CN112500463B

CN112500463B - Gene ZmCOL14 for controlling plant height and ear position height of corn and application thereof

Info

Publication number: CN112500463B
Application number: CN202011480563.7A
Authority: CN
Inventors: 刘相国; 柳青; 金敏亮; 许洁婷; 刘海军; 尹悦佳; 郭嘉; 李毅丹; 黄磊; 韩宝柱; 刘洋; 严建兵; 郝东云
Original assignee: Weimi Biotechnology Jiangsu Co ltd; Jilin Academy of Agricultural Sciences; Huazhong Agricultural University
Current assignee: Weimi Biotechnology Jiangsu Co ltd; Jilin Academy of Agricultural Sciences; Huazhong Agricultural University
Priority date: 2020-12-15
Filing date: 2020-12-15
Publication date: 2022-04-01
Anticipated expiration: 2040-12-15
Also published as: CN112500463A

Abstract

The present invention is in the field of molecular genetics. In particular to a gene ZmCOL14 for controlling the height of a corn plant and the height of a ear and application thereof in the aspect of regulating the characters of the height of the corn plant and the height of the ear. The invention provides a gene ZmCOL14 for controlling the height of a corn plant and the height of a ear position, discloses a method for delaying the flowering phase of corn and reducing the height of the corn plant and the height of the ear position by operating the gene ZmCOL14 by using a genetic engineering means, and provides a mutant gene for advancing the flowering phase of corn and improving the height of the corn plant and the height of the ear position under the long-day condition.

Description

Gene ZmCOL14 for controlling plant height and ear position height of corn and application thereof

Technical Field

Background

In the main agronomic characters of corn, the plant height and the ear height influence the lodging resistance, the photosynthetic efficiency and the harvest index of the corn and are closely related to the corn yield. Therefore, the characters of plant height and ear height have important value in corn breeding practice and germplasm resource improvement work. In addition, the plant height and ear height of the corn are closely related to the mechanized harvesting efficiency. The regulation and control mechanism of the plant height and the ear height is understood, and the plant height and the ear height of the corn variety can be flexibly regulated and controlled, so that the method has an important effect on corn planting and harvesting.

The plant height and the ear position are jointly controlled by major genes and micro-effective polygenes, so that the genetic expression is typical quantitative trait inheritance. Although some genes for regulating and controlling the plant height and the ear height of the corn are positioned and cloned (China southern agricultural university, maize ZmPIF3s mutant protein, a coding gene thereof and application thereof in breeding: CN201910273522.1[ P ] 2019-08-02 ], application of CYP78A gene in increasing the plant height and enhancing the plant growth: CN201510230547.5[ P ] 2016-12-07, China agricultural university, a gene related to the plant height of the corn and a coding protein and application thereof: CN200410037404.4[ P ] 2005-01-26, a crop scientific institute of Chinese agricultural academy, a method for creating a maize dwarfing material by using a gene editing technology: CN201910371358.8[ P ] 2019-08-16.), more genes related to the plant height and the ear height are to be further cloned.

The flowering phase is an important character in the crop evolution and adaptation process, the understanding of the genetic basis of the character of the crop flowering phase and the cloning of candidate genes can improve the environmental adaptability and plasticity of the crop, which has important significance for cultivating good crop varieties adapting to different ecological regions, and simultaneously, the genetic improvement process of important production characters such as yield and the like closely related to the flowering phase can be promoted.

Can simultaneously regulate and control the plant height and the flowering phase characters, and is beneficial to the corn to adapt to a specific ecological environment and a specific harvesting mode.

Disclosure of Invention

The invention aims to provide a gene ZmCOL14 for controlling the height and/or the ear height of a corn plant and application thereof in regulating the characters of the height and the ear height of the corn plant.

The second purpose of the invention is to disclose a method for advancing the flowering period of corn and reducing the plant height and the ear height of the corn.

The second purpose of the invention is to disclose application of the maize mutant gene in delaying the maize flowering period under the long-day condition and improving the maize plant height and ear position height.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides a gene ZmCOL14 for controlling the height and/or the ear height of a corn plant and application thereof in regulating the height and/or the ear height of the corn plant, which is characterized in that the nucleic acid sequence of the gene is shown as SEQ ID No. 1.

The invention also provides a protein capable of reducing the plant height and/or the ear height of the corn, which is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO. 3.

The invention also provides a nucleic acid for reducing the plant height and/or ear height of corn, which is characterized in that the nucleic acid encodes the protein; in some embodiments, the nucleic acid sequence is set forth in SEQ ID NO. 2.

The invention also provides a gene expression cassette capable of reducing the plant height and/or the ear height of the corn, which is characterized in that the expression cassette contains the nucleic acid sequence.

In some embodiments, the above nucleic acid is operably linked to a pZmUBI promoter, a3 XFlag tag, and a nos terminator.

In some embodiments, the sequence of the gene expression cassette is as set forth in SEQ ID NO. 4.

The invention also provides an expression vector capable of reducing the plant height and/or the ear height of the corn, which is characterized by comprising the expression cassette.

The invention also provides a host cell capable of reducing the plant height and/or the ear height of the corn, which is characterized by comprising the expression vector.

In some embodiments, the host cell is an agrobacterium cell.

The invention also provides a method for delaying the flowering phase of corn and reducing the plant height and ear height of corn, which is characterized in that the expression vector or the host cell is used for transforming corn to obtain transgenic corn; screening materials with delayed tasseling period, spinning period and pollen scattering period and reduced plant height and ear height.

The invention also provides application of the maize mutant gene in advancing maize flowering period and improving maize plant height and ear position height under long-day conditions, which is characterized in that: the sequence of the mutant gene is shown in any one of SEQ ID NO.5 or SEQ ID NO. 6.

The invention has the following advantages and beneficial effects: the ZmCOL14 gene is not reported before to control the plant height and ear height of corn. According to the invention, the ZmCOL14 gene is overexpressed and edited, the regulation function of the gene on the flowering period of the corn is confirmed, the specific regulation mode (inhibiting tasseling, spinning and powder scattering) is determined, and meanwhile, the ZmCOL14 gene is unexpectedly found to control the properties of the plant height and the ear height of the corn in a mode of inhibiting the properties of the plant height and the ear height. In general, late flowering of corn results in prolonged vegetative growth with a corresponding increase in plant and ear height. However, due to the special function of the ZmCOL14 gene, the expression cassette constructed by connecting the pZmUBI promoter and nos terminator with the ZmCOL14 gene coding sequence can reduce the height of the maize plant and the height of the ear while delaying the flowering period of the maize, thereby being used for cultivating the late-flowering half-dwarf maize variety. In addition, two optimized mutant genes edited by the CRISPR/Cas9 gene can effectively advance the flowering period of the corn and improve the plant height and the ear position height of the corn under the long-day condition, so that the method is used for cultivating early-flowering high-stalk corn varieties.

Drawings

FIG. 1 shows a ZmCOL14 gene overexpression vector. The English and abbreviated meanings of each element are listed as follows:

FIG. 2 shows the plant height and flowering phase of over-expressed maize ZmCOL14 gene. The overexpression plants are on the left and the control plants are on the right.

Detailed Description

The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise indicated, terms are to be understood in accordance with their ordinary usage by those of ordinary skill in the relevant art. All patent documents, academic papers, industry standards and other publications, etc., cited herein are incorporated by reference in their entirety.

As used herein, "maize" is any maize plant and includes all plant varieties that can be bred with maize, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like. Unless otherwise indicated, nucleic acids are written from left to right in the 5 'to 3' direction; amino acid sequences are written from left to right in the amino to carboxy direction. Amino acids may be referred to herein by their commonly known three letter symbols or by the one letter symbols recommended by the IUPAC-IUB Biochemical nomenclature Commission. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include the numbers defining the range. As used herein, "nucleic acid" includes reference to deoxyribonucleotide or ribonucleotide polymers in either single-or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encode" or "encoded" when used in the context of a particular nucleic acid means that the nucleic acid contains the necessary information to direct translation of the nucleotide sequence into a particular protein. The information encoding the protein is represented using a codon. As used herein, "full-length sequence" in reference to a particular polynucleotide or protein encoded thereby refers to the entire nucleic acid sequence or the entire amino acid sequence having a native (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the particular protein. The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogues of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). The amino acid can be a naturally occurring amino acid, and unless otherwise limited, can include known analogs of natural amino acids that can function in a similar manner as naturally occurring amino acids.

As used herein, the terms "isolated" and "purified" may be used interchangeably to refer to a nucleic acid or polypeptide, or biologically active portion thereof, that is substantially or essentially free of components that normally accompany or react with the nucleic acid or polypeptide as found in its naturally occurring environment. Thus, an isolated or purified nucleic acid or polypeptide produced by recombinant techniques is substantially free of other cellular material or culture medium, or is substantially free of chemical precursors or other chemicals when chemically synthesized. An "isolated" nucleic acid is typically free of sequences (such as sequences encoding proteins) that naturally flank the nucleic acid (i.e., sequences located at the 5 'and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, an isolated nucleic acid may comprise less than about 0.5kb of nucleotide sequences that naturally flank the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.

In this application, the words "comprise", "comprising" or variations thereof are to be understood as embracing elements, numbers or steps in addition to those described. By "subject plant" or "subject plant cell" is meant a plant or plant cell in which the genetic modification has been effected, or a progeny cell of the plant or cell so modified, which progeny cell comprises the modification. The "control" or "control plant cell" provides a reference point for measuring the phenotypic change of the test plant or plant cell. The control plant or plant cell may include, for example: (a) a wild-type plant or cell, i.e., a plant or cell having the same genotype as the starting material for the genetic alteration that produced the test plant or cell; (b) plants or plant cells having the same genotype as the starting material but which have been transformed with an empty construct (i.e., a construct that has no known effect on the trait of interest, such as a construct comprising a target gene); (c) a plant or plant cell that is a non-transformed isolate of a subject plant or plant cell; (d) a plant or plant cell that is genetically identical to the subject plant or plant cell but that has not been exposed to conditions or stimuli that induce expression of the gene of interest; or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.

Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of suitable tools and procedures for engineering or engineering amino acid sequences and potential gene sequences of proteins of agricultural interest.

In some embodiments, changes may be made to the nucleotide sequences of the present application to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, substitutions that do not alter the amino acid sequence of the nucleotide sequences of the present application can be made in accordance with the codon preferences disclosed for monocots, e.g., codons encoding the same amino acid sequence can be substituted with monocot preferred codons without altering the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application is replaced with a different codon that encodes the same amino acid sequence, such that the nucleotide sequence is not altered while the amino acid sequence encoded thereby is not altered. Conservative variants include those sequences that, due to the degeneracy of the genetic code, encode the amino acid sequence of one of the proteins of the embodiments. In some embodiments, a partial nucleotide sequence herein is replaced according to monocot preferred codons. One skilled in the art will recognize that amino acid additions and/or substitutions are generally based on the relative similarity of the amino acid side-chain substituents, e.g., hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituent groups having various of the foregoing properties are known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance regarding suitable amino acid substitutions that do not affect the biological activity of the Protein of interest can be found in the model of the Atlas of Protein sequences and structures (Protein Sequence and Structure Atlas) (Natl. biomed. Res. Foundation, Washington, D.C.) (incorporated herein by reference). Conservative substitutions such as exchanging one amino acid for another with similar properties may be made. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., a genomic library or cDNA library) from a selected organism.

In some embodiments, fragments of the nucleotide sequences and the amino acid sequences encoded thereby are also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide or a portion of the amino acid sequence of a polypeptide of an embodiment. Fragments of the nucleotide sequences may encode protein fragments that retain the biological activity of the native or corresponding full-length protein, and thus have protein activity. Mutant proteins include biologically active fragments of the native protein that comprise contiguous amino acid residues that retain the biological activity of the native protein. Some embodiments also include a transformed plant cell or transgenic plant comprising the nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed with an expression vector comprising at least one embodiment of the nucleotide sequence and operably linked thereto a promoter that drives expression in plant cells. Transformed plant cells and transgenic plants refer to plant cells or plants that comprise a heterologous polynucleotide within their genome. Generally, the heterologous polynucleotide is stably integrated within the genome of the transformed plant cell or transgenic plant such that the polynucleotide is transmitted to progeny. The heterologous polynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants to which the present application relates include plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells, which are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, nuts, ears, cobs, husks, stalks, roots, root tips, anthers, and the like. The present application also includes plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves, and roots derived from the transgenic plants of the present application or progeny thereof, and thus comprising at least in part the nucleotide sequences of the present application.

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, steps or conditions of the present invention may be made without departing from the spirit and substance of the invention and are intended to be included within the scope of the present application. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell D W, Molecular cloning: a laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

Examples

Example 1 overexpression of the maize ZmCOL14 Gene

The ZmCOL14 gene (GRMZM2G042198) was located in maize chromosome 4 162885359 and 162891594, and the gene function was annotated as Zinc-finger protein CONSTANS-Like 11, by query of the MaizeGDB database (https:// www.maizegdb.org /). The genome sequence is shown as SEQ ID NO.1, the CDS sequence is shown as SEQ ID NO.2, and the coded amino acid sequence is shown as SEQ ID NO. 3. Normally, the CONSTANS-Like protein is associated with photoperiod and flowering stage traits in plants, however, as the research on the flowering gene in maize is shallow, the number of genes with CONSTANS-Like functional annotations is also large, and therefore the specific function of ZmCOL14 gene (whether it affects flowering traits) and the specific manner of affecting flowering in maize (whether it promotes or inhibits) cannot be completely determined. In order to determine the specific functions of the ZmCOL14 gene, the invention utilizes an overexpression technology to carry out manual operation on the expression of the ZmCOL14 gene, and investigates the phenotype of a corn plant with changed expression. The specific process is as follows:

1. and constructing a overexpression vector.

The invention uses pCAMBIA3301-pZmUBI-FLAG-nGFP as a skeleton vector to construct ZmCOL14 gene over-expression vector pCAMBIA3301-pZmUBI-FLAG-ZmCOL 14. The method comprises the following specific steps: taking leaves at the 4-leaf stage of the corn, extracting mRNA, carrying out reverse transcription to obtain cDNA, and cloning a ZmCOL14 gene CDS sequence (SEQ ID NO.2) by PCR. BamHI and BstEII are subjected to double enzyme digestion to remove a framework vector GFP sequence, and are connected with a ZmCOL14 cDNA sequence to obtain an over-expression vector pCAMBIA3301-pZmUBI-FLAG-ZmCOL 14. The vector takes pZmUBI as a promoter to drive the overexpression of the ZmCOL14 gene. Meanwhile, the N end of the gene is fused with a3 XFlag protein tag so as to facilitate the protein function research. In addition, the vector carries the Ltp-DsRed expression cassette to facilitate color screening of transformed maize, and the CAMV35S-bar expression cassette is carried for a screening marker in genetic transformation. The figure of the overexpression vector is shown in FIG. 1. The sequence of the expression cassette pZmUBI-3 Xflag-ZmCOL 14-nos is shown in SEQ ID NO. 4.

2. And (4) genetically transforming the corn.

Transferring the vector into agrobacterium strain EHA105 by an electric shock method, and identifying and screening positive clones by PCR. Taking freshly peeled young embryos of a maize inbred line KN5585 with the diameter of about 1mm as a material, putting the peeled maize embryos into a 2mL plastic centrifuge tube containing 1.8mL of suspension, and treating about 150 immature young embryos within 30 min; the suspension was aspirated, the remaining corn embryos placed in a tube and then 1.0mL of Agrobacterium suspension was added and left for 5 min. The young embryos in the centrifuge tube are suspended and poured onto a co-culture medium, and the surplus agrobacterium liquid on the surface is sucked by a liquid transfer device and is cultured for 3 days in the dark at the temperature of 23 ℃. After co-cultivation, the young embryos were transferred to a resting medium, cultured in the dark at 28 ℃ for 6 days, placed on a screening medium containing 5mg/L of Bialaphos, and screened for 2 weeks, and then transferred to a screening medium containing 8mg/L of Bialaphos for 2 weeks. The resistant calli were transferred to differentiation medium 1 and cultured at 25 ℃ under 5000lx light for 1 week. Transferring the callus to a differentiation culture medium 2, and culturing for 2 weeks by illumination; transferring the differentiated plantlets to a rooting culture medium, and culturing at 25 ℃ and 5000lx by illumination until the plantlets are rooted; transferring the plantlets into small pots for growth, transplanting the plantlets into a greenhouse after a certain growth stage, and harvesting progeny seeds after 3-4 months.

3. Character identification of over-expression plant

The 3T 2-generation overexpression transformants 1_6#, 7_3# and 7_6# were phenotypically identified in a summer Jilin (long day environment) and a winter Hainan (short day environment) trial, respectively. The results are shown in tables 1 and 2. Under both long-day and short-day conditions, overexpression of the ZmCOL14 gene resulted in a change in maize flowering phase. Wherein, under the condition of short sunshine, the heading stage, the silking stage and the pollen scattering stage of the positive plants of the 1_6# and 7_3# transformants are obviously delayed compared with the negative control plants; the heading stage and the silking stage of the 7_6# transformant positive plants are obviously delayed compared with those of the negative control plants, and the pollen scattering stage is unchanged, which is probably caused by different insertion positions of the exogenous genes. Under long-day conditions, the heading, spinning and pollen scattering periods of 3 transformant positive plants were significantly delayed from those of the negative control plants, and were more days delayed than those under short-day conditions.

TABLE 1 flowering time trait data for each over-expressed maize material under short-day conditions

Data are expressed as "mean ± standard deviation"; "+" indicates a positive sample, "-" indicates a negative sample; different letters indicate significant differences at the level of p 0.05 between the positive and negative samples of each group of materials.

TABLE 2 flowering time trait data for each over-expressed corn material under long-day conditions

The results show that the ZmCOL14 gene overexpression can cause the delay of the heading stage, the silking stage and the flour loosening stage of the corn.

In addition, the inventors surprisingly found that the plant height and the ear height of the over-expression material planted in Jilin and Hainan test fields are significantly changed, and the plant height and the ear height of 3 positive transformants 1_6#, 7_3# and 7_6# are reduced compared with those of the negative control plants (Table 3 and Table 4). Therefore, the ZmCOL14 gene also has the function of regulating and controlling the plant height and the ear height of the corn in a mode of inhibiting the characters of the plant height and the ear height. This function was not previously anticipated. In general, late flowering of corn results in prolonged vegetative growth with a corresponding increase in plant and ear height. The ZmCOL14 gene is overexpressed, so that the flowering of the corn can be delayed, the plant height and the ear position height of the corn can be reduced (figure 2), and the ZmCOL14 gene can be used for cultivating a new corn variety with late flowers and semi-short stalks.

TABLE 3 plant height and ear height data for each over-expressed corn material (Jilin)

TABLE 4 plant height and ear height data for each over-expressed corn material (Hainan)

Under the conditions of long sunlight and short sunlight, the heading period, the silking period and the pollen scattering period of the two transformants No. 1_6 and No. 7_3 are all obviously delayed, and the plant height and the ear position height are both reduced. Can be screened out as a new late-flowering semi-short-stalk corn germplasm.

Example 2 inhibition of maize ZmCOL14 gene expression

The invention further inhibits the expression of ZmCOL14 gene in a gene editing mode so as to further verify the function of the gene and establish a proper technical scheme. The inhibition of expression is realized by adopting a mode of carrying out site-directed mutation on ZmCOL14 gene by using a CRISPR-Cas9 tool. The implementation process comprises the construction of a gene editing vector, the genetic transformation of corn and the functional verification of editing effect.

The method comprises the following specific steps:

1. and (3) constructing a gene editing vector.

According to the invention, a ccdB sequence in a skeleton vector pCXB053 (constructed by Rice biotechnologies (Jiangsu) Co., Ltd.) is cut out through BsaI enzyme digestion, and a target sequence (totally designing 2 target points, specifically shown in Table 5) is connected between U6 and gRNA through T4 ligase. The specific construction process is as follows:

1) synthesis of primers

Primer TF: ATTGGGGCTCAGAGTGAACCTCC, respectively; primer TR: AAACGGAGGTTCACTCTGAGCCC. Synthesized in Shanghai, dissolved in ultrapure water and mixed uniformly.

2) Allocating an annexing Buffer TE

Tris-Cl PH8.0 10mM

EDTA 0.1mM

NaCl： 50mM

3) Annealing of connections

A connection system:

Annealing Buffer 50μL

Mix Primer 5μL

and (3) connecting procedures:

95℃ 3min

0.1 ℃/s constant speed drop

20℃ 1min

Storing at-20 deg.C

4) The backbone vector was digested with BsaI restriction enzyme

Enzyme digestion system:

after digestion at 37 ℃ for 5h, the product was recovered directly (using the quangen recovery kit).

The recovered product was diluted to 50 ng/. mu.L with water, diluted with an equal amount of T4 Buffer and stored at-20 ℃.

5) T4 enzyme linked

Enzyme linked systems:

enzyme linked procedure:

25 ℃ for 2h (in PCR instrument)

6) Transformation of Escherichia coli

10 mu L of enzyme-linked reaction solution and 100 mu L of escherichia coli 5a are subjected to competence mixing, strictly standing and ice-bath is carried out for 30min, heat shock is carried out for 35s at 42 ℃, ice-bath is carried out for 2min, 500L of antibiotic-free LB is added, and shaking recovery is carried out for 1h at 37 ℃. After centrifugation at 3000g for 1 minute and aspiration of the supernatant, 100. mu.L of the liquid was left to blow-beat the bacterial cells and plated (solid medium containing 50mg/L kanamycin) and cultured in an inverted state at 37 ℃ for 12 hours.

And (4) selecting positive clone sequencing and extracting plasmids. Sequencing verification primer is PUV 3-R: CTGGCGAAAGGGGGATGTGCTGCAA are provided.

2. Genetic transformation of maize

The transformation receptor was KN5585 (inbred line bred by Mimi Biotechnology (Jiangsu) Ltd.), and the detailed procedure was as in example 2.

3. Trait evaluation of Gene-edited plants

Extracting DNA detection gene editing conditions of all T1 generation materials in the seedling stage, and designing a primer amplification target editing section, wherein an amplification system is as follows: DNA: 3 μ L, 1 μ L each of the bidirectional primers, 2 × TaqMix: 7.5 μ L, ddH 2O: 2.5. mu.L, total volume 10. mu.L. The PCR reaction conditions were as follows: (1)94 ℃ for 5 minutes, (2)94 ℃ for 40 seconds, (3)57 ℃ for 30 seconds, (4)72 ℃ for 60 seconds, (5) cycle 35 times from (2) step (4), (6)72 ℃ for 7 minutes, and (7) storage at 4 ℃. PCR product sequencing analysis edit type. Genotype analysis on the target points of the gene editing materials shows that the target points of the ZmCOL14-1, ZmCOL14-2 and ZmCOL14-3 materials are changed, and the frame shift mutation can be caused (Table 5).

TABLE 5 target information for Gene editing and editing genotype of editing Material

Target sequences are underlined, and PAM sequences are in boxes; "-" indicates a base deletion, and bold indicates a base insertion.

The flowering phase traits of the gene editing material were investigated at the Hainan test site. The results show that there were no significant differences in the androgenesis, pollen dispersal and silking periods of the 3 gene-edited materials compared to the unedited control material (table 6), indicating that the flowering phase of maize was not affected after gene knockout under short-day conditions.

TABLE 6 flowering time trait data under short-day conditions for maize gene editing materials

Data are expressed as "mean ± standard deviation"; "+" indicates an edited sample, "-" indicates an unedited sample; different letters indicate significant differences at the level of p 0.05 between each set of material edited samples and unedited samples.

The flowering phase traits of the gene editing material were further investigated at the Jilin test site. The tasseling period and the pollen scattering period of the ZmCOL14-1 gene editing material are earlier than those of an unedited control material, and the spinning period change is not obvious; the tasseling period of the ZmCOL14-2 gene editing material is earlier than that of the unedited control material, and the changes of the spinning period and the pollen scattering period are not obvious; the shattering period of the ZmCOL14-3 gene edited material was earlier than its unedited control material, and neither the silking nor the androgenetic change was significant (Table 7). This demonstrates to some extent the inhibitory effect of ZmCOL14 gene on maize flowering. Due to different target point editing types, different mutant genes have different influence degrees on the flowering phase. The mutant gene of ZmCOL14-1 material had the greatest effect on flowering stage, followed by ZmCOL 14-2.

TABLE 7 flowering phase trait data under long-day conditions for maize gene editing materials

The plant height trait of gene editing was further investigated. The plant height and the ear position height of ZmCOL14-1 and ZmCOL14-2 positive gene editing materials are higher than those of negative control materials; the plant height of the ZmCOL14-3 positive gene editing material was higher than that of the negative control material, and the ear height change was insignificant (table 8). This demonstrates the inhibitory effect of ZmCOL14 gene on maize plant height and ear height. Due to different target point editing types, different mutant genes have different influence degrees on plant height and panicle height. Mutant genes of ZmCOL14-1 and ZmCOL14-2 materials have great influence on plant height and ear height.

TABLE 8 plant height and ear height data of maize Gene editing Material (Jilin)

By integrating the data of plant height, ear position height and flowering period characters, ZmCOL14-1 and ZmCOL14-2 gene editing materials show early flowering high stems under long-day conditions, and the mutant gene sequences of the two materials are shown as SEQ ID NO.5-SEQ ID NO. 6. Any one of the two mutant genes is introduced into other corn materials, so that the early flowering phase and the increase of the plant height spike position can be realized under the long-day condition, and the early flowering high-stalk corn variety suitable for being planted under the long-day condition can be cultivated.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Jilin province academy of agricultural sciences, Huazhong university of agriculture, Miami Biotechnology (Jiangsu) Ltd

<120> gene ZmCOL14 for controlling plant height and ear height of corn and application thereof

<130> 1

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6236

<212> DNA

<213> Zea mays

<400> 1

cacgtcctct tccagtctcc actctccacg tgttccatcc cattctcctc cccgcgcccc 60

gtccccctcg cctcgcttat cccccggacc cggccgaccc ctgctctgct cgacgtgttg 120

gcaaaacctc ctcctagtcc tctcgcagaa ggagcttgtt ttctttaccg gcgcggcaac 180

agcgaaagct tctcgatctc tctccccgct gctccgccgc tgggtacggt ggttccgcgc 240

ctcggacgcg cccgtgcggg ttggttggat ccgagctctg tgcagaagcg ccgccgcgac 300

acggtcggtg agcgctcttt ctggctgctg ttttcatcgc gagcttggat tcagacattc 360

ggtgccgtcc atgcaagggg tagacggatt tgggtgagga gtctattgct tcttcgatcg 420

gggattgagt gtttggtcta ccgtccttgt ttatttagct cgtcggtgtt ccagggagtt 480

cgacgtgtat gggtgtagtg tgttgggctg acaagtctga actctatttt ttttcctttc 540

tttcctcttt gcggacactt cacgttttta ttccgtgtcg cgtagaccgt acgcgagtgg 600

ttcggtttgt ttgatttcgc ccttgcgcag gcggcctcag ctgctaaagt cttgattaac 660

cccgtctaat tgcttgtatc tgcagccagt tcatctggaa agggttttat ctgttctttt 720

acaaaggttg cttttgccta ctgacgcgtg aatatcgaat agtgatgata gtatattcgc 780

gctttgcttg tacgtgtctg tactctgttg tcccttctgt tcaaagcggc aactattcat 840

ctgcgtcgaa agggaatcct tttgcagcgt gaatttgact gttcttgagc gaaatttgcc 900

gcgtttattt gagtggcgca gagagtccgc tggcttccag ccttccacga gtagccggca 960

agcgaccaga tagagggaaa aaagagaggg ttagtggtgc actggtgctt aacacctgta 1020

tttgttgtac ctgaagtttg gcatatggcc acttattctg tgccacactt accggtcatg 1080

tgcatggaaa gcgtccattc gatatgccaa gatatgaaca tgccacttaa aatgataact 1140

tgggaccagg gagccatttg caatagaggt cgcaaaaagt ttggttgcac ttcgtcctat 1200

ttgtctctca ctcactcagt cactcctatg tgctgatatg ctgtgctaag ctggcatgaa 1260

agactcttga cttcttcaga gcattgatgc caattgcaat aaaagcgttt gtttgtctcc 1320

aagatgacta ttcatcactc tatctttcgg tggtaccaaa tgcattatgg tcactctatt 1380

tgaaggtctt ttgaatttac tctgcttacc tcccccttat gctttacaga gattatatgc 1440

tttgccaata gcgtagtccc aaattatgga agccccctta gattacatgt ctgtacttct 1500

attctgaaac ttcttgtagt tatctaatgc gctggctgac agatatagga agaatatcta 1560

aatctcaaat tttctgtgag ggcctcaggg gaagcgtcct atgtagctaa atgagggagc 1620

ggttctgtgt tatctatggg tgacaatgag ctctaaattt tacactataa gatttaatga 1680

tcggatcata ttaggatcag gccctaccat tttgtgaaga agcatttgga ttgtaatcca 1740

ttaccatccc tagtgttatc ataagactgt cactagctcg tggcagagtg tatgtagatg 1800

catatttttg ctgatgtgga acagaatagg tatctgtttg catggcctgg ggaaaagttg 1860

ccaatttttc tcaatactca aattttgtct ctatgcgaaa cagtcagaag taactatagg 1920

tttgctgtat tgttactcat tgtttacttc ttaatgcttg tatcacatag aattccactg 1980

gatccagctg ctgaacgggg taccagaagg tggatttggt agtagcactg aacagcgagt 2040

ggaatttctc taatactgtc caggatcatg gttcctctct gtggtttctg tgggaaacaa 2100

aggtcaatga tctactgcag atcggatgcg gcatcattgt gcttatcatg cgaccgtagc 2160

gttcattcag ctaatgcact gtctcggcgt catagaagga cccttctttg tgatcgttgt 2220

ggtttacagc ctgcatcagt ccgatgtctt gaggacaaca catcactttg ccaaaactgt 2280

gattggaatg ggcatgatgc agcatcaggg gcttctgggc ataaaaggca ggccataaac 2340

tgttactcag ggtgcccatc atcagcagag ctttcgagaa tctggtcatt tattatcgat 2400

atcccgactg tagctgctga gcccaactgt gaggatgggc taagcatgat gacaattgat 2460

gacagtgatg tgactaatca tcacggtgct tcagatgata aacgattgtt ggaaatagct 2520

aacacagcac tcatgagtga tccaccttca cctgacaagc ttaaacctct gataggctct 2580

tcttctggag atgggtttga tgttctgcct ctagccacag atcagcctgc tggaccagtt 2640

tcagcgacac ctaaggtgcg atgtgccttt tcattttttc ctccaagaat gtttctgaac 2700

gttgtgcttt gttttttgca tgtcaaaaga cttgttgctt atggcatgca agttacgtac 2760

acatataaaa taaagaatgt tttcatatga atatagcata aacatgtagc ttggttactg 2820

tttcagtctt gcatcagcac agaaagtagt acgtggaaat tattccttag tgatgattcc 2880

cttttctcta tttaacactg cctgtctgtt ttttcctgct gagctctcaa tgcccaagta 2940

tgttcttttt acaatgaaaa ttccattttt gtaacaagtt attagataca tttgcgtcaa 3000

tggacagttg caagttgcat tggttcgtat tgtttcagat cttgtttatc accagtccct 3060

ttttaaagaa aaatatgatc tattgtcgtt gtattcttat cagatgcttg ttacatctct 3120

caggtacctt atgccagaga tgacaataag ttcaatgatg gcatgtatga agacttatgt 3180

gtggatgatg ctgacctgac attcgagaat tatgaagagc tattcggtac ctctcacatt 3240

cgaatagagg aactctttga tgacgccgga attgacagtt actttgaaat gaaggaaaca 3300

ccgccttttg atttcaatga ggtatgtact attcttctat actctttgtg attctaaatt 3360

agtgacattt taggatatca acatagtcta gaaggtgtca attcggctag ggatttctat 3420

gaaaatatgg cagttcatac aaagctaact aagtgctata aaattacttc atgtaacatg 3480

tatcttacac tgtcaaagca cacaactatc atatctgatg gccgaagtat atattttcat 3540

ttgaaatttt cctcaagctc atgcatcgtc tacaccaact tgccgagcca tcctgggacc 3600

tgggtagctt gggcccaatc cgatgacagg aacaaacctg caggggatca ctggaatcac 3660

ctccagaccc ttctccccct ctaccgggcc atcacttcgg tctgtgttgg aaatggcacg 3720

accacatcgt tctggttgga cgactggctc ccctttgacc cgatcgtgga acacctgcca 3780

gatctcgatc cgcagccatg tgacatgttg aaccaactgt tagccaggtt atgcaaactg 3840

gtgtgatcaa caacctgaga actcgcctca gtcgaactgc ccaacgggag aggccattct 3900

ccaacttgct ctgaacaacg tggatatcac tgatctgcca gatcagcgcc ggaggtcccc 3960

tcattgacag cactggcaag ttgcactccg gagcccttta cacaatgatc caatctctgt 4020

cagcccccaa cctagaggag cctgactttg tgtggaacgg ttgaagctct ttatgtggct 4080

cctcaatcaa agcaaaatca accacaaagt aagcttggtc gagaaaggtg tgattgccaa 4140

ccccatctgt gacctctgcc ttcaagcaga cgaagactgc caccacatct tcctctgacc 4200

tctggtgcca ctatgcagct tccttctggc acagcgtcgg gggtccaaat cccccctgga 4260

cctgacaacg tccaagctct gggatatcac cctcccacct gcacctgctg ccccacgaca 4320

ccagagcgct ctcgtccatc tttgctgctg ggccatttgg aaacaccgga acaacgtcgt 4380

cttcaaccaa acgcttcctt cagttcagag aatccgaaga cagtgccttg aagaagctag 4440

attctggaga tgtagaatta gaggcgactc tagcgaaata gacgcatggt gtaatctctt 4500

cattagcatg taccttgaaa caccccctcc ccccctgtgt tgtaaccccg gctaccttgc 4560

tgctcctatc aatcaatata ttaaaatcag gtggggacaa tcgtcccccc tataaaaaaa 4620

actgtgggaa agagagctcc tgtgcttagt tccccaacct acttgtagtt ggccagggtt 4680

agtttatttt cttacctcag ttgttattta tggtttctgt taatttcact catcaagcct 4740

gagttcagga cattttggca cttgaagtat tataagttta ttttccatcc atagaatacc 4800

ctattttttt aacaaaactc aataaatatt attatataca caaaaagatc aaatgttgtt 4860

gctttactaa aattcttggt cattttttat gttttcagca gcccaaaatt gtgcagctac 4920

aatgtagcga tgtggtacca gctgattgtg cgatgtcaaa cacaggggaa agggctgatt 4980

ccagcctttg tattcctgtt aggcaggtca gatctagtat atcccatccc ttatctggtt 5040

tgactggtga gagcagcgct ggagatcacc aagactgtgg ggtgtcacca attctcctca 5100

tgggcgagcc accctggtat tctcctggtc cagaaggctc attagctgga ggaagcagag 5160

atagtgctct cacacgatac aaggagaaga agaagaaaag aatgtaagca cgtttaaatg 5220

tctgcttgag gttgttctgc gcttaacatt catagatcgt ggctatcttt ttaaggcaaa 5280

aaaatgtctc caaccttctg tgtctcttgt ttctagtttc gataatgcat tttccttgca 5340

gaagtcgctg attcaccttt ccttttcacg aatttggtcg acaggtttga caagaagatc 5400

agatatgctt ctcgcaaggc tagggcagac gtgaggaaga gggtcaaggg acggtttata 5460

aaggctggcg aagcgtatga ctatgatcca ctaagtcaaa ctagaagcta ctgagactgc 5520

tgagccttga atgcggctgc ttgttgatcg tccagtgtca gcctagcaaa tcttcaacgg 5580

ctcgtctgtt gtaggtcgtt gcgctacagg caagattact ggagagcaca gcgattgcaa 5640

atttgcaatg cacgcatcag agcctgcagt tgaaatacga aaaaaaaagg ttaagaagag 5700

gtaccaaggg ttgggatgaa tgaaaaaaaa ggaaatacga cgcgaacttg ccggacgcct 5760

tgtggtttgg atggagcata catattcatt cttcagttca tctgcagatg agagtgattt 5820

ggatcagctc tgccgtctgt gcgttgaaca gatgcagtta tgggcgctcg tcctccggct 5880

gtgtctaccg ctgcgtgcaa ggacctgcgt cggccacggt gttcggcagt gagctgccag 5940

gattttacag tctgggtaac agcctaacag gatcccctta tttattacct cccagcttgc 6000

gctctgtaac aatattattt gtgaagcaca acattctctt gtcaggagat tgttttcgat 6060

cgtgtgttta tgtttgtaga tggacgcaat attggtaaaa agaagtagcc gtcatgaagt 6120

gtgttcttgt cggatcgcat atagcactgg ggatgagcag gagaatcaca catatttcat 6180

ctggacgtcg aacctctaac tattctatgc cagagtaacc ttcttgtgct ttgtca 6236

<210> 2

<211> 1943

<212> DNA

<213> Artificial Synthesis (unknown)

<400> 2

atggttcctc tctgtggttt ctgtgggaaa caaaggtcaa tgatctactg cagatcggat 60

gcggcatcat tgtgcttatc atgcgaccgt agcgttcatt cagctaatgc actgtctcgg 120

cgtcatagaa ggacccttct ttgtgatcgt tgtggtttac agcctgcatc agtccgatgt 180

cttgaggaca acacatcact ttgccaaaac tgtgattgga atgggcatga tgcagcatca 240

ggggcttctg ggcataaaag gcaggccata aactgttact cagggtgccc atcatcagca 300

gagctttcga gaatctggtc atttattatc gatatcccga ctgtagctgc tgagcccaac 360

tgtgaggatg ggctaagcat gatgacaatt gatgacagtg atgtgactaa tcatcacggt 420

gcttcagatg ataaacgatt gttggaaata gctaacacag cactcatgag tgatccacct 480

tcacctgaca agcttaaacc tctgataggc tcttcttctg gagatgggtt tgatgttctg 540

cctctagcca cagatcagcc tgctggacca gtttcagcga cacctaaggt accttatgcc 600

agagatgaca ataagttcaa tgatggcatg tatgaagact tatgtgtgga tgatgctgac 660

ctgacattcg agaattatga agagctattc ggtacctctc acattcgaat agaggaactc 720

tttgatgacg ccggaattga cagttacttt gaaatgaagg aaacaccgcc ttttgatttc 780

aatgagcagc ccaaaattgt gcagctacaa tgtagcgatg tggtaccagc tgattgtgcg 840

atgtcaaaca caggggaaag ggctgattcc agcctttgta ttcctgttag gcaggtcaga 900

tctagtatat cccatccctt atctggtttg actggtgaga gcagcgctgg agatcaccaa 960

gactgtgggg tgtcaccaat tctcctcatg ggcgagccac cctggtattc tcctggtcca 1020

gaaggctcat tagctggagg aagcagagat agtgctctca cacgatacaa ggagaagaag 1080

aagaaaagaa tgtttgacaa gaagatcaga tatgcttctc gcaaggctag ggcagacgtg 1140

aggaagaggg tcaagggacg gtttataaag gctggcgaag cgtatgacta tgatccacta 1200

agtcaaacta gaagctactg agactgctga gccttgaatg cggctgcttg ttgatcgtcc 1260

agtgtcagcc tagcaaatct tcaacggctc gtctgttgta ggtcgttgcg ctacaggcaa 1320

gattactgga gagcacagcg attgcaaatt tgcaatgcac gcatcagagc ctgcagttga 1380

aatacgaaaa aaaaaggtta agaagaggta ccaagggttg ggatgaatga aaaaaaagga 1440

aatacgacgc gaacttgccg gacgccttgt ggtttggatg gagcatacat attcattctt 1500

cagttcatct gcagatgaga gtgatttgga tcagctctgc cgtctgtgcg ttgaacagat 1560

gcagttatgg gcgctcgtcc tccggctgtg tctaccgctg cgtgcaagga cctgcgtcgg 1620

ccacggtgtt cggcagtgag ctgccaggat tttacagtct gggtaacagc ctaacaggat 1680

ccccttattt attacctccc agcttgcgct ctgtaacaat attatttgtg aagcacaaca 1740

ttctcttgtc aggagattgt tttcgatcgt gtgtttatgt ttgtagatgg acgcaatatt 1800

ggtaaaaaga agtagccgtc atgaagtgtg ttcttgtcgg atcgcatata gcactgggga 1860

tgagcaggag aatcacacat atttcatctg gacgtcgaac ctctaactat tctatgccag 1920

agtaaccttc ttgtgctttg tca 1943

<210> 3

<211> 406

<212> PRT

<213> Zea mays

<400> 3

Met Val Pro Leu Cys Gly Phe Cys Gly Lys Gln Arg Ser Met Ile Tyr

1 5 10 15

Cys Arg Ser Asp Ala Ala Ser Leu Cys Leu Ser Cys Asp Arg Ser Val

20 25 30

His Ser Ala Asn Ala Leu Ser Arg Arg His Arg Arg Thr Leu Leu Cys

35 40 45

Asp Arg Cys Gly Leu Gln Pro Ala Ser Val Arg Cys Leu Glu Asp Asn

50 55 60

Thr Ser Leu Cys Gln Asn Cys Asp Trp Asn Gly His Asp Ala Ala Ser

65 70 75 80

Gly Ala Ser Gly His Lys Arg Gln Ala Ile Asn Cys Tyr Ser Gly Cys

85 90 95

Pro Ser Ser Ala Glu Leu Ser Arg Ile Trp Ser Phe Ile Ile Asp Ile

100 105 110

Pro Thr Val Ala Ala Glu Pro Asn Cys Glu Asp Gly Leu Ser Met Met

115 120 125

Thr Ile Asp Asp Ser Asp Val Thr Asn His His Gly Ala Ser Asp Asp

130 135 140

Lys Arg Leu Leu Glu Ile Ala Asn Thr Ala Leu Met Ser Asp Pro Pro

145 150 155 160

Ser Pro Asp Lys Leu Lys Pro Leu Ile Gly Ser Ser Ser Gly Asp Gly

165 170 175

Phe Asp Val Leu Pro Leu Ala Thr Asp Gln Pro Ala Gly Pro Val Ser

180 185 190

Ala Thr Pro Lys Val Pro Tyr Ala Arg Asp Asp Asn Lys Phe Asn Asp

195 200 205

Gly Met Tyr Glu Asp Leu Cys Val Asp Asp Ala Asp Leu Thr Phe Glu

210 215 220

Asn Tyr Glu Glu Leu Phe Gly Thr Ser His Ile Arg Ile Glu Glu Leu

225 230 235 240

Phe Asp Asp Ala Gly Ile Asp Ser Tyr Phe Glu Met Lys Glu Thr Pro

245 250 255

Pro Phe Asp Phe Asn Glu Gln Pro Lys Ile Val Gln Leu Gln Cys Ser

260 265 270

Asp Val Val Pro Ala Asp Cys Ala Met Ser Asn Thr Gly Glu Arg Ala

275 280 285

Asp Ser Ser Leu Cys Ile Pro Val Arg Gln Val Arg Ser Ser Ile Ser

290 295 300

His Pro Leu Ser Gly Leu Thr Gly Glu Ser Ser Ala Gly Asp His Gln

305 310 315 320

Asp Cys Gly Val Ser Pro Ile Leu Leu Met Gly Glu Pro Pro Trp Tyr

325 330 335

Ser Pro Gly Pro Glu Gly Ser Leu Ala Gly Gly Ser Arg Asp Ser Ala

340 345 350

Leu Thr Arg Tyr Lys Glu Lys Lys Lys Lys Arg Met Phe Asp Lys Lys

355 360 365

Ile Arg Tyr Ala Ser Arg Lys Ala Arg Ala Asp Val Arg Lys Arg Val

370 375 380

Lys Gly Arg Phe Ile Lys Ala Gly Glu Ala Tyr Asp Tyr Asp Pro Leu

385 390 395 400

Ser Gln Thr Arg Ser Tyr

405

<210> 4

<211> 3334

<212> DNA

<213> Artificial Synthesis (unknown)

<400> 4

agtattttga caacaggact ctacagtttt atctttttag tgtgcatgtg ttctcctttt 60

tttttgcaaa tagcttcacc tatataatac ttcatccatt ttattagtac atccatttag 120

ggtttagggt taatggtttt tatagactaa tttttttagt acatctattt tattctattt 180

tagcctctaa attaagaaaa ctaaaactct attttagttt ttttatttaa taatttagat 240

ataaaataga ataaaataaa gtgactaaaa attaaacaaa taccctttaa gaaattaaaa 300

aaactaagga aacatttttc ttgtttcgag tagataatgc cagcctgtta aacgccgtcg 360

acgagtctaa cggacaccaa ccagcgaacc agcagcgtcg cgtcgggcca agcgaagcag 420

acggcacggc atctctgtcg ctgcctctgg acccctctcg agagttccgc tccaccgttg 480

gacttgctcc gctgtcggca tccagaaatt gcgtggcgga gcggcagacg tgagccggca 540

cggcaggcgg cctcctcctc ctctcacggc accggcagct acgggggatt cctttcccac 600

cgctccttcg ctttcccttc ctcgcccgcc gtaataaata gacaccccct ccacaccctc 660

tttccccaac ctcgtgttgt tcggagcgca cacacacaca accagatctc ccccaaatcc 720

acccgtcggc acctccgctt caaggtacgc cgctcgtcct cccccccccc ccctctctac 780

cttctctaga tcggcgttcc ggtccatggt tagggcccgg tagttctact tctgttcatg 840

tttgtgttag atccgtgttt gtgttagatc cgtgctgcta gcgttcgtac acggatgcga 900

cctgtacgtc agacacgttc tgattgctaa cttgccagtg tttctctttg gggaatcctg 960

ggatggctct agccgttccg cagacgggat cgatttcatg attttttttg tttcgttgca 1020

tagggtttgg tttgcccttt tcctttattt caatatatgc cgtgcacttg tttgtcgggt 1080

catcttttca tgcttttttt tgtcttggtt gtgatgatgt ggtctggttg ggcggtcgtt 1140

ctagatcgga gtagaattct gtttcaaact acctggtgga tttattaatt ttggatctgt 1200

atgtgtgtgc catacatatt catagttacg aattgaagat gatggatgga aatatcgatc 1260

taggataggt atacatgttg atgcgggttt tactgatgca tatacagaga tgctttttgt 1320

tcgcttggtt gtgatgatgt ggtgtggttg ggcggtcgtt cattcgttct agatcggagt 1380

agaatactgt ttcaaactac ctggtgtatt tattaatttt ggaactgtat gtgtgtgtca 1440

tacatcttca tagttacgag tttaagatgg atggaaatat cgatctagga taggtataca 1500

tgttgatgtg ggttttactg atgcatatac atgatggcat atgcagcatc tattcatatg 1560

ctctaacctt gagtacctat ctattataat aaacaagtat gttttataat tattttgatc 1620

ttgatatact tggatgatgg catatgcagc agctatatgt ggattttttt agccctgcct 1680

tcatacgcta tttatttgct tggtactgtt tcttttgtcg atgctcaccc tgttgtttgg 1740

tgttacttct gcagggatct atggattaca aagatcacga tggagattac aaagatcacg 1800

atatagatta caaggatgat gatgataaag gatccatggt tcctctctgt ggtttctgtg 1860

ggaaacaaag gtcaatgatc tactgcagat cggatgcggc atcattgtgc ttatcatgcg 1920

accgtagcgt tcattcagct aatgcactgt ctcggcgtca tagaaggacc cttctttgtg 1980

atcgttgtgg tttacagcct gcatcagtcc gatgtcttga ggacaacaca tcactttgcc 2040

aaaactgtga ttggaatggg catgatgcag catcaggggc ttctgggcat aaaaggcagg 2100

ccataaactg ttactcaggg tgcccatcat cagcagagct ttcgagaatc tggtcattta 2160

ttatcgatat cccgactgta gctgctgagc ccaactgtga ggatgggcta agcatgatga 2220

caattgatga cagtgatgtg actaatcatc acggtgcttc agatgataaa cgattgttgg 2280

aaatagctaa cacagcactc atgagtgatc caccttcacc tgacaagctt aaacctctga 2340

taggctcttc ttctggagat gggtttgatg ttctgcctct agccacagat cagcctgctg 2400

gaccagtttc agcgacacct aaggtacctt atgccagaga tgacaataag ttcaatgatg 2460

gcatgtatga agacttatgt gtggatgatg ctgacctgac attcgagaat tatgaagagc 2520

tattcggtac ctctcacatt cgaatagagg aactctttga tgacgccgga attgacagtt 2580

actttgaaat gaaggaaaca ccgccttttg atttcaatga gcagcccaaa attgtgcagc 2640

tacaatgtag cgatgtggta ccagctgatt gtgcgatgtc aaacacaggg gaaagggctg 2700

attccagcct ttgtattcct gttaggcagg tcagatctag tatatcccat cccttatctg 2760

gtttgactgg tgagagcagc gctggagatc accaagactg tggggtgtca ccaattctcc 2820

tcatgggcga gccaccctgg tattctcctg gtccagaagg ctcattagct ggaggaagca 2880

gagatagtgc tctcacacga tacaaggaga agaagaagaa aagaatgttt gacaagaaga 2940

tcagatatgc ttctcgcaag gctagggcag acgtgaggaa gagggtcaag ggacggttta 3000

taaaggctgg cgaagcgtat gactatgatc cactaagtca aactagaagc tactgaggtg 3060

accagctcga atttccccga tcgttcaaac atttggcaat aaagtttctt aagattgaat 3120

cctgttgccg gtcttgcgat gattatcata taatttctgt tgaattacgt taagcatgta 3180

ataattaaca tgtaatgcat gacgttattt atgagatggg tttttatgat tagagtcccg 3240

caattataca tttaatacgc gatagaaaac aaaatatagc gcgcaaacta ggataaatta 3300

tcgcgcgcgg tgtcatctat gttactagat cggg 3334

<210> 5

<211> 6219

<212> DNA

<213> Zea mays

<400> 5

cacgtcctct tccagtctcc actctccacg tgttccatcc cattctcctc cccgcgcccc 60

gtccccctcg cctcgcttat cccccggacc cggccgaccc ctgctctgct cgacgtgttg 120

gcaaaacctc ctcctagtcc tctcgcagaa ggagcttgtt ttctttaccg gcgcggcaac 180

agcgaaagct tctcgatctc tctccccgct gctccgccgc tgggtacggt ggttccgcgc 240

ctcggacgcg cccgtgcggg ttggttggat ccgagctctg tgcagaagcg ccgccgcgac 300

acggtcggtg agcgctcttt ctggctgctg ttttcatcgc gagcttggat tcagacattc 360

ggtgccgtcc atgcaagggg tagacggatt tgggtgagga gtctattgct tcttcgatcg 420

gggattgagt gtttggtcta ccgtccttgt ttatttagct cgtcggtgtt ccagggagtt 480

cgacgtgtat gggtgtagtg tgttgggctg acaagtctga actctatttt ttttcctttc 540

tttcctcttt gcggacactt cacgttttta ttccgtgtcg cgtagaccgt acgcgagtgg 600

ttcggtttgt ttgatttcgc ccttgcgcag gcggcctcag ctgctaaagt cttgattaac 660

cccgtctaat tgcttgtatc tgcagccagt tcatctggaa agggttttat ctgttctttt 720

acaaaggttg cttttgccta ctgacgcgtg aatatcgaat agtgatgata gtatattcgc 780

gctttgcttg tacgtgtctg tactctgttg tcccttctgt tcaaagcggc aactattcat 840

ctgcgtcgaa agggaatcct tttgcagcgt gaatttgact gttcttgagc gaaatttgcc 900

gcgtttattt gagtggcgca gagagtccgc tggcttccag ccttccacga gtagccggca 960

agcgaccaga tagagggaaa aaagagaggg ttagtggtgc actggtgctt aacacctgta 1020

tttgttgtac ctgaagtttg gcatatggcc acttattctg tgccacactt accggtcatg 1080

tgcatggaaa gcgtccattc gatatgccaa gatatgaaca tgccacttaa aatgataact 1140

tgggaccagg gagccatttg caatagaggt cgcaaaaagt ttggttgcac ttcgtcctat 1200

ttgtctctca ctcactcagt cactcctatg tgctgatatg ctgtgctaag ctggcatgaa 1260

agactcttga cttcttcaga gcattgatgc caattgcaat aaaagcgttt gtttgtctcc 1320

aagatgacta ttcatcactc tatctttcgg tggtaccaaa tgcattatgg tcactctatt 1380

tgaaggtctt ttgaatttac tctgcttacc tcccccttat gctttacaga gattatatgc 1440

tttgccaata gcgtagtccc aaattatgga agccccctta gattacatgt ctgtacttct 1500

attctgaaac ttcttgtagt tatctaatgc gctggctgac agatatagga agaatatcta 1560

aatctcaaat tttctgtgag ggcctcaggg gaagcgtcct atgtagctaa atgagggagc 1620

ggttctgtgt tatctatggg tgacaatgag ctctaaattt tacactataa gatttaatga 1680

tcggatcata ttaggatcag gccctaccat tttgtgaaga agcatttgga ttgtaatcca 1740

ttaccatccc tagtgttatc ataagactgt cactagctcg tggcagagtg tatgtagatg 1800

catatttttg ctgatgtgga acagaatagg tatctgtttg catggcctgg ggaaaagttg 1860

ccaatttttc tcaatactca aattttgtct ctatgcgaaa cagtcagaag taactatagg 1920

tttgctgtat tgttactcat tgtttacttc ttaatgcttg tatcacatag aattccactg 1980

gatccagctg ctgaacgggg taccagaagg tggatttggt agtagcactg aacagcgagt 2040

ggaatttctc taatactgtc caggatcatg gttcctctct gtggtttctg tgggaaacaa 2100

aggtcaatga tctactgcag atcggatgcg gcatcattgt gcttatcatg cgaccgtagc 2160

gttcattcag ctaatgcact gtctcggcgt catagaagga cccttctttg tgatcgttgt 2220

ggtttacagc ctgcatcagt ccgatgtctt gaggacaaca catcactttg ccaaaactgt 2280

gattggaatg ggcatgatgc agcatcaggg gcttctgggc ataaaaggca ggccataaac 2340

tgttactcag ggtgcccatc atcagcagag ctttcgagaa tctggtcatt tattatcgat 2400

atcccgactg tagctgctga gcccaactgt gaggatgggc taagcatgat gacaattgat 2460

gacagtgatg tgactaatca tcacggtgct tcagatgata aacgattgtt ggaaatagct 2520

aacacagcac tcatgagtga tccaccttca cctgacaagc ttaaacctct gataggctct 2580

tcttctggag atgggtttga tgttctgcct ctagccacag atcagcctgc tggaccagtt 2640

tcagcgacac ctaaggtgcg atgtgccttt tcattttttc ctccaagaat gtttctgaac 2700

gttgtgcttt gttttttgca tgtcaaaaga cttgttgctt atggcatgca agttacgtac 2760

acatataaaa taaagaatgt tttcatatga atatagcata aacatgtagc ttggttactg 2820

tttcagtctt gcatcagcac agaaagtagt acgtggaaat tattccttag tgatgattcc 2880

cttttctcta tttaacactg cctgtctgtt ttttcctgct gagctctcaa tgcccaagta 2940

tgttcttttt acaatgaaaa ttccattttt gtaacaagtt attagataca tttgcgtcaa 3000

tggacagttg caagttgcat tggttcgtat tgtttcagat cttgtttatc accagtccct 3060

ttttaaagaa aaatatgatc tattgtcgtt gtattcttat cagatgcttg ttacatctct 3120

caggtacctt atgccagaga tgacaataag ttcaatgatg gcatgtatga agacttatgt 3180

gtggatgatg ctgacctgac attcgagaat tatgaagagc tattcggtac ctctcacatt 3240

cgaatagagg aactctttga tgacgccgga attgacagtt actttgaaat gaaggaaaca 3300

ccgccttttg atttcaatga ggtatgtact attcttctat actctttgtg attctaaatt 3360

agtgacattt taggatatca acatagtcta gaaggtgtca attcggctag ggatttctat 3420

gaaaatatgg cagttcatac aaagctaact aagtgctata aaattacttc atgtaacatg 3480

tatcttacac tgtcaaagca cacaactatc atatctgatg gccgaagtat atattttcat 3540

ttgaaatttt cctcaagctc atgcatcgtc tacaccaact tgccgagcca tcctgggacc 3600

tgggtagctt gggcccaatc cgatgacagg aacaaacctg caggggatca ctggaatcac 3660

ctccagaccc ttctccccct ctaccgggcc atcacttcgg tctgtgttgg aaatggcacg 3720

accacatcgt tctggttgga cgactggctc ccctttgacc cgatcgtgga acacctgcca 3780

gatctcgatc cgcagccatg tgacatgttg aaccaactgt tagccaggtt atgcaaactg 3840

gtgtgatcaa caacctgaga actcgcctca gtcgaactgc ccaacgggag aggccattct 3900

ccaacttgct ctgaacaacg tggatatcac tgatctgcca gatcagcgcc ggaggtcccc 3960

tcattgacag cactggcaag ttgcactccg gagcccttta cacaatgatc caatctctgt 4020

cagcccccaa cctagaggag cctgactttg tgtggaacgg ttgaagctct ttatgtggct 4080

cctcaatcaa agcaaaatca accacaaagt aagcttggtc gagaaaggtg tgattgccaa 4140

ccccatctgt gacctctgcc ttcaagcaga cgaagactgc caccacatct tcctctgacc 4200

tctggtgcca ctatgcagct tccttctggc acagcgtcgg gggtccaaat cccccctgga 4260

cctgacaacg tccaagctct gggatatcac cctcccacct gcacctgctg ccccacgaca 4320

ccagagcgct ctcgtccatc tttgctgctg ggccatttgg aaacaccgga acaacgtcgt 4380

cttcaaccaa acgcttcctt cagttcagag aatccgaaga cagtgccttg aagaagctag 4440

aattagaggc gactctagcg aaatagacgc atggtgtaat ctcttcatta gcatgtacct 4500

tgaaacaccc cctccccccc tgtgttgtaa ccccggctac cttgctgctc ctatcaatca 4560

atatattaaa atcaggtggg gacaatcgtc ccccctataa aaaaaactgt gggaaagaga 4620

gctcctgtgc ttagttcccc aacctacttg tagttggcca gggttagttt attttcttac 4680

ctcagttgtt atttatggtt tctgttaatt tcactcatca agcctgagtt caggacattt 4740

tggcacttga agtattataa gtttattttc catccataga ataccctatt tttttaacaa 4800

aactcaataa atattattat atacacaaaa agatcaaatg ttgttgcttt actaaaattc 4860

ttggtcattt tttatgtttt cagcagccca aaattgtgca gctacaatgt agatgtggta 4920

ccagctgatt gtgcgatgtc aaacacaggg gaaagggctg attccagcct ttgtattcct 4980

gttaggcagg tcagatctag tatatcccat cccttatctg gtttgactgg tgagagcagc 5040

gctggagatc accaagactg tggggtgtca ccaattctcc tcatgggcga gccaccctgg 5100

tattctcctg gtccagaagg ctcattagct ggaggaagca gagatagtgc tctcacacga 5160

tacaaggaga agaagaagaa aagaatgtaa gcacgtttaa atgtctgctt gaggttgttc 5220

tgcgcttaac attcatagat cgtggctatc tttttaaggc aaaaaaatgt ctccaacctt 5280

ctgtgtctct tgtttctagt ttcgataatg cattttcctt gcagaagtcg ctgattcacc 5340

tttccttttc acgaatttgg tcgacaggtt tgacaagaag atcagatatg cttctcgcaa 5400

ggctagggca gacgtgagga agagggtcaa gggacggttt ataaaggctg gcgaagcgta 5460

tgactatgat ccactaagtc aaactagaag ctactgagac tgctgagcct tgaatgcggc 5520

tgcttgttga tcgtccagtg tcagcctagc aaatcttcaa cggctcgtct gttgtaggtc 5580

gttgcgctac aggcaagatt actggagagc acagcgattg caaatttgca atgcacgcat 5640

cagagcctgc agttgaaata cgaaaaaaaa aggttaagaa gaggtaccaa gggttgggat 5700

gaatgaaaaa aaaggaaata cgacgcgaac ttgccggacg ccttgtggtt tggatggagc 5760

atacatattc attcttcagt tcatctgcag atgagagtga tttggatcag ctctgccgtc 5820

tgtgcgttga acagatgcag ttatgggcgc tcgtcctccg gctgtgtcta ccgctgcgtg 5880

caaggacctg cgtcggccac ggtgttcggc agtgagctgc caggatttta cagtctgggt 5940

aacagcctaa caggatcccc ttatttatta cctcccagct tgcgctctgt aacaatatta 6000

tttgtgaagc acaacattct cttgtcagga gattgttttc gatcgtgtgt ttatgtttgt 6060

agatggacgc aatattggta aaaagaagta gccgtcatga agtgtgttct tgtcggatcg 6120

catatagcac tggggatgag caggagaatc acacatattt catctggacg tcgaacctct 6180

aactattcta tgccagagta accttcttgt gctttgtca 6219

<210> 6

<211> 6229

<212> DNA

<213> Zea mays

<400> 6

cacgtcctct tccagtctcc actctccacg tgttccatcc cattctcctc cccgcgcccc 60

gtccccctcg cctcgcttat cccccggacc cggccgaccc ctgctctgct cgacgtgttg 120

gcaaaacctc ctcctagtcc tctcgcagaa ggagcttgtt ttctttaccg gcgcggcaac 180

agcgaaagct tctcgatctc tctccccgct gctccgccgc tgggtacggt ggttccgcgc 240

ctcggacgcg cccgtgcggg ttggttggat ccgagctctg tgcagaagcg ccgccgcgac 300

acggtcggtg agcgctcttt ctggctgctg ttttcatcgc gagcttggat tcagacattc 360

ggtgccgtcc atgcaagggg tagacggatt tgggtgagga gtctattgct tcttcgatcg 420

gggattgagt gtttggtcta ccgtccttgt ttatttagct cgtcggtgtt ccagggagtt 480

cgacgtgtat gggtgtagtg tgttgggctg acaagtctga actctatttt ttttcctttc 540

tttcctcttt gcggacactt cacgttttta ttccgtgtcg cgtagaccgt acgcgagtgg 600

ttcggtttgt ttgatttcgc ccttgcgcag gcggcctcag ctgctaaagt cttgattaac 660

cccgtctaat tgcttgtatc tgcagccagt tcatctggaa agggttttat ctgttctttt 720

acaaaggttg cttttgccta ctgacgcgtg aatatcgaat agtgatgata gtatattcgc 780

gctttgcttg tacgtgtctg tactctgttg tcccttctgt tcaaagcggc aactattcat 840

ctgcgtcgaa agggaatcct tttgcagcgt gaatttgact gttcttgagc gaaatttgcc 900

gcgtttattt gagtggcgca gagagtccgc tggcttccag ccttccacga gtagccggca 960

agcgaccaga tagagggaaa aaagagaggg ttagtggtgc actggtgctt aacacctgta 1020

tttgttgtac ctgaagtttg gcatatggcc acttattctg tgccacactt accggtcatg 1080

tgcatggaaa gcgtccattc gatatgccaa gatatgaaca tgccacttaa aatgataact 1140

tgggaccagg gagccatttg caatagaggt cgcaaaaagt ttggttgcac ttcgtcctat 1200

ttgtctctca ctcactcagt cactcctatg tgctgatatg ctgtgctaag ctggcatgaa 1260

agactcttga cttcttcaga gcattgatgc caattgcaat aaaagcgttt gtttgtctcc 1320

aagatgacta ttcatcactc tatctttcgg tggtaccaaa tgcattatgg tcactctatt 1380

tgaaggtctt ttgaatttac tctgcttacc tcccccttat gctttacaga gattatatgc 1440

tttgccaata gcgtagtccc aaattatgga agccccctta gattacatgt ctgtacttct 1500

attctgaaac ttcttgtagt tatctaatgc gctggctgac agatatagga agaatatcta 1560

aatctcaaat tttctgtgag ggcctcaggg gaagcgtcct atgtagctaa atgagggagc 1620

ggttctgtgt tatctatggg tgacaatgag ctctaaattt tacactataa gatttaatga 1680

tcggatcata ttaggatcag gccctaccat tttgtgaaga agcatttgga ttgtaatcca 1740

ttaccatccc tagtgttatc ataagactgt cactagctcg tggcagagtg tatgtagatg 1800

catatttttg ctgatgtgga acagaatagg tatctgtttg catggcctgg ggaaaagttg 1860

ccaatttttc tcaatactca aattttgtct ctatgcgaaa cagtcagaag taactatagg 1920

tttgctgtat tgttactcat tgtttacttc ttaatgcttg tatcacatag aattccactg 1980

gatccagctg ctgaacgggg taccagaagg tggatttggt agtagcactg aacagcgagt 2040

ggaatttctc taatactgtc caggatcatg gttcctctct gtggtttctg tgggaaacaa 2100

aggtcaatga tctactgcag atcggatgcg gcatcattgt gcttatcatg cgaccgtagc 2160

gttcattcag ctaatgcact gtctcggcgt catagaagga cccttctttg tgatcgttgt 2220

ggtttacagc ctgcatcagt ccgatgtctt gaggacaaca catcactttg ccaaaactgt 2280

gattggaatg ggcatgatgc agcatcaggg gcttctgggc ataaaaggca ggccataaac 2340

tgttactcag ggtgcccatc atcagcagag ctttcgagaa tctggtcatt tattatcgat 2400

atcccgactg tagctgctga gcccaactgt gaggatgggc taagcatgat gacaattgat 2460

gacagtgatg tgactaatca tcacggtgct tcagatgata aacgattgtt ggaaatagct 2520

aacacagcac tcatgagtga tccaccttca cctgacaagc ttaaacctct gataggctct 2580

tcttctggag atgggtttga tgttctgcct ctagccacag atcagcctgc tggaccagtt 2640

tcagcgacac ctaaggtgcg atgtgccttt tcattttttc ctccaagaat gtttctgaac 2700

gttgtgcttt gttttttgca tgtcaaaaga cttgttgctt atggcatgca agttacgtac 2760

acatataaaa taaagaatgt tttcatatga atatagcata aacatgtagc ttggttactg 2820

tttcagtctt gcatcagcac agaaagtagt acgtggaaat tattccttag tgatgattcc 2880

cttttctcta tttaacactg cctgtctgtt ttttcctgct gagctctcaa tgcccaagta 2940

tgttcttttt acaatgaaaa ttccattttt gtaacaagtt attagataca tttgcgtcaa 3000

tggacagttg caagttgcat tggttcgtat tgtttcagat cttgtttatc accagtccct 3060

ttttaaagaa aaatatgatc tattgtcgtt gtattcttat cagatgcttg ttacatctct 3120

caggtacctt atgccagaga tgacaataag ttcaatgatg gcatgtatga agacttatgt 3180

gtggatgatg ctgacctgac attcgagaat tatgaagagc tattcggtac ctctcacatt 3240

cgaatagagg aactctttga tgacgccgga attgacagtt actttgaaat gaaggaaaca 3300

ccgccttttg atttcaatga ggtatgtact attcttctat actctttgtg attctaaatt 3360

agtgacattt taggatatca acatagtcta gaaggtgtca attcggctag ggatttctat 3420

gaaaatatgg cagttcatac aaagctaact aagtgctata aaattacttc atgtaacatg 3480

tatcttacac tgtcaaagca cacaactatc atatctgatg gccgaagtat atattttcat 3540

ttgaaatttt cctcaagctc atgcatcgtc tacaccaact tgccgagcca tcctgggacc 3600

tgggtagctt gggcccaatc cgatgacagg aacaaacctg caggggatca ctggaatcac 3660

ctccagaccc ttctccccct ctaccgggcc atcacttcgg tctgtgttgg aaatggcacg 3720

accacatcgt tctggttgga cgactggctc ccctttgacc cgatcgtgga acacctgcca 3780

gatctcgatc cgcagccatg tgacatgttg aaccaactgt tagccaggtt atgcaaactg 3840

gtgtgatcaa caacctgaga actcgcctca gtcgaactgc ccaacgggag aggccattct 3900

ccaacttgct ctgaacaacg tggatatcac tgatctgcca gatcagcgcc ggaggtcccc 3960

tcattgacag cactggcaag ttgcactccg gagcccttta cacaatgatc caatctctgt 4020

cagcccccaa cctagaggag cctgactttg tgtggaacgg ttgaagctct ttatgtggct 4080

cctcaatcaa agcaaaatca accacaaagt aagcttggtc gagaaaggtg tgattgccaa 4140

ccccatctgt gacctctgcc ttcaagcaga cgaagactgc caccacatct tcctctgacc 4200

tctggtgcca ctatgcagct tccttctggc acagcgtcgg gggtccaaat cccccctgga 4260

cctgacaacg tccaagctct gggatatcac cctcccacct gcacctgctg ccccacgaca 4320

ccagagcgct ctcgtccatc tttgctgctg ggccatttgg aaacaccgga acaacgtcgt 4380

cttcaaccaa acgcttcctt cagttcagag aatccgaaga cagtgccttg aagaagctct 4440

ggagatgtag aattagaggc gactctagcg aaatagacgc atggtgtaat ctcttcatta 4500

gcatgtacct tgaaacaccc cctccccccc tgtgttgtaa ccccggctac cttgctgctc 4560

ctatcaatca atatattaaa atcaggtggg gacaatcgtc ccccctataa aaaaaactgt 4620

gggaaagaga gctcctgtgc ttagttcccc aacctacttg tagttggcca gggttagttt 4680

attttcttac ctcagttgtt atttatggtt tctgttaatt tcactcatca agcctgagtt 4740

caggacattt tggcacttga agtattataa gtttattttc catccataga ataccctatt 4800

tttttaacaa aactcaataa atattattat atacacaaaa agatcaaatg ttgttgcttt 4860

actaaaattc ttggtcattt tttatgtttt cagcagccca aaattgtgca gctacaatgt 4920

agatgtggta ccagctgatt gtgcgatgtc aaacacaggg gaaagggctg attccagcct 4980

ttgtattcct gttaggcagg tcagatctag tatatcccat cccttatctg gtttgactgg 5040

tgagagcagc gctggagatc accaagactg tggggtgtca ccaattctcc tcatgggcga 5100

gccaccctgg tattctcctg gtccagaagg ctcattagct ggaggaagca gagatagtgc 5160

tctcacacga tacaaggaga agaagaagaa aagaatgtaa gcacgtttaa atgtctgctt 5220

gaggttgttc tgcgcttaac attcatagat cgtggctatc tttttaaggc aaaaaaatgt 5280

ctccaacctt ctgtgtctct tgtttctagt ttcgataatg cattttcctt gcagaagtcg 5340

ctgattcacc tttccttttc acgaatttgg tcgacaggtt tgacaagaag atcagatatg 5400

cttctcgcaa ggctagggca gacgtgagga agagggtcaa gggacggttt ataaaggctg 5460

gcgaagcgta tgactatgat ccactaagtc aaactagaag ctactgagac tgctgagcct 5520

tgaatgcggc tgcttgttga tcgtccagtg tcagcctagc aaatcttcaa cggctcgtct 5580

gttgtaggtc gttgcgctac aggcaagatt actggagagc acagcgattg caaatttgca 5640

atgcacgcat cagagcctgc agttgaaata cgaaaaaaaa aggttaagaa gaggtaccaa 5700

gggttgggat gaatgaaaaa aaaggaaata cgacgcgaac ttgccggacg ccttgtggtt 5760

tggatggagc atacatattc attcttcagt tcatctgcag atgagagtga tttggatcag 5820

ctctgccgtc tgtgcgttga acagatgcag ttatgggcgc tcgtcctccg gctgtgtcta 5880

ccgctgcgtg caaggacctg cgtcggccac ggtgttcggc agtgagctgc caggatttta 5940

cagtctgggt aacagcctaa caggatcccc ttatttatta cctcccagct tgcgctctgt 6000

aacaatatta tttgtgaagc acaacattct cttgtcagga gattgttttc gatcgtgtgt 6060

ttatgtttgt agatggacgc aatattggta aaaagaagta gccgtcatga agtgtgttct 6120

tgtcggatcg catatagcac tggggatgag caggagaatc acacatattt catctggacg 6180

tcgaacctct aactattcta tgccagagta accttcttgt gctttgtca 6229

Claims

1. The application of the ZmCOL14 gene in the regulation of the plant height and/or ear height traits of corn is characterized in that the nucleic acid sequence of the gene is shown as SEQ ID No. 1.

2. The application of protein overexpression in reducing the traits of the plant height and/or the ear height of corn is characterized in that the amino acid sequence of the protein is shown as SEQ ID No. 3.

3. Use of overexpression of a nucleic acid encoding the protein according to claim 2 for reducing the plant height and/or panicle height of maize.

4. The use of claim 3, wherein the nucleic acid sequence is as set forth in SEQ ID No. 2.

5. Use of a gene expression cassette for reducing the plant height and/or ear height trait in maize, wherein the gene expression cassette comprises a nucleic acid according to any one of claims 3 to 4.

6. The use of claim 5, wherein the nucleic acid in the gene expression cassette is operably linked to the pZmUBI promoter, the 3 XFlag tag and the nos terminator.

7. The use of claim 6, wherein the gene expression cassette has the sequence shown in SEQ ID No. 4.

8. The application of an expression vector in reducing the plant height and/or ear height of corn, which is characterized in that the expression vector contains the expression cassette of any one of claims 5-7.

9. Use of a host cell for reducing maize plant height and/or ear height traits, wherein said host cell comprises the expression vector of claim 8.

10. The use of claim 9, wherein the host cell is an agrobacterium cell.

11. A method for delaying the flowering period of corn and reducing the plant height and ear height of corn, characterized in that corn is transformed with the expression vector of claim 8 or the host cell of any one of claims 9 to 10 to obtain transgenic corn; screening materials with delayed tasseling period, spinning period and pollen scattering period and reduced plant height and ear height.

12. The application of the maize mutant gene in advancing maize flowering period and improving maize plant height and ear position height under long-day condition is characterized in that the mutant gene sequence is shown as any one of SEQ ID No.5 or SEQ ID No. 6.