CN110862440B

CN110862440B - Gene ZKM465 for controlling corn plant height and application thereof

Info

Publication number: CN110862440B
Application number: CN201911271025.4A
Authority: CN
Inventors: 许洁婷; 张茂林; 刘海军; 严建兵; 韩宝柱; 杨晓凤
Original assignee: Weimi Biotechnology Jiangsu Co ltd; Huazhong Agricultural University
Current assignee: Changzhou Xinmi Biotechnology Co ltd
Priority date: 2019-12-12
Filing date: 2019-12-12
Publication date: 2022-02-15
Anticipated expiration: 2039-12-12
Also published as: CN110862440A

Abstract

The present invention is in the field of molecular genetics. In particular to a gene ZKM465 for controlling the height of a corn plant and the application thereof in reducing the high character of the corn plant. The invention provides a sequence of a gene ZKM465 for controlling the height of a corn plant and discloses a method for reducing the height of the corn plant by mutating ZKM465 gene by using a genetic engineering means.

Description

Gene ZKM465 for controlling corn plant height and application thereof

Technical Field

Background

The dwarfing character brings breakthrough to crop yield, and the method for reducing the plant height of the crops has great application potential. In the main agronomic traits of corn, the plant height influences the lodging resistance, photosynthetic efficiency and harvest index of the corn and is closely related to the yield of the corn. Therefore, the plant height trait has important value in corn breeding practice and germplasm resource improvement work.

The plant height is commonly controlled by major genes and micro-effective polygenes, and is expressed as typical quantitative trait inheritance. Although some genes for regulating the height of the corn plant are positioned and cloned (China southern agriculture university, corn ZmPIF3s mutant protein, a coding gene thereof and application thereof in breeding: CN201910273522.1[ P ] 2019-08-02.; Hangzhou Ruifeng Biotech limited company, CYP78A gene is applied to increasing the height of the corn plant and enhancing the growth vigor of the plant: CN201510230547.5[ P ] 2016-12-07.; China agricultural university, a gene related to the height of the corn plant, a coding protein thereof and application thereof: CN200410037404.4[ P ] 2005-01-26.; Chinese agricultural academy crop scientific research institute, a method for creating a corn dwarfing material by using a gene editing technology: CN201910371358.8[ P ] 2019-08-16.), more genes related to be further cloned.

Disclosure of Invention

The invention aims to provide a sequence of a gene ZKM465 for controlling the height character of a corn plant.

The second purpose of the invention is to disclose a method for reducing the high character of corn plants.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides a gene ZKM465 for controlling the height of a corn plant and application thereof in reducing the character of the corn plant height, which is characterized in that: the nucleic acid sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO. 2. Wherein, the sequence of SEQ ID NO.1 is the genome sequence of ZKM465, and the sequence of SEQ ID NO.2 is the transcript cDNA sequence of the gene.

In another aspect, the present invention also provides a method for reducing the plant height of corn, which comprises: inhibiting the expression and/or activity of the protein coded by the ZKM465 gene in the corn, and selecting the plants with reduced corn plant height.

In some embodiments, the amino acid sequence of the above protein is shown in SEQ ID NO. 3.

In some embodiments, the method of inhibiting protein expression and/or activity comprises any one of gene editing, RNA interference, T-DNA insertion, physical or chemical mutagenesis.

In some embodiments, the above gene editing employs the CRISPR/Cas9 method.

In some embodiments, the DNA sequence of the genomic target region in maize of the CRISPR/Cas9 method described above is shown as SEQ ID No. 4.

In another aspect, the present invention also provides a kit for reducing the plant height of corn, wherein the kit is characterized in that: including any of the following:

(1) the sequence of the sgRNA molecule is shown as SEQ ID NO. 5;

(2) a DNA molecule encoding the sgRNA;

(3) a vector expressing the sgRNA.

In another aspect, the present invention also provides a maize mutant genotype obtained by using the above-mentioned kit, characterized in that: the mutation genotype sequence is that the 1251-position 1256-position ACCTAC base of the sequence shown in SEQ ID NO.1 is mutated into TCC.

The invention has the following advantages and beneficial effects: the gene ZKM465 for controlling the height of corn plants has not been reported before. The invention utilizes the multi-parent high-generation inbred line population to locate the genome region for controlling the high character of the corn plant, and utilizes the CRISPR/Cas9 method to mutate the functional gene in the region, and finds that the ZKM465 gene can control the high character of the corn plant. By using the CRISPR/Cas9 gene editing method and the edited mutant genotype sequence, the height of the corn plant can be reduced, and dwarf corn varieties can be created, so that the corn yield is increased, the lodging rate is reduced, and the planting efficiency is improved.

Drawings

FIG. 1 shows the results of QTL location of plant height. The vertical axis represents the p-value of each marker association analysis test, taken as-log 10, and the horizontal axis represents the position of the chromosome.

FIG. 2 ZKM465 gene editing vector map. The English and abbreviated meanings of each element are listed as follows:

RB T-DNA right border sequence

gRNA guide RNA

UBI ubiquitin promoter

Cas9 Cas9 gene sequence

NOS terminator of nopaline synthase

35S cauliflower mosaic virus 35S promoter

Bar glufosinate-ammonium tolerance screening marker gene

PolyA cauliflower mosaic virus 35S polyadenylation sequence

Left border sequence of LB T-DNA

Kan kanamycin resistance sequence

pBR322 pBR322 vector replication initiation site

Bom site vector Bom Gene site

pVS1 pVS1 replicon

STA region transcriptional initiation region

FIG. 3 shows the plant height of maize ZKM465 gene protein after mutation by using CRISPR-Cas9 technology. ZKM465 denotes the gene-edited plant, CK denotes the unedited plant.

Detailed Description

The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise indicated, terms are to be understood in accordance with their ordinary usage by those of ordinary skill in the relevant art. All patent documents, academic papers, industry standards and other publications, etc., cited herein are incorporated by reference in their entirety.

As used herein, "maize" is any maize plant and includes all plant varieties that can be bred with maize, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like. Unless otherwise indicated, nucleic acids are written from left to right in the 5 'to 3' direction; amino acid sequences are written from left to right in the amino to carboxy direction. Amino acids may be referred to herein by their commonly known three letter symbols or by the one letter symbols recommended by the IUPAC-IUB Biochemical nomenclature Commission. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include the numbers defining the range. As used herein, "nucleic acid" includes reference to deoxyribonucleotide or ribonucleotide polymers in either single-or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encode" or "encoded" when used in the context of a particular nucleic acid means that the nucleic acid contains the necessary information to direct translation of the nucleotide sequence into a particular protein. The information encoding the protein is represented using a codon. As used herein, "full-length sequence" in reference to a particular polynucleotide or protein encoded thereby refers to the entire nucleic acid sequence or the entire amino acid sequence having a native (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the particular protein. The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogues of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). The amino acid can be a naturally occurring amino acid, and unless otherwise limited, can include known analogs of natural amino acids that can function in a similar manner as naturally occurring amino acids.

As used herein, the terms "isolated" and "purified" may be used interchangeably to refer to a nucleic acid or polypeptide, or biologically active portion thereof, that is substantially or essentially free of components that normally accompany or react with the nucleic acid or polypeptide as found in its naturally occurring environment. Thus, an isolated or purified nucleic acid or polypeptide produced by recombinant techniques is substantially free of other cellular material or culture medium, or is substantially free of chemical precursors or other chemicals when chemically synthesized. An "isolated" nucleic acid is typically free of sequences (such as sequences encoding proteins) that naturally flank the nucleic acid (i.e., sequences located at the 5 'and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, an isolated nucleic acid may comprise less than about 0.5kb of nucleotide sequences that naturally flank the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.

In this application, the words "comprise", "comprising" or variations thereof are to be understood as embracing elements, numbers or steps in addition to those described. By "subject plant" or "subject plant cell" is meant a plant or plant cell in which the genetic modification has been effected, or a progeny cell of the plant or cell so modified, which progeny cell comprises the modification. The "control" or "control plant cell" provides a reference point for measuring the phenotypic change of the test plant or plant cell. The control plant or plant cell may include, for example: (a) a wild-type plant or cell, i.e., a plant or cell having the same genotype as the starting material for the genetic alteration that produced the test plant or cell; (b) plants or plant cells having the same genotype as the starting material but which have been transformed with an empty construct (i.e., a construct that has no known effect on the trait of interest, such as a construct comprising a target gene); (c) a plant or plant cell that is a non-transformed isolate of a subject plant or plant cell; (d) a plant or plant cell that is genetically identical to the subject plant or plant cell but that has not been exposed to conditions or stimuli that induce expression of the gene of interest; or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.

Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of suitable tools and procedures for engineering or engineering amino acid sequences and potential gene sequences of proteins of agricultural interest.

In some embodiments, changes may be made to the nucleotide sequences of the present application to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, substitutions that do not alter the amino acid sequence of the nucleotide sequences of the present application can be made in accordance with the codon preferences disclosed for monocots, e.g., codons encoding the same amino acid sequence can be substituted with monocot preferred codons without altering the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application is replaced with a different codon that encodes the same amino acid sequence, such that the nucleotide sequence is not altered while the amino acid sequence encoded thereby is not altered. Conservative variants include those sequences that, due to the degeneracy of the genetic code, encode the amino acid sequence of one of the proteins of the embodiments. In some embodiments, a partial nucleotide sequence herein is replaced according to monocot preferred codons. One skilled in the art will recognize that amino acid additions and/or substitutions are generally based on the relative similarity of the amino acid side-chain substituents, e.g., hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituent groups having various of the foregoing properties are known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance regarding suitable amino acid substitutions that do not affect the biological activity of the Protein of interest can be found in the model of the Atlas of Protein sequences and structures (Protein Sequence and Structure Atlas) (Natl. biomed. Res. Foundation, Washington, D.C.) (incorporated herein by reference). Conservative substitutions such as exchanging one amino acid for another with similar properties may be made. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., a genomic library or cDNA library) from a selected organism.

In some embodiments, fragments of the nucleotide sequences and the amino acid sequences encoded thereby are also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide or a portion of the amino acid sequence of a polypeptide of an embodiment. Fragments of the nucleotide sequences may encode protein fragments that retain the biological activity of the native or corresponding full-length protein, and thus have protein activity. Mutant proteins include biologically active fragments of the native protein that comprise contiguous amino acid residues that retain the biological activity of the native protein. Some embodiments also include a transformed plant cell or transgenic plant comprising the nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed with an expression vector comprising at least one embodiment of the nucleotide sequence and operably linked thereto a promoter that drives expression in plant cells. Transformed plant cells and transgenic plants refer to plant cells or plants that comprise a heterologous polynucleotide within their genome. Generally, the heterologous polynucleotide is stably integrated within the genome of the transformed plant cell or transgenic plant such that the polynucleotide is transmitted to progeny. The heterologous polynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants to which the present application relates include plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells, which are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, nuts, ears, cobs, husks, stalks, roots, root tips, anthers, and the like. The present application also includes plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves, and roots derived from the transgenic plants of the present application or progeny thereof, and thus comprising at least in part the nucleotide sequences of the present application.

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, steps or conditions of the present invention may be made without departing from the spirit and substance of the invention and are intended to be included within the scope of the present application. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell D W, Molecular cloning: a laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

Examples

Example 1 maize plant height QTL location procedure

1. Population construction

The invention obtains a multi-parent high-generation inbred line group (CUBIC) consisting of 1404 generations of excellent 24 Chinese maize inbred lines through two-generation double-row hybridization, six-generation open pollination and six-generation inbred. The 24 elite maize inbred lines in China included LV28 (tour 28), E28, DAN340 (DAN 340), F349, ZI330 (since 330), ZONG3 (heddle 3), ZONG31 (heddle 31), HUANGGC (yellow C), HZS (yellow early four), HYS (yellow wild four), TY4 (Skyline 4), YUANGFH (primary and secondary yellow), CHANG7-2 (Chang 7-2), K12, XI502 (west 502), LX9801, H21, SHUANG741 (double 741), Q1261, JI853 (Ji 853), JI53 (Ji 53), 5237, 81515, NX110 (agricultural line 110), and all of the 24 parental and progeny inbred lines of the population were genomically sequenced to obtain SNPs and InDel variations exceeding 14M.

2. Phenotypic analysis

All 24 parents and 1404 progeny inbred lines are planted in 5 places of Huang-Huai-Hai and northeast, and the phenotypic variation is rich. The agronomic phenotypes examined included plant height, ear height, flowering time, ear weight, and other yield traits. Optimal linear unbiased predictor (BLUP) values for each inbred line were repeatedly calculated for all environments for subsequent analysis, including basic phenotype statistics, correlation analysis, and GWAS. Phenotypic variance or heritability explained by the QTL for a given trait is estimated by linear regression, combined with an estimate of the total variance of the explanation.

3. Univariate GWAS analysis (sGWAS)

After filtering according to Minimum Allele Frequency (MAF), a total of 1180 million high quality SNPs were used for downstream analysis. The first ten Principal Components (PCs) together account for 8.76% of the genetic variance, while the genetic relationship K matrix is integrated as a random effect for sggaas analysis. The significance threshold of the association was set at 1.23E-8, which is equal to 0.05/Ne, where Ne is the effective number of independent tests calculated from all the variations. The criteria for determining the QTL interval are: extracting the significant SNP of each character firstly, only reserving at least two sites with continuous SNP less than 20Kb and combining the sites as basic interval units, and excluding the SNP with only single significant site within 20Kb in the next analysis; if any significant SNP between adjacent interval units has a higher linkage disequilibrium relationship (LD, r2 ≧ 0.2), the adjacent interval units are further combined into QTL candidate intervals. To reduce the likelihood that the QTL interval obtained by the smaller QTL effect is smaller and does not contain a functional gene, for those QTLs with intervals less than 50Kb and the most significant SNP with significance less than 100-fold the threshold (i.e. 1.23E-10), the final QTL interval will be obtained by continuing to extend 25Kb to both sides of the QTL interval. The most significant SNP in the interval is taken as the significance of sQTL, and all genes in the interval are taken as candidate genes.

4. Obtaining QTL interval

By utilizing the positioning method, the 2 groups of most significant SNPs of the maize plant height character are found and are respectively positioned in a 13886872 nd chromosome 2-14540646 interval, a 7231744 nd chromosome 5-7873497 interval and a 146705700-150358009 th chromosome 10.

Wherein, 4 annotated genes (FIG. 1) in the region of chromosome 5 7231744 and 7873497, numbered GRMZM2G147814, GRMZM2G147862, GRMZM2G147809 and GRMZM2G172132, were selected by query of the MaizeGDB database (https:// www.maizegdb.org /), and the next gene knockout experiment was performed.

Example 2 Gene editing knockout candidates to analyze Gene function

The invention utilizes CRISPR-Cas9 gene editing technology to perform site-directed mutation on 4 genes in the interval. The implementation mode comprises the construction of a gene editing vector, the genetic transformation of corn and the functional verification of editing effect. The method comprises the following specific steps:

1. construction of Gene editing vector

The invention cuts off the ccdB sequence in a skeleton vector pCXB053 (constructed by Rice biotechnologies (Jiangsu) Co., Ltd.) by BsaI enzyme digestion, and connects a target sequence (shown as SEQ ID NO. 4) between U6 and gRNA by T4 ligase. The specific construction process is as follows:

1) synthesis of primers

Primer TF: ATTGGGGCTCAGAGTGAACCTCC, respectively; primer TR: AAACGGAGGTTCACTCTGAGCCC. Synthesized in Shanghai, dissolved in ultrapure water and mixed uniformly.

2) Allocating an annexing Buffer TE

Tris-Cl PH8.0 10mM

EDTA 0.1mM

NaCl： 50mM

3) Annealing of connections

A connection system:

Annealing Buffer 50μL

Mix Primer 5μL

and (3) connecting procedures:

95℃ 3min

0.1 ℃/s constant speed drop

20℃ 1min

Storing at-20 deg.C

4) The backbone vector was digested with BsaI restriction enzyme

Enzyme digestion system:

after digestion at 37 ℃ for 5h, the product was recovered directly (using the quangen recovery kit).

The recovered product was diluted to 50 ng/. mu.L with water, diluted with an equal amount of T4 Buffer and stored at-20 ℃.

5) T4 enzyme linked

Enzyme linked systems:

enzyme linked procedure:

25 ℃ for 2h (in PCR instrument)

6) Transformation of Escherichia coli

10 mu L of enzyme-linked reaction solution and 100 mu L of escherichia coli 5a are subjected to competence mixing, strictly standing and ice-bath is carried out for 30min, heat shock is carried out for 35s at 42 ℃, ice-bath is carried out for 2min, 500L of antibiotic-free LB is added, and shaking recovery is carried out for 1h at 37 ℃. After centrifugation at 3000g for 1 minute and aspiration of the supernatant, 100. mu.L of the liquid was left to blow-beat the bacterial cells and plated (solid medium containing 50mg/L kanamycin) and cultured in an inverted state at 37 ℃ for 12 hours.

And (4) selecting positive clone sequencing and extracting plasmids. Sequencing verification primer is PUV 3-R: CTGGCGAAAGGGGGATGTGCTGCAA are provided.

2. Genetic transformation of maize

The vector is transferred into agrobacterium EHA105 by an electric shock method, and PCR is carried out for identification. Taking a freshly peeled young embryo of a maize inbred line KN5585 (an inbred line bred by Mimi Biotechnology (Jiangsu) Co., Ltd.) of about 1mm as a material, putting the peeled maize embryo into a 2mL plastic centrifuge tube containing 1.8mL of suspension, and treating about 150 immature young embryos within 30 min; the suspension was aspirated, the remaining corn embryos placed in a tube and then 1.0mL of Agrobacterium suspension was added and left for 5 min. The young embryos in the centrifuge tube are suspended and poured onto a co-culture medium, and the surplus agrobacterium liquid on the surface is sucked by a liquid transfer device and is cultured for 3 days in the dark at the temperature of 23 ℃. After co-cultivation, the young embryos were transferred to a resting medium, cultured in the dark at 28 ℃ for 6 days, placed on a screening medium containing 5mg/L of Bialaphos, and screened for 2 weeks, and then transferred to a screening medium containing 8mg/L of Bialaphos for 2 weeks. The resistant calli were transferred to differentiation medium 1 and cultured at 25 ℃ under 5000lx light for 1 week. Transferring the callus to a differentiation culture medium 2, and culturing for 2 weeks by illumination; transferring the differentiated plantlets to a rooting culture medium, and culturing at 25 ℃ and 5000lx by illumination until the plantlets are rooted; transferring the plantlets into small pots for growth, transplanting the plantlets into a greenhouse after a certain growth stage, and harvesting progeny seeds after 3-4 months.

3. Trait evaluation of Gene-edited plants

Extracting seedling-stage DNA from T1 generation material, detecting gene editing condition, designing primer amplification target editing section, and amplifying the target editing section by the following system: DNA: 3 μ L, 1 μ L each of the bidirectional primers, 2 × TaqMix: 7.5 μ L, ddH 2O: 2.5. mu.L, total volume 10. mu.L. The PCR reaction conditions were as follows: (1)94 ℃ for 5 minutes, (2)94 ℃ for 40 seconds, (3)57 ℃ for 30 seconds, (4)72 ℃ for 60 seconds, (5) cycle 35 times from (2) step (4), (6)72 ℃ for 7 minutes, and (7) storage at 4 ℃. The PCR product was submitted to Sanger sequencing by Wuhan Strongziaceae Biotech Ltd. And comparing the sequencing result of the transformant with the genome of the wild KN5585, wherein the material subjected to base substitution, insertion or deletion is a positive editing material, and the material is a negative material if the material is not subjected to base substitution, insertion or deletion. Through the phenotypic identification of each gene editing material, the plant height of the edited plant of the GRMZM2G147862 gene is found to be changed (Table 1).

TABLE 1 plant height trait data of maize material edited by each gene

Data are expressed as "mean ± standard deviation", with different letters indicating significant differences at the level of p 0.05 for each material.

4. In-depth analysis of plants with altered plant height

Further, the plant edited by GRMZM2G147862 gene (named ZKM465) with changed plant height trait is subjected to in-depth analysis. A total of 3 independent transformation events were obtained for this gene. Primers 5'-TAGGTCGGGATCCTGGCGT-3' and 5'-CAATCATGCGCAACTCCACC-3', PCR were designed to amplify the target editing segment and the PCR products were sequenced. The result shows that one event is edited in the gene (specifically, the mutation of one base and the deletion of 3 bases), and the gene is a positive plant; 2 were unedited and negative plants. The plant height of the positive transformation event T1 generation material at the late pollination stage is investigated, and the plant height between the positive mutant and the separated negative plant is found to have very significant difference (P is 1.08E-10), which indicates that the gene controls the plant height. The data are shown in Table 2.

TABLE 2 ZKM465 Gene editing plant height trait data for maize Material

Data are expressed as "mean ± standard deviation", with different letters indicating significant differences at the level of p 0.05 for each material. "-" indicates a base deletion, and bold indicates a base mutation.

ZKM465 gene, is located in the Chr5:7,871,353-7,873,497 interval, the genome sequence is shown as SEQ ID NO.1, and the total length is 2,145 bp. Comprises 1 transcript, the cDNA sequence of the transcript is shown as SEQ ID NO.2, and the coded amino acid sequence is shown as SEQ ID NO. 3.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Junmi Biotechnology (Jiangsu) Ltd, university of agriculture in Huazhong

<120> corn plant height control gene ZKM465 and application thereof

<130> 1

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2145

<212> DNA

<213> corn (Zea mays L.)

<400> 1

atgacaagag atggattgga tgcccctgcc aattcggttg cggtggtcgc tggttcctcc 60

accgcggcag ctggttcctt cgaggcagct gccttgcctg agagtgttct tcgaccagag 120

ggccgcccaa agatggctga catcggcgtc gccgtgtatg gagtgctggt tggtggcttg 180

aggcctaggg ttttgtgaaa ttgatgagta gcgcgatgat ggctcgaagg aaggatagct 240

cgcgggactg gaggtagcga cagatctgtt gaggatggtg ggcggggggc gaggactgat 300

atgggggggt gcaggcgcgt tgtccgattt aggagtagga gaaatggccg acctaggggg 360

aagagaacca ggtggtgcca accgccacac acgtcggggg actccatcgc cactgcggtg 420

cagaggagtg gagggaaccc agagaggtgg aggcgccatt gggtgtgtgt tgatgaggat 480

ctgccgtcgc ggttgggggt tgcacgagcg tgggcgagga gcagcgcatc gggcggcacc 540

gcaaccaatc ccatccgtgt caccatcgat tccgctggga ggaatgggag atgaggaggt 600

gggaggagag gcggcgacca tgtcgtggtg gagcggtgta ggctggtcta ggaggcgagg 660

acacatggag cagaggcgga tggggagacg gtgagggcgc aaagcgtaga gacagaggaa 720

gggagtggac acggggtgag agaggggaag gacgacgctt gactcggcgg ctcgggggcg 780

agggcatcgc agacggaaga cagaggcgag gcgggggcac ggaggtgtgg acgcacttgt 840

tagcttctta atagagtagt atagattaga ccaaatgatt atgatgtcaa cacgatttgg 900

gatccgtgta ccaacgggtg ctttgccacg aagcaaatcc agtttcctcc ccacaaatag 960

agcccgccca gcgacgggcg gatcgtggac gtggcccgtt tcgtaaagcc aaggactcaa 1020

atctcctcaa ccagaaccag cgaagcgtgc gtggacgcgt cctattcttc ttccctcccc 1080

gacctttccc caacttctcc ctccttcaaa tccgatctcc ccgcaaggcc gcaatcatgc 1140

gcaactccac cgccgcccag ccctctactc cctcctccgc ccccgtcatg tccggctcag 1200

gccccgctta cgtggcgccg gcctcttcca cccccgtcgg cggcggatac acctacccgg 1260

cgccggcctc ctccgggggc agcgccggct acgccaggat cccgacctac cccgcgcccc 1320

cgtcgtcgta ccccgccacc aaccctccca cgccgcaggt ctccaccaac gccccggtcc 1380

aggaccccac ggcgccgccg tctccgctgg ccaaggcggg cgagctcgtc gcgcggctcc 1440

gcgagcaggg ccaggcgctg atggcggcgc gccggccctg ggccgaggtc ttccgcgcgg 1500

cggccttctc caggccaccg tcgctcgggg aggcgctcgc ccggacgcgc cgcaacgccg 1560

cctacttccg cgccaactac gcgctggccg tgctcgccgc cgtggcggcc tcgctgctct 1620

ggcaccccgg cacgctgctc gcgctcgtcc tcctctgcgc cgcctggttc ttcctctact 1680

tcgcgcgggc gcgggtgaac cagccgctca gggtcctggg gacggagttc gacgacggga 1740

ccgtgctcgc cgcgctctgc ggggtcaccg tcgtcgcctt gctcttcacc agcgtcggct 1800

ggaacgtcgt gggctccgtc atggtcgggg gcgcgctggt cggcgcgcac gccgcgctca 1860

ggaccaccga cgacctcttc ctcacggagc aggaggccgc cggggacggg ctggtggcag 1920

ccgggcccat cttgcccacc tatgtccgca tcgtttgatt cattcgcgca gctgggcggt 1980

gtcattcatc aatcttgatg ttattgcttg cagacagtag caattttcct tgtaattacc 2040

atcacgatga tgtctgatat tggttgtggg tgtgtaaaga tctatatttg ttcagaaaga 2100

caactgcgat atcgcgcaca ttctagtttc gatgcttcaa gatct 2145

<210> 2

<211> 1351

<212> DNA

<213> corn (Zea mays L.)

<400> 2

atgacaagag atggattgga tgcccctgcc aattcggttg cggtggtcgc tggttcctcc 60

accgcggcag ctggttcctt cgaggcagct gccttgcctg agagtgttct tcgaccagag 120

ggccgcccaa agatggctga catcggcgtc gccgtgtatg gagtgctgcc cgcccagcga 180

cgggcggatc gtggacgtgg cccgtttcgt aaagccaagg actcaaatct cctcaaccag 240

aaccagcgaa gcgtgcgtgg acgcgtccta ttcttcttcc ctccccgacc tttccccaac 300

ttctccctcc ttcaaatccg atctccccgc aaggccgcaa tcatgcgcaa ctccaccgcc 360

gcccagccct ctactccctc ctccgccccc gtcatgtccg gctcaggccc cgcttacgtg 420

gcgccggcct cttccacccc cgtcggcggc ggatacacct acccggcgcc ggcctcctcc 480

gggggcagcg ccggctacgc caggatcccg acctaccccg cgcccccgtc gtcgtacccc 540

gccaccaacc ctcccacgcc gcaggtctcc accaacgccc cggtccagga ccccacggcg 600

ccgccgtctc cgctggccaa ggcgggcgag ctcgtcgcgc ggctccgcga gcagggccag 660

gcgctgatgg cggcgcgccg gccctgggcc gaggtcttcc gcgcggcggc cttctccagg 720

ccaccgtcgc tcggggaggc gctcgcccgg acgcgccgca acgccgccta cttccgcgcc 780

aactacgcgc tggccgtgct cgccgccgtg gcggcctcgc tgctctggca ccccggcacg 840

ctgctcgcgc tcgtcctcct ctgcgccgcc tggttcttcc tctacttcgc gcgggcgcgg 900

gtgaaccagc cgctcagggt cctggggacg gagttcgacg acgggaccgt gctcgccgcg 960

ctctgcgggg tcaccgtcgt cgccttgctc ttcaccagcg tcggctggaa cgtcgtgggc 1020

tccgtcatgg tcgggggcgc gctggtcggc gcgcacgccg cgctcaggac caccgacgac 1080

ctcttcctca cggagcagga ggccgccggg gacgggctgg tggcagccgg gcccatcttg 1140

cccacctatg tccgcatcgt ttgattcatt cgcgcagctg ggcggtgtca ttcatcaatc 1200

ttgatgttat tgcttgcaga cagtagcaat tttccttgta attaccatca cgatgatgtc 1260

tgatattggt tgtgggtgtg taaagatcta tatttgttca gaaagacaac tgcgatatcg 1320

cgcacattct agtttcgatg cttcaagatc t 1351

<210> 3

<211> 387

<212> PRT

<213> corn (Zea mays L.)

<400> 3

Met Thr Arg Asp Gly Leu Asp Ala Pro Ala Asn Ser Val Ala Val Val

1 5 10 15

Ala Gly Ser Ser Thr Ala Ala Ala Gly Ser Phe Glu Ala Ala Ala Leu

20 25 30

Pro Glu Ser Val Leu Arg Pro Glu Gly Arg Pro Lys Met Ala Asp Ile

35 40 45

Gly Val Ala Val Tyr Gly Val Leu Pro Ala Gln Arg Arg Ala Asp Arg

50 55 60

Gly Arg Gly Pro Phe Arg Lys Ala Lys Asp Ser Asn Leu Leu Asn Gln

65 70 75 80

Asn Gln Arg Ser Val Arg Gly Arg Val Leu Phe Phe Phe Pro Pro Arg

85 90 95

Pro Phe Pro Asn Phe Ser Leu Leu Gln Ile Arg Ser Pro Arg Lys Ala

100 105 110

Ala Ile Met Arg Asn Ser Thr Ala Ala Gln Pro Ser Thr Pro Ser Ser

115 120 125

Ala Pro Val Met Ser Gly Ser Gly Pro Ala Tyr Val Ala Pro Ala Ser

130 135 140

Ser Thr Pro Val Gly Gly Gly Tyr Thr Tyr Pro Ala Pro Ala Ser Ser

145 150 155 160

Gly Gly Ser Ala Gly Tyr Ala Arg Ile Pro Thr Tyr Pro Ala Pro Pro

165 170 175

Ser Ser Tyr Pro Ala Thr Asn Pro Pro Thr Pro Gln Val Ser Thr Asn

180 185 190

Ala Pro Val Gln Asp Pro Thr Ala Pro Pro Ser Pro Leu Ala Lys Ala

195 200 205

Gly Glu Leu Val Ala Arg Leu Arg Glu Gln Gly Gln Ala Leu Met Ala

210 215 220

Ala Arg Arg Pro Trp Ala Glu Val Phe Arg Ala Ala Ala Phe Ser Arg

225 230 235 240

Pro Pro Ser Leu Gly Glu Ala Leu Ala Arg Thr Arg Arg Asn Ala Ala

245 250 255

Tyr Phe Arg Ala Asn Tyr Ala Leu Ala Val Leu Ala Ala Val Ala Ala

260 265 270

Ser Leu Leu Trp His Pro Gly Thr Leu Leu Ala Leu Val Leu Leu Cys

275 280 285

Ala Ala Trp Phe Phe Leu Tyr Phe Ala Arg Ala Arg Val Asn Gln Pro

290 295 300

Leu Arg Val Leu Gly Thr Glu Phe Asp Asp Gly Thr Val Leu Ala Ala

305 310 315 320

Leu Cys Gly Val Thr Val Val Ala Leu Leu Phe Thr Ser Val Gly Trp

325 330 335

Asn Val Val Gly Ser Val Met Val Gly Gly Ala Leu Val Gly Ala His

340 345 350

Ala Ala Leu Arg Thr Thr Asp Asp Leu Phe Leu Thr Glu Gln Glu Ala

355 360 365

Ala Gly Asp Gly Leu Val Ala Ala Gly Pro Ile Leu Pro Thr Tyr Val

370 375 380

Arg Ile Val

385

<210> 4

<211> 19

<212> DNA

<213> corn (Zea mays L.)

<400> 4

gggctcagag tgaacctcc 19

<210> 5

<211> 102

<212> RNA

<213> unkown

<400> 5

gggcucagag ugaaccuccg uuuuagagcu agaaauagca aguuaaaaua aggcuagucc 60

guuaucaacu ugaaaaagug gcaccgaguc ggugcuuuuu uu 102

Claims

1. The application of a gene ZKM465 for controlling the height of a corn plant in the reduction of the corn plant height character is characterized in that: the nucleic acid sequence of the gene is shown in SEQ ID NO. 1.

2. A method for reducing the plant height of corn is characterized in that: inhibiting the expression and/or activity of the protein encoded by the gene of claim 1 in maize, and selecting plants with reduced maize plant height.

3. The method for reducing the plant height of corn according to claim 2, wherein the method comprises the following steps: the amino acid sequence of the protein is shown as SEQ ID NO. 3.

4. The method for reducing the plant height of corn according to claim 2, wherein the method comprises the following steps: the method of inhibiting protein expression and/or activity comprises any one of gene editing, RNA interference or T-DNA insertion.

5. The method for reducing the plant height of corn according to claim 4, wherein the method comprises the following steps: the gene editing adopts a CRISPR/Cas9 method.

6. The method for reducing the plant height of corn according to claim 5, wherein the method comprises the following steps: the DNA sequence of the genome target region of the CRISPR/Cas9 method in maize is shown in SEQ ID No. 4.

7. A kit for reducing the plant height of corn, which is characterized in that: including any of the following:

(1) the sequence of the sgRNA molecule is shown as SEQ ID NO. 5;

(2) (1) a DNA molecule encoding the sgRNA;

(3) a vector expressing the sgRNA of (1).

8. The application of a corn mutant genotype in reducing the height of a corn plant is characterized in that: the mutation genotype sequence is that the 1251-position 1256-position ACCTAC base of the sequence shown in SEQ ID NO.1 is mutated into TCC.