CN107266544B

CN107266544B - Application of protein SiNADP-ME3 and coding gene thereof in regulation and control of plant stress resistance

Info

Publication number: CN107266544B
Application number: CN201710691367.6A
Authority: CN
Inventors: 刁现民; 陈倩楠; 汤沙; 贾冠清; 智慧
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2017-08-14
Filing date: 2017-08-14
Publication date: 2020-06-02
Anticipated expiration: 2037-08-14
Also published as: CN107266544A

Abstract

The invention discloses application of a protein SiNADP-ME3 and a coding gene thereof and related biological materials in regulation and control of plant stress resistance. The amino acid sequence of the protein SiNADP-ME3 is a protein shown in a sequence 2; the sequence of the coding gene of the protein SiNADP-ME3 is shown as a sequence 1. Experiments prove that: the SiNADP-ME3 plays an important role in maintaining yield under drought stress of plants, the gene has important practical significance in the aspects of crop drought resistance and water efficient utilization, and clues are provided for deep understanding of mechanisms generated by the drought resistance of millet.

Description

Application of protein SiNADP-ME3 and coding gene thereof in regulation and control of plant stress resistance

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of a protein SiNADP-ME3 and a coding gene thereof in regulation and control of plant stress resistance.

Background

Drought has become a major limiting factor in further crop yield improvement and stable growth worldwide. Millet serving as a traditional grain and grass dual-purpose crop in China has the excellent characteristics of barren resistance, high water utilization efficiency, high photosynthesis efficiency and the like, and plays an important role in dry farming agriculture. With the increasing shortage of water resources, the research on the drought-resistant germplasm resources of the millet is enhanced, new drought-resistant genes are excavated, the drought resistance of the millet is further improved, and the method has important strategic significance for promoting the improvement of the production level of the millet and the improvement of the drought resistance of other crops.

NADP-ME is involved in plant defense and stress response. The non-photosynthetic NADP-ME is involved in defense reactions caused by various stress factors, such as physical damage, pathogen invasion, UV-B radiation, and the like. Under these stresses, NADP-ME activity is significantly increased, presumably by catalyzing the reduction of the production of the substance NADPH during malate metabolism for lignin and other substance synthesis.

Disclosure of Invention

The invention aims to solve the technical problem of how to improve the stress resistance of plants.

In order to solve the technical problems, the invention firstly provides a new application of the SiNADP-ME3 protein.

The invention provides application of SiNADP-ME3 protein in regulation and control of plant stress resistance;

the SiNADP-ME3 protein is a protein of the following a) or b) or c) or d):

a) the amino acid sequence is a protein shown in a sequence 2;

b) a fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in the sequence 2;

c) the protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2;

d) and (b) a protein having a homology of 75% or more than 75% with the amino acid sequence shown in the sequence 2 and having the same function.

In order to facilitate the purification of the protein in a), the amino terminal or the carboxyl terminal of the protein shown in the sequence 2 in the sequence table can be connected with a label shown in the table 1.

TABLE 1 sequence of tags

The protein of c) above, wherein the substitution and/or deletion and/or addition of one or more amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

The protein in the c) can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

The gene encoding the protein of c) above can be obtained by deleting one or several codons of amino acid residues from the DNA sequence shown in sequence No.1, and/or performing missense mutation of one or several base pairs, and/or connecting the coding sequence of the tag shown in Table 1to the 5 'end and/or 3' end thereof.

In the above d), "homology" includes an amino acid sequence having 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more homology with the amino acid sequence represented by the sequence 2 of the present invention.

In order to solve the technical problems, the invention also provides a new application of the biological material related to the SiNADP-ME3 protein.

The invention provides an application of a biological material related to SiNADP-ME3 protein in regulation and control of plant stress resistance, which comprises the following steps:

the biomaterial is any one of the following A1) to A12):

A1) nucleic acid molecules encoding SiNADP-ME3 protein;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a recombinant microorganism comprising a4) said recombinant vector;

A9) a transgenic plant cell line comprising the nucleic acid molecule of a 1);

A10) a transgenic plant cell line comprising the expression cassette of a 2);

A11) a transgenic plant cell line comprising the recombinant vector of a 3);

A12) a transgenic plant cell line comprising the recombinant vector of a 4).

In the above application, the nucleic acid molecule of A1) is a gene as shown in 1) or 2) or 3) below:

1) the coding sequence is a cDNA molecule or a genome DNA molecule shown in a sequence 1;

2) a cDNA molecule or a genome DNA molecule which has 75 percent or more than 75 percent of identity with the nucleotide sequence limited by 1) and codes SiNADP-ME3 protein;

3) a cDNA molecule or a genome DNA molecule which is hybridized with the nucleotide sequence limited by 1) or 2) under strict conditions and codes SiNADP-ME3 protein.

In the above application, the vector may be a plasmid, a cosmid, a phage, or a viral vector.

In the above application, the microorganism may be yeast, bacteria, algae or fungi, such as Agrobacterium.

In the above applications, the transgenic plant cell line does not comprise propagation material.

In order to solve the technical problems, the invention also provides a new application of the SiNADP-ME3 protein or the biological material.

The invention provides application of SiNADP-ME3 protein or the above biological material in culturing transgenic plants with improved stress resistance.

The invention also provides application of the SiNADP-ME3 protein or the biological material in plant breeding.

In the above application, the stress resistance is drought resistance.

In the above application, the regulation and control is an improvement, which is specifically embodied in that: under the condition of full watering, the root length, the leaf area, the stem elongation, the growth rate and the flower stem height of the SiNADP-ME3 transgenic arabidopsis are higher than those of wild arabidopsis; under the condition of water stress, the water loss rate and the cell death rate of the Arabidopsis thaliana converted by SiNADP-ME3 are lower than those of wild Arabidopsis thaliana; under drought stress, the survival rate and the total biomass of the SiNADP-ME 3-transferred arabidopsis are higher than those of wild arabidopsis.

In order to solve the above technical problems, the present invention finally provides a method for breeding transgenic plants with improved stress resistance.

The method for cultivating the transgenic plant with improved stress resistance comprises the steps of improving the content and/or activity of SiNADP-ME3 protein in a receptor plant to obtain the transgenic plant; the transgenic plant has higher stress resistance than the recipient plant.

In the above method, the stress resistance is drought resistance.

In the above method, the transgenic plant exhibits higher stress resistance than the recipient plant exhibits in any one of the following (1) to (9):

(1) the leaf area of the transgenic plant is higher than that of the receptor plant;

(2) the transgenic plant has a longer root length than the recipient plant;

(3) the stem elongation and/or growth rate of the transgenic plant is higher than that of the recipient plant;

(4) the height of the flower stem of the transgenic plant is higher than that of the receptor plant;

(5) the bolting time of the transgenic plant is earlier than that of the receptor plant;

(6) the water loss rate of the transgenic plant is lower than that of the receptor plant;

(7) the transgenic plant has lower cell death rate than the recipient plant;

(8) the survival rate of the transgenic plant is higher than that of the receptor plant;

(9) the total biomass of the transgenic plant is higher than that of the recipient plant.

In the method, the method for improving the content and/or activity of the SiNADP-ME3 protein in the recipient plant comprises the steps of over-expressing the SiNADP-ME3 protein in the recipient plant;

the overexpression method is to introduce the coding gene of the SiNADP-ME3 protein into a receptor plant;

the nucleotide sequence of the coding gene of the SiNADP-ME3 protein is a DNA molecule shown in a sequence 1.

In the embodiment of the invention, the coding gene of the SiNADP-ME3 protein is introduced into the receptor plant through a SiNADP-ME3 gene recombinant expression vector containing a SiNADP-ME3 gene expression cassette;

the SiNADP-ME3 gene recombinant expression vector containing the SiNADP-ME3 gene expression cassette is a super expression vector pCAMBIA1304: 35S: SiNADP-ME 3; the overexpression vector pCAMBIA1304 (35S) SiNADP-ME3 is a vector obtained by inserting a CDS sequence of a SiNADP-ME3 gene shown in a sequence 1 into an NcoI enzyme cutting site of the pCAMBIA1304 skeleton vector and keeping other sequences of the pCAMBIA1304 skeleton vector unchanged.

In the above method, the transgenic plant is understood to include not only the first generation transgenic plant obtained by transforming the SiNADP-ME3 gene into a plant of interest, but also its progeny. For transgenic plants, the gene can be propagated in the species, and can also be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, whole plants and cells.

In the above application, the recipient plant is a monocot or a dicot, the dicot may be arabidopsis thaliana, and the arabidopsis thaliana may be wild-type arabidopsis thaliana (columbia type).

In the early research, transcriptomics analysis data between a millet drought sensitive material An04 and a drought resistant variety Yugu1 are utilized, and a candidate gene SiNADP-ME3 related to drought resistance is obtained by combining whole genome association analysis of the millet drought resistance. The invention firstly constructs a overexpression vector pCAMBIA1304 (35S) SiNADP-ME3, and transfers the overexpression vector pCAMBIA1304 (35S) SiNADP-ME3 into wild type Arabidopsis by utilizing an agrobacterium-mediated inflorescence infection method to obtain the SiNADP-ME3 Arabidopsis. Experiments prove that: compared with wild type, the SiNADP-ME 3-transferred Arabidopsis has the characteristics of early germination, long root, large leaf area, high flower stem and the like; the experimental result of physiological research of water shows that the SiNADP-ME 3-transferring Arabidopsis has higher water utilization efficiency; the resistance experiment shows that the SiNADP-ME 3-transferring Arabidopsis has higher plant drought resistance. The SiNADP-ME 3-transferred Arabidopsis thaliana shows higher biomass accumulation under the conditions of full watering and drought stress. The SiNADP-ME3 is proved to play an important role in maintaining yield under the drought stress of plants, has important practical significance in the aspects of crop drought resistance and high-efficiency water utilization, and provides clues for further understanding of mechanisms of millet drought resistance.

Drawings

FIG. 1 shows the construction of overexpression vector pCAMBIA1304::35S:: SiNADP-ME 3.

FIG. 2 shows the screening of Arabidopsis thaliana with SiNADP-ME3 conversion. FIG. A shows the PCR detection result of Arabidopsis thaliana transformed with SiNADP-ME 3; FIG. B shows the result of qRT-PCR analysis of Arabidopsis thaliana transformed with SiNADP-ME 3.

FIG. 3 shows phenotypic analysis of SiNADP-ME3 transgenic Arabidopsis thaliana under normal water supply. FIG. A is a comparison of the lengths of primary roots of 8-day-old SiNADP-ME3 Arabidopsis thaliana, wild type Arabidopsis thaliana (WT), and empty vector Arabidopsis thaliana (VC); FIG. B is a comparison of the leaf areas of seedlings of 18-day-old SiNADP-ME3 transgenic Arabidopsis thaliana, wild Arabidopsis thaliana (WT) and transgenic empty vector Arabidopsis thaliana (VC); FIG. C is a comparison of average stem elongation of 25-40 days old transgenic Arabidopsis with SiNADP-ME3, wild type Arabidopsis (WT), and transgenic Arabidopsis with empty Vector (VC); FIG. D is a morphological comparison of the primary root lengths of 8-day-old SiNADP-ME3 Arabidopsis thaliana, wild type Arabidopsis thaliana (WT), and empty vector Arabidopsis thaliana (VC); FIG. E is a morphological comparison of rosette leaves of 18-day-old seedlings of SiNADP-ME3 Arabidopsis, wild type Arabidopsis (WT) and empty vector Arabidopsis (VC); panel F shows the growth patterns of 23-day-old seedlings of SiNADP-ME3 transgenic Arabidopsis, wild Arabidopsis (WT), and empty vector transgenic Arabidopsis (VC) grown under sufficient watering conditions. Error bars represent mean ± SE (n ═ 30); indicates a significant difference in the levels of P.ltoreq.0.05 and P.ltoreq.0.01.

FIG. 4 shows the analysis of dehydration drought tolerance of SiNADP-ME 3-transferred Arabidopsis thaliana. FIG. A is a table representation of leaves of 3 weeks old SiNADP-ME3 transgenic Arabidopsis thaliana, wild type Arabidopsis thaliana (WT) and transgenic empty vector Arabidopsis thaliana (VC) at 0h, 1h and 6h of dehydration treatment; FIG. B is a trypan blue staining pattern of isolated leaves of wild type Arabidopsis (WT) and SiNADP-ME3 transgenic Arabidopsis after 6h of dehydration; and the graph C shows the water loss rate of isolated plants of SiNADP-ME3 transgenic arabidopsis thaliana, wild type arabidopsis thaliana (WT) and transgenic empty vector arabidopsis thaliana (VC) after dehydration treatment for 6 h.

FIG. 5 shows drought stress experiments of SiNADP-ME 3-transgenic Arabidopsis thaliana. Panel A shows the drought tolerant phenotype of SiNADP-ME3 transgenic Arabidopsis, wild type Arabidopsis (WT) and transgenic empty vector plants (VC) grown in soil; FIG. B shows the survival rates of SiNADP-ME 3-transformed Arabidopsis thaliana, wild Arabidopsis thaliana (WT) and empty vector-transformed plant (VC) after rehydration; and the diagram C shows the total biomass of the SiNADP-ME 3-transferred arabidopsis thaliana, wild type arabidopsis thaliana (WT) and a transferred empty vector plant (VC) after drought treatment.

FIG. 6 shows the expression pattern of SiNADP-ME3 gene. FIG. A shows the qRT-PCR analysis result of SiNADP-ME3 gene at booting stage; FIG. B shows the qRT-PCR analysis result of SiNADP-ME3 gene at heading stage; FIG. C shows RT-PCR analysis results of SiNADP-ME3 gene at booting stage; and the graph D shows the RT-PCR analysis result of the SiNADP-ME3 gene at the heading stage.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the quantitative tests in the following examples, three replicates were set up and the results averaged.

The variety Yugu No.1 (Yugu1) of millet in the following examples is described in the document "Hu salty Yugu No.1 [ J ] New agriculture, 1985, (05): 25", publicly available from the applicant, and this biomaterial is used only for repeating the experiments related to the present invention and is not used for other purposes.

The pCAMBIA1304 backbone vector in the following examples is a product of Purpurene Biotech (Beijing) Inc., catalog number Biovectorpcambia 1304.

Agrobacterium tumefaciens GV3101 in the following examples is a product of Enze Biotechnology Inc. of Beijing, having catalog number 140384-10.

Example 1 obtaining of SiNADP-ME 3-transferred Arabidopsis thaliana and stress resistance analysis

Obtaining of transgenic SiNADP-ME3 Arabidopsis thaliana

1. Construction of pCAMBIA1304 35S SiNADP-ME3 overexpression vector

The CDS sequence of the SiNADP-ME3 gene shown in sequence 1 is inserted into the NcoI enzyme cutting site of the pCAMBIA1304 skeleton vector to obtain pCAMBIA 1304S 35S SiNADP-ME3 overexpression vector. pCAMBIA1304 35S SiNADP-ME3 overexpression vector expresses SiNADP-ME3 protein, and the amino acid sequence of the SiNADP-ME3 protein is shown as a sequence 2.

2. Preparation of recombinant bacterium

The recombinant bacterium pCAMBIA1304 (35S) 35S (SiNADP-ME 3) is obtained by transferring the overexpression vector of pCAMBIA1304 (35S) into Agrobacterium tumefaciens GV3101 (35S) SiNADP-ME3/GV 3101).

The pCAMBIA1304 is transferred into agrobacterium tumefaciens GV3101 to obtain a recombinant bacterium pCAMBIA1304/GV 3101.

3. Obtaining and identifying SiNADP-ME 3-transferred arabidopsis thaliana

The wild arabidopsis thaliana (Columbia type) is infected by recombinant bacteria pCAMBIA1304 (35S) SiNADP-ME3/GV3101 by utilizing an agrobacterium-mediated inflorescence infection method for genetic transformation, and transgenic T is collected₀Seeds are generated and sowed in 1/2MS screening culture medium containing 60mg/L hygromycin, observation shows that most seeds can not germinate or leaf whitening growth is inhibited after germination about 2 weeks, only few plants have good growth situation, healthy plants are transferred into a nutrition pot for continuous culture, and a PCR method is utilized to detect positive transgenic plants. Harvesting T1 transgenic seeds according to the strain, and further performing propagation culture on the strain line until T is obtained₃Generating transgenic plant seeds.

According to the method, wild type arabidopsis thaliana (Columbia type) is infected by using a recombinant bacterium pCAMBIA1304/GV3101 by an agrobacterium-mediated inflorescence infection method for genetic transformation, and the empty vector arabidopsis thaliana is obtained.

The method for detecting the positive transgenic plant by PCR comprises the following steps: extracting genome DNA of the transgenic plant, and adopting pC 1304F: ACGCACAATCCCACTAT and pC1304RAGAGGGTGAAGGTGAT primers are subjected to PCR amplification, and a 1938bp plant which is a positive SiNADP-ME3 Arabidopsis thaliana plant is obtained through amplification. The PCR detection result of a part of positive SiNADP-ME 3-transferred Arabidopsis strains is shown in FIG. 2A. As can be seen from the figure: positive transgenic Arabidopsis strains #35, #40, #49 of SiNADP-ME3 all amplified the target band, while wild type Arabidopsis did not.

4. SiNADP-ME3 expression level detection of SiNADP-ME3 transgenic arabidopsis thaliana

In order to detect the genetic stability of SiNADP-ME3 in a SiNADP-ME3 transgenic arabidopsis strain, T is extracted₃And (3) carrying out real-time fluorescence qRT-PCR detection on the positive transgenic SiNADP-ME3 Arabidopsis RNA by using a cDNA template obtained by reverse transcription. Meanwhile, a homologous gene AtNADP-ME3(At1g79750) of the SiNADP-ME3 gene in arabidopsis thaliana is used as a reference groupTherefore, Actin is the expression level of the over-expressed plant of the reference gene analysis. The primer sequences are as follows:

SiNADP-ME3-F：CTCAAGGACAAGGGCAAGATCC；

SiNADP-ME3-R：GGCCAATGTAGAACTCGTCGTT；

AtNADP-ME-F：TTTGATCATGTCCGGTGCCATT；

AtNADP-ME-R：AGATTCGATGCCAGTCCGAGTT。

the results are shown in FIG. 2B. The results show that: under the comparison of using Actin as an internal reference gene and AtNADP-ME3 as a reference gene, the SiNADP-ME3 gene has higher expression level in positive transgenic Arabidopsis strains #35, #40, #49, which indicates that the SiNADP-ME3 is successfully integrated on Arabidopsis chromosomes and can be inherited into offspring.

Positive transgenic Arabidopsis strains #35, #40, #49 of SiNADP-ME3 were selected for stress resistance analysis experiments as follows.

Stress resistance analysis of SiNADP-ME 3-transferring Arabidopsis thaliana

1. Root length, leaf area and Stem elongation test

Seeds of positive transgenic SiNADP-ME3 Arabidopsis lines #35, #40, #49, transgenic empty vector Arabidopsis (VC) and wild Arabidopsis (WT) were simultaneously sown in 1/2MS medium under sufficient watering conditions. And 8d after the seeds germinate, comparing the primary root growth of positive SiNADP-ME3 transgenic Arabidopsis strains #35, #40, #49, transgenic empty vector Arabidopsis and wild Arabidopsis seedlings. Then respectively transplanting the seedlings into the soil, comparing the leaf area of 18d seedlings after germination, firstly measuring the height of the flower stem after the arabidopsis grows for 25 days, then measuring the height of the flower stem of the same plant every 3 days, measuring at least 10 plants of each plant line, and repeating for 3 times. Average stem elongation ═ 3 (height of stem after n days of germination-height of stem after (n-3) days of germination).

The results are shown in FIG. 3. The results show that: under the condition of fully watering, the growth state of the empty carrier arabidopsis (VC) has no significant difference from that of the wild arabidopsis (WT) (after t test on statistical data of primary root growth, leaf area and stem elongation, the P value is more than 0.1, and no significant difference exists). Positive transSiNADP-ME 3 Arabidopsis strains #35, #40 and #49 all show obvious growth advantages in the germination stage, seedling growth stage, bolting stage and maturation stage. Wherein, the root length of positive SiNADP-ME3 transgenic Arabidopsis lines #35, #40, #49 is longer than that of empty vector transgenic Arabidopsis (VC) and wild type Arabidopsis (WT) (FIGS. 3A and 3D). After seedlings are transplanted into soil, positive transfer SiNADP-ME3 Arabidopsis strains #35, #40, #49 all show larger total leaf area (FIG. 3B and FIG. 3E), and the leaf area of positive transfer SiNADP-ME3 plants is 2-2.5 times that of wild Arabidopsis and empty carrier Arabidopsis. And in the bolting time of the arabidopsis thaliana, the positive SiNADP-ME 3-transferred arabidopsis thaliana is bolting 22 days after germination, the wild type arabidopsis thaliana is bolting 24 days after germination, and the positive SiNADP-ME 3-transferred arabidopsis thaliana is 1-2 days earlier than the wild type arabidopsis thaliana. The average stem elongation of positive SiNADP-ME3 Arabidopsis strains #35, #40 and #49 in the early growth stage (24-37 d after germination) is higher than that of wild Arabidopsis and that of empty vector Arabidopsis, and the growth rates are faster (FIGS. 3C and 3F), and at 37d after germination, the height of the stem of SiNADP-ME3 Arabidopsis is 29.3-31.6cm, while the height of the stem of wild Arabidopsis is 23.4-25.6 cm.

2. Tolerance detection of water stress

(1) Dehydration treatment

To further investigate the water stress tolerance of the positive-transgenic SiNADP-ME3 Arabidopsis lines, wild type Arabidopsis, transgenic empty Arabidopsis and positive-transgenic SiNADP-ME3 Arabidopsis lines #35, #40, #49, which grew for 3 weeks after germination, were placed on dry filter paper in a drought incubator (25 ℃ C., 30% humidity, 150. mu. moL. m.light intensity)^-2·s^-1The illumination period is 16h illumination/8 h darkness), and the dehydration degree of the plant is detected after dehydration for 1h, 3h and 6h respectively.

The results are shown in FIG. 4. The results show that: with the increase of the treatment time, the wilting speed of the leaves of wild arabidopsis and unloaded arabidopsis is higher, while the water loss of the positive SiNADP-ME3 arabidopsis strains #35, #40, #49 is slower, the water retention is stronger, and the wilting of the leaves of wild arabidopsis is more serious when the dehydration treatment time reaches 6h (FIG. 4A).

(2) Trypan blue staining

And carrying out trypan blue staining on the plant leaves subjected to dehydration treatment for 6 hours. The method comprises the following specific steps: after dehydration treatment for 6 hours, each plant line was stained with trypan blue, and the degree of cell membrane destruction was determined. The formula of trypan blue dye solution comprises: 2.5mg of Triflozin blue is added into 1mL of the lactol solution, and a 50mL of the lactol solution system is 25% of lactic acid, 23% of water-soluble phenol and 25% of glycerol, and the sterile water is added to the solution to a constant volume of 50 mL. Respectively putting the strains to be detected into trypan blue staining solution in boiling water bath for 10min, after staining for 12h at room temperature, decoloring with 2.5mg/mL chloral hydrate for 3-4d, wherein the decoloring solution needs to be replaced in the period, observing whether blue spots exist after decoloring, and photographing for evidence keeping. The stained leaves can be preserved in 50% glycerol.

The results show that: the colors of the wild arabidopsis thaliana and the transgenic empty vector arabidopsis thaliana are deeper than those of the positive transgenic SiNADP-ME3 arabidopsis thaliana, which indicates that the cell death rates of the wild arabidopsis thaliana and the transgenic empty vector arabidopsis thaliana are higher than those of the positive transgenic SiNADP-ME3 arabidopsis thaliana (fig. 4B).

(3) Rate of water loss

Compared with wild arabidopsis thaliana in the same period, the positive transformation SiNADP-ME3 arabidopsis thaliana has stronger growth advantages, and the water loss rate is calculated by adopting a calculation mode of the area water loss rate to eliminate the influence of the size of the blade area on the water loss rate. The method comprises the following specific steps: shearing the whole positive transgenic SiNADP-ME3 Arabidopsis, wild Arabidopsis and transgenic unloaded Arabidopsis which grow for 3 weeks under normal conditions, putting the cut plants in a culture dish filled with dry filter paper, weighing, and taking pictures to measure the surface area of the plants; the samples were placed in an incubator with a temperature of 21-25 ℃ and a humidity of 45-50% together with the petri dish, weighed and photographed within a specified time. The water loss rate of the leaf area of the plant was (fresh weight of the plant-weight after air-drying)/(air-drying time × leaf area).

The results show that: the water loss rate of positive SiNADP-ME3 transgenic Arabidopsis strains #35, #40 and #49 is lower than that of wild Arabidopsis and unloaded Arabidopsis (FIG. 4C).

The above results show that: the positive transformation SiNADP-ME3 Arabidopsis thaliana can improve drought resistance.

3. Drought resistance assay

A wild type Arabidopsis thaliana which germinated and grown for 10d under normal conditions on 1/2MS medium was transformedSeedlings of idle Arabidopsis and positive transformation SiNADP-ME3 Arabidopsis lines #35, #40, #49 were transplanted into nutrient soil and recovered for 2 d. Then transplanting the seedlings to a temperature of 25 ℃, a humidity of 30 percent and an illumination intensity of 150 mu mol.m^-2·s^-1And growing in a drought incubator with the illumination period of 16h illumination/8 h darkness. After drought treatment for 15d, the growth state of the plants was observed. And (5) counting the survival rate and biomass of the plants after 8 days of rehydration. The biomass calculation method comprises the following steps: and (4) drying the plants with the same number of plants after maturation, and weighing to obtain the total biomass.

The results show that: after the drought treatment for 15 days, all leaves of wild arabidopsis thaliana and empty vector-transferred arabidopsis thaliana show severe wilting and withering, while only a few leaves of positive SiNADP-ME3 arabidopsis thaliana strains #35, #40 and #49 show withering (fig. 5A), and meanwhile, the growth states of the positive SiNADP-ME3 plants are found to have obvious advantages compared with those of the wild arabidopsis thaliana and the empty vector-transferred arabidopsis thaliana. After all plants are rehydrated for 8 days, the survival rate of positive-transgenic SiNADP-ME3 Arabidopsis lines #35, #40, #49 is obviously higher than that of wild plants (FIG. 5B), the growth can be quickly recovered, normal flowering and fruiting can be realized, and the total biomass formed is larger (FIG. 5C).

In conclusion, compared with wild Arabidopsis thaliana, the SiNADP-ME 3-transferred Arabidopsis thaliana has the characteristics of early germination, long root, large leaf area, high flower stem and the like; the experimental result of the physiological research of the water shows that the positive transSiNADP-ME 3 Arabidopsis has higher water utilization efficiency; resistance experiments show that the positive SiNADP-ME 3-converted Arabidopsis has higher plant drought tolerance. The SiNADP-ME 3-transferred Arabidopsis thaliana shows higher biomass accumulation under the conditions of full watering and drought stress. The SiNADP-ME3 is proved to play an important role in maintaining yield under the drought stress of plants.

Example 2 tissue-specific expression of SiNADP-ME3 Gene in millet

In order to verify the tissue specific expression characteristics of the SiNADP-ME3 gene in the millet, the tissue specific expression of the SiNADP-ME3 gene in the booting stage and the heading stage of Yugu1 under normal growth conditions is analyzed by a real-time fluorescence qRT-PCR (quantitative reverse transcription-polymerase chain reaction) and semi-quantitative RT-PCR (quantitative reverse transcription-polymerase chain reaction) method. The method comprises the following specific steps:

1. extraction of plant tissue RNA

Tissue (root, stem, leaf and ear) RNA was extracted by Trizol (Cat No.15596-026, Invitrogen, Scotland, UK) method, and then purified by Purelink RNA Kit (Cat No.12183018, Invitrogen, Scotland, UK) to remove impurities and DNA fragments. The method comprises the following specific steps:

(1) placing special tools for extracting RNA such as a mortar, a pestle, scissors and tweezers into a tray, spraying 95% alcohol fire, calcining for about 5min, removing RNase, slightly cooling, and soaking in liquid nitrogen for precooling. The special operating platform for RNA extraction is cleaned by wiping with 75% alcohol and then sprayed with RNase Zap to remove the RNase. Clean experimental clothes, gloves and masks are needed to be worn in the whole RNA extraction operation process, so that RNase in saliva and sweat is prevented from entering a sample to degrade RNA.

(2) Quickly weighing 0.1-0.15g of leaf blade or other tissue, placing into a mortar containing liquid nitrogen, quickly freezing, quickly grinding for 1-2 times after it becomes brittle to make the material be broken into powder, and fully grinding. Liquid nitrogen is continuously supplemented in the process to keep low temperature and reduce the degradation of RNA.

(3) The well ground material was transferred to a 2mL RNase-free centrifuge tube to which 1mL Trizol reagent had been added, shaken well and placed on ice, after all samples had been added to Trizol, vortexed for 15s and allowed to stand at room temperature for 5 min.

(4) Add 200. mu.L of chloroform to 1mL of Trizol, vortex for 15s, stand at room temperature for 2-3min, and centrifuge at 12000rpm for 15min at 4 ℃.

(5) The supernatant was transferred to a new 1.5mL RNase-free centrifuge tube, and an equal volume of 70% ethanol was added, followed by thorough mixing and dissolution of the resulting precipitate.

(6) Pipette 700. mu.L of the mixed sample into a column of Pure Link RNA Mini Kit, centrifuge at 12000rpm for 15s at room temperature, and repeat 3-4 times until all samples have passed through the column.

(7) 700 μ L of WBI was added to the filtration column and centrifuged at 12000rpm for 15s, and the column was washed to discard the filtrate.

(8) The filtration column was centrifuged at 12000rpm for 15s with 500. mu.L of WBII added, the column was washed, the filtrate was discarded, the operation was repeated once, and the column was dried by centrifugation at 12000rpm for 2 min.

(9) The column was transferred to a new 1.5mL RNase-free centrifuge tube, and 30-100. mu.L Nase-free water was added thereto, and the mixture was left at room temperature for 1min to dissolve RNA.

(10) The mixture was centrifuged at 12000rpm for 2min at room temperature to collect RNA. The extracted RNA can be immediately inverted into cDNA and stored at-20 ℃ or directly stored at-80 ℃.

(11) Taking a small amount of RNA and determining OD of sample by using NANODROP 1000₂₆₀、OD₂₈₀、OD₃₂₀、OD₂₆₀/OD₂₈₀And the concentration thereof. OD of RNA-only sample₂₆₀/OD₂₈₀The ratio is between 1.9 and 2.1, OD₂₆₀/OD₂₃₀The ratio is more than or equal to 2.0, and the test can be used for subsequent tests.

(12) And (3) carrying out electrophoresis by using 1% agarose gel and quickly carrying out electrophoresis to detect the quality of the RNA. High quality RNA should have two bright and distinct bands, 28S and 18S, with 28S being more than twice as bright as 18S.

2. Reverse transcription of RNA into cDNA

RNA was inverted into cDNA using a TaKaRa Primer Script II 1st Stand cDNA Synthesis Kit (Cat No.6210A, Takara, Otsu Shiga, Japan) reverse transcription Kit. The method comprises the following specific steps:

(1) add the following reagents to 200. mu.L RNase-free centrifuge tubes: oligo dT (500. mu.g/mL) 1. mu. L, dNTPMixture 1. mu.L, total RNA 5. mu.g, RNase Free dH₂O to a total volume of 10. mu.L.

(2) The tube was placed on a PCR, reacted at 65 ℃ for 5min, and then rapidly cooled on ice.

(3) The following reaction solutions were added to the centrifuge tube: 5 XPrime Script TM Buffer 4. mu. L, RNaseInhibitor (40U/. mu.L) 0.5. mu.L (20U), PrimeScriptTM RTase (200U/. mu.L) 1. mu.L (200U), RNaseFreedH₂O 4.5μL。

(4) Placing the centrifugal tube on a PCR instrument, inverting the reaction tube into cDNA according to the procedures of reacting at 42 ℃ for 40min, reacting at 70 ℃ for 15min and stopping reaction at 4 ℃, diluting the successfully inverted cDNA by 10 times and then placing the diluted cDNA at-20 ℃ for storage.

3. Method for detecting expression quantity difference of SiNADP-ME3 gene by qRT-PCR (quantitative reverse transcription-polymerase chain reaction)

(1) And (3) designing a webpage design primer by using an NCBI primer according to a CDS sequence of the SiNADP-ME3 gene, detecting the conservatism of the primer by using a conventional PCR method, and selecting a primer with a single amplification fragment end. The primer sequences are as follows:

seita.3g109300: CGCATCCTTCCATCTGTA and CCATCTCCGACGACATAT;

and (3) Actin: TATGGGTCATCAACAGCTTGTC, and GTAGTCCCTCGTGATGAGATCC.

(2) qRT-PCR experiments were performed using the FastStart Universal SYBR Green Master kit (Cat No.04913914001, Roche, Mannheim, Germany) and the configured systems were added to standard 96-well qRT-PCR plates.

(3) The qRT-PCR program was run using an AppLied Biosystems 7300 analyzer (AppLied Biosystems, Foster City, Calif., USA) fluorescent quantitative PCR instrument. qRT-PCR three independent experimental replicates were performed per sample. The reaction system is shown in Table 1.

TABLE 1 PCR reaction System

Components of reaction solution	Volume of	Final concentration
			FastStart UniversaL SYBR	25.0μL	1×
Primers:F+R(30μM)	0.5. mu.L each	300nM
			cDNA(100ng/μL)	5μL	200ng
ddH₂O	19μL

TABLE 2 PCR reaction procedure

Name of program	Temperature of	Time of day
			Pre-denaturation	95℃	2min
Denaturation of the material	95℃	1min
			Annealing	60℃	1min
Extension of	72℃	1min
			Total extension of	72℃	7min

4. Detection of SiNADP-ME3 gene specific expression by RT-PCR method

The fluorescent primers designed above are used, cDNA of roots, stems, leaves and ears of Yugu1 varieties in heading stage is used as a template to detect the specific expression of the SiNADP-ME3 gene, the brightness of the templates of each tissue is adjusted to be consistent by an Actin primer, the using amount of the templates of each tissue is recorded, and then the SiNADP-ME3 gene primer is used for amplifying the templates of each tissue. KOD FX enzyme (Code No. KFX-101TOYOBO Japan) reaction System and program are shown in Table 3 and Table 4.

TABLE 3 PCR amplification System

Composition (I)	Amount of addition
		DNA template	nμL
2×Prime GC Buffer	12.5μL
		Primer F/R	0.75. mu.L each
2Mm dNTP	5μL
		KOD Fx enzyme	0.5μL
ddH₂O	up to 25μL

TABLE 4 PCR reaction procedure

(Note: cycle number is 30 cycles)

The results are shown in FIG. 6. Panels a and B are qRT-PCR assay results at booting stage and heading stage, respectively: as can be seen from the figure, the SiNADP-ME3 gene has higher expression level in the stem part during the booting period; in the heading stage, the gene has higher expression level in the stem; panels C and D are RT-PCR assay results at booting stage and heading stage, respectively: in the booting stage, the SiNADP-ME3 gene has a high expression level in the stem part, and in the heading stage, the gene has a high expression level in the root part. In general, the SiNADP-ME3 gene has high expression level in both root and stem. Root systems and stems are main tissues for absorbing and transmitting mineral element water and the like, and the SiNADP-ME3 gene is expressed in a large quantity to regulate the osmotic potential, pH value, ion absorption balance and the like of cells, so that the plants are helped to resist adversity stress during adversity stress, and the stress resistance of the plants is improved.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

<120> protein SiNADP-ME3 and application of coding gene thereof in regulation and control of plant stress resistance

<160>2

<210>1

<211>1731bp

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>1

atgtcgtcgg agatggagat ggctggcggc ggcgtcgagg acgcgtacgg cgaggaccgc 60

gccaccgagg agcatctcgt cacgccgtgg gccttctccg tcgccagcgg ctacaccctg 120

ctccgcgacc cgcggcacaa caagggcctg gccttctcgg aggcggagcg caacgcgcac 180

tacctgcgcg gcctgctccc gcccgcgctg gcgtcgcagg agctccagga gaagaagatc 240

atgcacaacc tgcgccagta cacggtgccc ctgcagcgct acatcgccat gatggacctg 300

caggagcgca acgagcgtct cttctacaag ctcctcatcg acaacgtcga ggagctgctc 360

cccgtcgtct acacgcccac cgtcggcgag gcgtgccaga agtacggcag catctacagg 420

cgcccgcagg ggctctacat cagcctcaag gacaagggca agatccttga ggtgctcaag 480

aactggccgg agaggagcat ccaggtcatc gtcgtcaccg acggcgagcg catcctgggg 540

ctcggggacc tgggctgcca ggggatgggg atccccgttg gcaagctgtc tctctacacc 600

gccctcggag gcgttcgccc atccgcttgc ctgccgatca caatcgatgt tggcaccaac 660

aacgagacct tgctcaacga cgagttctac attggcctcc gccaaagacg tgccaccggc 720

caggaatacc acgagcttct cgaagagttc atgaccgccg tcaagcaaaa ctacggcgag 780

aaagtcctaa cccagttcga ggactttgcc aaccacaatg cttttgactt gcttgccaag 840

tacagcaaga gccatctcgt gttcaacgac gatatccagg gaacagcctc ggtggtcctc 900

gcaggtctct tggcggcgct caaggtggtc ggtggcactc ttgctgacca cacctacctg 960

ttccttggtg ccggcgaggc tggaactggt attgctgacc tcattgctct tgagatgtca 1020

aaacattcgg agactccgat cgacgattgc cgcaagaaga tctggcttgt ggactccaag 1080

ggcctgatcg tggagtcgcg caaggagtcg ctgcagcact tcaagcagcc gtgggcgcac 1140

gatcacgagc ccctcaagac cctgctggag gccgtggagt ccatcaagcc gacggtgctg 1200

atcggcacct ccggcgtggg ccgcaccttc accaaggagg tggtggaggc catggcgtcc 1260

ttcaacgaga ggcccgtcat cttcgcgctg tccaacccga cgtcgcactc ggagtgcacg 1320

gcggaggagg cttacacctg gtcccagggc cgcgccgtgt tcgccagcgg cagccccttc 1380

gacgccgtcg agcacgaagg caaggtgtac gtgccggggc agtccaacaa cgcctacata 1440

ttccctgggt tcggcctcgg cgtggtcatc tccggcgcca tccgcgtcca cgacgacatg 1500

ctgctggcgg cgtcggaggc gctggcggag caggtcaccg acgagcactt cgccaagggg 1560

ctcatcttcc cgccgttcac caacatccgc accatctcgg cgcgcatcgc cgccaaggtg 1620

gccgaaaagg cctacgagct cggcctcgcc agccgcctgc cgcgccccga cgaccttgtc 1680

aagtacgccc agagctgcat gtacacccca acctaccgca gctaccggta a 1731

<210>2

<211>576

<212>PRT

<213> Artificial sequence

<220>

<223>

<400>2

Met Ser Ser Glu Met Glu Met Ala Gly Gly Gly Val Glu Asp Ala Tyr

1 5 10 15

Gly Glu Asp Arg Ala Thr Glu Glu His Leu Val Thr Pro Trp Ala Phe

20 25 30

Ser Val Ala Ser Gly Tyr Thr Leu Leu Arg Asp Pro Arg His Asn Lys

35 40 45

Gly Leu Ala Phe Ser Glu Ala Glu Arg Asn Ala His Tyr Leu Arg Gly

50 55 60

Leu Leu Pro Pro Ala Leu Ala Ser Gln Glu Leu Gln Glu Lys Lys Ile

65 70 75 80

Met His Asn Leu Arg Gln Tyr Thr Val Pro Leu Gln Arg Tyr Ile Ala

85 90 95

Met Met Asp Leu Gln Glu Arg Asn Glu Arg Leu Phe Tyr Lys Leu Leu

100 105 110

Ile Asp Asn Val Glu Glu Leu Leu Pro Val Val Tyr Thr Pro Thr Val

115 120 125

Gly Glu Ala Cys Gln Lys Tyr Gly Ser Ile Tyr Arg Arg Pro Gln Gly

130 135 140

Leu Tyr Ile Ser Leu Lys Asp Lys Gly Lys Ile Leu Glu Val Leu Lys

145 150 155 160

Asn Trp Pro Glu Arg Ser Ile Gln Val Ile Val Val Thr Asp Gly Glu

165 170 175

Arg Ile Leu Gly Leu Gly Asp Leu Gly Cys Gln Gly Met Gly Ile Pro

180 185 190

Val Gly Lys Leu Ser Leu Tyr Thr Ala Leu Gly Gly Val Arg Pro Ser

195 200 205

Ala Cys Leu Pro Ile Thr Ile Asp Val Gly Thr Asn Asn Glu Thr Leu

210 215 220

Leu Asn Asp Glu Phe Tyr Ile Gly Leu Arg Gln Arg Arg Ala Thr Gly

225 230 235 240

Gln Glu Tyr His Glu Leu Leu Glu Glu Phe Met Thr Ala Val Lys Gln

245 250 255

Asn Tyr Gly Glu Lys Val Leu Thr Gln Phe Glu Asp Phe Ala Asn His

260 265 270

Asn Ala Phe Asp Leu Leu Ala Lys Tyr Ser Lys Ser His Leu Val Phe

275 280 285

Asn Asp Asp Ile Gln Gly Thr Ala Ser Val Val Leu Ala Gly Leu Leu

290 295 300

Ala Ala Leu Lys Val Val Gly Gly Thr Leu Ala Asp His Thr Tyr Leu

305 310 315 320

Phe Leu Gly Ala Gly Glu Ala Gly Thr Gly Ile Ala Asp Leu Ile Ala

325 330 335

Leu Glu Met Ser Lys His Ser Glu Thr Pro Ile Asp Asp Cys Arg Lys

340 345 350

Lys Ile Trp Leu Val Asp Ser Lys Gly Leu Ile Val Glu Ser Arg Lys

355 360 365

Glu Ser Leu Gln His Phe Lys Gln Pro Trp Ala His Asp His Glu Pro

370 375 380

Leu Lys Thr Leu Leu Glu Ala Val Glu Ser Ile Lys Pro Thr Val Leu

385 390 395 400

Ile Gly Thr Ser Gly Val Gly Arg Thr Phe Thr Lys Glu Val Val Glu

405 410 415

Ala Met Ala Ser Phe Asn Glu Arg Pro Val Ile Phe Ala Leu Ser Asn

420 425 430

Pro Thr Ser His Ser Glu Cys Thr Ala Glu Glu Ala Tyr Thr Trp Ser

435 440 445

Gln Gly Arg Ala Val Phe Ala Ser Gly Ser Pro Phe Asp Ala Val Glu

450 455 460

His Glu Gly Lys Val Tyr Val Pro Gly Gln Ser Asn Asn Ala Tyr Ile

465 470 475 480

Phe Pro Gly Phe Gly Leu Gly Val Val Ile Ser Gly Ala Ile Arg Val

485 490 495

His Asp Asp Met Leu Leu Ala Ala Ser Glu Ala Leu Ala Glu Gln Val

500 505 510

Thr Asp Glu His Phe Ala Lys Gly Leu Ile Phe Pro Pro Phe Thr Asn

515 520 525

Ile Arg Thr Ile Ser Ala Arg Ile Ala Ala Lys Val Ala Glu Lys Ala

530 535 540

Tyr Glu Leu Gly Leu Ala Ser Arg Leu Pro Arg Pro Asp Asp Leu Val

545 550 555 560

Lys Tyr Ala Gln Ser Cys Met Tyr Thr Pro Thr Tyr Arg Ser Tyr Arg

565 570 575

Claims

1. The application of any one of the following biological materials in improving the stress resistance of plants:

the biomaterial is any one of the following A1) to A9):

A1) the protein has an amino acid sequence shown as a sequence 2;

A2) a nucleic acid molecule encoding the protein of A1);

A3) an expression cassette comprising the nucleic acid molecule of a 2);

A4) a recombinant vector comprising the nucleic acid molecule of a 2);

A5) a recombinant vector comprising the expression cassette of a 3);

A6) a recombinant microorganism comprising the nucleic acid molecule of a 2);

A7) a recombinant microorganism comprising the expression cassette of a 3);

A8) a recombinant microorganism comprising a4) said recombinant vector;

a recombinant microorganism comprising a5) said recombinant vector;

the stress resistance is drought resistance; the plant is a dicotyledonous plant. .

2. Use according to claim 1, characterized in that: A2) the nucleic acid molecule is a DNA molecule shown in a sequence 1.

3. A method for producing a transgenic plant having improved stress resistance, which comprises the step of increasing the content of the protein of a1) in claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has higher stress resistance than the recipient plant; the method for increasing the content of the protein of claim 1 in a recipient plant comprises overexpressing the protein of claim 1 in the recipient plant; the method of overexpression comprises introducing a gene encoding the protein of claim 1 into a recipient plant;

the nucleotide sequence of the coding gene of the protein is a DNA molecule shown in a sequence 1;

the transgenic plant has higher stress resistance than the recipient plant is found in any one of the following (1) to (9):

(2) the transgenic plant has a longer root length than the recipient plant;

(7) the transgenic plant has lower cell death rate than the recipient plant;

(9) the total biomass of the transgenic plant is higher than that of the receptor plant;

the stress resistance is drought resistance; the plant is a dicotyledonous plant.