CN113957082B - Rice chloroplast development gene TSA protected at low temperature and encoding protein and application thereof - Google Patents

Abstract

The invention discloses a TSA (TSA) gene for protecting rice chloroplast development at low temperature, a coded protein and application thereof, wherein a gene TSA for regulating and controlling chloroplast development at low temperature is cloned by a map-based cloning technology, and transgenic knockout and functional complementation experiments prove that the TSA gene is important for protecting normal development of chloroplast at low temperature. The fluorescence quantitative PCR discovers that TSA is induced to be expressed under the low temperature condition (20 ℃), and the expression of the TSA is properly regulated to improve the adaptability of rice cold stress, so that a new idea is provided for cultivating new varieties of cold-resistant rice. Meanwhile, the gene can be used for regulating and controlling the development of rice chloroplasts, improving photosynthesis efficiency and increasing rice yield. In addition, the gene mutant is genetically stable and can be used as a marker in production practice.

Description

Rice chloroplast development gene TSA protected at low temperature and encoding protein and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and in particular relates to a rice chloroplast development related gene TSA, and a coding protein and application thereof.

Background

Rice is one of the world's important food crops, and more than half of the population worldwide takes rice as the main food. In China, more than 60% of people take rice as main food, and the rice is an important grain crop. Therefore, the high and stable yield of the rice has important significance for the grain safety of China. The high yield of rice can be realized without separating chloroplast and chlorophyll. Mutation of chloroplast development related genes causes defects in chloroplast development, reduced photosynthesis, retarded growth, and even death. After the gene related to chlorophyll metabolic pathway is mutated, the chlorophyll content in the plant is changed, the color depth of the plant is changed, and the photosynthesis efficiency of the plant is directly influenced.

The rice seedling stage is a chloroplast system building stage, which is extremely susceptible to low temperatures. Under the condition of field planting, rice seedling stage is stressed by low temperature and often shows the phenomenon of irregular germination, yellowing of leaf color and even death. Therefore, the chloroplast development gene is regulated under the condition of low temperature by developing and describing the molecular mechanism of the chloroplast development gene, and the chloroplast development gene plays an important role in improving the cold resistance of rice in seedling stage. Meanwhile, the method has important biological significance for analyzing the cause of high photosynthetic efficiency of the rice, and lays a good theoretical foundation for cultivation of super rice in subsequent production.

Disclosure of Invention

The invention aims to disclose a gene TSA for regulating and controlling chloroplast development under a low-temperature condition of rice, and a coding protein and application thereof.

The invention provides a gene TSA, which is a DNA molecule as described in the following 1) or 2):

1) A DNA molecule shown in SEQ ID No. 1;

2) A DNA molecule shown in SEQ ID No. 2;

SEQ ID NO.1 or SEQ ID NO.2 in the sequence Listing are composed of 1404 nucleotides.

The invention also provides a protein encoded by the gene TSA.

Specifically, the protein provided by the invention is selected from any one of the following (a) or (b):

(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 3;

(b) And (3) a protein which is derived from SEQ ID NO.1 or SEQ ID NO.2, is related to chloroplast development and is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence of SEQ ID NO. 3.

SEQ ID NO.3 of the sequence Listing consists of 467 amino acids.

The invention also provides a knockout expression vector, a recombinant expression vector, a fusion complementary vector or recombinant bacteria containing the gene TAS. Recombinant expression vectors containing any of the above genes are also within the scope of the present invention.

Primers that amplify the full length or any fragment of the gene (TSA) are also within the scope of the present invention.

The positioning primers involved in the fine positioning of this gene (see Table 1), inDel primers were self-designed primers required for this experiment, and these self-designed primers also fall within the scope of the present invention.

The invention also provides a gene shown in SEQ ID NO.1, and application of at least one of the protein, the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium in cultivating transgenic rice with normal leaf color or normal chloroplast development.

The invention also provides a method for cultivating the transgenic rice with normal leaf color, which is to introduce the gene shown in SEQ ID NO.1 into the rice with abnormal leaf color to obtain the transgenic rice with normal leaf color, wherein the abnormal leaf color refers to the rice with albino phenotype in a low-temperature environment, and the normal leaf color refers to the rice with normal leaf color in the low-temperature environment.

The invention also provides a method for cultivating the transgenic rice with normal chloroplast development, which is to introduce the gene shown in SEQ ID NO.1 into the rice with abnormal chloroplast development to obtain the transgenic rice with normal chloroplast development.

The invention also provides the application of the gene shown in SEQ ID NO.2, the protein coded by the SEQ ID NO.2, or the recombinant expression vector, the expression cassette or the recombinant bacterium containing the gene shown in the SEQ ID NO.2 in research on rice leaf color or chloroplast development.

The beneficial effects are that:

the gene TSA for regulating and controlling chloroplast development under the low temperature condition is cloned by the map-based cloning technology, and a transgenic knockout and functional complementation experiment proves that the TSA is vital for protecting chloroplast normal development under the low temperature condition. The fluorescence quantitative PCR discovers that TSA is induced to express under the low temperature condition (20 ℃) (figure 6), and the expression of the TSA is properly regulated to improve the adaptability of rice cold stress, so that a new idea is provided for cultivating new varieties of cold-resistant rice. Meanwhile, the gene can be used for regulating and controlling the development of rice chloroplasts, improving photosynthesis efficiency and increasing rice yield. In addition, the gene mutant is genetically stable and can be used as a marker in production practice.

Description of the drawings:

FIG. 1 shows the phenotypes of wild-type N3 and mutant tsa.

FIG. 2 shows chlorophyll content measurement and transmission electron microscopy observation of wild type N3 and mutant tsa.

FIG. 3 shows projection electron microscope observations of wild-type N3 and mutant tsa.

FIG. 4 shows the fine localization of TSA on rice chromosome 2.

FIG. 5 is a phenotype of a transgenic knockout and functionally complementary plant.

FIG. 6 shows low temperature induced expression of TSA.

Detailed Description

The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.

Example 1 discovery of chloroplast development deficient mutant tsa under Low temperature conditions

1. Phenotype and genetic analysis of mutant tsa

In an EMS mutagenesis pool, a temperature-sensitive albino mutant is screened out and named tsa.

Ratio to wild type N3In contrast, tsa first leaf is light green at 20 ℃, second and third leaves exhibit a whitened phenotype and begin turning green during the four-leaf phase, the fourth leaf appearing green; tsa exhibits a light green phenotype at 30 ℃. The mutant is a temperature-sensitive albino-greening material, and a albino phenotype appears in a low-temperature environment, and gradually returns to a wild type phenotype along with the rise of temperature and the progress of growth and development stages (figure 1). Mutant tsa is orthogonalized and anticrossed with wild type, F ₁ The seedling stage grows under the condition of 20 ℃, leaves are green, and the tsa albino-greening phenotype is controlled by recessive nuclear genes.

By measuring the chlorophyll content in the two-leaf stage, it was found that the chlorophyll a, chlorophyll b, carotenoid content and total chlorophyll content in the second leaf of tsa seedlings were all significantly lower than that of the wild type at 20 c (fig. 2). It was found by transmission electron microscopy that under 20℃the tsa was completely whitened, the chloroplast was dysplasia, and the chloroplast structure of the partial cells was abnormal, with the thylakoid lamina missing (FIG. 3).

2. Map cloning of mutant Gene loci

1. Localization of mutant genes

F obtained by hybridization of tsa and 9311 is selected in an incubator under low temperature (20 ℃) ₂ And (3) carrying out linkage analysis on the polymorphism markers according to genotyping by using 165 on 10 two-leaf albino individuals in the population, and preliminarily positioning the gene for controlling leaf color mutation on a No.2 chromosome long arm, wherein the gene is positioned between the markers I2-10 and InDel96, and the gap between the two molecular markers is about 1Mbp. On this basis, albino individuals were increased to 384, and the polymorphic molecular markers were increased to further narrow the localization interval to between Y1 and Y28, with the two molecular markers being about 24.56kb apart (FIG. 4).

The method for SSR marker analysis is as follows:

the specific method for extracting the DNA of the rice tissue comprises the following steps:

a) Picking F ₂ About 0.2g of invisible single plant leaves in the population are placed in a 2.0mL centrifuge tube, and after liquid nitrogen is frozen, a grinding instrument is used for grinding samples.

b) 650. Mu.L of CTAB extract was added and the sample was incubated at 65℃for 25min with shaking every 5min.

c) 650 μl chloroform was added: isoamyl alcohol (24:1), the mixture was inverted and left to stand for 5min.

d) Centrifuge at 12000rpm for 8min.

e) The supernatant was transferred to a new 1.5mL centrifuge tube, and 0.7 volumes of isopropanol were added, mixed and placed at-20 ℃.

f) After 1 hour of freezing, the supernatant was discarded by centrifugation at 12000rpm for 8min (4 ℃).

g) The precipitate was washed twice with 70% ethanol and dried in a fume hood. The DNA pellet was dissolved in 100. Mu.L deionized water and stored at-20℃until use.

(2) The DNA extracted as described above was diluted to about 20 ng/. Mu.L and subjected to PCR amplification as a template:

the PCR reaction system is as follows:

the PCR reaction procedure was:

molecular markers were developed using an online site (http:// ricevarmap. Ncpgr. Cn /), the reference genome being Nipponbare and 9311, respectively.

TABLE 1 molecular markers for Fine localization

2. Acquisition of the Gene of interest

Using Gramene (http:// www.gramene.org /) website predictions, the 24.56kb interval between markers Y1 and Y28 contained 6 ORFs. It was found by sequencing that a single base substitution occurred in the fourth ORF coding region, resulting in a single amino acid change. Namely, the gene shown in the wild type SEQ ID NO.1 (the coded protein sequence is shown as SEQ ID NO. 3) is changed into a mutant type gene shown as SEQ ID NO. 2.

The fourth ORF sequencing primer sequence is as follows:

Primer1:TCCGCTCTCCCCTATCCAT

Primer2:AACCCCTAAAACTCAACGCG

performing PCR amplification by using wild type and mutant DNA as templates, wherein an amplification system is as follows: DNA template 5. Mu.L, ddH2O 10. Mu.L, 2xbuffer 25. Mu.L, 2. Mu.M dNTPs 10. Mu.L, KOD 1. Mu.L, primer 5. Mu.L.

Example 2 acquisition and identification of transgenic plants

1. Recombinant expression vector construction

The CRISPR-P online website (http:// cbi.hzau.edu.cn/cgi-bin/CRISPR) is utilized to design a knockout primer of candidate gene TSA, and the primer sequence is as follows:

Primer3：5'GGCATCGGATTCTCCTCGCCCGCG 3'

Primer4：5'AAACCGCGGGCGAGGAGAATCCGA 3'

and (3) taking wild DNA as a template, performing PCR amplification to obtain TSA genes and promoters, and constructing a pCAMBIA1390 complementary vector, wherein the PCR primer sequences are as follows:

Primer5：

5'CCGGCGCGCCAAGCTT TCCAGTAAAGTAACAAGCAGTA 3'

Primer6：

5'GAATTCCCGGGGATCCATTAGTTGCAAACAGATGTATC 3'

the wild cDNA is used as a template, the TSA gene is obtained through amplification, and a pCAMBIA1305.1 GFP fusion vector is constructed, and the PCR primer sequence is as follows:

Primer7：

5'CGG AGC TAG CTC TAG A ATGGCCTCCCTCGCCTCCGC 3'

Primer8：

5'TGC TCA CCA TGG ATC C CTTCAAGATCGTATTGATGA 3'

and purifying and recovering the PCR products amplified by the primers, and respectively recombining with the corresponding linearization vectors. Recombinant System (10. Mu.L): DNA 3. Mu.L, linear vector 2. Mu.L, recombinant Mix 5. Mu.L (Takara).

The carrier construction step:

a) 10. Mu.L of the mixture was placed in a 50℃water bath for 20min of reconstitution.

b) The recombinant product was transferred to 100. Mu.L of E.coli competent (DH 5. Alpha.) and mixed well in an ice bath for 25min. And then placing the mixture on ice for standing for 5min after heat shock is carried out for 60s in a water bath kettle at the temperature of 42 ℃.

c) Add 500. Mu.L of E.coli medium and resuscitate in a shaker at 37℃for 1h.

d) The corresponding antibiotic plates were applied and incubated upside down in an incubator at 37℃for 15h.

e) The monoclonal strain was picked up into sterilized PE tubes containing 1ml of medium, cultured at 37℃for 6 hours, the expression vector plasmid was extracted and sequenced.

f) And respectively transforming the knocked-out vector, the functional complementary vector and the fusion complementary vector into the agrobacterium EHA105 strain by using a freeze thawing method to obtain a recombinant strain.

2. Acquisition of transgenic plants

1. Infection of callus

a) The transgenic knockout strain and the functionally complementary strain were cultured at 28℃for 16 hours, and the cells were collected and diluted into N6 liquid medium (Sigma Co., C1416) to a concentration of OD 600. Apprxeq.0.5 to obtain a bacterial liquid.

b) The knocked-out strain and the complementary strain respectively infect the calli prepared by the wild N3 and N3/tsa hybrid, and are cultured for 3 days.

c) The infected calli were transferred to N6 solid medium containing the corresponding resistance screening compound for 15 days.

d) Healthy calli were picked and subjected to a second selection using the corresponding selection medium.

e) The resistant calli were picked and placed on a screening differentiation medium for differentiation.

2. Identification of transgenic plants.

Identification of transgenic knockout plants: and designing amplification primers near 200bp upstream and downstream of the knockout target point, extracting transgenic plant DNA amplification, and sequencing, analyzing and editing. The knockout homozygous plants all exhibit a whiteout phenotype.

Identification of functionally complementary plants: t1 isolation gives transgenic plants, which show normal leaf-color phenotype in the mutant background, while transgenic recessive plants show a whitening phenotype under low temperature conditions (FIG. 5).

Example 3 Induction of TSA transcription level under Low temperature conditions

1. Extraction and reverse transcription of total RNA of plant

And (3) respectively planting the wild type (N3) in an incubator at 20 ℃,25 ℃ and 30 ℃, and selecting a second leaf to extract total RNA when seedlings grow to a two-leaf stage. The total RNA was extracted using the plant RNA extraction kit (DP 432) from Biochemical technology company of Beijing antenna root. 1. Mu.g of total RNA was used and inverted into 20. Mu.l of cDNA stock solution using Takara reverse transcription kit (RR 036A), and the stock solution was diluted 10-fold to give working solution and stored at-20℃for use.

2. Real-time PCR analysis

The Real-time PCR instrument used the ABI 7500 fluorescent quantitative detection system (Applied Biosystems). The reagent is TB Green Premix Ex Taq II (Tli RNaseH Plus) premix from Bao Bio Inc.

PCR System (20. Mu.l):

PCR procedure: 95 ℃ for 30s;95 ℃ for 5s;60 ℃ for 34s; to the second step 39 cycles; dissolution profile from 65 ℃ to 95 ℃. Each experimental group was provided with three biological replicates and three technical replicates, respectively. The rice UBQ gene is used as an internal reference gene, and quantitative primers are as follows:

TSA Forward Primer：GGCCAACCCTGCCATTAAGC

TSA Reverse Primer：AGCAAGCAAGAACGGGAGGT

UBQ Forward Primer：GCTCCGTGGCGGTATCAT

UBQ Reverse Primer：CGGCAGTTGACAGCCCTAG

the results of inducing TSA transcription level under low temperature conditions are shown in FIG. 6, which shows that it is expressed by low temperature induction.

Sequence listing

<110> Nanjing agricultural university

<120> a rice chloroplast development gene TSA protected at low temperature, and encoded protein and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1404

<212> DNA

<213> Rice (Oryza sativa. Nipponbare)

<400> 1

atggcctccc tcgcctccgc ctccgcatcc acctccctgg tcttctccac ctcctcctcc 60

aagccgcgcc tcggctcctc cgtcggattc tcctcgcccg cgcggttccg gcgcacggcg 120

gcggcggcgg cgtccagggg cacggggcgg cgcgcggggc tgctggtagt gcgcgcggcg 180

agggggaagt tcgagcggac caagccgcac gtcaacatcg gcaccatcgg ccacgtcgac 240

cacgggaaga ctacgctgac ggcggcgctc accatggtgc tcgcctccgt gggcgggagc 300

gcccccaaga agtacgacga gatcgacgcg gcgcccgagg agcgcgcccg cggcatcacc 360

atcaacaccg ccaccgtcga gtacgagacc gagacccgcc actacgccca cgtcgactgc 420

cccggccacg ccgactacgt caagaacatg attaccggcg ccgcgcagat ggacggcgcc 480

atcctcgtcg tctccggcgc cgacgggccc atgccgcaga ccaaggagca catcctgctc 540

gccaagcagg tcggtgtccc caagattgtt gtcttcctca acaagaagga ccaggtcgac 600

gacgaggagc tgctccagct cgtcgagctc gaggtccgcg aattgctctc ctcctacgag 660

tacgatggcg acgaagtgcc catcgtcgct ggctccgcgc tcaaggcgct cgagaacctc 720

atggccaacc ctgccattaa gcgcggcgat gatgagtggg tggacgggat cttctcgttg 780

attgattccg tggataacta catccctgtc ccacagcgcc agaccgacct cccgttcttg 840

cttgctgttg aggatgtgtt ctccatcacc ggtcgtggta ccgttgccac tggccgtatt 900

gagcgtggca ccgtcaaggt tggggacacg gtcgatatcg tcggtatccg ggagactcgc 960

aactgcacgg tgactggtgt tgagatgttc cagaagacca tggatgatgc gatggctggg 1020

gacaatgtcg gcctgcttct ccgaggtatg cagaaggatg atatcgagag aggcatggtg 1080

cttgcgaagc ctgcttccat cacgccacac accaagtttg atgcggttgt gtatgtcctg 1140

aagaaggacg agggtggacg gcactcaccg tttttccctg gttaccgccc tcagttctac 1200

atgcggacta ccgatgtgac ggggaatgtc acaaagatta tgaacgacaa ggacgaggag 1260

gcgaagatgt gcatgcctgg tgaccgtgtc aagatggttg tggagctcat ccagcccgtc 1320

gcttgtgagc agggaatgag gtttgccatc cgtgagggtg gaaagaccgt cggtgccggc 1380

gtcatcaata cgatcttgaa gtaa 1404

<210> 2

<211> 1404

<212> DNA

<213> Rice (Oryza sativa. Nipponbare)

<400> 2

atggcctccc tcgcctccgc ctccgcatcc acctccctgg tcttctccac ctcctcctcc 60

aagccgcgcc tcggctcctc cgtcggattc tcctcgcccg cgcggttccg gcgcacggcg 120

gcggcggcgg cgtccagggg cacggggcgg cgcgcggggc tgctggtagt gcgcgcggcg 180

agggggaagt tcgagcggac caagccgcac gtcaacatcg gcaccatcgg ccacgtcgac 240

cacgggaaga ctacgctgac ggcggcgctc accatggtgc tcgcctccgt gggcgggagc 300

gcccccaaga agtacgacga gatcgacgcg gcgcccgagg agcgcgcccg cggcatcacc 360

atcaacaccg ccaccgtcga gtacgagacc gagacccgcc actacgccca cgtcgactgc 420

cccggccacg ccgactacgt caagaacatg attaccggcg ccgcgcagat ggacggcgcc 480

atcctcgtcg tctccggcgc cgacgggccc atgccgcaga ccaaggagca catcctgctc 540

gccaagcagg tcggtgtccc caagattgtt gtcttcctca acaagaagga ccaggtcgac 600

gacgaggagc tgctccagct cgtcgagctc gaggtccgcg aattgctctc ctcctacgag 660

tacgatggcg acgaagtgcc catcgtcgct ggctccgcgc tcaaggcgct cgagaacctc 720

atggccaacc ctgccattaa gcgcggcgat gatgagtggg tggacgggat cttctcgttg 780

attgattccg tggataacta catccctgtc ccacagcgcc agaccgacct cccgttcttg 840

cttgctgttg aggatgtgtt ctccatcacc ggtcgtggta ccgttgccac tggccgtatt 900

gagcgtggca ccgtcaaggt tggggacacg gtcgatatcg tcggtatccg ggagactcgc 960

aactgcacgg tggctggtgt tgagatgttc cagaagacca tggatgatgc gatggctggg 1020

gacaatgtcg gcctgcttct ccgaggtatg cagaaggatg atatcgagag aggcatggtg 1080

cttgcgaagc ctgcttccat cacgccacac accaagtttg atgcggttgt gtatgtcctg 1140

aagaaggacg agggtggacg gcactcaccg tttttccctg gttaccgccc tcagttctac 1200

atgcggacta ccgatgtgac ggggaatgtc acaaagatta tgaacgacaa ggacgaggag 1260

gcgaagatgt gcatgcctgg tgaccgtgtc aagatggttg tggagctcat ccagcccgtc 1320

gcttgtgagc agggaatgag gtttgccatc cgtgagggtg gaaagaccgt cggtgccggc 1380

gtcatcaata cgatcttgaa gtaa 1404

<210> 3

<211> 467

<212> PRT

<213> Rice (Oryza sativa. Nipponbare)

<400> 3

Met Ala Ser Leu Ala Ser Ala Ser Ala Ser Thr Ser Leu Val Phe Ser

1 5 10 15

Thr Ser Ser Ser Lys Pro Arg Leu Gly Ser Ser Val Gly Phe Ser Ser

20 25 30

Pro Ala Arg Phe Arg Arg Thr Ala Ala Ala Ala Ala Ser Arg Gly Thr

35 40 45

Gly Arg Arg Ala Gly Leu Leu Val Val Arg Ala Ala Arg Gly Lys Phe

50 55 60

Glu Arg Thr Lys Pro His Val Asn Ile Gly Thr Ile Gly His Val Asp

65 70 75 80

His Gly Lys Thr Thr Leu Thr Ala Ala Leu Thr Met Val Leu Ala Ser

85 90 95

Val Gly Gly Ser Ala Pro Lys Lys Tyr Asp Glu Ile Asp Ala Ala Pro

100 105 110

Glu Glu Arg Ala Arg Gly Ile Thr Ile Asn Thr Ala Thr Val Glu Tyr

115 120 125

Glu Thr Glu Thr Arg His Tyr Ala His Val Asp Cys Pro Gly His Ala

130 135 140

Asp Tyr Val Lys Asn Met Ile Thr Gly Ala Ala Gln Met Asp Gly Ala

145 150 155 160

Ile Leu Val Val Ser Gly Ala Asp Gly Pro Met Pro Gln Thr Lys Glu

165 170 175

His Ile Leu Leu Ala Lys Gln Val Gly Val Pro Lys Ile Val Val Phe

180 185 190

Leu Asn Lys Lys Asp Gln Val Asp Asp Glu Glu Leu Leu Gln Leu Val

195 200 205

Glu Leu Glu Val Arg Glu Leu Leu Ser Ser Tyr Glu Tyr Asp Gly Asp

210 215 220

Glu Val Pro Ile Val Ala Gly Ser Ala Leu Lys Ala Leu Glu Asn Leu

225 230 235 240

Met Ala Asn Pro Ala Ile Lys Arg Gly Asp Asp Glu Trp Val Asp Gly

245 250 255

Ile Phe Ser Leu Ile Asp Ser Val Asp Asn Tyr Ile Pro Val Pro Gln

260 265 270

Arg Gln Thr Asp Leu Pro Phe Leu Leu Ala Val Glu Asp Val Phe Ser

275 280 285

Ile Thr Gly Arg Gly Thr Val Ala Thr Gly Arg Ile Glu Arg Gly Thr

290 295 300

Val Lys Val Gly Asp Thr Val Asp Ile Val Gly Ile Arg Glu Thr Arg

305 310 315 320

Asn Cys Thr Val Thr Gly Val Glu Met Phe Gln Lys Thr Met Asp Asp

325 330 335

Ala Met Ala Gly Asp Asn Val Gly Leu Leu Leu Arg Gly Met Gln Lys

340 345 350

Asp Asp Ile Glu Arg Gly Met Val Leu Ala Lys Pro Ala Ser Ile Thr

355 360 365

Pro His Thr Lys Phe Asp Ala Val Val Tyr Val Leu Lys Lys Asp Glu

370 375 380

Gly Gly Arg His Ser Pro Phe Phe Pro Gly Tyr Arg Pro Gln Phe Tyr

385 390 395 400

Met Arg Thr Thr Asp Val Thr Gly Asn Val Thr Lys Ile Met Asn Asp

405 410 415

Lys Asp Glu Glu Ala Lys Met Cys Met Pro Gly Asp Arg Val Lys Met

420 425 430

Val Val Glu Leu Ile Gln Pro Val Ala Cys Glu Gln Gly Met Arg Phe

435 440 445

Ala Ile Arg Glu Gly Gly Lys Thr Val Gly Ala Gly Val Ile Asn Thr

450 455 460

Ile Leu Lys

465

Claims (1)

1. The application of the gene shown in SEQ ID NO.2, the protein coded by SEQ ID NO.2, or the recombinant expression vector, the expression cassette or the recombinant bacterium containing the gene shown in SEQ ID NO.2 in research on rice leaf color or chloroplast development.