CN107353332B

CN107353332B - Protein and the application of a kind of rice chloroplast developmental regulation Gene A HS1 and its coding

Info

Publication number: CN107353332B
Application number: CN201710817590.0A
Authority: CN
Inventors: 胡时开; 胡培松; 郭龙彪; 钱前; 唐绍清; 曾大力; 魏祥进; 焦桂爱; 圣忠华; 邵高能; 谢黎红
Original assignee: China National Rice Research Institute
Current assignee: China National Rice Research Institute
Priority date: 2017-09-12
Filing date: 2017-09-12
Publication date: 2019-08-09
Anticipated expiration: 2037-09-12
Also published as: CN107353332A

Abstract

The invention discloses a kind of protein of rice chloroplast developmental regulation Gene A HS1 coding, have amino acid sequence shown in Seq ID No:2；The invention also discloses a kind of genes for encoding above-mentioned protein, have genome nucleotide sequence shown in Seq ID No:1；The invention also discloses the plant expression vector containing said gene, host cell and above-mentioned protein, gene, plant expression vector, host cells in the developmental application of regulation plant chloroplast and the method for improvement rice leaf color.The present invention is cloned into AHS1 gene using map-based cloning in rice for the first time, pass through the functional analysis to AHS1 gene, the genetic mechanism that plant especially gramineae plant Development of Chloroplasts and leaf color are formed is further clarified, for the photosynthetic efficiency for improveing crops, improves increasing production of rice potentiality and lay a good foundation.

Description

Protein and the application of a kind of rice chloroplast developmental regulation Gene A HS1 and its coding

Technical field

The invention belongs to plant genetic engineering fields.Specifically, map-based cloning gram is utilized the present invention relates to a kind of Precititation rice AHS1 (Albino in Heat Stress1) gene, and identify using transgene complementation test the function of the gene Energy；It also relates to be regulated and controled using the gene pairs rice chloroplast growth course and leaf color, to improve crops Photosynthetic efficiency, improve increasing production of rice potentiality.

Background technique

Chloroplaset be it is distinctive in green plants mesophyll cell be able to carry out photosynthetic organelle, be distributed mainly on In the cortical cell of mesophyll cell and young stem.In ontogeny, chloroplaset is to develop into leaf by proplastid from proplastid Green body.In the growth course of chloroplaset, in the formation of thylakoid membrane and the accumulation of chlorophyll be two complementary Process.When gene relevant to Development of Chloroplasts mutates, it will the normal development of chloroplaset is influenced, to influence leaf The biosynthesis of green element causes the pigment ratio in chlorophyll to change and generate leaf color mutant.And leaf color is to influence rice light Important character of the cooperation with yield, occupies an important position in terms of improving rice yield and breed improvement.

Rice chloroplast is the important place of synthesis of organic substance matter, by delaying the aging of blade and extending photosynthetic organs Function can increase dry-matter accumulation；Especially in the late growth stage of rice, by extending the photosynthesis time of plant leaf, Accumulating more organic substances can be improved the potential of increasing production of rice.There is a kind of important leaf color mutants in rice -- often Greenery, are a kind of evergreen mutant of functional form, and main phenotypic characteristic contains for growth anaphase blade Senescence, chlorophyll Amount and photosynthetic capacity remain unchanged.Therefore, the production capacity of rice not only can be improved in the effective use of leaf color gene, also for Super rice breeding from now on provides new approaches and methods.

Summary of the invention

The object of the present invention is to provide it is a kind of can influence rice chloroplast development and the protein of leaf color, its gene and Using.

To achieve the above object, the present invention provides a kind of albumen of rice chloroplast developmental regulation Gene A HS1 coding Matter, the protein have sequence shown in (A) or (B): (A) Seq ID No:2 or amino acid sequence shown in Fig. 8；(B) exist (A) one or more amino acid and with the same function are added and/or replaced and/or lack in amino acid sequence defined by The protein as derived from (A).

The present invention also provides a kind of gene for encoding above-mentioned protein, the gene have (a) or (b) shown in sequence: (a) Seq ID No:1 or genome nucleotide sequence shown in Fig. 7；(b) in the nucleotide sequence shown in (a) addition and/or Replace and/or lacks one or more nucleotide and the codified that generates has the protein of rice chloroplast developmental regulation function Mutated gene, allele or derivative.

The present invention also provides a kind of plant expression vectors comprising said gene.The plant expression vector is preferred PCambia1300 expression vector.

The present invention also provides a kind of host cell, which contains said gene sequence.The host cell is big Coli cell, agrobatcerium cell or plant cell.

The present invention also provides a kind of methods for improveing rice leaf color, by said gene rice transformation cell, then will conversion Rice cell afterwards is cultivated into plant.

The present invention also provides above-mentioned protein, gene, plant expression vector, host cells in regulation plant chloroplast hair Application in educating.The plant is preferably gramineae plant, in particular rice.

Be further elaborated with: the object of the present invention is to provide one kind from rice mutant albino in heat The new gene AHS1 cloned in stress1, the DNA sequence dna as shown in Fig. 7 and Seq ID No:1 also include and Seq ID No:1 Shown in DNA sequence dna at least 70% homology gene order；Further include in Seq ID No:1 add and/or replace and/ Or lack one or more nucleotide and the mutated gene, allele or the derivative that generate, sequence with the same function The purpose of the present invention can be reached.It includes egg that Seq ID No:2 and protein shown in Fig. 8 in the present invention, which belong to triangular shape pentapeptide, White, wherein carrying out one or more replacements, the purpose of the present invention can also be reached by being inserted into or lack functional analogue obtained.

It is a further object to provide a kind of methods for carrying out efficient Plant Transformation with AHS1 gene, specifically It says, the present invention provides with the gene of sequence shown in Seq ID No:1 and Fig. 7 or the carrier of Gene Partial segment, wherein such as PCambia1300-AHS1 shown in Fig. 4, the carrier can express above-mentioned nucleotide sequence coded polypeptide or its homologous class Like object.

The present invention also provides a kind of methods that rice leaf color is influenced using plant expression vector conversion plant cell. The method of rice chloroplast development is specifically influenced using plant expression vector conversion plant cell.

Realize that steps are as follows for particular technique of the invention:

(1) separation and genetic analysis of mutant ahs1:

Rice seedling albino mutant ahs1 of the invention comes from japonica rice variety OryzasativaLcv.Nipponbare (Oryza sativa L.cv Nipponbare) the mutation that EMS (Ethyl Methyl Sulfonate) mutagenesis generates.It is real by the reciprocal cross with wild type It tests, it was demonstrated that the mutant is controlled by Recessive genes, as shown in Figure 1.

(2) mutant ahs1 is compared with wild type mesophyll cell chloroplaset and glume parenchyma cell chloroplast structure:

Compared with wild type, thylakoid structure is unobvious in mutant ahs1 mesophyll cell chloroplaset or number is decreased obviously (shown in such as Figure 1B, 1C)；Compared with wild type, without mature or complete chloroplast structure in mutant ahs1 glume parenchyma cell (such as Fig. 2 B, shown in 2C).

(3) map based cloning AHS1 gene:

1) the first positioning of AHS1:

In order to separate AHS1 gene, the present invention constructs a target group first, by mutant ahs1 and rice variety Local No. 1 hybridization combines F in platform₂Target group.It, will using molecular labelings such as STS, SSR again by the method for map based cloning The site AHS1 Primary Location is in the region between the 5th chromosome is marked between 5-11 and A5-9 (Fig. 3).

2) finely positioning of AHS1:

Develop new STS label AHS1 to be accurately located on BAC OJ1268_B08, between K5-13 and K5-27 label Within the scope of 22kb (Fig. 3), candidate gene is speculated by analyzing this section open reading frame (ORF).

3) identification and functional analysis of AHS1 gene:

Pass through transgenic technology, the results showed that present invention obtains the transgenic paddy rices for making mutant restore normal phenotype (Fig. 5, Fig. 6), it was demonstrated that of the invention correct to have cloned AHS1 gene.

In conclusion the present invention utilizes rice seedling albefaction ahs1 mutant, by map-based cloning for the first time in rice In be cloned into AHS1 gene, it includes albumen which, which encodes triangular shape pentapeptide, and adjusting and controlling rice blade and glume middle period are green Body early development, to influence leaf color and glume color.By the functional analysis to AHS1 gene, plant has been further clarified The genetic mechanism that object especially gramineae plant Development of Chloroplasts and leaf color are formed, for the photosynthesis effect for improveing crops Rate improves increasing production of rice potentiality and lays a good foundation.

Detailed description of the invention

Fig. 1 is that rice chloroplast developmental defect material ahs1 and the seedling stage phenotypic map (A) and blade and blade of wild type material are green Body micro-structure diagram (B and C).

Fig. 2 is rice chloroplast developmental defect material ahs1 and wild type material fringe portion phenotypic map (A) and glume chloroplaset Micro-structure diagram (B and C).

Fig. 3 is that the finely positioning of AHS1 gene and clone scheme.

Fig. 4 is pCAMBIA1302-AHS1 Vector map.

Fig. 5 is transgenosis complementation T₁For rice plant and ahs1 mutant plants phenotypic map.A left side, ahs1 mutant seedlings； The right side, transgenosis complementation T₁For seedling.

Fig. 6 is transgenosis complementation T₁For rice plant and ahs1 mutant fringe portion phenotypic map.A left side, ahs1 mutant fringe portion； The right side, transgenosis complementation T₁For fringe portion.

Fig. 7 is the DNA nucleotide sequence figure of AHS1 gene.

Fig. 8 is the amino acid sequence figure of AHS1 gene coding.

Specific embodiment

Following embodiment further illustrates the contents of the present invention, but should not be construed limitation of the present invention.It is not carrying on the back In the case where from spirit of that invention and essence, to modifications or substitutions made by the method for the present invention, step or condition, this hair is belonged to Bright range.Unless otherwise specified, the conventional means that technological means used in embodiment is well known to those skilled in the art. Unless otherwise specified, biochemical reagents used in embodiment, carrier, consumptive material etc. are commercially available products.

The clone of 1. rice chloroplast developmental regulation Gene A HS1 of embodiment

(1) rice material:

Rice mutant ahs1 (albino in heat stress1), original wild material are japonica rice variety OryzasativaLcv.Nipponbare (Oryza sativa L.cv Nipponbare).As shown in Figure 1, mutant ahs1 wheat seeding albefaction (Figure 1A)；With it is wild Type is compared, and ahs1 Development of Chloroplasts is abnormal (Figure 1B, 1C).At heading stage, mutant ahs1 glume shows albefaction phenotype, mutation It is visible (Fig. 2 B, 2C) without complete chloroplaset in body ahs1 glume.

(2) analysis and target group:

Local No. 1 is hybridized in homozygous ahs1 mutant and wild type rice variety platform, F₁Generation selfing, obtains F₂Group Body, and 2104 plants of ahs1 phenotype individuals are therefrom selected as target group.1 gram or so of tender leaf is taken for every plant in seedling stage, for mentioning Take plant genomic DNA.

(3) positioning of AHS1 gene:

Using the ahs1 phenotype individuals chosen from target group, the microcommunity of composition carries out ssr analysis, according to announcement The molecular genetic linkage map of japonica rice and long-grained nonglutinous rice creation chooses approaches uniformity and is distributed in the progress PCR expansion of the SSR primer on each chromosome Increase, using following amplification program: 94 DEG C initial denaturation 4 minutes；94 DEG C be denaturalized 30 seconds, 55 DEG C anneal 30 seconds, 72 DEG C extend 30 seconds, 35 A circulation；Last 72 DEG C re-extend 10 minutes.PCR product is dyed through the separation of 5% agarose gel electrophoresis and Ethidum Eremide, detection The polymorphism of PCR product, by AHS1 Primary Location between No. 5 the short arm of a chromosome 5-11 and A5-9 label.What is just positioned On the basis of continue to design SSR and STS label, AHS1 is finally accurately located at No. BAC as total 22kb on OJ1268_B08 section Within the scope of, the molecular labeling on both sides is K5-13 and K5-27 (Fig. 3), and is isolated with K5-29.Primer sequence is as follows:

5-11 F:GCTCTCCTGTGGGTTTTCAG R:CATGGTGCTCCTACTGGTTG

A5-9 F:ACTTACATCTGAGGTGCATA R:GCATTGCAGATTACAGATAC

K5-13 F:TCGTCGCACGCGAGATTTT R:ACACCGAACTGGGGCTGT

K5-27 F:GCGTCTCACCTAGCACTAT R:CGTCGCTCTATTTATCACAG

K5-29 F:CGATTTTGATGAACCAGAT R:TGCTCTCTCAGACTAAATG

(4) predictive genes and sequencing analysis:

According to finely positioning as a result, according to Rice Automated Annotation System within the scope of 22kb The prediction of (http://RiceGAAS.dna.affrc.go.jp), discovery shares 4 candidate genes in this section, according to two Mark remaining recombination number of individuals and isolate label, we devise the sequencing primer of each gene, using PCR method respectively from Each candidate gene progress sequencing analysis is amplified in ahs1 and wild-type variety OryzasativaLcv.Nipponbare genome.It was found that wherein 1 candidate In 1 DNA fragmentation of gene, the product of mutant ahs1 amplification has 1 base replacement compared with wild-type variety OryzasativaLcv.Nipponbare.It will Above-mentioned sequencing procedure repeated authentication twice, obtains identical result.Therefore, which is named as AHS1.According to BAC The gene annotation information for cloning OJ1268_B08 sequence, predicting that the candidate gene encodes a triangular shape pentapeptide includes albumen.

Embodiment 2.pCAMBIA1300-AHS1 plant expression vector construction

According to rice varieties OryzasativaLcv.Nipponbare (the Oryza sativa L cv.Nipponbare) full-length genome provided in NCBI Sequence, the specificity amplification primer of design amplification AHS1 candidate gene full length sequence, and expressed according to the pCambia1300 of selection The feature of carrier and AHS1 candidate gene sequence adds specific cleavage site (Fig. 4) at specific primer both ends.Specific design Primer are as follows: forward primer (P1F) 5 ' end addition EcoRI restriction enzyme site (GAATTC), reverse primer (P1R) 5 ' end addition Sse83871 restriction enzyme site (CCTGCAGG), primer sequence is as follows:

P1F forward primer: 5 '-CGGAATTCACTCCGATTTCCGTCTCTT-3 '

P1R reverse primer: 5 '-TGCCTGCAGGGCAGAAACGATAAGCACATA-3 '

Then rice varieties OryzasativaLcv.Nipponbare genomic DNA is extracted, and using OryzasativaLcv.Nipponbare genomic DNA as template, using setting above Primer (P1F and P1R) the amplification AHS1 candidate gene full length sequence of meter amounts to 4934bp: including AHS1 genomic DNA overall length and Downstream sequence thereon.Using following amplification program: 94 DEG C initial denaturation 4 minutes；98 DEG C are denaturalized 30 seconds, and 55 DEG C are annealed 30 seconds, 68 DEG C Extend 5 minutes, 35 circulations；Last 72 DEG C re-extend 10 minutes.The target fragment for recycling PCR amplification, connects ZERO BLUNT TOPO carrier converts escherichia coli DH5a competent cell to (Invitrogen), then by bacterium colony PCR identification sieve Positive colony is selected, and positive colony is sent to Invitrogen for sequencing.Plasmid will be carried out by the positive colony of sequencing identification It extracts, the plasmid EcoRI and Sse83871 double digestion of extraction, and recycles AHS1 complementary fragment.Simultaneously using EcoRI and Sse83871 carries out double digestion linearisation to pCambia1300, and recycles pCambia1300 skeleton, by what is recycled after digestion The pCambia1300 skeleton T4 ligase (being purchased from NEB company) recycled after AHS1 complementary fragment and digestion is attached, and is obtained PCAMBIA1300-AHS1 is expressed using electroporated method and is carried by AHS1 complementation expression vector pCAMBIA1300-AHS1 (Fig. 4) Body is transferred in agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105.

Embodiment 3. is by pCAMBIA1300-AHS1 plant expression vector rice transformation

Method for transformation is disseminated using the Mature Embryos of Rice callus of mediated by agriculture bacillus, by recombinant expression carrier pCAMBIA1300- AHS1 is transferred in Mature Embryos of Rice, and method for transformation is as follows: (1) induction of Mature Embryos of Rice callus: by mature OryzasativaLcv.Nipponbare Then seed decladding impregnates 30min with 30%NaClO solution then with 75% alcohol surface sterilization 2min, and be repeated once, Then it is cleaned 4-5 times with aqua sterilisa.Then seed is placed in induced medium and is cultivated, 26 degree are protected from light culture evoked callus For converting.(2) identification in embodiment 2 co-cultivation of Rice Callus and Agrobacterium: is contained into pCAMBIA1300-AHS1 The EHA105 bacterial strain of expression vector is activated, is enriched with, is resuspended, and OD600=0.4-0.6 is adjusted.Callus is collected in In 50ml sterile centrifugation tube, the agrobacterium suspension being resuspended is poured into, disseminates callus.After impregnating 15-30min, suspension is outwelled, The callus disseminated is placed on aseptic filter paper and blots extra Agrobacterium bacterium solution.Then callus is placed in and is covered with aseptic filter paper In culture dish, 26 degree are protected from light culture 2-3 days.(3) screening of kanamycin-resistant callus tissue: after the completion of co-cultivation, by callus be transferred to containing In the screening and culturing medium of the hygromycin of 50mg/ml, resistance screening under the conditions of 26-28 degree.(4) it the differentiation of kanamycin-resistant callus tissue: will screen The good callus of growth conditions is placed in differential medium in culture medium, is placed in 16 hours illumination/8 hour dark, environment temperatures Under conditions of between 26-28 degree, differentiation culture, until differentiation grows seedling.(5) break up taking root for seedling: seedling to be broken up When or so moon 2cm, seedling is transferred in root media, carries out culture of rootage.Grow the small transplantation of seedlings of root system in greenhouse or Transgenosis is grown in garden.Identification is carried out to plant and continuously it has been observed that compared with mutant of the same period, transgenosis Complementary T₁It is restored to normal condition (Fig. 5) for plant seedling stage leaf color, transgenosis complementation T₁It is also returned to for plant fringe portion glume Green (Fig. 6).

Sequence table

<110>China Paddy Rice Inst

<120>protein and the application of a kind of rice chloroplast developmental regulation Gene A HS1 and its coding

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2613

<212> DNA

<213>Oryza rice (Oryza sativa)

<400> 1

atgccgccac cgccagctag aacccacccg aaccctcccc tcctccacct cctcgcctcc 60

caccgcgcgc cgcagccgct cccgctcacg ccggcgcacg gccacctccc gccgcggaag 120

cgtccccgcg gagtcggctc cgcagcggcg ccgccgccgc cgcgtgccgc cgcctccgcg 180

gaggccacct actctgaccg gagcgccgcg ctgcgggcgc tctgtagcca tggccagctg 240

gcgcaggcgc tctggctcct cgagtcctcc ccggagccgc ccgacgaggg cgcctacgtc 300

gcgctgttcc ggctctgcga gtggcgccgc gcggtcgacg ccgggatgcg ggcgtgcgcg 360

cgcgccgacg ccgagcaccc gagcttcggg ctccgcctcg ggaacgctat gctcagcatg 420

ctcgtcaggt tcggggagat atggcacgcg tggagggtgt tcgccaaaat gcctgagagg 480

gacgtcttct cctggaacgt catggtaggc gggtacggca aggtgggctt cctcgaggag 540

gcgctggacc tgtactacag gatgctgtgg gcagggatga ggccggatgt ctacacgttc 600

ccctgcgtgc tgcgtacctg cgggggcatc cctgactgga ggatggggag ggaggtgcat 660

gctcatgtgc ttcgatttgg ttttggagac gaggtcgatg tattgaatgc tctggtgacc 720

atgtatgcaa aatgtgggga tattgtggcg gcgaggaagg tgtttgatgg aatggccgtg 780

acagactgca tatcatggaa tgcgatgata gctgggcatt ttgagaatca tgagtgtgag 840

gcagggttgg agttgtttct caccatgctg gagaatgagg tacaaccgaa tctcatgaca 900

ataaccagtg tgactgttgc atctggaatg ttgtctgaag tgggttttgc aaaagaaatg 960

catgggtttg ctgtaaagag aggtttcgcc attgatgttg cattctgtaa ctcgttgatt 1020

cagatgtaca ccagtctcgg gaggatgggg gatgcaggta aaatattctc aagaatggaa 1080

actaaagatg ccatgtcatg gactgcaatg atatcggggt atgagaaaaa tggtttccca 1140

gataaagccc ttgaagttta tgcactgatg gaattgcata atgtaagtcc tgatgatgtt 1200

acaattgcaa gtgcccttgc tgcttgtgcc tgcttgggga ggttagatgt aggcatcaaa 1260

ttgcatgagc ttgctcagaa caagggattc atcaggtatg ttgtcgttgc taatgcgctc 1320

cttgaaatgt atgctaaatc caagcacatt gataaggcta ttgaagtatt taagttcatg 1380

gctgagaagg atgtggtatc atggagttca atgattgctg gattttgctt taaccacagg 1440

agttttgagg ctttgtacta tttccggtat atgctaggac atgtaaaacc caattctgtt 1500

acatttatag ctgctctaag tgcttgtgct gctactgggg ctttgagatc tggtaaggaa 1560

atccatgcat atgttttaag gtgtggtatt ggatctgaag gttatgtacc caatgctctt 1620

ctagacttgt atgtgaaatg tggccagaca agctatgctt gggcacaatt cagcgtgcat 1680

agtgaaaagg atgttgtctc ttggaatata atgctttctg gttttgtagc tcatgggctt 1740

ggagatattg ctttatcact ctttaaccaa atggtagaaa tgggagagca tccggatgaa 1800

gttacatttg ttgctttatt gtgtgcttgt agtagggctg gaatggttat tcaaggctgg 1860

gagctttttc acatgatgac tgagaaattt tcaatagttc caaatctcaa gcactatgca 1920

tgtatggtag atctattgag tcgtgttggg aaattaacag aagcttacaa cctcataaat 1980

cgaatgccta tcaaacctga tgctgcagtg tggggagcct tgttgaatgg atgccggatc 2040

caccgacatg ttgaacttgg cgagcttgct gcaaaagtta tccttgagtt ggaacctaat 2100

gatgttgcat atcatgttct tctgtgtgat ttatatactg atgctggcaa atgggctcaa 2160

gtggctagag tgagaaaaac catgcgagag aagggattgg agcaagataa tggatgtagc 2220

tgggttgagg ttaagggagt aactcacgca tttcttacag atgatgaatc acatccacag 2280

ataaaagaaa taaatgttgt tctacatggc atatatgagc gaatgaaagc atgtggtttt 2340

gctcctgttg agtccttaga agataaagaa gtatccgagg acgacatctt gtgcggtcac 2400

agtgaaagat tagctgtagc ttttggtttg atcaatacta cacctggtac cactatttct 2460

gtcacaaaga accgatacac ttgccagagt tgtcatgtga tattcaaggc aatttctgaa 2520

attgttcgaa gagagataac tgttagagac actaagcaat tacactgctt taaggatgga 2580

gattgttcat gtggagatat aggatatgga tga 2613

<210> 2

<211> 870

<212> PRT

<213>Oryza rice (Oryza sativa)

<400> 2

Met Pro Pro Pro Pro Ala Arg Thr His Pro Asn Pro Pro Leu Leu His

1 5 10 15

Leu Leu Ala Ser His Arg Ala Pro Gln Pro Leu Pro Leu Thr Pro Ala

20 25 30

His Gly His Leu Pro Pro Arg Lys Arg Pro Arg Gly Val Gly Ser Ala

35 40 45

Ala Ala Pro Pro Pro Pro Arg Ala Ala Ala Ser Ala Glu Ala Thr Tyr

50 55 60

Ser Asp Arg Ser Ala Ala Leu Arg Ala Leu Cys Ser His Gly Gln Leu

65 70 75 80

Ala Gln Ala Leu Trp Leu Leu Glu Ser Ser Pro Glu Pro Pro Asp Glu

85 90 95

Gly Ala Tyr Val Ala Leu Phe Arg Leu Cys Glu Trp Arg Arg Ala Val

100 105 110

Asp Ala Gly Met Arg Ala Cys Ala Arg Ala Asp Ala Glu His Pro Ser

115 120 125

Phe Gly Leu Arg Leu Gly Asn Ala Met Leu Ser Met Leu Val Arg Phe

130 135 140

Gly Glu Ile Trp His Ala Trp Arg Val Phe Ala Lys Met Pro Glu Arg

145 150 155 160

Asp Val Phe Ser Trp Asn Val Met Val Gly Gly Tyr Gly Lys Val Gly

165 170 175

Phe Leu Glu Glu Ala Leu Asp Leu Tyr Tyr Arg Met Leu Trp Ala Gly

180 185 190

Met Arg Pro Asp Val Tyr Thr Phe Pro Cys Val Leu Arg Thr Cys Gly

195 200 205

Gly Ile Pro Asp Trp Arg Met Gly Arg Glu Val His Ala His Val Leu

210 215 220

Arg Phe Gly Phe Gly Asp Glu Val Asp Val Leu Asn Ala Leu Val Thr

225 230 235 240

Met Tyr Ala Lys Cys Gly Asp Ile Val Ala Ala Arg Lys Val Phe Asp

245 250 255

Gly Met Ala Val Thr Asp Cys Ile Ser Trp Asn Ala Met Ile Ala Gly

260 265 270

His Phe Glu Asn His Glu Cys Glu Ala Gly Leu Glu Leu Phe Leu Thr

275 280 285

Met Leu Glu Asn Glu Val Gln Pro Asn Leu Met Thr Ile Thr Ser Val

290 295 300

Thr Val Ala Ser Gly Met Leu Ser Glu Val Gly Phe Ala Lys Glu Met

305 310 315 320

His Gly Phe Ala Val Lys Arg Gly Phe Ala Ile Asp Val Ala Phe Cys

325 330 335

Asn Ser Leu Ile Gln Met Tyr Thr Ser Leu Gly Arg Met Gly Asp Ala

340 345 350

Gly Lys Ile Phe Ser Arg Met Glu Thr Lys Asp Ala Met Ser Trp Thr

355 360 365

Ala Met Ile Ser Gly Tyr Glu Lys Asn Gly Phe Pro Asp Lys Ala Leu

370 375 380

Glu Val Tyr Ala Leu Met Glu Leu His Asn Val Ser Pro Asp Asp Val

385 390 395 400

Thr Ile Ala Ser Ala Leu Ala Ala Cys Ala Cys Leu Gly Arg Leu Asp

405 410 415

Val Gly Ile Lys Leu His Glu Leu Ala Gln Asn Lys Gly Phe Ile Arg

420 425 430

Tyr Val Val Val Ala Asn Ala Leu Leu Glu Met Tyr Ala Lys Ser Lys

435 440 445

His Ile Asp Lys Ala Ile Glu Val Phe Lys Phe Met Ala Glu Lys Asp

450 455 460

Val Val Ser Trp Ser Ser Met Ile Ala Gly Phe Cys Phe Asn His Arg

465 470 475 480

Ser Phe Glu Ala Leu Tyr Tyr Phe Arg Tyr Met Leu Gly His Val Lys

485 490 495

Pro Asn Ser Val Thr Phe Ile Ala Ala Leu Ser Ala Cys Ala Ala Thr

500 505 510

Gly Ala Leu Arg Ser Gly Lys Glu Ile His Ala Tyr Val Leu Arg Cys

515 520 525

Gly Ile Gly Ser Glu Gly Tyr Val Pro Asn Ala Leu Leu Asp Leu Tyr

530 535 540

Val Lys Cys Gly Gln Thr Ser Tyr Ala Trp Ala Gln Phe Ser Val His

545 550 555 560

Ser Glu Lys Asp Val Val Ser Trp Asn Ile Met Leu Ser Gly Phe Val

565 570 575

Ala His Gly Leu Gly Asp Ile Ala Leu Ser Leu Phe Asn Gln Met Val

580 585 590

Glu Met Gly Glu His Pro Asp Glu Val Thr Phe Val Ala Leu Leu Cys

595 600 605

Ala Cys Ser Arg Ala Gly Met Val Ile Gln Gly Trp Glu Leu Phe His

610 615 620

Met Met Thr Glu Lys Phe Ser Ile Val Pro Asn Leu Lys His Tyr Ala

625 630 635 640

Cys Met Val Asp Leu Leu Ser Arg Val Gly Lys Leu Thr Glu Ala Tyr

645 650 655

Asn Leu Ile Asn Arg Met Pro Ile Lys Pro Asp Ala Ala Val Trp Gly

660 665 670

Ala Leu Leu Asn Gly Cys Arg Ile His Arg His Val Glu Leu Gly Glu

675 680 685

Leu Ala Ala Lys Val Ile Leu Glu Leu Glu Pro Asn Asp Val Ala Tyr

690 695 700

His Val Leu Leu Cys Asp Leu Tyr Thr Asp Ala Gly Lys Trp Ala Gln

705 710 715 720

Val Ala Arg Val Arg Lys Thr Met Arg Glu Lys Gly Leu Glu Gln Asp

725 730 735

Asn Gly Cys Ser Trp Val Glu Val Lys Gly Val Thr His Ala Phe Leu

740 745 750

Thr Asp Asp Glu Ser His Pro Gln Ile Lys Glu Ile Asn Val Val Leu

755 760 765

His Gly Ile Tyr Glu Arg Met Lys Ala Cys Gly Phe Ala Pro Val Glu

770 775 780

Ser Leu Glu Asp Lys Glu Val Ser Glu Asp Asp Ile Leu Cys Gly His

785 790 795 800

Ser Glu Arg Leu Ala Val Ala Phe Gly Leu Ile Asn Thr Thr Pro Gly

805 810 815

Thr Thr Ile Ser Val Thr Lys Asn Arg Tyr Thr Cys Gln Ser Cys His

820 825 830

Val Ile Phe Lys Ala Ile Ser Glu Ile Val Arg Arg Glu Ile Thr Val

835 840 845

Arg Asp Thr Lys Gln Leu His Cys Phe Lys Asp Gly Asp Cys Ser Cys

850 855 860

Gly Asp Ile Gly Tyr Gly

865 870

<210> 3

<211> 20

<212> DNA

<213>artificial sequence (5-11 F)

<400> 3

gctctcctgt gggttttcag 20

<210> 4

<211> 20

<212> DNA

<213>artificial sequence (5-11 R)

<400> 4

catggtgctc ctactggttg 20

<210> 5

<211> 20

<212> DNA

<213>artificial sequence (A5-9 F)

<400> 5

acttacatct gaggtgcata 20

<210> 6

<211> 20

<212> DNA

<213>artificial sequence (A5-9 R)

<400> 6

gcattgcaga ttacagatac 20

<210> 7

<211> 19

<212> DNA

<213>artificial sequence (K5-13 F)

<400> 7

tcgtcgcacg cgagatttt 19

<210> 8

<211> 18

<212> DNA

<213>artificial sequence (K5-13 R)

<400> 8

acaccgaact ggggctgt 18

<210> 9

<211> 19

<212> DNA

<213>artificial sequence (K5-27 F)

<400> 9

gcgtctcacc tagcactat 19

<210> 10

<211> 20

<212> DNA

<213>artificial sequence (K5-27 R)

<400> 10

cgtcgctcta tttatcacag 20

<210> 11

<211> 19

<212> DNA

<213>artificial sequence (K5-29 F)

<400> 11

cgattttgat gaaccagat 19

<210> 12

<211> 19

<212> DNA

<213>artificial sequence (K5-29 R)

<400> 12

tgctctctca gactaaatg 19

<210> 13

<211> 27

<212> DNA

<213>artificial sequence (P1F)

<400> 13

cggaattcac tccgatttcc gtctctt 27

<210> 14

<211> 30

<212> DNA

<213>artificial sequence (P1R)

<400> 14

tgcctgcagg gcagaaacga taagcacata 30

Claims

1. a kind of method for improveing rice leaf color, it is characterised in that: will the genome nucleotide sequence as shown in Seq ID No:1 Genetic transformation rice cell, then by after conversion rice cell cultivate at plant.

2. a kind of protein, gene, plant expression vector or host cell are in the regulation developmental application of plant chloroplast, spy Sign is:

The amino acid sequence of the protein is as shown in Seq ID No:2；

The genome nucleotide sequence of the gene is as shown in Seq ID No:1；

The plant expression vector is the plant expression vector containing genome nucleotide sequence shown in Seq ID No:1；

The host cell is the host cell containing genome nucleotide sequence shown in Seq ID No:1.

3. application according to claim 2, it is characterised in that: the plant is gramineae plant.

4. application according to claim 2, it is characterised in that: the plant is rice.