CN113604475B - Application of cotton GH_D03G1517 gene in promotion of drought resistance and salt tolerance - Google Patents

Abstract

The application discloses cottonGH_D03G1517The application of the gene in promoting drought resistance and salt tolerance of plants belongs to the technical field of plant genetic engineering.GH_D03G1517The gene has a nucleotide sequence shown as SEQ ID NO. 1 and can code an amino acid sequence shown as SEQ ID NO. 2. The application can be used for supporting the stress-resistant molecular improvement of plants, especially cotton.

Description

Application of cotton GH_D03G1517 gene in promotion of drought resistance and salt tolerance

Technical Field

The application belongs to the technical field of plant genetic engineering, and particularly relates to application of a cotton GH_D03G1517 gene in drought resistance and salt tolerance promotion.

Background

The major stresses affecting crop production worldwide are abiotic stresses, such as: high temperature, salt and water shortage. The most important of these stresses are drought and salt stresses, which have a significant impact on agriculture and food supplies and cause significant loss of crop productivity. Plants successfully achieve metabolic, physiological and morphological changes by using specific and complex signaling mechanisms to cope with external stresses, including accumulation of metabolites, pressure-related gene expression, osmotic pressure and antioxidant synthesis, root development and transpiration, and regulate water loss to the atmosphere.

Cotton is an important fiber crop and is widely used in the global textile industry. In areas of the world that are affected by abiotic stress, one of the main ways to maintain an increasing cotton yield is to mine key genes to increase stress resistance. However, studies on cotton stress resistance, especially drought and salt tolerance genes, are still insufficient.

Disclosure of Invention

The inventor carries out identification and characteristic analysis on the GH_D03G1517 gene of the A group member of one MAPK in cotton, and combines the results of fluorescence quantification, transformation of Arabidopsis thaliana, VIGS test and the like to show that the GH_D03G1517 gene plays an important role in drought resistance and salt tolerance of cotton, and can be used for improving stress-resistant molecules of cotton. Thus, the present application has been completed.

The application provides application of a GH_D03G1517 gene in promoting drought resistance and salt tolerance of plants, wherein the GH_D03G1517 gene has a nucleotide sequence shown in SEQ ID NO. 1.

The open reading frame of the GH_D03G1517 gene is 1128bp.

In some embodiments of the application, the nucleotide sequence set forth in SEQ ID NO. 1 is capable of encoding the amino acid sequence set forth in SEQ ID NO. 2. The protein comprising this amino acid sequence has a relative molecular weight of 43.018kDa and an isoelectric point of 5.677.

In some embodiments of the application, the expression level of the gh_d03g1517 gene is increased in plants to promote drought and salt tolerance in the plants.

In some embodiments of the present application, the increase in the expression level of the gh_d03g1517 gene in plants is achieved by: increasing the expression of the endogenous GH_D03G1517 gene of the plant, or over-expressing the exogenous GH_D03G1517 gene in the plant.

In a specific claimed embodiment of the application said over-expression of the exogenous gh_d03g1517 gene refers to the expression of said gh_d03g1517 gene in plants by agrobacterium-mediated transformation using a plant expression vector.

Further, the GH_D03G1517 gene is introduced into a plant cell, tissue or organ through a plant expression vector.

Still further, the plant expression vector drives the expression of the gh_d03g1517 gene by a constitutive or inducible promoter.

Still further, the constitutive promoter is a 35S promoter.

In the present application, the promotion of flowering means promotion of the plant flowering phase in advance.

In the present application, the plant is cotton, maize, rice, wheat or arabidopsis.

The beneficial effects of the application are that

The result of silencing the GH_D03G1517 gene in cotton shows that the GH_D03G1517 gene may have a key role in promoting drought resistance and salt tolerance of cotton. The application can be used for supporting the stress-resistant molecular improvement of plants, especially cotton.

Drawings

Fig. 1 shows: physiological parameter assessment of gh_d03g1517 overexpressing strains under drought and salt stress conditions: phenotypic characteristics of overexpression lines and WT plants before and after drought and salt treatment. After 8D stress, WT and overexpressing strain leaf (A) leaf relative water content (RLWC), (B) leaf loss of water from the body (ELWL), (C) ion leakage, and (D) quantitative determination of chlorophyll II content. Each experiment was repeated three times, the error bars indicate Standard Deviation (SD), and the different letters on the bars indicate statistically significant differences (ANOVA, P < 0.05). WT: wild type, L2, L6, L8: overexpressing strains.

Fig. 2 shows: determination of the oxidant and antioxidant concentration levels of the gh_d03g1517 transgenic line under drought and salt stress conditions: after 8d of stress, leaves of wild-type and overexpressing lines (A) quantitative determination of Malondialdehyde (MDA), (B) hydrogen peroxide (H ₂ O ₂ ) Quantitative determination of concentration, (C) quantitative determination of Catalase (CAT) content, and (D) quantitative determination of Peroxidase (POD). Each experiment was repeated three times, the error bars indicate Standard Deviation (SD), and the different letters on the column indicate statistically significant differences (ANOVA, P<0.05). WT: wild type, L2, L6, L8: overexpressing strains.

Fig. 3 shows: expression levels of abiotic stress response genes (ABF 4, KIN1, RAB18 and RD 22) in gh_d03G1517 overexpressing lines (L2, L6 and L8) and wild-type arabidopsis. AtACTIN2 was used as a housekeeping gene. The letter a/b indicates a statistically significant difference (ANOVA, P < 0.05). Error bars represent Standard Deviation (SD) of 3 biological replicates.

Fig. 4 shows: germination rate and root growth conditions of wild-type and GH_D03G1517 overexpressing strains under PEG treatment. Seed germination (A) 1/2MS agar, (B) 8% PEG plate, (C) 10% PEG plate, (D) 15% PEG plate, each experiment was repeated three times, each measurement representing the average germination rate.+ -. SD of 50 seeds. (E) Germination of seeds 7 days later on 1/2MS supplemented with 0, 8%,10% and 15% peg. Seedlings grown on 1/2MS medium for 3 days were transferred to medium containing 0, 8%,10% and 15% PEG for 7 days, (F) wild type and GH_D03G1517 overexpressing strain root growth, (G) comparison of root elongation, each experiment was repeated three times, scale 2cm, each measurement representing the average root length of 50 seedlings, error bars indicating Standard Deviation (SD), and different letters on the column indicating statistically significant differences (ANOVA, P < 0.05).

Fig. 5 shows: germination rate and root growth conditions of wild-type and GH_D03G1517 overexpressing strains under salt treatment. Quantitative seed germination (A) 1/2MS agar, (B) 50mM plate, (C) 75mM plate, (D) 100mM plate, each experiment was repeated three times, each measurement representing the average germination rate.+ -. SD of 50 seeds. (E) Germination of seeds 7 days later on 1/2MS with 0, 50mM,75mM and 100mM NaCl. Seedlings grown on 1/2MS medium for 3 days were transferred to medium containing 0, 50mM,75mM and 100mM NaCl (F) wild type and GH_D03G1517 overexpressing strain root growth, (G) comparison of root elongation after 7 days of growth, each experiment was repeated three times, scale 2cm, each measurement representing the average root length of 50 seedlings, error bars indicate Standard Deviations (SD), and different letters on the column indicate statistically significant differences (ANOVA, P < 0.05).

Fig. 6 shows: GH_D03G1517 improves drought tolerance throughout the growth cycle of Arabidopsis. (A-B) the transgenic GH_D03G1517 gene of Arabidopsis thaliana was analyzed for drought tolerance in one complete growth cycle, with a scale of 4cm. (C) Pod length of gh_d03g1517 transgenic and wild-type arabidopsis under drought treatment and blank control conditions. (D-F) stem length, pod length and number of individual pods were measured for 35S GH_D03G1517 and WT plants under drought treatment and placebo conditions. Each experiment was repeated three times. Error bars indicate standard error (SD), and different letters on the bars indicate statistically significant differences (ANOVA, P < 0.05).

Fig. 7 shows: evaluation of physiological parameters of VIGS-treated cotton plants: the phenotypes of PSD, empty and GH_D03G1517-silenced plants (I) (A-C), and the expression levels of (D) GH_D03G1517 in the blank and GH_D03G1517-silenced plants. (II) after 8 days of drought and control treatment, the leaf blades of the empty and GH_D03G1517-VIGS plants (A) RLWC, (B) ELWL, (C) ion leakage, (D) chlorophyll concentration were determined. Each experiment was repeated three times. Error bars represent SD of three biological replicates. The different letters on the bars indicate statistically significant differences (ANOVA, P < 0.05).

Fig. 8 shows: under drought stress conditions, the expression level of the oxidant and antioxidant enzymes and stress response genes in leaves of GH_D03G1517-VIGS and VA cotton plants were analyzed. (IA-D) quantitative determination of (A) MDA, (B) H2O2, (C) CAT and (D) POD after 7 days of drought and control treatment. (II) relative expression level of stress response gene (A) DXT/MATE, (B) Ghmekk24, (C) Ghraf4. Error bars represent SD of three biological replicates. The different letters on the bars indicate statistically significant differences (ANOVA, P < 0.05).

Detailed Description

In order to make the technical problems, technical schemes and beneficial effects solved by the application more clear, the application is further described in detail below with reference to the embodiments.

Examples

The following examples are presented herein to demonstrate preferred embodiments of the present application. It will be appreciated by those skilled in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function in the practice of the application, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit or scope of the application.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs, the disclosure of which is incorporated herein by reference as is commonly understood by reference.

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the application described herein. Such equivalents are intended to be encompassed by the claims.

Example 1

1. Cotton material

The cotton materials selected in this example were upland cotton TM-1, miao cotton station No. 10, miao H177. Tissue or organ expression was assessed using upland cotton TM-1. Plants for vegetative tissue were grown in 16 hours light and 8 hours dark 25 ℃ growth chambers. Plants to obtain reproductive tissues were planted in cotton institute test fields (an yang city of Henan province, china) at the national academy of agricultural sciences. In the room, tissues like young leaves are sampled at the initial stage of planting, and stalks, true leaves and roots are sampled at two weeks after sowing. Flowers were harvested from the field 10 days after flowering.

Salt stress and drought stress tests were performed using middle cotton institute No. 10 and middle H177, respectively. Cotton seedlings of cotton institute No. 10 and H177 were grown in a laboratory growth room at 25 ℃ with 16 hour light/8 hour dark cycle. Treatment of seedlings with 15% polyethylene glycol 6000 (PEG-6000) caused drought stress and treatment of plants with 200mM sodium chloride caused salt stress. Samples were taken at 0h,2h,4h,6h,12h,48h and 72h, respectively, after treatment. Each experiment was performed 3 times.

2. Reagent and consumable

2.1 enzymes and kits:GXL DNA Polymerase high-fidelity enzyme, gel recovery kit and PCR product purification kit are all purchased from Takara company; RNA reverse transcription kit, KOD FX Neo enzyme (code. No. KFX-201) available from Toyobo company; />Ultra One Step Cloning Kit kit is available from Vazyme; plasmid miniprep kit was purchased from Magen company; restriction enzymes (BamH I, sac I) were purchased from NEB company; DNA Marker III, total plant RNA extraction kit from TIANGEN company; fluorescent quantitation TransStart Top Green qPCR SuperMix was purchased from TransGen corporation.

2.2 other drugs: agarose is spanish original product, peptone, yeast extract, chloroform, isoamyl alcohol, ethanol, isopropanol, sodium chloride, sucrose, silwet L-77, phloroglucinol and the like are domestic analytically pure, and the colibacillus competent cells Trans5 alpha are purchased from Bao bioengineering (Dalian) Limited company, and the agrobacterium competent cells LBA4404 are purchased from Shanghai Weidi biotechnology Co.

2.3 Medium: LB liquid medium: tryptone (Tryptone) 10g/L, yeast extract (Yeast extract) 5g/L, sodium chloride (NaCl) 10g/L; LB solid medium: 10g/L of Tryptone (Tryptone), 5g/L of Yeast extract (Yeast extract), 10g/L of sodium chloride (NaCl), 15g/L of Agar powder (Agar) and fixing the volume to 1L; LB selection Medium: before LB plate laying, adding antibiotics with corresponding concentration when the culture medium is sterilized under high pressure and cooled to 55 ℃, shaking uniformly, and then plate laying. Various reagent solutions mentioned herein but not listed are prepared according to the method on the third edition of the guidelines for molecular cloning experiments, and biochemical reagents are analytically pure or superior.

2.4 main instrument: PCR amplification instrument (Eppendorf), high-speed centrifuge (Eppendorf 5427R), electrophoresis device (Beijing Liuyi), gel imaging system (BIO-RAD), fluorescence quantitative PCR instrument (ABI 7500), fluorescence microscope (Olympus BX 43), constant temperature culture oscillator (Shanghai Zhi Cheng), artificial climate test box (Saifu), etc.

Experimental methods and results

Bioinformatics analysis and cloning of 1 cotton GH_D03G1517 gene

1.1 obtaining GH_D03G1517 gene sequence from NCBI, designing Primer by Primer Premier 5.0 software, amplifying TM-1 from upland cotton by PCR (Polymerase Chain Reaction) method, wherein the open reading frame is 1128bp, encoding 375 amino acids, the relative molecular weight of protein is 43.018kDa, and isoelectric point is 5.677. The gene open reading frame sequence is (SEQ ID NO: 1):

ATGGCTGACGTCGCTCCGGGAAACGCCGGCGGTCAATTTGGAGATTTTCCGACGATTCATACACATGGAGGTCAGTTTATTCAGTATAATATTTTTGGAAATTTGTTCGAGGTGACGTCTAAGTATCGGCCTCCGATCATGCCGATCGGTCGTGGAGCCTACGGCATCGTTTGCTCGGTGTTGAATTCGGAGACAAACGAGATGGTTGCGGTAAAGAAAATCGCCAACGCTTTTGATAATCACATGGATGCTAAGCGCACGCTTCGTGAGATTAAACTCCTTCGACATTTGGATCACGAAAACGTTATTGGAATCAAAGATGTGATTCCTCCGCCTTTAAGGAGGGAATTTACTGATGTTTACATTGCGACTGAGCTCATGGATACCGATCTTCACCAAATCATTCGCTCTAATCAGAGTTTATCGGAGGAGCATTGCCAGTATTTCTTGTATCAAATTCTTCGAGGACTGAAGTACATACATTCTGCCAATGTCATTCATAGAGATTTGAAACCCAGCAACCTCTTGCTGAATGCTAATTGTGATCTTAAGATTTGCGACTTTGGTCTCGCTCGGCCTACTGCTGAGAATGAGTTTATGACTGAATATGTTGTCACGAGGTGGTATCGGGCACCGGAGATATTGCTAAACTCTTCAGACTACACCGCTGCCATAGATGTCTGGTCTGTTGGTTGCATCTTCATGGAGCTCATGAATAGGAAGCCTCTGTTTCCAGGCAAAGATCATGTACATCAAATGCGTTTATTAACTGAGCTGCTCGGCACACCAACTGAATCCGATCTTGGATTTCTCCGGAACGAGGATGCAAGGAGATATATCAGGCAGCTCCCAGCACATCCGCGCCAATCACTAGCAGAAGTTTTCCCACATGTTCATCCATTGGCCATTGATCTCATTGACAGAATGTTGACATTTGATCCGACCAGAAGGATTACTGTTGAAGAAGCATTGGCACATCCTTACCTCGAAAGATTACACGACATATCTGATGAACCAGTCTGCCCCGAACCGTTTTCTTTCGACTTTGAGCAGCAACCATTGGGAGAAGAACAGATGAAGGACATGATTTACCAAGAGGCCTTGGCTCTGAATCCAACTTATGCTTAA

the amino acid sequence is (SEQ ID NO: 2):

MADVAPGNAGGQFGDFPTIHTHGGQFIQYNIFGNLFEVTSKYRPPIMPIGRGAYGIVCSVLNSETNEMVAVKKIANAFDNHMDAKRTLREIKLLRHLDHENVIGIKDVIPPPLRREFTDVYIATELMDTDLHQIIRSNQSLSEEHCQYFLYQILRGLKYIHSANVIHRDLKPSNLLLNANCDLKICDFGLARPTAENEFMTEYVVTRWYRAPEILLNSSDYTAAIDVWSVGCIFMELMNRKPLFPGKDHVHQMRLLTELLGTPTESDLGFLRNEDARRYIRQLPAHPRQSLAEVFPHVHPLAIDLIDRMLTFDPTRRITVEEALAHPYLERLHDISDEPVCPEPFSFDFEQQPLGEEQMKDMIYQEALALNPTYA

1.2 the specific cloning procedure of genes is as follows:

(1) In the seedling stage of cotton, tender cotton leaves are taken and quick frozen in liquid nitrogen and stored in a refrigerator of-80 degrees for standby. The total RNA of the plants is extracted by using TIANGEN company kit.

(2) The RNA extraction steps are as follows:

all centrifugation steps below were performed at room temperature.

1) Homogenizing: 100mg of plant leaves were rapidly ground to a powder in liquid nitrogen, 700. Mu.L SL (beta-mercaptoethanol was added before use) was added, and immediately vigorously shaken to mix the samples.

2) Centrifuge at 12,000rpm for 2min.

3) The supernatant was transferred to a filter column CS and centrifuged at 12,000rpm for 2min, carefully pipetting the supernatant from the collection tube into a new RNase-Free centrifuge tube, and the pipette tips prevented from contacting cell debris in the collection tube.

4) Adding 0.4 times of absolute ethyl alcohol with the supernatant volume, mixing well, transferring the mixture into an adsorption column CR3, centrifuging at 12,000rpm for 15sec, pouring out waste liquid in a collecting pipe, and placing the adsorption column CR3 back into the collecting pipe.

5) 350. Mu.L of deproteinized liquid RW1 was added to the adsorption column CR3, centrifuged at 12,000rpm for 15sec, and the waste liquid in the collection tube was discarded, and the adsorption column CR3 was returned to the collection tube.

6) DNase I working solution: mu.L of DNase I stock solution and 70. Mu.L of RDD solution were gently mixed.

7) To CR3, 80. Mu.L of DNase I working solution was added and the mixture was allowed to stand at room temperature for 15min.

8) After completion of the standing, 350. Mu.L of deproteinized liquid RW1 was added to CR3, centrifuged at 12,000rpm for 15sec, and the waste liquid in the collection tube was discarded, and the adsorption column CR3 was returned to the collection tube.

9) To the adsorption column CR3, 500. Mu.L of a rinse solution RW (ethanol was added before use) was added, and the mixture was centrifuged at 12,000rpm for 15sec, and the waste liquid in the collection tube was poured off, and the adsorption column CR3 was returned to the collection tube.

10 Step 9) is repeated.

11 12,000rpm (13,400Xg) for 2min, placing the adsorption column CR3 into a new RNase-Free centrifuge tube, and suspending and dripping 30-50 μl RNase-Free ddH into the middle part of the adsorption membrane ₂ O, 2min at room temperature, and centrifugation at 12,000rpm (13,400Xg) for 1 min. Note that: the volume of the elution buffer should not be less than 30 mu L, and too small a volume affects recovery efficiency. The RNA samples were kept at-70 ℃. If the expected RNA yield is greater than 30. Mu.g, the RNA solution obtained by centrifugation in step 11 may be added to the column CR3 and left at room temperature for 2min at 12,000rpm (13,400Xg) for 1min to obtain an RNA solution.

To prevent RNase contamination, care was taken:

1) New gloves are often replaced. Because skin is often bacterial, RNase contamination can result;

2) The plastic products without RNase and the gun head are used for avoiding cross contamination;

3) RNA is not degraded by RNase in the lysate SL. However, RNase-free plastics and glassware should be used for continued processing after extraction.

4) RNase-Free ddH should be used for preparing the solution ₂ O。

(3) Synthesis of cDNA. 500ng of RNA is reversely transcribed into cDNA, and a reverse transcription kit FSQ-201 of Toyobo is adopted, wherein a reverse transcription system is as follows:

the RT reaction solution was prepared (reaction solution was prepared on ice) as follows:

the reverse transcription reaction conditions were as follows:

at 37℃for 15min (reverse transcription reaction),

98℃for 5s (inactivation of reverse transcriptase);

the reverse transcription product cDNA solution was diluted 6-fold as a template for PCR reaction.

(4) PCR reaction system, program and product detection for gene cloning

1) PCR reaction System according to TaKaRaGXL DNA Polymerase Hi-Fi enzyme Specification, PCR reaction system is as follows:

2) The PCR amplification procedure was:

primer sequence:

upstream primer F

5′-ATGGCTGACGTCGCTCCGGGA-3′(SEQ ID NO:3)

Downstream primer R

5′-TTAAGCATAAGTTGGATTCAG-3′(SEQ ID NO:4)

3) Detection of PCR products

mu.L of the PCR product was taken, 11. Mu.L of 6×loading Buffer was added, mixed well, spotted on 1% agarose gel, and detected by electrophoresis.

And (5) performing gel cutting recovery on the target fragment by using a gel recovery kit.

The products recovered from the above-mentioned gums are according toUltra One Step Cloning Kit the kit is used for constructing and transforming the T-linked vector.

Overnight culture at 37℃after single clone was picked from resistant LB medium, shaking culture at 37 ℃.

And (3) performing PCR verification on bacterial liquid, picking a positive clone sample, sending the sample to a gold and other intelligent biotechnology limited company for sequencing, adding a certain amount of glycerol into bacterial liquid with correct sequencing, and preserving at the final concentration of glycerol of about 20-70 ℃.

Construction of 2PBI121-GH_D03G1517 plant expression vector

The test carrier is constructed by adoptingUltra One Step Cloning Kit, which is suitable for the connection of any vector and any gene fragment, requires only 15min for reaction, and requires 15bp overlapping regions at the 5 'end and the 3' end of the insert and linearization vector respectively.

The amplification primers are as follows:

upstream primer F (SEQ ID NO.5:5 '-3')

CACGGGGGACTCTAGAATGGCTGACGTCGCTCC

Downstream primer R (SEQ ID NO.6:5 '-3')

GATCGGGGAAATTCGAGCTCTTAAGCATAAGTTGGATTCAGAGCCAAGG

The operation procedure is as follows: amplifying and purifying the insert fragment by taking a cloning vector of a target gene GH_D03G1517 as a template; the resulting insert GH_D03G1517 was placed in a 2:1 molar ratio with pBI121 linearization vector.

Mixing the above solutions, reacting for 10min at 50 ℃, then placing on ice, transforming the Trans5 alpha competent cells, picking up monoclonal, sending sample, and sequencing to obtain the over-expression vector containing the correct target genes.

The procedure used LB resistant medium with plates resistant to kanamycin, formulated kanamycin 50mg/mL, diluted 1000-fold with time, i.e., 100mL medium added 100. Mu.L of 50mg/mL kanamycin.

3. Transformation of GH_D03G1517 Gene in Arabidopsis Using Agrobacterium-mediated methods

3.1. Agrobacterium tumefaciens GV3101 competent cells were transformed by freeze thawing, the specific transformation procedure was as follows:

(1) Adding 1 mug (2-10 mug) of constructed target gene over-expression vector plasmid into 100 mug of agrobacterium tumefaciens GV3101 competent cells, uniformly mixing and then carrying out ice bath for 30min; quick freezing with liquid nitrogen for 2-3min, and heat-shock at 37deg.C for 90s;

(2) Ice-bath for 5min, and adding 800 μl of LB liquid medium;

(3) After culturing for 4 hours at 28 ℃ at 190rpm, centrifuging at 4000rpm for 5 minutes, sucking the supernatant to the remaining 400-500 mu L, repeatedly sucking and beating, uniformly mixing, and then taking 200 mu L of bacterial liquid to be coated on a three-antibody screening culture medium containing kanamycin, streptomycin sulfate and rifampicin, and culturing for about 36-48 hours at 28 ℃ to obtain a resistant bacterial colony;

(4) Selecting single bacterial colony, and culturing in 1mL LB liquid medium containing the three antibodies for about 16h until turbidity;

(5) And (3) colony PCR and enzyme digestion identification, screening out positive agrobacterium strain, and preserving 20% glycerol bacterial solution at-80 ℃.

3.2 transformation of Arabidopsis thaliana by inflorescence dip-dyeing

(1) Inoculating 20 mu L of agrobacterium tumefaciens bacterial liquid preserved at-80 ℃ into 1mL of LB liquid culture medium, performing shaking culture at 28 ℃ and 180rpm for overnight, and adding 200 mu L of activated bacterial liquid into 20mL of LB liquid culture medium at 28 ℃ and 180rpm for shaking culture;

(2) When the OD value of the bacterial liquid is about 1.2-1.6, the bacterial liquid is centrifuged at 3000rpm to collect bacterial cells;

(3) The formula of the conversion medium is as follows: 5% sucrose, 0.03% silwet L-77 (Steven J, 1998);

(4) Suspending the bacterial cells with the transformation medium, and adjusting OD ₆₀₀ Start dip dyeing =0.8;

(5) Placing the arabidopsis inflorescence in a transformation medium for 30-50s, packaging the arabidopsis with a preservative film after dip-dyeing, culturing in dark for 24h, culturing under normal conditions, and harvesting seeds after maturation.

4. Phenotypic identification of transgenic Arabidopsis plants

4.1 overexpression and stress treatment of wild Arabidopsis, physiological parameter measurement, determination of oxidants and antioxidants

The inventors sterilized the surfaces of seeds of the overexpressing T3-generation arabidopsis strains L2, L6, L8 and wild type, and planted in a greenhouse. After 7 days, seedlings were transplanted into small pots filled with vermiculite and humus mixed in a 1:1 ratio. To induce drought stress, water was cut off for 8 days and 14 days. At the same time, using 250mThe M NaCl solution induced salt stress. For drought stress, plants were re-watered to measure drought resistance. And measuring physiological parameters such as leaf relative leaf water content, in-vitro leaf water loss, ion leakage, chlorophyll content and the like. The method for measuring the relative water content of the leaf comprises weighing Fresh Weight (FW) of the leaf of the same part of the treated plant, uniformly placing the leaf in a culture dish containing tap water to absorb water for 12 hours, immediately weighing water on the surface of the leaf by wiping (TW), uniformly placing the leaf in an oven to bake for 12 hours at 65 ℃, weighing (DW), and calculating the relative water content of the leaf = { (FW-DW)/(TW-DW) } ×100. The method for measuring the water loss of the in-vitro blade comprises the steps of taking down the blade, weighing the blade (FW), placing the blade in a culture room with constant temperature and humidity and constant illumination intensity for 24 hours, weighing the blade (WW), uniformly placing the blade in an oven, baking at 65 ℃ for 12 hours, weighing the blade (DW), and obtaining the water loss of the in-vitro blade= (FW-WW)/DW. About 0.1g of cotton leaf is leaked by leaf ions, the cotton leaf is washed by double distilled water, the water absorbing paper absorbs the water on the surface of the leaf lightly, the leaf is sheared and placed in 25mL double distilled water, the leaf is pumped under 0.05MPa for 20min in a vacuum dryer, the cotton leaf is slowly oscillated for 2h at 25 ℃, then the conductivity S1 is measured, and meanwhile, the blank conductivity C1 of the water is measured. The sample was then treated in a boiling water bath for 20min, cooled to room temperature and then brought to a constant volume of 25mL to determine conductivity S2, and water was treated in the same manner to determine its blank conductivity C2. Ion leakage= (S1-C1)/(S2-C2) ×100%. Chlorophyll content measurement leaf 0.1g was extracted with 80% acetone extraction, and chlorophyll content was calculated according to the following formula: c (C) _T ＝20.29D ₆₄₅ +8.05D ₆₆₃ 。

4.2 germination and root growth test under drought and salt treatment

For germination rates of transgenic and wild type seeds, the inventors sterilized the seed surface and sown on 1/2MS plates with addition of PEG (8%, 10%, 15%) and salt (50 mM,75mM and 100 mM), respectively. The plates were layered in the dark at 4 ℃ for 2 days and then placed in a growth chamber under controlled conditions of 22 ℃,70% relative humidity and 16/8 hours light/dark cycle. The germination rate was recorded daily for 7 days. Each experiment was performed 3 times, 3 technical replicates were performed, and 50 seeds were placed on each plate. In root growth experiments, seeds were sterilized and spread on 1/2MS and placed in a growth chamber, then three-day old seedlings were transferred to vertical growth in 1/2MS plates with PEG (8%, 10% and 15%) solvent added to simulate water deficit under drought stress, and for salt stress three-day old seedlings were transferred to vertical growth in 1/2MS plates with salt added (50 mM,75mM and 100 mM) and after one week, root length was measured.

4.3 expression of stress response genes in WT and GH_D031517 overexpression in Arabidopsis under drought and salt stress

The inventors selected four stress response genes ABF4, KIN1, RD22 and RAB18 to determine their expression in gh_d03g1517 overexpressing arabidopsis and wild-type under drought and salt stress. RNA was extracted from mature leaves of GH_D031517 over-expressed Arabidopsis and wild-type (WT) seedlings cultured under control, drought and salt stress conditions using Takara extraction kit. The RNA was converted to cDNA using the Prime Script RT kit (TaKaRa, china). qPCR experiments were performed using SYBR-Green Master fluorescent intercalating dyes.

4.4 overexpression of GH_D03G1517 improves drought and salt tolerance in transformed plants

The inventors evaluated the relative moisture content of wild-type and transgenic lines and found that the relative moisture content in the overexpressing lines was significantly higher than in the wild-type under drought and salt stress. The overexpressed lines had the same relative water content at the same concentration. The in vitro leaf loss (EWL) of the transgenic lines is significantly lower compared to the wild type. In the wild type, ion leakage was also higher than in the transgenic lines, indicating that the transgenic lines had higher Cell Membrane Stability (CMS) than the wild type (fig. 1). The high CMS of the gh_d03g1517 transgenic line suggests that this gene regulates drought and salt stress conditions. Chlorophyll content was the same in the transgenic lines but significantly reduced in the wild type. This suggests that the wild type has a higher level of oxidative stress as opposed to the transgenic line. Drought treatment for 14 days, wild type plants produced extreme wilting compared to transgenic lines. Under normal conditions, the wild-type and transgenic lines have similar growth conditions.

In addition, the inventors analyzed the enzymatic activity of the transgenic lines and the wild type. Before and after treatmentAfter the treatment, two antioxidants (CAT and POD) and two oxidants (MDA and H) were detected, respectively ₂ O ₂ ). The concentration of antioxidants was significantly higher for the transgenic lines than for the wild type (fig. 2). The higher antioxidant levels in transgenic lines indicate that transgenic lines can greatly reduce ROS to normal levels under salt and drought stress. Wild-type oxidants (H ₂ O ₂ And MDA) concentration is significantly increased, whereas the oxidant (H) of the transgenic lines ₂ O ₂ And MDA) concentrations were significantly reduced (fig. 2). When plants are in unfavorable environments such as lack of water and high salt, the cell functions and different biochemical parameters are significantly changed.

To further investigate the role of gh_d03g1517 in cotton drought and salt stress, the inventors studied the expression levels of 4 stress response genes. The four STRESS genes used were ABRE BINDING FACTOR (ABF 4), STRAS-INDUCED PROTEIN (KIN 1), RAS-RELATED PROTEIN (RAB 18) and DESICCATION-response (RD 22). In the control, the expression profile was identical for wild-type and gh_d03g1517 transgenic plants. However, all transgenic lines showed up-regulation after drought and salt treatment compared to wild type (fig. 3). This suggests that overexpression of gh_d03g1517 has a beneficial effect on the expression profile of stress response genes. It is suggested that these gene modulations play an important role in the abiotic stress tolerance of these plants. These genes are considered stress tolerance genes.

Overexpression of 5GH_D03G1517 enhances seed germination and root growth, thus tolerating drought and salt stress

Under PEG treatment, there was a significant difference in germination rates between the transgenic line and wild type seed. Wild type seed germination was more sensitive to PEG than transgenic lines. Under the treatment of 8 percent PEG, the germination rate of the transgenic arabidopsis seeds is 84 to 85 percent, and the germination rate of the wild seeds is 67 to 69 percent. The germination rate of wild type seeds was delayed at 10% and 15% peg treatment compared to transgenic lines (fig. 4, a-D). To evaluate root length, the inventors measured the growth of transgenic lines and wild-type roots under drought stress, and found that there was a large difference in root length between transgenic lines and wild-type roots (FIG. 4,F-G).

Under the condition of salt stress, the germination rate of the wild type and the transgenic strain is obviously reduced, and the germination rate of the transgenic strain is inhibited to a lower degree. The germination rate was lower for the wild type but much higher for the over-expressed line (FIG. 5, A-D). Under salt stress conditions, the root elongation of the transgenic lines was longer, while the root length of the wild type was shorter (FIG. 7, E-F).

4.6 maintenance of drought tolerance throughout the growth phase of Arabidopsis lines GH_D03G1517

In the seedling stage of transgenic arabidopsis, the overexpression of GH_D03G1517 remarkably improves drought tolerance of arabidopsis. An increase in drought resistance was also observed throughout the fertility cycle, thus resulting in an increase in seed yield and dry matter. This increase was maintained throughout the plant growth cycle and eventually increased the yield of dry seeds (fig. 6, a-B). As drought stress continued, the transgenic lines were significantly higher in plant height, pod length, and seed number per pod than the wild type (fig. 6, c-F). Both the gh_d03g1517 overexpressed arabidopsis and the control wild-type showed normal growth. The results show that overexpression of gh_d03g1517 in plants increases drought stress tolerance and seed yield in plants.

5. Silencing of GH_D03G1517 in cotton

5.1 specific procedures for cotton VIGS are briefly described as follows:

1) Construction of the vector: by avoiding the conserved domain, the target fragment was amplified using cDNA of the TM-1 leaf sample as a template by primer design with Oligo7 and addition of linker sequences (Spe I and Asc I) based on the CDS sequence of GH_D03G1517. The amplified product is recovered and purified, and then is connected with the pCLCrVA vector after enzyme digestion.

Upstream primer F (SEQ ID NO.7:5 '-3')

ATGCCTGCAGACTAGTCCGCTGCCATAGATGTCTGGTCT

Upstream primer R (SEQ ID NO.8:5 '-3')

AGACCTAGGGGCGCGCCCTGGTTCATCAGATATGTCGTGTAATCTTTCG

2) Conversion: the recombinant vector is transformed into escherichia coli competent DH5 alpha, and after culturing, monoclonal is selected for sequencing verification. Positive clones with correct sequences are propagated and then plasmids are extracted. The recombinant plasmid was electrotransformed into Agrobacterium competent strain LBA4404.

3) Plant preparation: selecting full TM-1 cotton seeds, planting in a climatic chamber, culturing for about 10d under the light/dark growth conditions of 25 ℃ and 16/8h, and carrying out subsequent experiments when the cotton cotyledon spreads and leaves of the first true leaves are not appeared or leaf cores are just exposed.

4) Activating bacterial liquid: the LBA4404 strains of pCLCrVA-GH_D03G1517, pCLCrVA-PDS, empty pCLCrVA and pCLCrVB were added to liquid LB medium containing three antibodies (kanamycin, rifampin and streptomycin, 50 mg/l) and incubated at 28℃for 14-16h at 180 r/min.

5) Expanding and shaking bacterial liquid: 100 mu L of each of the activated bacterial solutions is added into 50mL of liquid LB culture medium containing the three antibiotics, and the bacterial solutions are cultured for 16-20h under the condition of 180r/min at the temperature of 28 ℃ to ensure that the OD600 value of the bacterial solutions is between 1.5 and 2.0 (the bacterial solutions generally turn orange yellow at the moment). 5000g, centrifuging for 10min, and recovering thallus.

6) Preparing a conversion medium: the collected thalli are suspended by the prepared transformation medium, the OD600 value is about 1.5, and then the thalli are kept stand for more than 3 hours at room temperature and in a dark place. Wherein the conversion medium is as follows:

7) Infection: the medium of pCLCrVB and pCLCrVA (empty), pCLCrVA-PDS and pCLCrVA-GH_D03G1517 are mixed uniformly according to a ratio of 1:1. The back of the cotton cotyledon was gently scratched with a sterile syringe needle, and the mixed liquid was aspirated with a 1mL syringe (needle removed) and injected into the cotyledon until the cotyledon was completely infiltrated. The injected seedlings are cultivated for 1d in dark, and then are cultivated in a climatic chamber under the condition of illumination/darkness growth at 22 ℃ and 16/8 h.

8) Observing and sampling: after the albino phenotype of the positive control plants (pCLCrVA-PDS), DNA extraction was performed on each plant and PCR detection was performed using primers (VA-F/R and VB-F/R). Transplanting the positive plants into a big basin for culturing until flowering, observing the phenotype of each single plant flower organ, taking anther tissues of each plant, extracting RNA, and detecting the expression change of each gene.

5.2 silencing of GH_D03G1517 in cotton increases the sensitivity of cotton to drought

pCLCrVA-PDS showed a albino phenotype after infection of cotton plants for 2 weeks. The albino phenotype is the result of loss of leaf chlorophyll content (fig. 7). The effect of VIGS on gh_d03g1517 expression was examined using qRT-PCR. GH_D03G1517 expression levels were significantly lower in the silencing plants (pCLCrVA-G_D03G 1517) compared to control plants (pCLCrVA) (FIG. 7). These studies showed successful knockdown of the gene of interest in cotton plants. Physiological parameters of the silenced cotton (pCLCrVA-gh_d03g1517) and control plants (pCLCrVA) were examined, such as RLWC, ELWL, chlorophyll II content and ion leakage. The results indicate that RLWC and chlorophyll content of the silenced plants are lower than the control and ELWL and ion leakage are higher than the control. Excessive ion leakage is due to loss of cell membrane stability caused by stress exposure (fig. 7).

The inventors determined that GH_D03G1517 silenced and pCLCrVA control plants were both oxidizing agents (MDA and H ₂ O ₂ ) And enzymatic activity of two antioxidants (CAT and POD). Antioxidant (MDA and H2O 2) concentrations were significantly higher in the silencing plants than in the control plants. The concentration of antioxidants (CAT and POD) in GH-D03G 1517-silenced plants was significantly lower than in the control plants (FIG. 8). This indicates that the gene has been successfully suppressed. The antioxidant capacity of different cotton varieties measures their tolerance to drought stress (Ullah et al 2017). In addition, the results of virus-induced gene silencing (VIG) indicate that the loss of water and drought sensitivity is high in gh_d031517 silenced cotton plants, indicating that the gene plays a role in cotton tolerance to drought stress.

The inventors analyzed expression levels of cotton Raf kinase (GhRAF 4), mitogen-activated protein kinase (GhMEKK 12) and DXT/MATE (GhDTX 2) in silenced cotton using qRT-PCR. The results indicated that under stress conditions, expression was down-regulated in gh_d03g1517 gene-silenced leaf tissue and up-regulated in control plants (fig. 8).

All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.

Sequence listing

<110> cotton institute of national academy of agricultural sciences

Application of <120> cotton GH_D03G1517 gene in promotion of drought resistance and salt tolerance

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1128

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atggctgacg tcgctccggg aaacgccggc ggtcaatttg gagattttcc gacgattcat 60

acacatggag gtcagtttat tcagtataat atttttggaa atttgttcga ggtgacgtct 120

aagtatcggc ctccgatcat gccgatcggt cgtggagcct acggcatcgt ttgctcggtg 180

ttgaattcgg agacaaacga gatggttgcg gtaaagaaaa tcgccaacgc ttttgataat 240

cacatggatg ctaagcgcac gcttcgtgag attaaactcc ttcgacattt ggatcacgaa 300

aacgttattg gaatcaaaga tgtgattcct ccgcctttaa ggagggaatt tactgatgtt 360

tacattgcga ctgagctcat ggataccgat cttcaccaaa tcattcgctc taatcagagt 420

ttatcggagg agcattgcca gtatttcttg tatcaaattc ttcgaggact gaagtacata 480

cattctgcca atgtcattca tagagatttg aaacccagca acctcttgct gaatgctaat 540

tgtgatctta agatttgcga ctttggtctc gctcggccta ctgctgagaa tgagtttatg 600

actgaatatg ttgtcacgag gtggtatcgg gcaccggaga tattgctaaa ctcttcagac 660

tacaccgctg ccatagatgt ctggtctgtt ggttgcatct tcatggagct catgaatagg 720

aagcctctgt ttccaggcaa agatcatgta catcaaatgc gtttattaac tgagctgctc 780

ggcacaccaa ctgaatccga tcttggattt ctccggaacg aggatgcaag gagatatatc 840

aggcagctcc cagcacatcc gcgccaatca ctagcagaag ttttcccaca tgttcatcca 900

ttggccattg atctcattga cagaatgttg acatttgatc cgaccagaag gattactgtt 960

gaagaagcat tggcacatcc ttacctcgaa agattacacg acatatctga tgaaccagtc 1020

tgccccgaac cgttttcttt cgactttgag cagcaaccat tgggagaaga acagatgaag 1080

gacatgattt accaagaggc cttggctctg aatccaactt atgcttaa 1128

<210> 2

<211> 375

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Met Ala Asp Val Ala Pro Gly Asn Ala Gly Gly Gln Phe Gly Asp Phe

1 5 10 15

Pro Thr Ile His Thr His Gly Gly Gln Phe Ile Gln Tyr Asn Ile Phe

20 25 30

Gly Asn Leu Phe Glu Val Thr Ser Lys Tyr Arg Pro Pro Ile Met Pro

35 40 45

Ile Gly Arg Gly Ala Tyr Gly Ile Val Cys Ser Val Leu Asn Ser Glu

50 55 60

Thr Asn Glu Met Val Ala Val Lys Lys Ile Ala Asn Ala Phe Asp Asn

65 70 75 80

His Met Asp Ala Lys Arg Thr Leu Arg Glu Ile Lys Leu Leu Arg His

85 90 95

Leu Asp His Glu Asn Val Ile Gly Ile Lys Asp Val Ile Pro Pro Pro

100 105 110

Leu Arg Arg Glu Phe Thr Asp Val Tyr Ile Ala Thr Glu Leu Met Asp

115 120 125

Thr Asp Leu His Gln Ile Ile Arg Ser Asn Gln Ser Leu Ser Glu Glu

130 135 140

His Cys Gln Tyr Phe Leu Tyr Gln Ile Leu Arg Gly Leu Lys Tyr Ile

145 150 155 160

His Ser Ala Asn Val Ile His Arg Asp Leu Lys Pro Ser Asn Leu Leu

165 170 175

Leu Asn Ala Asn Cys Asp Leu Lys Ile Cys Asp Phe Gly Leu Ala Arg

180 185 190

Pro Thr Ala Glu Asn Glu Phe Met Thr Glu Tyr Val Val Thr Arg Trp

195 200 205

Tyr Arg Ala Pro Glu Ile Leu Leu Asn Ser Ser Asp Tyr Thr Ala Ala

210 215 220

Ile Asp Val Trp Ser Val Gly Cys Ile Phe Met Glu Leu Met Asn Arg

225 230 235 240

Lys Pro Leu Phe Pro Gly Lys Asp His Val His Gln Met Arg Leu Leu

245 250 255

Thr Glu Leu Leu Gly Thr Pro Thr Glu Ser Asp Leu Gly Phe Leu Arg

260 265 270

Asn Glu Asp Ala Arg Arg Tyr Ile Arg Gln Leu Pro Ala His Pro Arg

275 280 285

Gln Ser Leu Ala Glu Val Phe Pro His Val His Pro Leu Ala Ile Asp

290 295 300

Leu Ile Asp Arg Met Leu Thr Phe Asp Pro Thr Arg Arg Ile Thr Val

305 310 315 320

Glu Glu Ala Leu Ala His Pro Tyr Leu Glu Arg Leu His Asp Ile Ser

325 330 335

Asp Glu Pro Val Cys Pro Glu Pro Phe Ser Phe Asp Phe Glu Gln Gln

340 345 350

Pro Leu Gly Glu Glu Gln Met Lys Asp Met Ile Tyr Gln Glu Ala Leu

355 360 365

Ala Leu Asn Pro Thr Tyr Ala

370 375

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atggctgacg tcgctccggg a 21

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ttaagcataa gttggattca g 21

<210> 5

<211> 33

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

cacgggggac tctagaatgg ctgacgtcgc tcc 33

<210> 6

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gatcggggaa attcgagctc ttaagcataa gttggattca gagccaagg 49

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

atgcctgcag actagtccgc tgccatagat gtctggtct 39

<210> 8

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

agacctaggg gcgcgccctg gttcatcaga tatgtcgtgt aatctttcg 49

Claims (7)

1.GH_D03G1517Use of a gene for promoting salt tolerance in plants, characterized in that the gene comprisesGH_D03G1517The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the plant is cotton or Arabidopsis thaliana.

2. The use according to claim 1, characterized in that: enhancement in plantsGH_D03G1517The expression level of the gene is used for promoting the salt tolerance of plants.

3. The use according to claim 2, wherein said improvement in plantsGH_D03G1517The expression level of the gene is realized by the following method: improving plant endogenousGH_D03G1517Expression of genes, or in plantsOverexpression of exogenous sources in matterGH_D03G1517And (3) a gene.

4. The use according to claim 3, wherein the over-expression of exogenous sourcesGH_D03G1517Gene means that the gene is expressed byGH_D03G1517The gene is transformed into plants for over-expression by using a plant expression vector through agrobacterium mediation.

5. The use according to claim 4, wherein theGH_D03G1517The gene is introduced into a plant cell, tissue or organ by a plant expression vector.

6. The use according to claim 5, wherein the plant expression vector drives the plant expression vector via a constitutive or inducible promoterGH_D03G1517Expression of the genes.

7. The use according to claim 6, wherein the constitutive promoter is a 35S promoter.