by the presence of a heterologous nucleic acid (such as a recombinant DNA construct). The term "transgene" as used herein includes those initial transgenic events as well as those generated by sexual crosses or asexual propagation from the initial transgenic events and does not encompass genomic (chromosomal or extra-chromosomal) alteration by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.

In this application, the words "comprise", "comprising" or variations thereof are to be understood as embracing elements, numbers or steps in addition to those described. By "subject plant" or "subject plant cell" is meant a plant or plant cell in which the genetic modification has been effected, or a progeny cell of the plant or cell so modified, which progeny cell comprises the modification. The "control" or "control plant cell" provides a reference point for measuring the phenotypic change of the test plant or plant cell.

Negative or control plants may include, for example: (a) a wild-type plant or cell, i.e., a plant or cell having the same genotype as the starting material for the genetic alteration that produced the test plant or cell; (b) plants or plant cells having the same genotype as the starting material but which have been transformed with an empty construct (i.e., a construct that has no known effect on the trait of interest, such as a construct comprising a target gene); (c) a plant or plant cell that is a non-transformed isolate of a subject plant or plant cell; (d) a plant or plant cell that is genetically identical to the subject plant or plant cell but that has not been exposed to conditions or stimuli that induce expression of the gene of interest; or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.

Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of suitable tools and procedures for engineering or engineering amino acid sequences and potential gene sequences of proteins of agricultural interest.

The invention is described in further detail below with reference to the figures and the detailed description.

Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular cloning Manual of Sambrook et al (Sambrook J & Russell DW, Molecular cloning: a laboratory Manual,2001), or following the conditions suggested by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

Example A maize Zm00001d000204 Gene sequence and gRNA sequence

In the maizeGDB database (https:// www.maizegdb.org /), the maize Zm00001d000204(GRMZM2G444801) gene was queried, the CDS nucleic acid sequence in B73 is shown in SEQ ID NO.3, and the gene function is annotated as the sulfate transporter (sfp 5), which encodes a protein comprising 681 amino acids, the sequence of which is shown in SEQ ID NO. 1.

The sequence information of the gene in other corn materials (DK105, Mo17 and EP1) and the self-bred corn material KN5585 in the database is further inquired, and the amino acid sequence coded by the gene has extremely high similarity with B73 in the 4 corn materials and codes 681 amino acids. Wherein, the protein sequences in Mo17 and DK105 are the same as B73, and the sequences in KN5585 and EP1 have a P31A variation compared with B73, and the sequences are shown as SEQ ID NO. 2.

The CDS nucleic acid sequence of the gene has extremely high similarity with B73 in the 4 corn materials, wherein the sequence in DK105 is the same as B73, the sequences of KN5585, EP1 and Mo17 are respectively shown as SEQ ID NO.4-SEQ ID NO.6, and the similarity with the gene sequence (SEQ ID NO.3) in B73 reaches 99%.

In general, sulfate transporters function during sulfate transport. There is no published research data due to the actual function of the gene in maize. In order to clarify the function of the gene in the corn, the invention is to adopt a CRISPR/Cas9 gene editing method to mutate a Zm00001d000204 gene sequence and knock out the function of the gene in the corn.

The invention selects a maize inbred line KN5585 (an inbred line bred by Mimi Biotechnology (Jiangsu) Co., Ltd.) as a receptor for gene editing. The invention respectively selects sequences shown in SEQ ID NO.7 and SEQ ID NO.8 of gene conserved regions as target regions for CRISPR/Cas9 gene editing to synthesize gRNA sequences (the sequences are shown in SEQ ID NO.9 and SEQ ID NO. 10).

Example two corn Zm00001d000204 Gene Functions and creation of corn female sterile line Using CRISPR/Cas9 method

1. And (5) construction of a CRISPR/Cas9 gene editing vector.

The gene editing vector of the invention is GX-CPB-ZmUbi-hspCas 9. The basic vector of the vector is CPB-ZmUbi-hspCas 9. The invention obtains U6-sgRNA through Overlap PCR and clones the same into a basic vector through homologous recombination, and the specific construction process is as follows:

(1) cloning of the U6 promoter. The U6 promoter was cloned from B73, and the sequence information of the U6 promoter is shown in SEQ ID NO. 16.

(2) Design of target gRNA. Inputting the genome sequence of the receptor material KN5585 into http:// cbi.hzau.edu.cn/criprpr/carrying out target design. The DNA sequences of two preferred target regions of the invention are shown in SEQ ID NO.7 or SEQ ID NO. 8. The sgRNA framework sequence is obtained by artificial synthesis, and the sequence information is shown in SEQ ID NO.9 and SEQ ID NO. 10.

(3) U6-sgRNA was obtained by Overlap PCR. The primer pair pU6F1/pU6R is used for amplifying the U6 promoter of the first target, and the product length is 515 bp; the primer pair p0204-1F (3F)/pgRR1 is used for amplifying the sgRNA of the first target, and the product length is 127 bp; the primer pair pU6F1/gRR1 was used for performing the Overlap PCR step 2 amplification (U6-sgRNA), and the product length was 634 bp. U6 and sgRNA are respectively amplified in the 1 st step of the Overlap PCR, and PCR products are respectively diluted by 50 times and then mixed to be used as a template for carrying out the 2 nd step amplification of the Overlap PCR. And (5) electrophoresis gel cutting recovery and sequencing of the amplification product to confirm the sequence. The Overlap PCR system and conditions were as follows: the 15. mu.L reaction in step 1 of the Overlap PCR was as follows, template DNA (U6 or sgRNA,. gtoreq.30 ng/. mu.L): 0.5. mu.L, Primer F/R: 1.2 μ L each, sterile ddH 2O: 3.7 μ L,2 × phanta max Buffer: 7.5 μ L, dNTP mix: 0.6. mu.L, Phanta enzyme (product No.: P505-d1/d2/d 3): 0.3. mu.L. The reaction system in step 2 of the Overlap PCR was a 30. mu.L system. U6 pipetted 1. mu.L, diluted with 49. mu.L ddH 2O; sgRNA aspirated at 1. mu.L, diluted with 49. mu.L of ddH2O, aspirated at 10. mu.L each, and mixed well. The method comprises the following specific steps: mixed template DNA (U6+ sgRNA): 1.5 μ L, Primer F/R: 2.4 μ L each, sterile ddH 2O: 6.9 μ L,2 × phanta maxBuffer: 15 μ L, dNTP mix: 1.2. mu.L, Phanta enzyme: 0.6. mu.L. The Overlap PCR program was as follows: (1)94 ℃ for 5 minutes, (2)94 ℃ for 30 seconds, (3)62 ℃ for 35 seconds, (4)72 ℃ for 30 seconds, and the (5) th step is a cycle of 32 times from the (2) step to the (4) step, (6)72 ℃ for 10 minutes, and (7)25 ℃ for 5 minutes. The primer sequences required for vector construction are shown in Table 1.

TABLE 1 primer sequences required for vector construction

(4) The construction into a backbone vector is carried out by recombinant cloning. The CPB-Ubi-hspcas9 vector was digested with Hind III and recovered. Both U6-gRNA and the vector were ligated by homologous recombination. Before reaction liquid preparation, the concentration of each Overlap product is ensured to be close to be consistent, and a 20 mu L homologous recombination system comprises the following steps: cas Hind III: 3 μ L, T-1F Overlap: 1 μ L, sterile ddH 2O: 10 μ L, 5 × CE MultiS buffer: 4 μ L, Exnase MultiS (product No.: C113-01/02): 2 μ L.

As shown in FIG. 1, the physical map of the expression vector p000204_1F constructed by the single target gRNA sequence 000204_1F, the marker gene Cas9 and bar of the target gene Zm00001d000204 and the skeleton vector pCAMBIA is shown. The physical map of an expression vector p000204_2F constructed by the single target gRNA sequence 000204_2F is the same as p000204_1F except the difference of gRNA sequences.

2. Agrobacterium-mediated genetic transformation of maize and creation of transformants

The vector is transferred into agrobacterium EHA105 by an electric shock method, and PCR is carried out for identification. Taking freshly peeled young embryos of a maize inbred line KN5585 with the diameter of about 1mm as a material, putting the peeled maize embryos into a 2mL plastic centrifuge tube containing 1.8mL of suspension, and treating about 150 immature young embryos within 30 min; the suspension was aspirated, and 1.0mL of Agrobacterium suspension was added to the remaining corn embryos in the tube and allowed to stand for 5 min. The young embryos in the centrifuge tube are suspended and poured onto a co-culture medium, and the surplus agrobacterium liquid on the surface is sucked by a liquid transfer device and is cultured for 3 days in the dark at the temperature of 23 ℃. After co-cultivation, the young embryos were transferred to a resting medium, incubated in the dark at 28 ℃ for 6 days, placed on a selection medium containing 5mg/L of Bialaphos, and initially cultured for 2 weeks, followed by 2 weeks on a selection medium containing 8mg/L of LBialaphos. Transferring the resistant callus to a differentiation culture medium, culturing for 2 weeks at 25 ℃ and 5000lx under illumination, transferring the differentiated plantlet to a rooting culture medium, and culturing under illumination at 25 ℃ and 5000lx until the plantlet roots; transferring the plantlets into small pots for growth, transplanting the plantlets into a greenhouse after a certain growth stage, and harvesting progeny seeds after 3-4 months.

3. Mutation result detection of CRISPR/Cas9

The research adopts a CTAB method to extract the DNA of the corn leaves, and the specific method is as follows: weighing about 0.1g of leaves, placing into a centrifuge tube, adding 600 μ L CTAB extraction buffer solution, 5 μ L RNase A, shaking for dispersion, and water bathing at 65 deg.C for 0.5hr while gently shaking for 2-3 times; adding equal volume of chloroform/Tris-saturated phenol (1:1, v/v), mixing, and shaking gently for 10 min; centrifuging at 4 deg.C 10000rpm for 20 min; transfer supernatant to a new tube and add 1/10 volumes of 3M sodium acetate (pH 5.2), 0.6-1 volumes of cold isopropanol; shaking gently and mixing until flocculent precipitate appears; centrifuging at 4 deg.C 10000rpm for 10 min; discarding the supernatant, and washing the precipitate with 70% ethanol by volume percentage for 2 times; air-dried, and 50. mu.L of 1 XTE was added to dissolve the precipitate, which was stored at-20 ℃. The DNA concentration was measured by Nanodrop 2000 and diluted to 10ng/L for use as a PCR template.

PCR primers were designed based on the Zm00001d000204 gene sequence.

(1) Detecting a target: 000204_ 1F; the size of the product is as follows: 999 bp; the primer sequence is as follows:

000204_1F:5’-GCCCAGAATATAGGCAGGCA-3’；

000204_1R:5’-GCCAAATCGTAAGCTCAACCT-3’。

(2) detecting a target: 000204_ 2F; the size of the product is as follows: 899 bp; the primer sequence is as follows:

000204_2F:5’-GACCTTTGCGTCCATCAAC-3’；

000204_2R:5’-CTCCTGTTCATTCGTAACATGCA-3’。

genomic DNA was extracted and amplified according to the following PCR parameters:

reaction system: 15 μ L MIX conventional PCR system, 1 μ L forward primer, 1 μ L reverse primer,2 μ L DNA, 3.5 μ L H2O, 7.5 μ L vazyme, 2 × taq MIX.

Reaction procedure: conventional PCR: annealing at 58 ℃, extending for 1 minute and circulating for 35 rounds.

The DNA sequence of the target region of 10 transformants was analyzed by sequencing to determine whether the target region had an editing mutation. The sequences of the target regions of 5 of the transformants were changed, and the sequences before and after editing are shown in Table 2. 000204-01, 000204-03, 000204-05, 000204-06, have a deletion mutation or single base insertion mutation in the target 1 region, whereas 000204-2 has a deletion mutation in the target 2 DNA region.

TABLE 25 editing of the sequences after DNA mutation in the target region of transformants

Target sequences are underlined, "-" indicates base deletion, and bold indicates base insertion.

Clustal alignment of the edited amino acid sequences of 5 positive transformants revealed that the nucleotides encoded by the mutated lines 000204-01, 000204-03, 000204-05 and 000204-06 were frame-shifted due to base deletion or insertion in the target 1 region and early amino acid termination thereafter, compared with wild-type and unedited WT; deletion of the target 2 region of the mutated line 000204-02 results in a frame shift mutation of its amino acids, and subsequent premature termination of the amino acids. Therefore, the function of Zm00001d000204 protein in these transformants was deleted.

4. Phenotypic analysis of Gene editing transformants

The plants with the changed gene sequences and the frame shift mutation are selected for phenotype observation, the fact that the plants with the gene editing can not normally fruit under the conditions of self-crossing and open pollination (growing place: greenhouse of Huazhong university of agriculture) is found, the phenotype photos of the edited plants are shown in figures 2 and 3, the gene controls the female characters of the corn, and the mutants created by the gene editing are female sterile mutants. The wild corn can be normally fruited by pollinating the wild corn with the mutant pollen, which indicates that the male ear fertility is not influenced. Taking 000204-02 strain as an example, F1 is harvested and sown, powder can be normally scattered after ear emergence, normal fructification can be realized by bagging and selfing, and F2 seeds are harvested for single ear. And (3) sowing F2 seeds obtained by single ear selfing in rows, carrying out natural pollination to identify fertility, and counting 28 plants, wherein 20 plants are normally fruited, 8 plants are not fruited and basically meet 3:1 separation, which indicates that the sterile character is controlled by a single recessive gene.

Example three sequences of maize Zm00001d000204 Gene in different maize inbreds and creating maize female sterile lines under different genetic backgrounds

1. The mutant genotypes were introduced into other maize material by means of backcross transfer.

The mutant obtained by the invention and the functional marker (SEQ ID NO.3-SEQ ID NO.8) of the mutant gene can be used for various molecular marker-assisted selection methods, the mutant genotype is transferred to other corn genetic backgrounds in a hybridization backcross mode, and the general flow is as follows:

and (3) hybridization: taking the mutant strain as a male parent, and hybridizing the mutant strain and a receptor corn material as a female parent to obtain F1 seeds; f1 is obtained after the first round of backcross, F1 plants are obtained after sowing, and the F1 plants are crossed with the recurrent parent to obtain BC1 seeds; BC1 sterility gene selection (foreground selection): sowing BC1 seeds to obtain not less than 500 seedlings, collecting each single leaf blade in the seedling stage, extracting DNA according to the method described in the second embodiment, carrying out amplification, electrophoresis and sequencing by using corresponding primer pairs, selecting the single plant with heterozygous genotype to continue planting, and discarding the single plant with homozygous wild type;

BC1 background selection: identifying individuals selected from a group (e.g., 100, or 200, etc.) of molecular markers (including but not limited to SSR, INDEL, SNP, EST, RFLP, AFLP, RAPD, SCAR, etc. type markers) which are polymorphic between the mutant and the recurrent parent and are uniformly distributed on the genome, and selecting materials with high similarity (e.g., greater than 88% similarity, or 2% selection rate, etc.) with the recurrent parent; the same method can be used for molecular marker-assisted selection in each subsequent backcross. Individuals homozygous for 100% background were finally selected. If the genotype of the selected single plant is homozygous mutant, the single plant is the final target material and can be further crossed with a recurrent parent or other corn materials to preserve the material. If the selected single plant is heterozygous genotype, the selected single plant can be directly used for storing germplasm or sterile plants obtained by selfing are used for crossbreeding or seed production.

2. Direct mutation of the Zm00001d000204 gene in other maize material.

The invention obtains Zm00001d000204 genome sequences (Chr 9-20343120.. 20348157 intervals) in 24 maize backbone inbred lines by a genome re-sequencing method. The 24 maize backbone inbred lines are 5237, E28, Q1261, Chang 7-2, Dan 340, yellow C, yellow wild 4, Huangzao four, Skyline 4, self 330, heddle 3, Lx9801, west 502, 81515, F349, H21, Ji 853, Ji 53, Lu 28, Yuanfu yellow, Shuang741, K12, agriculture line 110 and heddle 31 respectively, and the gene is relatively conserved and has little sequence change in each maize material through Clustal alignment analysis (figure 4). In addition, two gene editing targets were designed to be located in the conserved regions of the sequence (fig. 5, fig. 6), and the two targets can be used to edit the Zm00001d000204 gene in different maize materials by the method of example two, thereby creating maize female sterile lines with different genetic backgrounds.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in Huazhong, Kyoto Biotechnology (Jiangsu) Ltd

<120> a gene for controlling female traits of corn and a kit, mutant genotype and method for creating female sterile line of corn

<130>1

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>681

<212>PRT

<213> corn (Zea mays L.)

<400>1

Met Val Val Asn Asn Lys Val Asp Ser Leu Ser Tyr Asp Val Glu Ala

1 5 10 15

Pro Pro Pro Ser Ala Ala Gly Ala Ala Ala Gly Gln Ala Pro Pro Pro

20 25 30

Ala Ser Pro Ala Pro Ala Pro Ala Pro Ala Thr His Ala Pro Val Thr

35 40 45

Arg Glu Gly Gly Ala Ala Ser Val Leu Glu Leu His Lys Val Ser Leu

50 55 60

Pro Glu Arg Arg Thr Thr Ala Lys Ala Leu Arg Gln Arg Leu Ala Glu

65 70 75 80

Val Phe Phe Pro Asp Asp Pro Leu His Gln Phe Lys Asn Gln Ser Ser

85 90 95

Ala Arg Arg Leu Val Leu Ala Leu His Tyr Phe Phe Pro Ile Phe Gln

100 105 110

Trp Gly Ser Ala Tyr Ser Pro Arg Leu Leu Arg Ser Asp Leu Val Ala

115 120 125

Gly Leu Thr Ile Ala Ser Leu Ala Ile Pro Gln Gly Ile Ser Tyr Ala

130 135 140

Lys Leu Ala Asn Leu Pro Pro Ile Val Gly Leu Tyr Ser Ser Phe Val

145 150 155 160

Pro Pro Leu Ile Tyr Ala Leu Leu Gly Ser Ser Arg Asp Leu Ala Val

165 170 175

Gly Pro Val Ser Ile Ala Ser Leu Val Met Gly Ser Met Leu Arg Asp

180 185 190

Ala Val Ser Pro Asp Glu Gln Pro Leu Leu Tyr Leu Gln Leu Ala Phe

195 200 205

Thr Ala Thr Phe Phe Ala Gly Val Phe Gln Ala Ser Leu Gly Phe Leu

210 215 220

Arg Leu Gly Phe Ile Val Asp Phe Leu Ser Lys Ala Thr Leu Thr Gly

225 230 235 240

Phe Met Gly Gly Ala Ala Val Ile Val Ser Leu Gln Gln Leu Lys Gly

245 250 255

Leu Leu Gly Ile Ser His Phe Thr Ser His Met Gly Phe Leu Asp Val

260 265 270

Met Arg Ser Val Val Asn Arg His Asp Glu Trp Lys Trp Gln Thr Ile

275 280 285

Val Met Gly Ser Ala Phe Leu Ala Ile Leu Leu Leu Thr Arg Gln Ile

290 295 300

Ser Ala Arg Asn Pro Lys Leu Phe Trp Val Ser Ala Gly Ala Pro Leu

305 310 315 320

Ala Ser Val Ile Ile Ser Thr Ile Leu Ser Phe Ile Trp Lys Ser Pro

325 330 335

Ser Ile Ser Val Ile Gly Ile Leu Pro Arg Gly Val Asn Pro Pro Ser

340 345 350

Ala Asn Met Leu Ser Phe Ser Gly Ser Tyr Val Ala Leu Thr Ile Lys

355 360 365

Thr Gly Ile Met Thr Gly Ile Leu Ser Leu Thr Glu Gly Ile Ala Val

370 375 380

Gly Arg Thr Phe Ala Ser Ile Asn Asn Tyr Gln Val Asp Gly Asn Lys

385 390 395 400

Glu Met Met Ala Ile Gly Leu Met Asn Met Ala Gly Ser Cys Ala Ser

405 410 415

Cys Tyr Val Thr Thr Gly Ser Phe Ser Arg Ser Ala Val Asn Tyr Ser

420 425 430

Ala Gly Cys Arg Thr Ala Leu Ser Asn Val Val Met Ala Ala Ala Val

435 440 445

Leu Val Thr Leu Leu Phe Leu Met Pro Leu Phe His Tyr Thr Pro Asn

450 455 460

Val Ile Leu Ala Ala Ile Ile Ile Thr Ala Val Val Gly Leu Val Asp

465 470 475 480

Val Arg Gly Ala Ala Arg Leu Trp Lys Val Asp Lys Leu Asp Phe Leu

485 490 495

Ala Cys Val Ala Ala Phe Leu Gly Val Leu Leu Val Ser Val Gln Thr

500 505 510

Gly Leu Gly Val Ala Val Gly Ile Ser Leu Phe Lys Val Leu Leu Gln

515 520 525

Val Thr Arg Pro Asn Val Val Val Glu Gly Leu Val Pro Gly Thr Gln

530 535 540

Ser Tyr Arg Ser Val Ala Gln Tyr Arg Glu Ala Val Arg Val Pro Gly

545 550 555 560

Phe Leu Val Val Gly Val Glu Ser Ala Val Tyr Phe Ala Asn Ser Met

565 570 575

Tyr Leu Val Glu Arg Val Met Arg Tyr Leu Arg Asp Glu Glu Glu Arg

580 585 590

Ala Leu Lys Ser Asn His Pro Ser Ile Arg Cys Val Val Leu Asp Met

595 600 605

Gly Ala Val Ala Ala Ile Asp Thr Ser Gly Leu Asp Ala Leu Ser Glu

610 615 620

Leu Lys Lys Val Leu Asp Lys Arg Asn Ile Glu Leu Val Leu Ala Asn

625 630 635 640

Pro Val Gly Ser Val Ala Glu Arg Met Phe Asn Ser Ala Val Gly Glu

645 650 655

Ser Phe Gly Ser Gly Arg Leu Phe Phe Ser Val Ala Glu Ala Val Ala

660 665 670

Ala Gly Ala Cys Lys Ala Ala Gln Pro

675 680

<210>2

<211>681

<212>PRT

<213> corn (Zea mays L.)

<400>2

Met Val Val Asn Asn Lys Val Asp Ser Leu Ser Tyr Asp Val Glu Ala

1 5 10 15

Pro Pro Pro Ser Ala Ala Gly Ala Ala Ala Gly Gln Ala Pro Ala Pro

20 25 30

Ala Ser Pro Ala Pro Ala Pro Ala Pro Ala Thr His Ala Pro Val Thr

35 40 45

Arg Glu Gly Gly Ala Ala Ser Val Leu Glu Leu His Lys Val Ser Leu

50 55 60

Pro Glu Arg Arg Thr Thr Ala Lys Ala Leu Arg Gln Arg Leu Ala Glu

65 70 75 80

Val Phe Phe Pro Asp Asp Pro Leu His Gln Phe Lys Asn Gln Ser Ser

85 90 95

Ala Arg Arg Leu Val Leu Ala Leu His Tyr Phe Phe Pro Ile Phe Gln

100 105 110

Trp Gly Ser Ala Tyr Ser Pro Arg Leu Leu Arg Ser Asp Leu Val Ala

115 120 125

Gly Leu Thr Ile Ala Ser Leu Ala Ile Pro Gln Gly Ile Ser Tyr Ala

130 135 140

Lys Leu Ala Asn Leu Pro Pro Ile Val Gly Leu Tyr Ser Ser Phe Val

145 150 155 160

Pro Pro Leu Ile Tyr Ala Leu Leu Gly Ser Ser Arg Asp Leu Ala Val

165 170 175

Gly Pro Val Ser Ile Ala Ser Leu Val Met Gly Ser Met Leu Arg Asp

180 185 190

Ala Val Ser Pro Asp Glu Gln Pro Leu Leu Tyr Leu Gln Leu Ala Phe

195 200 205

Thr Ala Thr Phe Phe Ala Gly Val Phe Gln Ala Ser Leu Gly Phe Leu

210 215 220

Arg Leu Gly Phe Ile Val Asp Phe Leu Ser Lys Ala Thr Leu Thr Gly

225 230 235 240

Phe Met Gly Gly Ala Ala Val Ile Val Ser Leu Gln Gln Leu Lys Gly

245 250 255

Leu Leu Gly Ile Ser His Phe Thr Ser His Met Gly Phe Leu Asp Val

260 265 270

Met Arg Ser Val Val Asn Arg His Asp Glu Trp Lys Trp Gln Thr Ile

275 280 285

Val Met Gly Ser Ala Phe Leu Ala Ile Leu Leu Leu Thr Arg Gln Ile

290 295 300

Ser Ala Arg Asn Pro Lys Leu Phe Trp Val Ser Ala Gly Ala Pro Leu

305 310 315 320

Ala Ser Val Ile Ile Ser Thr Ile Leu Ser Phe Ile Trp Lys Ser Pro

325 330 335

Ser Ile Ser Val Ile Gly Ile Leu Pro Arg Gly Val Asn Pro Pro Ser

340 345 350

Ala Asn Met Leu Ser Phe Ser Gly Ser Tyr Val Ala Leu Thr Ile Lys

355 360 365

Thr Gly Ile Met Thr Gly Ile Leu Ser Leu Thr Glu Gly Ile Ala Val

370 375 380

Gly Arg Thr Phe Ala Ser Ile Asn Asn Tyr Gln Val Asp Gly Asn Lys

385 390 395 400

Glu Met Met Ala Ile Gly Leu Met Asn Met Ala Gly Ser Cys Ala Ser

405 410 415

Cys Tyr Val Thr Thr Gly Ser Phe Ser Arg Ser Ala Val Asn Tyr Ser

420 425 430

Ala Gly Cys Arg Thr Ala Leu Ser Asn Val Val Met Ala Ala Ala Val

435 440 445

Leu Val Thr Leu Leu Phe Leu Met Pro Leu Phe His Tyr Thr Pro Asn

450 455 460

Val Ile Leu Ala Ala Ile Ile Ile Thr Ala Val Val Gly Leu Val Asp

465 470 475 480

Val Arg Gly Ala Ala Arg Leu Trp Lys Val Asp Lys Leu Asp Phe Leu

485 490 495

Ala Cys Val Ala Ala Phe Leu Gly Val Leu Leu Val Ser Val Gln Thr

500 505 510

Gly Leu Gly Val Ala Val Gly Ile Ser Leu Phe Lys Val Leu Leu Gln

515 520 525

Val Thr Arg Pro Asn Val Val Val Glu Gly Leu Val Pro Gly Thr Gln

530 535 540

Ser Tyr Arg Ser Val Ala Gln Tyr Arg Glu Ala Val Arg Val Pro Gly

545 550 555 560

Phe Leu Val Val Gly Val Glu Ser Ala Val Tyr Phe Ala Asn Ser Met

565 570 575

Tyr Leu Val Glu Arg Val Met Arg Tyr Leu Arg Asp Glu Glu Glu Arg

580 585 590

Ala Leu Lys Ser Asn His Pro Ser Ile Arg Cys Val Val Leu Asp Met

595 600 605

Gly Ala Val Ala Ala Ile Asp Thr Ser Gly Leu Asp Ala Leu Ser Glu

610 615 620

Leu Lys Lys Val Leu Asp Lys Arg Asn Ile Glu Leu Val Leu Ala Asn

625 630 635 640

Pro Val Gly Ser Val Ala Glu Arg Met Phe Asn Ser Ala Val Gly Glu

645 650 655

Ser Phe Gly Ser Gly Arg Leu Phe Phe Ser Val Ala Glu Ala Val Ala

660 665 670

Ala Gly Ala Cys Lys Ala Ala Gln Pro

675 680

<210>3

<211>2046

<212>DNA

<213>unkown

<400>3

atggtcgtga acaacaaggt ggacagcctg tcgtacgacg tcgaggcgcc gccgccctct 60

gccgccggcg ccgccgcggg gcaagcgcca ccgccggcgt cgccagctcc ggcgccggca 120

ccggcaaccc acgcgcccgt gacgcgggaa ggcggcgcgg cgtcggtgct ggagctgcac 180

aaggtgtcgc tgccggagcg gcggacgacg gcgaaggcgc tgcggcagcg cctggccgag 240

gtgttcttcc cggacgaccc gctgcaccag ttcaagaacc agtcgtcggc gcggcgcctc 300

gtgctggcgc tgcactactt cttccccatc ttccagtggg ggtccgccta cagcccgcgc 360

ctcctgcgct ccgacctcgt cgccggcctc accattgcca gcctcgccat cccgcaggga 420

atcagctacg ccaagctcgc caacctgccg ccaatcgttg gcctatattc cagcttcgtg 480

ccgccgctca tctacgcgct gctggggagc tcgcgggacc tggcggtggg gccggtgtcc 540

atcgcgtcgc tggtgatggg gtccatgctc cgggacgccg tgtcgccgga cgagcagccg 600

ctcctctacc tgcagctggc cttcaccgcc accttcttcg ccggcgtctt ccaggcgtcc 660

ctgggattcc tcaggctggg cttcatcgtg gacttcctgt ccaaggcgac gctgacgggc 720

ttcatgggcg gcgccgccgt catcgtgtcg ctgcagcagc tcaagggcct gctcggcatc 780

tcccacttca cctcccacat gggattcctc gacgtcatgc gctccgtcgt caaccgccac 840

gacgagtgga agtggcagac gatcgtcatg ggctccgcct tcctcgccat cctcctcctc 900

acgcgccaaa tcagcgccag gaatccaaag cttttctggg tatcagcagg tgctcccctg 960

gcgtcggtga tcatctccac catcctctcc ttcatctgga aatcccccag catcagtgtt 1020

atcggcatcc tccccagggg agtgaaccct ccttcggcga acatgctcag cttcagcggc 1080

tcctacgtgg cgctgacgat caaaaccggg atcatgacag gcatcctgtc cttaacagaa 1140

gggatcgcag tgggcaggac ctttgcgtcc atcaacaact accaggtgga cgggaacaag 1200

gagatgatgg cgatcgggct gatgaacatg gcgggctcct gcgcctcctg ctacgtgacg 1260

acggggtcct tctcccggtc ggcggtgaac tacagcgcgg gctgcaggac ggcgttgtcc 1320

aacgtcgtga tggcggcggc ggtgctggtg acgctgctgt tcctcatgcc gctgttccac 1380

tacaccccga acgtgatcct ggcggcgatc atcatcacgg cggtggtggg gctggtggac 1440

gtgcgcggcg ccgccaggct gtggaaggtg gacaagctgg acttcctggc gtgcgtggcg 1500

gcgttcctcg gcgtgctgct ggtgtccgtg cagacgggcc tgggcgtcgc cgtcggcatc 1560

tcgctcttca aggtcctgct gcaggtcacc cgccccaacg tcgtggtgga gggcctcgtc 1620

ccggggacgc agagctaccg cagcgtggcg cagtaccgcg aggccgtccg cgtgccgggc 1680

ttcctcgtcg tcggcgtcga gtccgccgtc tacttcgcca actccatgta cctggtggag 1740

cgggtcatgc gctacctccg cgacgaggag gagcgcgcgc tcaagtccaa ccacccctcc 1800

atccgatgcg tcgtcctcga catgggcgcc gtcgcggcga tcgacaccag cggtctagac 1860

gcgctgtccg agctcaagaa agtcctggac aaaagaaaca tcgagctggt gcttgccaac 1920

ccggtggggt cggtggcgga gaggatgttc aactcggcgg tgggcgagag cttcgggtcg 1980

ggccgcctct tcttcagcgt agcggaggcc gtcgcggcgg gggcgtgcaa agcggcgcag 2040

ccctga 2046

<210>4

<211>2046

<212>DNA

<213>unkown

<400>4

atggtcgtga acaacaaggt ggacagcctg tcgtacgacg tcgaggcgcc gccgccctct 60

gccgccggcg ccgccgcggg gcaagcgcca gcgccggcgt cgccagcgcc ggcgccggct 120

ccggcaaccc acgcgcccgt gacgcgggag ggcggcgcgg cgtcggtgct ggagctgcac 180

aaggtgtcgc tgccggagcg gcggacgacg gcgaaggcgc tgcggcagcg cctggccgag 240

gttttcttcc cggacgaccc gctgcaccag ttcaagaacc agtcgtcggc gcggcgcctc 300

gtgctggcgc tgcactactt cttccccatc ttccagtggg ggtccgccta cagcccgcgc 360

ctcctgcgct ccgacctcgt cgccggcctc accattgcca gcctcgccat cccgcaggga 420

atcagctacg ccaagctcgc caacctgccg ccaatcgttg gcctatattc cagcttcgtg 480

ccgccgctca tctacgcgct gctggggagc tcgcgggacc tggcggtggg gccggtgtcc 540

atcgcgtcgc tggtgatggg gtccatgctc cgggacgccg tgtcgccgga cgagcagccg 600

ctcctctacc tgcagctggc cttcaccgcc actttcttcg ccggcgtctt ccaggcgtcc 660

ctgggattcc tcaggctggg cttcatcgtg gacttcctgt ccaaggcgac gctgacgggc 720

ttcatgggcg gcgccgccgt catcgtgtcg ctacagcagc tcaagggcct gctcggcatc 780

tcccacttca cctcccacat gggattcctc gacgtcatgc gctccgtcgt caaccgccac 840

gacgagtgga agtggcagac gatcgtcatg ggctccgcct tcctcgccat cctcctcctc 900

acgcgccaaa tcagcgccag gaatccaaag cttttctggg tatcagcagg tgctcccctg 960

gcgtcggtga tcatctccac catcctctcc ttcatctgga aatcccctag catcagtgtt 1020

attggcatcc tccccagggg agtgaaccct ccttcggcga acatgctcag cttcagcggc 1080

tcctacgtgg cgctgacgat caaaaccggg atcatgacag gcatcctgtc cttaacagaa 1140

gggattgcag tgggcaggac cttcgcgtcc atcaacaact accaggtgga cgggaacaag 1200

gagatgatgg cgatcgggct gatgaacatg gcgggctcct gcgcctcctg ctacgtgacg 1260

acggggtcct tctcccggtc ggcggtgaac tacagcgcgg gctgcaggac ggcgctgtcc 1320

aacgtcgtga tggcggcggc ggtgctggtg acgctgctgt tcctcatgcc gctgttccac 1380

tacaccccga acgtgatcct ggcggcgatc atcatcacgg cggtggtggg gctggtggac 1440

gtgcgaggcg ccgccaggct gtggaaggtg gacaagctgg acttcctggc gtgcgtggcg 1500

gcgttcctcg gcgtgctgct ggtgtccgtg cagacgggcc tgggcgtcgc cgtcggcatc 1560

tcgctcttca aggtcctgct gcaggtcacc cgccccaacg tcgtggtgga gggcctcgtc 1620

ccggggacgc agagctaccg cagcgtggcg cagtaccgcg aggccgtccg cgtgccgggc 1680

ttcctcgtcg tcggcgtcga gtccgccgtc tacttcgcca actccatgta cctggtggag 1740

cgggtcatgc gctacctccg cgacgaggag gagcgcgcgc tcaagtccaa ccacccctcc 1800

atccgatgcg tcgtcctcga catgggcgcc gtcgcggcga tcgacacgag cggtctagac 1860

gcgctgtccg agctcaagaa agtcctggac aaaagaaaca tcgagctggt gcttgccaac 1920

ccggtggggt cggtggcgga gaggatgttc aactcggcgg tgggcgagag cttcgggtcg 1980

ggccgcctct tcttcagcgt agcggaggcc gtcgcggcgg gggcgtgcaa agcggcgcag 2040

ccctga 2046

<210>5

<211>2046

<212>DNA

<213>unkown

<400>5

atggtcgtga acaacaaggt ggacagcctg tcgtacgacg tcgaggcgcc gccgccctct 60

gccgccggcg ccgccgcggg gcaagcgcca gcgccggcgt cgccagcgcc ggcgccggct 120

ccggcaaccc acgcgcccgt gacgcgggag ggcggcgcgg cgtcggtgct ggagctgcac 180

aaggtgtcgc tgccggagcg gcggacgacg gcgaaggcgc tgcggcagcg cctggccgag 240

gttttcttcc cggacgaccc gctgcaccag ttcaagaacc agtcgtcggc gcggcgcctc 300

gtgctggcgc tgcactactt cttccccatc ttccagtggg ggtccgccta cagcccgcgc 360

ctcctgcgct ccgacctcgt cgccggcctc accattgcca gcctcgccat cccgcaggga 420

atcagctacg ccaagctcgc caacctgccg ccaatcgttg gcctatattc cagcttcgtg 480

ccgccgctca tctacgcgct gctggggagc tcgcgggacc tggcggtggg gccggtgtcc 540

atcgcgtcgc tggtgatggg gtccatgctc cgggacgccg tgtcgccgga cgagcagccg 600

ctcctctacc tgcagctggc cttcaccgcc accttcttcg ccggcgtctt ccaggcgtcc 660

ctgggattcc tcaggctggg cttcatcgtg gacttcctgt ccaaggcgac gctgacgggc 720

ttcatgggcg gcgccgccgt catcgtgtcg ctgcagcagc tcaagggcct gctcggcatc 780

tcccacttca cctcccacat gggattcctc gacgtcatgc gctccgtcgt caaccgccac 840

gacgagtgga agtggcagac gatcgtcatg ggctccgcct tcctcgccat cctcctcctc 900

acgcgccaaa tcagcgccag gaatccaaag cttttctggg tatcagcagg tgctcccctg 960

gcgtcggtga tcatctccac catcctctcc ttcatctgga aatcccccag catcagtgtt 1020

atcggcatcc tccccagggg agtgaaccct ccttcggcga acatgctcag cttcagcggc 1080

tcctacgtgg cgctgacgat caaaaccggg atcatgacag gcatcctgtc cttaacagaa 1140

gggatcgcag tgggcaggac ctttgcgtcc atcaacaact accaggtgga cgggaacaag 1200

gagatgatgg cgatcgggct gatgaacatg gcgggctcct gcgcctcctg ctacgtgacg 1260

acggggtcct tctcccggtcggcggtgaac tacagcgcgg gctgcaggac ggcgctgtcc 1320

aacgtcgtga tggcggcggc ggtgctggtg acgctgctgt tcctcatgcc gctgttccac 1380

tacaccccga acgtgatcct ggcggcgatc atcatcacgg cggtggtggg gctggtggac 1440

gtgcgcggcg ccgccaggct gtggaaggtg gacaagctgg acttcctggc gtgcgtggcg 1500

gcgttcctcg gcgtgctgct ggtgtccgtg cagacgggcc tgggcgtcgc cgtcggcatc 1560

tcgctcttca aggtcctgct gcaggtcacc cgccccaacg tcgtggtgga gggcctcgtc 1620

ccggggacgc agagctaccg cagcgtggcg cagtaccgcg aggccgtccg cgtgccgggc 1680

ttcctcgtcg tcggcgtcga gtccgccgtc tacttcgcca actccatgta cttggtggag 1740

cgggtcatgc gctacctccg cgacgaggag gagcgcgcgc tcaagtccaa tcacccctcc 1800

atccgatgcg tcgtcctcga catgggcgcc gtcgcggcga tcgacacgag cggtctagac 1860

gcgctgtccg agctcaagaa agtcctggac aaaagaaaca tcgagctggt gctcgccaac 1920

ccggtggggt cggtggcgga gaggatgttc aactcggcgg tgggcgagag cttcgggtcg 1980

ggccgcctct tcttcagcgt agcggaggcc gtcgcggcgg gggcgtgcaa agcggcgcag 2040

ccctga 2046

<210>6

<211>2046

<212>DNA

<213>unkown

<400>6

atggtcgtga acaacaaggt ggacagcctg tcgtacgacg tcgaggcgcc gccgccctct 60

gccgccggcg ccgccgcggg gcaagcgcca ccgccggcgt cgccagctcc ggcgccggca 120

ccggcaaccc acgcgcccgt gacgcgggaaggcggcgcgg cgtcggtgct ggagctgcac 180

aaggtgtcgc tgccggagcg gcggacgacg gcgaaggcgc tgcggcagcg cctggccgag 240

gtgttcttcc cggacgaccc gctgcaccag ttcaagaacc agtcgtcggc gcggcgcctc 300

gtgctggcgc tgcactactt cttccccatc ttccagtggg ggtccgccta cagcccgcgc 360

ctcctgcgct ccgacctcgt cgccggcctc accattgcca gcctcgccat cccgcaggga 420

atcagctacg ccaagctcgc caacctgccg ccaatcgttg gcctatattc cagcttcgtg 480

ccgccgctca tctacgcgct gctggggagc tcgcgggacc tggcggtggg gccggtgtcc 540

atcgcgtcgc tggtgatggg gtccatgctc cgggacgccg tgtcgccgga cgagcagccg 600

ctcctctacc tgcagctggc cttcaccgcc accttcttcg ccggcgtctt ccaggcgtcc 660

ctgggattcc tcaggctggg cttcatcgtg gacttcctgt ccaaggcgac gctgacgggc 720

ttcatgggcg gcgccgccgt catcgtgtcg ctgcagcagc tcaagggcct gctcggcatc 780

tcccacttca cctcccacat gggattcctc gacgtcatgc gctccgtcgt caaccgccac 840

gacgagtgga agtggcagac gatcgtcatg ggctccgcct tcctcgccat cctcctcctc 900

acgcgccaaa tcagcgccag gaacccaaag cttttctggg tatcagcagg tgctcccctg 960

gcgtcggtga tcatctccac catcctctcc ttcatctgga aatcccccag catcagtgtt 1020

attggcatcc tccccagggg agtgaaccct ccttcggcga acatgctcag cttcagcggc 1080

tcctatgtgg cgctgacgat caaaaccggg atcatgacag gcatcctgtc cttaacagaa 1140

gggatcgcag tgggcaggac cttcgcgtcc atcaacaact accaggtgga cgggaacaag 1200

gagatgatgg cgatcgggct gatgaacatg gcgggctcct gcgcctcctg ctacgtgacg 1260

acggggtcct tctcccggtc ggcggtgaac tacagcgcgg gctgcaggac ggcgctgtcc 1320

aacgtcgtga tggcggcggc ggtgctggtg acgctgctgt tcctcatgcc gctgttccac 1380

tacaccccga acgtgatcct ggcggcgatc atcatcacgg cggtggtggg gctggtggac 1440

gtgcgcggcg ccgccaggct gtggaaggtg gacaagctgg acttcctggc gtgcgtggcg 1500

gcgttcctcg gcgtgctgct ggtgtccgtg cagacgggcc tgggcgtcgc cgtcggcatc 1560

tcgctcttca aggtcctgct gcaggtcacc cgccccaacg tcgtggtgga gggcctcgtc 1620

ccggggacgc agagctaccg cagcgtggcg cagtaccgcg aggccgtccg cgtgccgggc 1680

ttcctcgtcg tcggcgtcga gtccgccgtc tacttcgcca actccatgta cctggtggag 1740

cgggtcatgc gctacctccg cgacgaggag gagcgcgcgc tcaagtccaa ccacccctcc 1800

atccgatgcg tcgtcctcga catgggcgcc gtcgcggcga tcgacacgag cggtctagac 1860

gcgctgtccg agctcaagaa agtcctggac aaaagaaaca tcgagctggt gcttgccaac 1920

ccggtggggt cggtggcgga gaggatgttc aactcggcgg tgggcgagag cttcgggtcg 1980

ggccgcctct tcttcagcgt agcggaggcc gtcgcggcgg gggcgtgcaa agcggcgcag 2040

ccctga 2046

<210>7

<211>20

<212>DNA

<213> corn (Zea mays L.)

<400>7

gactcacata ggccaacgat 20

<210>8

<211>20

<212>DNA

<213> corn (Zea mays L.)

<400>8

gaagtggcag acgatcgtca 20

<210>9

<211>103

<212>RNA

<213>unkown

<400>9

gacucacaua ggccaacgau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 103

<210>10

<211>103

<212>RNA

<213>unkown

<400>10

gaaguggcag acgaucguca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 103

<210>11

<211>32

<212>DNA

<213>unkown

<400>11

gccgccaatc ggttggccta tgtgagtccc tc 32

<210>12

<211>32

<212>DNA

<213>unkown

<400>12

gccgccaatc gtttggccta tgtgagtccc tc 32

<210>13

<211>29

<212>DNA

<213>unkown

<400>13

gccgccaatc tggcctatgt gagtccctc 29

<210>14

<211>21

<212>DNA

<213>unkown

<400>14

gccggcctat gtgagtccct c 21

<210>15

<211>22

<212>DNA

<213>unkown

<400>15

ggcgtgctgc tgtcggcatc tc 22

<210>16

<211>500

<212>DNA

<213> corn (Zea mays L.)

<400>16

gctgtttttg ttagccccat cgaatccttg acataatgat cccgcttaaa taagcaacct 60

cgcttgtata gttccttgtg ctctaacaca cgatgatgat aagtcgtaaa atagtggtgt 120

ccaaagaatt tccaggccca gttgtaaaag ctaaaatgct attcgaattt ctactagcag 180

taagtcgtgt ttagaaatta tttttttata tacctttttt ccttctatgt acagtaggac 240

acagtgtcag cgccgcgttg acggagaata tttgcaaaaa agtaaaagag aaagtcatag 300

cggcgtatgt gccaaaaact tcgtcacaga gagggccata agaaacatgg cccacggccc 360

aatacgaagc accgcgacga agcccaaaca gcagtccgta ggtggagcaa agcgctgggt 420

aatacgcaaa cgttttgtcc caccttgact aatcacaaga gtggagcgta ccttataaac 480

cgagccgcaa gcaccgaatt 500

Claims (8)

1. The application of a protein in controlling female traits of corn is characterized in that: the amino acid sequence of the protein is shown as SEQ ID NO.1 or SEQ ID NO. 2.

2. Use of a nucleic acid for controlling female traits in maize, wherein: the nucleic acid encodes the protein of claim 1; the sequence of the nucleic acid is shown as SEQ ID NO.3-SEQ ID NO. 6.

3. A method for creating a female sterile line of corn is characterized in that: inhibiting the expression and/or activity of the protein of claim 1 in maize and selecting maize female sterile plants.

4. The method of creating a maize female sterile line of claim 3, wherein: the method for inhibiting the expression and/or activity of the protein comprises any one of gene editing, RNA interference and T-DNA insertion.

5. The method of creating a maize female sterile line of claim 4, wherein: the gene editing adopts a CRISPR/Cas9 method.

6. The method of creating a maize female sterile line of claim 5, wherein: the DNA sequence of the genome target region of the CRISPR/Cas9 method in maize is shown as SEQ ID NO.7 or SEQ ID NO. 8.

7. A kit for creating a female sterile line of corn, which is characterized in that: including any of the following:

(1) the sequence of the sgRNA molecule is shown as SEQ ID NO.9 or SEQ ID NO. 10;

(2) a DNA molecule encoding the sgRNA;

(3) a vector expressing the sgRNA.

8. A maize female sterility mutant gene characterized by: the mutant gene sequence is shown in SEQ ID NO.15 through 1510-th and 1562-th bit sequence mutation of the sequence shown in SEQ ID NO. 4.

Images