Detailed Description
The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise indicated, terms are to be understood in accordance with their ordinary usage by those of ordinary skill in the relevant art. All patent documents, academic papers, industry standards and other publications, etc., cited herein are incorporated by reference in their entirety.
As used herein, "maize" is any maize plant and includes all plant varieties that can be bred with maize, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like. Unless otherwise indicated, nucleic acids are written from left to right in the 5 'to 3' direction; amino acid sequences are written from left to right in the amino to carboxy direction. Amino acids may be referred to herein by their commonly known three letter symbols or by the one letter symbols recommended by the IUPAC-IUB Biochemical nomenclature Commission. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include the numbers defining the range. As used herein, "nucleic acid" includes reference to deoxyribonucleotide or ribonucleotide polymers in either single-or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encode" or "encoded" when used in the context of a particular nucleic acid means that the nucleic acid contains the necessary information to direct translation of the nucleotide sequence into a particular protein. The information encoding the protein is represented using a codon. As used herein, "full-length sequence" in reference to a particular polynucleotide or protein encoded thereby refers to the entire nucleic acid sequence or the entire amino acid sequence having a native (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the particular protein. The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogues of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). The amino acid can be a naturally occurring amino acid, and unless otherwise limited, can include known analogs of natural amino acids that can function in a similar manner as naturally occurring amino acids.
As used herein, the terms "isolated" and "purified" may be used interchangeably to refer to a nucleic acid or polypeptide, or biologically active portion thereof, that is substantially or essentially free of components that normally accompany or react with the nucleic acid or polypeptide as found in its naturally occurring environment. Thus, an isolated or purified nucleic acid or polypeptide produced by recombinant techniques is substantially free of other cellular material or culture medium, or is substantially free of chemical precursors or other chemicals when chemically synthesized. An "isolated" nucleic acid is typically free of sequences (such as sequences encoding proteins) that naturally flank the nucleic acid (i.e., sequences located at the 5 'and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, an isolated nucleic acid may comprise less than about 0.5kb of nucleotide sequences that naturally flank the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.
In this application, the words "comprise", "comprising" or variations thereof are to be understood as embracing elements, numbers or steps in addition to those described. By "subject plant" or "subject plant cell" is meant a plant or plant cell in which the genetic modification has been effected, or a progeny cell of the plant or cell so modified, which progeny cell comprises the modification. The "control" or "control plant cell" provides a reference point for measuring the phenotypic change of the test plant or plant cell. The control plant or plant cell may include, for example: (a) a wild-type plant or cell, i.e., a plant or cell having the same genotype as the starting material for the genetic alteration that produced the test plant or cell; (b) plants or plant cells having the same genotype as the starting material but which have been transformed with an empty construct (i.e., a construct that has no known effect on the trait of interest, such as a construct comprising a target gene); (c) a plant or plant cell that is a non-transformed isolate of a subject plant or plant cell; (d) a plant or plant cell that is genetically identical to the subject plant or plant cell but that has not been exposed to conditions or stimuli that induce expression of the gene of interest; or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.
Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of suitable tools and procedures for engineering or engineering amino acid sequences and potential gene sequences of proteins of agricultural interest.
In some embodiments, changes may be made to the nucleotide sequences of the present application to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, substitutions that do not alter the amino acid sequence of the nucleotide sequences of the present application can be made in accordance with the codon preferences disclosed for monocots, e.g., codons encoding the same amino acid sequence can be substituted with monocot preferred codons without altering the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application is replaced with a different codon that encodes the same amino acid sequence, such that the nucleotide sequence is not altered while the amino acid sequence encoded thereby is not altered. Conservative variants include those sequences that, due to the degeneracy of the genetic code, encode the amino acid sequence of one of the proteins of the embodiments. In some embodiments, a partial nucleotide sequence herein is replaced according to monocot preferred codons. One skilled in the art will recognize that amino acid additions and/or substitutions are generally based on the relative similarity of the amino acid side-chain substituents, e.g., hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituent groups having various of the foregoing properties are known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance as to suitable amino acid substitutions that do not affect the biological activity of the Protein of interest can be found in the model of the Atlas of Protein sequences and structural Atlas (Natl.biomed.Res.Foundation., Washington, D.C.) (1978), incorporated herein by reference. Conservative substitutions such as exchanging one amino acid for another with similar properties may be made. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., a genomic library or cDNA library) from a selected organism.
In some embodiments, fragments of the nucleotide sequences and the amino acid sequences encoded thereby are also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide or a portion of the amino acid sequence of a polypeptide of an embodiment. Fragments of the nucleotide sequences may encode protein fragments that retain the biological activity of the native or corresponding full-length protein, and thus have protein activity. Mutant proteins include biologically active fragments of the native protein that comprise contiguous amino acid residues that retain the biological activity of the native protein. Some embodiments also include a transformed plant cell or transgenic plant comprising the nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed with an expression vector comprising at least one embodiment of the nucleotide sequence and operably linked thereto a promoter that drives expression in plant cells. Transformed plant cells and transgenic plants refer to plant cells or plants that comprise a heterologous polynucleotide within their genome. Generally, the heterologous polynucleotide is stably integrated within the genome of the transformed plant cell or transgenic plant such that the polynucleotide is transmitted to progeny. The heterologous polynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants to which the present application relates include plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells, which are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, nuts, ears, cobs, husks, stalks, roots, root tips, anthers, and the like. The present application also includes plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves, and roots derived from the transgenic plants of the present application or progeny thereof, and thus comprising at least in part the nucleotide sequences of the present application.
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, steps or conditions of the present invention may be made without departing from the spirit and substance of the invention and are intended to be included within the scope of the present application. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular cloning A.laboratory Manual of Sambrook et al (Sambrook J & Russell D W, Molecular cloning: a laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.
Example 2 Gene editing knockout candidates to analyze Gene function
The invention utilizes CRISPR-Cas9 gene editing technology to carry out site-directed mutation on 13 genes in the interval. The implementation mode comprises the construction of a gene editing vector, the genetic transformation of corn and the functional verification of editing effect. The method comprises the following specific steps:
1. construction of Gene editing vector
The invention cuts off the ccdB sequence in a skeleton vector pCXB053 (constructed by Rice biotechnologies (Jiangsu) Co., Ltd.) by BsaI enzyme digestion, and connects a target sequence (shown as SEQ ID NO. 8) between U6 and gRNA by T4 ligase. The specific construction process is as follows:
1) synthesis of primers
Primer TF: ATTGGGGCTCAGAGTGAACCTCC, respectively; primer TR: AAACGGAGGTTCACTCTGAGCCC. Synthesized in Shanghai, dissolved in ultrapure water and mixed uniformly.
2) Allocating an annexing Buffer TE
Tris-Cl PH8.0 10mM
EDTA 0.1mM
NaCl: 50mM
3) Annealing of connections
A connection system:
Annealing Buffer 50μL
Mix Primer 5μL
and (3) connecting procedures:
95℃ 3min
0.1 ℃/s constant speed drop
20℃ 1min
Storing at-20 deg.C
4) The backbone vector was digested with BsaI restriction enzyme
Enzyme digestion system:
after digestion at 37 ℃ for 5h, the product was recovered directly (using the quangen recovery kit).
The recovered product was diluted to 50 ng/. mu.L with water, diluted with an equal amount of T4 Buffer and stored at-20 ℃.
5) T4 enzyme linked
Enzyme linked systems:
enzyme linked procedure:
25 ℃ for 2h (in PCR instrument)
6) Transformation of Escherichia coli
10 mu L of enzyme-linked reaction solution and 100 mu L of escherichia coli 5a are subjected to competence mixing, strictly standing and ice-bath is carried out for 30min, heat shock is carried out for 35s at 42 ℃, ice-bath is carried out for 2min, 500L of antibiotic-free LB is added, and shaking recovery is carried out for 1h at 37 ℃. After centrifugation at 3000g for 1 minute and aspiration of the supernatant, 100. mu.L of the liquid was left to blow-beat the bacterial cells and plated (solid medium containing 50mg/L kanamycin) and cultured in an inverted state at 37 ℃ for 12 hours.
And (4) selecting positive clone sequencing and extracting plasmids. Sequencing verification primer is PUV 3-R: CTGGCGAAAGGGGGATGTGCTGCAA are provided.
2. Genetic transformation of maize
The vector is transferred into agrobacterium EHA105 by an electric shock method, and PCR is carried out for identification. Taking a freshly peeled young embryo of a maize inbred line KN5585 (an inbred line bred by Mimi Biotechnology (Jiangsu) Co., Ltd.) of about 1mm as a material, putting the peeled maize embryo into a 2mL plastic centrifuge tube containing 1.8mL of suspension, and treating about 150 immature young embryos within 30 min; the suspension was aspirated, the remaining corn embryos placed in a tube and then 1.0mL of Agrobacterium suspension was added and left for 5 min. The young embryos in the centrifuge tube are suspended and poured onto a co-culture medium, and the surplus agrobacterium liquid on the surface is sucked by a liquid transfer device and is cultured for 3 days in the dark at the temperature of 23 ℃. After co-cultivation, the young embryos were transferred to a resting medium, cultured in the dark at 28 ℃ for 6 days, placed on a screening medium containing 5mg/L of Bialaphos, and screened for 2 weeks, and then transferred to a screening medium containing 8mg/L of Bialaphos for 2 weeks. The resistant calli were transferred to differentiation medium 1 and cultured at 25 ℃ under 5000lx light for 1 week. Transferring the callus to a differentiation culture medium 2, and culturing for 2 weeks by illumination; transferring the differentiated plantlets to a rooting culture medium, and culturing at 25 ℃ and 5000lx by illumination until the plantlets are rooted; transferring the plantlets into small pots for growth, transplanting the plantlets into a greenhouse after a certain growth stage, and harvesting progeny seeds after 3-4 months.
3. Trait evaluation of Gene-edited plants
Extracting seedling-stage DNA from T1 generation material, detecting gene editing condition, designing primer amplification target editing section, and amplifying the target editing section by the following system: DNA: 3 μ L, 1 μ L each of the bidirectional primers, 2 × TaqMix: 7.5 μ L, ddH 2O: 2.5. mu.L, total volume 10. mu.L. The PCR reaction conditions were as follows: (1)94 ℃ for 5 minutes, (2)94 ℃ for 40 seconds, (3)57 ℃ for 30 seconds, (4)72 ℃ for 60 seconds, (5) cycle 35 times from (2) step (4), (6)72 ℃ for 7 minutes, and (7) storage at 4 ℃. The PCR product was submitted to Sanger sequencing by Wuhan Strongziaceae Biotech Ltd. And comparing the sequencing result of the transformant with the genome of the wild KN5585, wherein the material subjected to base substitution, insertion or deletion is a positive editing material, and the material is a negative material if the material is not subjected to base substitution, insertion or deletion. Through the phenotypic identification of each gene editing material, the plant height and the ear height of the edited plant of the GRMZM5G864693 gene are found to be changed (Table 1).
TABLE 1 Gene editing of plant height and ear height trait data for corn material
Data are expressed as "mean ± standard deviation", with different letters indicating significant differences at the level of p 0.05 for each material.
4. In-depth analysis of plants with altered plant height
Further, the plant edited by GRMZM5G864693 gene (named ZKM89) with changed plant height traits was subjected to in-depth analysis. A total of 4 independent transformation events were obtained for this gene. Primers 5'-GGTGGCAGCATCATCCTTTG-3' and 5'-CTCAAGCTGCAGCACCGACAA-3', PCR were designed to amplify the target editing segment and the PCR products were sequenced. Among 4 independent transformation events, 2 events are edited in genes and are positive plants, wherein one event is deletion of one base T, and the sequence is shown as SEQ ID No. 10; 2 were unedited and negative plants. The plant height and the ear height of the late stage of the positive transformation event T1 generation material pollination are investigated, and the plant height and the ear height of the positive mutant and the separated negative plant are found to have very significant difference, which indicates that the gene controls the plant height and the ear height. The data are shown in Table 2.
TABLE 2 Gene 2 ZKM89 editing plant height and ear height trait data for corn material
Data are expressed as "mean ± standard deviation", with different letters indicating significant differences at the level of p 0.05 for each material. "-" indicates a base deletion.
ZKM89 gene is located in the Chr10:149,034,287-149,035,982 region, the genome sequence is shown in SEQ ID NO.1, the total length is 1696 bp. Comprises 3 transcripts, wherein the cDNA sequences of the 3 transcripts are shown as SEQ ID NO.2-SEQ ID NO.4, and the coded amino acid sequences are shown as SEQ ID NO.5-SEQ ID NO. 7.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Junmi Biotechnology (Jiangsu) Ltd, university of agriculture in Huazhong
<120> gene ZKM89 for controlling plant height and ear height of corn and application thereof
<130>1
<160>10
<170>SIPOSequenceListing 1.0
<210>1
<211>1696
<212>DNA
<213> corn (Zea mays L.)
<400>1
gtaaaattgt atttcctctg gctggcgagc ggaggacgac ggagcagaag cagctggcct 60
cagccgctgg acagtgggcc tcgactagca gcagatagga aaccgggata gagctgcctt 120
ccccttccgg ctccgctcag tcaggcctca gatcggtcga atccagcacc ccctccagat 180
ttgcgtcacc aatcttcttc ttcttccgcc gccgccgccg ctcccccaca aggaggttag 240
ctgctatccc caaatcgatt catcaatcat ccgtgtcctt ccatttcatt ccagtcggtc 300
gccgcagcac ggaccgagaa cagagcatca cgtcacatca aactaaccta accagcctcg 360
tccctcgctg cgtatctgct gcactttcat caacaccagt ctttctcctc ctggattgca 420
ttgcccaggc aagagaacgc acgcacaccg accggaatag ccatgatctt ctgatccaat 480
ccaagatggg cctcaaggag cagcagctag acgccactga ccaaactcgt gatgccgcca 540
actccctcgc ttctgtttct gacgagcacc acgagggacc ccgtgtctca agctgcagca 600
ccgacaagga ttctggcctt ccaagttgcc gagtctgcca ttgcgtggaa cccgatctaa 660
gaggcgagtc cgccctcgga ttcttgggca tcgtgccccc ttcccctccc aggactgaca 720
ctggggggcc aaaggatgat gctgccacca gccccaaggg ggagatattc gtgtgcgcta 780
ctgacgtcga attgcagcag cagcaggacc atcttgtgga tctagggtgt tgttgcaaga 840
acgagcttgc ccttgcgcac tatgcctgtg cgttgaagtg gttcatcagc catggatcca 900
ccgcctgcga gatctgtgga actgttgctg caaatgtaag gcctgacgat ttcaacaagg 960
ttctcgcgtc cctcaaggat taccaagctc tcagggaaag tacatccaca tactggtggt 1020
tgcagcagca tagtggtgtt gatccagacg ctgttgcagc aatacgaagg cacgagatct 1080
catcctggtt caatcctcac gtgcctatct cccaaggcca cattgatcaa ccgcatccct 1140
caaccaataa ttcttctgtt cttgagcagc atactagtgt tgtggcaaac acaagatgga 1200
gtttggagag tactggagtt tttattgcta tctgcctggt tgtcattatt cttgcatggt 1260
tggtcgctcc acatgttggc aaggtatgct gcaacttctg ctaaagagta gttagtacta 1320
cgtacttgtc ctttacaaat cataaagcgg agaagcattt tctgtgcaga aagctgctgt 1380
aatctgtctt catatgcttc ttggaggtct atgcatattg actgtagtaa tatccctgag 1440
atttgtaagt aggcggtgac atatttcatt tttcctttta gccagatttt tcacctctga 1500
ctgagtttaa atgtcaaaaa aataaataaa tatgcaggtt ttcccgagaa tccagtatgg 1560
gtctatgcaa tattgggcaa tcttgtttgt gtcctggttc cttgtgtttg gtgtttgggc 1620
ttcacgaaca cgcggcgcgc gttcctcatg agtatattct tgtgtacttg ctatgtaaaa 1680
taatgcttgt cttttc 1696
<210>2
<211>1548
<212>DNA
<213> corn (Zea mays L.)
<400>2
gtaaaattgt atttcctctg gctggcgagc ggaggacgac ggagcagaag cagctggcct 60
cagccgctgg acagtgggcc tcgactagca gcagatagga aaccgggata gagctgcctt 120
ccccttccgg ctccgctcag tcaggcctca gatcggtcga atccagcacc ccctccagat 180
ttgcgtcacc aatcttcttc ttcttccgcc gccgccgccg ctcccccaca aggaggttag 240
ctgctatccc caaatcgatt catcaatcat ccgtgtcctt ccatttcatt ccagtcggtc 300
gccgcagcac ggaccgagaa cagagcatca cgtcacatca aactaaccta accagcctcg 360
tccctcgctg cgtatctgct gcactttcat caacaccagt ctttctcctc ctggattgca 420
ttgcccaggc aagagaacgc acgcacaccg accggaatag ccatgatctt ctgatccaat 480
ccaagatggg cctcaaggag cagcagctag acgccactga ccaaactcgt gatgccgcca 540
actccctcgc ttctgtttct gacgagcacc acgagggacc ccgtgtctca agctgcagca 600
ccgacaagga ttctggcctt ccaagttgcc gagtctgcca ttgcgtggaa cccgatctaa 660
gaggcgagtc cgccctcgga ttcttgggca tcgtgccccc ttcccctccc aggactgaca 720
ctggggggcc aaaggatgat gctgccacca gccccaaggg ggagatattc gtgtgcgcta 780
ctgacgtcga attgcagcag cagcaggacc atcttgtgga tctagggtgt tgttgcaaga 840
acgagcttgc ccttgcgcac tatgcctgtg cgttgaagtg gttcatcagc catggatcca 900
ccgcctgcga gatctgtgga actgttgctg caaatgtaag gcctgacgat ttcaacaagg 960
ttctcgcgtc cctcaaggat taccaagctc tcagggaaag tacatccaca tactggtggt 1020
tgcagcagca tagtggtgtt gatccagacg ctgttgcagc aatacgaagg cacgagatct 1080
catcctggtt caatcctcac gtgcctatct cccaaggcca cattgatcaa ccgcatccct 1140
caaccaataa ttcttctgtt cttgagcagc atactagtgt tgtggcaaac acaagatgga 1200
gtttggagag tactggagtt tttattgcta tctgcctggt tgtcattatt cttgcatggt 1260
tggtcgctcc acatgttggc aaggtatgct gcaacttctg ctaaagagta gttagtacta 1320
cgtacttgtc ctttacaaat cataaagcgg agaagcattt tctgtgcaga aagctgctgt 1380
aatctgtctt catatgcttc ttggaggtct atgcatattg actgtagtaa tatccctgag 1440
atttgtaagt aggcggtgac atatttcatt tttcctttta gccagatttt tcacctctga 1500
ctgagtttaa atgtcaaaaa aataaataaa tatgcaggtt ttcccgag 1548
<210>3
<211>1464
<212>DNA
<213> corn (Zea mays L.)
<400>3
gtaaaattgt atttcctctg gctggcgagc ggaggacgac ggagcagaag cagctggcct 60
cagccgctgg acagtgggcc tcgactagca gcagatagga aaccgggata gagctgcctt 120
ccccttccgg ctccgctcag tcaggcctca gatcggtcga atccagcacc ccctccagat 180
ttgcgtcacc aatcttcttc ttcttccgcc gccgccgccg ctcccccaca aggaggttag 240
ctgctatccc caaatcgatt catcaatcat ccgtgtcctt ccatttcatt ccagtcggtc 300
gccgcagcac ggaccgagaa cagagcatca cgtcacatca aactaaccta accagcctcg 360
tccctcgctg cgtatctgct gcactttcat caacaccagt ctttctcctc ctggattgca 420
ttgcccaggc aagagaacgc acgcacaccg accggaatag ccatgatctt ctgatccaat 480
ccaagatggg cctcaaggag cagcagctag acgccactga ccaaactcgt gatgccgcca 540
actccctcgc ttctgtttct gacgagcacc acgagggacc ccgtgtctca agctgcagca 600
ccgacaagga ttctggcctt ccaagttgcc gagtctgcca ttgcgtggaa cccgatctaa 660
gaggcgagtc cgccctcgga ttcttgggca tcgtgccccc ttcccctccc aggactgaca 720
ctggggggcc aaaggatgat gctgccacca gccccaaggg ggagatattc gtgtgcgcta 780
ctgacgtcga attgcagcag cagcaggacc atcttgtgga tctagggtgt tgttgcaaga 840
acgagcttgc ccttgcgcac tatgcctgtg cgttgaagtg gttcatcagc catggatcca 900
ccgcctgcga gatctgtgga actgttgctg caaatgtaag gcctgacgat ttcaacaagg 960
ttctcgcgtc cctcaaggat taccaagctc tcagggaaag tacatccaca tactggtggt 1020
tgcagcagca tagtggtgtt gatccagacg ctgttgcagc aatacgaagg cacgagatct 1080
catcctggtt caatcctcac gtgcctatct cccaaggcca cattgatcaa ccgcatccct 1140
caaccaataa ttcttctgtt cttgagcagc atactagtgt tgtggcaaac acaagatgga 1200
gtttggagag tactggagtt tttattgcta tctgcctggt tgtcattatt cttgcatggt 1260
tggtcgctcc acatgttggc aagaaagctg ctgtaatctg tcttcatatg cttcttggag 1320
gtctatgcat attgactgta gtaatatccc tgagatttgt aagtaggcgg tgacatattt 1380
catttttcct tttagccaga tttttcacct ctgactgagt ttaaatgtca aaaaaataaa 1440
taaatatgca ggttttcccg agaa 1464
<210>4
<211>1517
<212>DNA
<213> corn (Zea mays L.)
<400>4
gtaaaattgt atttcctctg gctggcgagc ggaggacgac ggagcagaag cagctggcct 60
cagccgctgg acagtgggcc tcgactagca gcagatagga aaccgggata gagctgcctt 120
ccccttccgg ctccgctcag tcaggcctca gatcggtcga atccagcacc ccctccagat 180
ttgcgtcacc aatcttcttc ttcttccgcc gccgccgccg ctcccccaca aggaggttag 240
ctgctatccc caaatcgatt catcaatcat ccgtgtcctt ccatttcatt ccagtcggtc 300
gccgcagcac ggaccgagaa cagagcatca cgtcacatca aactaaccta accagcctcg 360
tccctcgctg cgtatctgct gcactttcat caacaccagt ctttctcctc ctggattgca 420
ttgcccaggc aagagaacgc acgcacaccg accggaatag ccatgatctt ctgatccaat 480
ccaagatggg cctcaaggag cagcagctag acgccactga ccaaactcgt gatgccgcca 540
actccctcgc ttctgtttct gacgagcacc acgagggacc ccgtgtctca agctgcagca 600
ccgacaagga ttctggcctt ccaagttgcc gagtctgcca ttgcgtggaa cccgatctaa 660
gaggcgagtc cgccctcgga ttcttgggca tcgtgccccc ttcccctccc aggactgaca 720
ctggggggcc aaaggatgat gctgccacca gccccaaggg ggagatattc gtgtgcgcta 780
ctgacgtcga attgcagcag cagcaggacc atcttgtgga tctagggtgt tgttgcaaga 840
acgagcttgc ccttgcgcac tatgcctgtg cgttgaagtg gttcatcagc catggatcca 900
ccgcctgcga gatctgtgga actgttgctg caaatgtaag gcctgacgat ttcaacaagg 960
ttctcgcgtc cctcaaggat taccaagctc tcagggaaag tacatccaca tactggtggt 1020
tgcagcagca tagtggtgtt gatccagacg ctgttgcagc aatacgaagg cacgagatct 1080
catcctggtt caatcctcac gtgcctatct cccaaggcca cattgatcaa ccgcatccct 1140
caaccaataa ttcttctgtt cttgagcagc atactagtgt tgtggcaaac acaagatgga 1200
gtttggagag tactggagtt tttattgcta tctgcctggt tgtcattatt cttgcatggt 1260
tggtcgctcc acatgttggc aagaaagctg ctgtaatctg tcttcatatg cttcttggag 1320
gtctatgcat attgactgta gtaatatccc tgagatttgt tttcccgaga atccagtatg 1380
ggtctatgca atattgggca atcttgtttg tgtcctggtt ccttgtgttt ggtgtttggg 1440
cttcacgaac acgcggcgcg cgttcctcat gagtatattc ttgtgtactt gctatgtaaa 1500
ataatgcttg tcttttc 1517
<210>5
<211>272
<212>PRT
<213> corn (Zea mays L.)
<400>5
Met Gly Leu Lys Glu Gln Gln Leu Asp Ala Thr Asp Gln Thr Arg Asp
1 5 10 15
Ala Ala Asn Ser Leu Ala Ser Val Ser Asp Glu His His Glu Gly Pro
20 25 30
Arg Val Ser Ser Cys Ser Thr Asp Lys Asp Ser Gly Leu Pro Ser Cys
35 40 45
Arg Val Cys His Cys Val Glu Pro Asp Leu Arg Gly Glu Ser Ala Leu
50 55 60
Gly Phe Leu Gly Ile Val Pro Pro Ser Pro Pro Arg Thr Asp Thr Gly
65 70 75 80
Gly Pro Lys Asp Asp Ala Ala Thr Ser Pro Lys Gly Glu Ile Phe Val
85 90 95
Cys Ala Thr Asp Val Glu Leu Gln Gln Gln Gln Asp His Leu Val Asp
100 105 110
Leu Gly Cys Cys Cys Lys Asn Glu Leu Ala Leu Ala His Tyr Ala Cys
115 120 125
Ala Leu Lys Trp Phe Ile Ser His Gly Ser Thr Ala Cys Glu Ile Cys
130 135 140
Gly Thr Val Ala Ala Asn Val Arg Pro Asp Asp Phe Asn Lys Val Leu
145 150 155 160
Ala Ser Leu Lys Asp Tyr Gln Ala Leu Arg Glu Ser Thr Ser Thr Tyr
165 170 175
Trp Trp Leu Gln Gln His Ser Gly Val Asp Pro Asp Ala Val Ala Ala
180 185 190
Ile Arg Arg His Glu Ile Ser Ser Trp Phe Asn Pro His Val Pro Ile
195 200 205
Ser Gln Gly His Ile Asp Gln Pro His Pro Ser Thr Asn Asn Ser Ser
210 215 220
Val Leu Glu Gln His Thr Ser Val Val Ala Asn Thr Arg Trp Ser Leu
225 230 235 240
Glu Ser Thr Gly Val Phe Ile Ala Ile Cys Leu Val Val Ile Ile Leu
245 250 255
Ala Trp Leu Val Ala Pro His Val Gly Lys Val Cys Cys Asn Phe Cys
260 265 270
<210>6
<211>295
<212>PRT
<213> corn (Zea mays L.)
<400>6
Met Gly Leu Lys Glu Gln Gln Leu Asp Ala Thr Asp Gln Thr Arg Asp
1 5 10 15
Ala Ala Asn Ser Leu Ala Ser Val Ser Asp Glu His His Glu Gly Pro
20 25 30
Arg Val Ser Ser Cys Ser Thr Asp Lys Asp Ser Gly Leu Pro Ser Cys
35 40 45
Arg Val Cys His Cys Val Glu Pro Asp Leu Arg Gly Glu Ser Ala Leu
50 55 60
Gly Phe Leu Gly Ile Val Pro Pro Ser Pro Pro Arg Thr Asp Thr Gly
65 70 75 80
Gly Pro Lys Asp Asp Ala Ala Thr Ser Pro Lys Gly Glu Ile Phe Val
85 90 95
Cys Ala Thr Asp Val Glu Leu Gln Gln Gln Gln Asp His Leu Val Asp
100 105 110
Leu Gly Cys Cys Cys Lys Asn Glu Leu Ala Leu Ala His Tyr Ala Cys
115 120 125
Ala Leu Lys Trp Phe Ile Ser His Gly Ser Thr Ala Cys Glu Ile Cys
130 135 140
Gly Thr Val Ala Ala Asn Val Arg Pro Asp Asp Phe Asn Lys Val Leu
145 150 155 160
Ala Ser Leu Lys Asp Tyr Gln Ala Leu Arg Glu Ser Thr Ser Thr Tyr
165 170 175
Trp Trp Leu Gln Gln His Ser Gly Val Asp Pro Asp Ala Val Ala Ala
180 185 190
Ile Arg Arg His Glu Ile Ser Ser Trp Phe Asn Pro His Val Pro Ile
195 200 205
Ser Gln Gly His Ile Asp Gln Pro His Pro Ser Thr Asn Asn Ser Ser
210 215 220
Val Leu Glu Gln His Thr Ser Val Val Ala Asn Thr Arg Trp Ser Leu
225 230 235 240
Glu Ser Thr Gly Val Phe Ile Ala Ile Cys Leu Val Val Ile Ile Leu
245 250 255
Ala Trp Leu Val Ala Pro His Val Gly Lys Lys Ala Ala Val Ile Cys
260 265 270
Leu His Met Leu Leu Gly Gly Leu Cys Ile Leu Thr Val Val Ile Ser
275 280 285
Leu Arg Phe Val Ser Arg Arg
290 295
<210>7
<211>328
<212>PRT
<213> corn (Zea mays L.)
<400>7
Met Gly Leu Lys Glu Gln Gln Leu Asp Ala Thr Asp Gln Thr Arg Asp
1 5 10 15
Ala Ala Asn Ser Leu Ala Ser Val Ser Asp Glu His His Glu Gly Pro
20 25 30
Arg Val Ser Ser Cys Ser Thr Asp Lys Asp Ser Gly Leu Pro Ser Cys
35 40 45
Arg Val Cys His Cys Val Glu Pro Asp Leu Arg Gly Glu Ser Ala Leu
50 55 60
Gly Phe Leu Gly Ile Val Pro Pro Ser Pro Pro Arg Thr Asp Thr Gly
65 70 75 80
Gly Pro Lys Asp Asp Ala Ala Thr Ser Pro Lys Gly Glu Ile Phe Val
85 90 95
Cys Ala Thr Asp Val Glu Leu Gln Gln Gln Gln Asp His Leu Val Asp
100 105 110
Leu Gly Cys Cys Cys Lys Asn Glu Leu Ala Leu Ala His Tyr Ala Cys
115 120 125
Ala Leu Lys Trp Phe Ile Ser His Gly Ser Thr Ala Cys Glu Ile Cys
130 135 140
Gly Thr Val Ala Ala Asn Val Arg Pro Asp Asp Phe Asn Lys Val Leu
145 150 155 160
Ala Ser Leu Lys Asp Tyr Gln Ala Leu Arg Glu Ser Thr Ser Thr Tyr
165 170 175
Trp Trp Leu Gln Gln His Ser Gly Val Asp Pro Asp Ala Val Ala Ala
180 185 190
Ile Arg Arg His Glu Ile Ser Ser Trp Phe Asn Pro His Val Pro Ile
195 200 205
Ser Gln Gly His Ile Asp Gln Pro His Pro Ser Thr Asn Asn Ser Ser
210 215 220
Val Leu Glu Gln His Thr Ser Val Val Ala Asn Thr Arg Trp Ser Leu
225 230 235 240
Glu Ser Thr Gly Val Phe Ile Ala Ile Cys Leu Val Val Ile Ile Leu
245 250 255
Ala Trp Leu Val Ala Pro His Val Gly Lys Lys Ala Ala Val Ile Cys
260 265 270
Leu His Met Leu Leu Gly Gly Leu Cys Ile Leu Thr Val Val Ile Ser
275 280 285
Leu Arg Phe Val Phe Pro Arg Ile Gln Tyr Gly Ser Met Gln Tyr Trp
290 295 300
Ala Ile Leu Phe Val Ser Trp Phe Leu Val Phe Gly Val Trp Ala Ser
305 310 315 320
Arg Thr Arg Gly Ala Arg Ser Ser
325
<210>8
<211>20
<212>DNA
<213> corn (Zea mays L.)
<400>8
tgcgtggaac ccgatctaag 20
<210>9
<211>103
<212>RNA
<213>unkown
<400>9
ugcguggaac ccgaucuaag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 103
<210>10
<211>19
<212>DNA
<213>unkown
<400>10
tgcgtggaac ccgatcaag 19