CN112501181A

CN112501181A - Rice stress resistance related gene OsTZF7 and encoding protein and application thereof

Info

Publication number: CN112501181A
Application number: CN202011407585.0A
Authority: CN
Inventors: 郭迟鸣; 崔玉超; 陈玲丽; 郭小玲; 陈亮
Original assignee: SUBTROPICAL CROPS INSTITUTE OF FUJIAN PROVINCE; Xiamen University
Current assignee: SUBTROPICAL CROPS INSTITUTE OF FUJIAN PROVINCE; Xiamen University
Priority date: 2020-12-04
Filing date: 2020-12-04
Publication date: 2021-03-16

Abstract

A rice stress resistance related gene OsTZF7 and an encoding protein and application thereof relate to the field of plant genetic engineering. The OsTZF7 gene is composed of a sequence table SEQ ID NO:1, and the RR-TZF family gene consists of nucleotide sequences shown in the specification. The gene can be used for cultivating transgenic plants with enhanced drought resistance and salt tolerance. Also provides a protein containing the OsTZF7 gene code, and the amino acid sequence is shown in SEQ ID NO. 2. Also provided is a recombinant vector comprising the OsTZF7 gene code. Provides an application of the OsTZF7 gene in improving the stress resistance of plants. The OsTZF7 gene is subjected to high salt, drought and ABA induced expression are simulated, and the OsTZF7 overexpression improves the salt tolerance and drought resistance of rice in the seedling stage. Has important significance for plant stress-resistant breeding and has wide application space and market prospect in the agricultural field.

Description

Rice stress resistance related gene OsTZF7 and encoding protein and application thereof

Technical Field

The invention relates to the field of plant genetic engineering, in particular to a novel rice stress resistance related gene OsTZF7, and a coding protein and application thereof.

Background

Since plants live in natural environment, they are exposed to a series of abiotic stresses such as drought, high salinity, high temperature, low temperature, etc. during their lifetime, and these stresses seriously affect the growth and development of the plants. In order to adapt to and survive in a severe environment, after sensing environmental stress, plants activate a series of signal paths, and physiological and biochemical reactions and morphological changes of the plants are caused through the expression of stress response genes, so that the plants are finally adapted to various stresses. Abiotic stresses such as high salinity, drought and low temperature are important environmental factors influencing the growth and development of rice, and the yield of the rice is greatly reduced when the abiotic stresses are serious. In recent years, along with the change of global climate, the continuous emergence of the problems of drought climate, soil salinization and the like will provide more severe ground test for the planting of rice; therefore, the search for stress-resistant related genes and the cultivation of stress-resistant rice varieties by using genetic engineering have become the direction for the cultivation of new crop varieties.

CCCH-type zinc finger proteins are a family of proteins that contain one or more CCCH zinc finger domains, consisting of three cysteines and one histidine, that bind to zinc ions. Tandem CCCH zinc finger proteins (TZFs) belong to a subfamily of CCCH-type zinc finger proteins and are widely found in eukaryotes. In recent years, researches show that the TZF protein plays an important role in the growth and development of animals and plants and in adversity stress response. A plurality of TZF genes in arabidopsis participate in adversity stress response reaction: AtTZF1(AtC3H23) affected ABA, GA and sugar-mediated arabidopsis growth and stress responses. AtTZF2(AtOZF1/AtC3H20) and AtTZF3(AtOZF2/AtC3H49) are involved in ABA, JA, oxidative stress and the like. OsTZF1 and OsTZF2(OsDOS) in rice regulate rice leaf senescence, and OsTZF1 is also involved in salt stress, drought stress and ABA, JA hormone response. The OsTZF7 gene is subjected to salt stress, drought stress and induced expression of stress hormone ABA, and the resistance of transgenic rice with the gene over-expressed to the drought stress and the salt stress is enhanced. The invention has important significance for breeding new varieties of stress-resistant rice.

Disclosure of Invention

The invention aims to provide a rice stress-resistance related gene OsTZF7 and a coding protein thereof, wherein the gene responds to stress, and overexpression of OsTZF7 can improve the resistance of transgenic rice to drought stress and salt stress.

The invention also aims to provide application of the rice stress resistance related gene OsTZF7 in improving the stress resistance of rice.

The rice stress resistance related gene OsTZF7 is derived from rice, and the sequence of the OsTZF7 gene comprises one of a DNA sequence shown in SEQ ID NO. 1, a DNA sequence which is at least 90% homologous with the SEQ ID NO. 1, and a subfragment with the function equivalent to that of the sequence shown in SEQ ID NO. 1.

The nucleotide sequence of the rice stress-resistance related gene OsTZF7 is shown as SEQ NO:1 is represented by 1-768 bases.

The invention also provides a protein containing the OsTZF7 gene code, the amino acid sequence of the protein is shown as SEQ ID NO. 2, or the homologous sequence, or the conservative variant, or the allelic variant, or the natural mutant, or the induced mutant of the SEQ ID NO. 2 sequence.

The invention also provides a recombinant vector containing the OsTZF7 gene code, the vector selected for constructing the recombinant vector is a Ti plasmid or a plant virus vector, and the OsTZF7 gene is overexpressed in rice through transgenosis, so that the drought and salt stress tolerance of the rice is improved.

The invention also provides a transformant containing the OsTZF7 gene, and the host of the transformant is rice.

The invention also provides application of the OsTZF7 gene in improving the stress resistance of plants.

The gene or homologous gene of the present invention is screened from cDNA library and genome library by using the cloned OsTZF7 gene as a probe. The OsTZF7 gene and any interested DNA or homologous DNA can also be obtained by amplifying from genome, mRNA and cDNA by using PCR (polymerase chain reaction) technology. By adopting the technology, the OsTZF7 gene can be separated, the sequence is connected with any vector which can guide the expression of the exogenous gene in the plant and then the plant is transformed, and the transgenic plant with enhanced stress response can be obtained.

The expression vector carrying the OsTZF7 gene provided by the invention can be introduced into plant cells by using Ti plasmids and plant virus vectors and by using conventional biotechnology methods such as direct DNA transformation, microinjection, electroporation and the like.

The OsTZF7 gene expression vector transformation host is various plants including rice.

The rice gene of the invention has obvious response to the stress and can be applied to the breeding of plant resistance.

The invention discloses a rice stress resistance related gene OsTZF7, a coding protein and application. The gene is represented by a sequence table SEQ ID NO:1, and the RR-TZF family gene consists of nucleotide sequences shown in the specification. The OsTZF7 gene is subjected to high salt, drought and ABA induced expression are simulated, and the OsTZF7 overexpression improves the salt tolerance and drought resistance of rice in the seedling stage. The rice gene and the encoding protein thereof have important significance for plant stress-resistant breeding, and have wide application space and market prospect in the agricultural field.

Drawings

FIG. 1 is the analysis of OsTZF7 adversity expression profile.

FIG. 2 shows OsTZF7 overexpression and CRISPR/Cas9 knockout transgenic rice analysis.

FIG. 3 shows the phenotypic identification of transgenic plants under salt stress.

FIG. 4 is a phenotypic characterization of transgenic plants in simulated drought stress.

Detailed Description

The invention is further described in the following examples, which are intended to be illustrative only and not limiting. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

Example 1 cloning of OsTZF7 Gene of Rice

Extraction of RNA: reference is made to Promega

Super total RNA extraction kit catalog # S104. The rice material was taken in a mortar, rapidly frozen with liquid nitrogen and ground until the tissue was completely ground to a powder. The powdered sample was quickly transferred to a nuclease-free EP tube and 350. mu.L of lysis solution was added, after repeated pipetting, an equal volume of diluent was added. After 5min at room temperature, centrifuge at maximum speed for 5 min. Carefully absorbing the supernatant liquid into a new 1.5mL nuclease-free EP tube, adding 0.5-fold volume of absolute ethyl alcohol of the supernatant, and absorbing and releasing for 3-4 times by using a pipette gun to mix uniformly. The mixture was transferred to a spin column and then centrifuged at 12000g for 1 min. Discarding the filtrate, replacing the column into the collection tube, adding 600 μ L RNA washing solution into the column, centrifuging at 12000g for 1min, and discarding the filtrate. Add 50. mu.L DNase I incubation to the center of the column and let stand at room temperature for 30 min. Add 600. mu.L RNA wash to the column, centrifuge at 12000g for 1min, discard the filtrate. After repeated one time, the column was replaced on the collection tube and centrifuged at 12000g for 2 min. Transferring the column to an elution tube, adding 50 μ L of nuclease-free water into the center of the column membrane, standing at room temperature for 2min, and centrifuging at 12000g for 1 min. And adding the eluted eluent back to the center of the centrifugal column, standing at room temperature for 2min, centrifuging at 12000g for 1min, eluting again, and measuring the RNA content on a spectrophotometer. The RNA was then stored at-80 ℃.

2. Reverse transcription: see vazyme Inc

II 1st Strand cDNASynthesis Kit reverse transcription Kit catalog # R211, RNA samples were incubated at 65 ℃ for 5min to open the higher order structure, immediately after completion placed on ice, and the following reaction system was configured:

(1) reaction System (20. mu.L)

Name of reagent	Amount used (μ L)
		RNA	6
Oligo(dT)/Random hexamers	2
		2×RT Mix
HiScript II Enzyme Mix	2
		DEPC H₂O	Up to 20μL

(2) Reaction conditions

Temperature of	Time
		25℃	5min
50℃	60min
		85℃	2min

The reacted sample is stored at 4 ℃ for a short time and at-20 ℃ for a long time.

And 3, cloning cDNA, namely designing a primer according to the cDNA sequence information of OsTZF7 provided in the Rice database information in the Rice Genome Annotation Project, and carrying out full-length cDNA cloning by adopting an RT-PCR method.

The primer sequences are as follows (SEQ ID Nos: 3-4):

OsTZF7-F：TATGGCGAGCCGAGAGCACCT

OsTZF7-R：CTACATCACAAGCTCGGACAC

obtaining a coding region containing a complete open reading frame by RT-PCR, wherein the length of the coding region is 768 bp; recovered, ligated to pMD19-T vector, and sequenced. The sequencing result is analyzed on DNAMAN software, and the result shows that the gene is completely matched with the OsTZF7 gene of rice.

Example 2 expression analysis of Rice Gene OsTZF7 under stress

1. Stress management

Selecting plump Nipponbare seeds, cleaning with distilled water, sterilizing with 3% NaClO for 10min, cleaning, accelerating germination at 30 deg.C, transferring the seeds after exposure to white, culturing in water, and applying nutrient solution (1/2MS in large amount) after three leaves. Culturing at 28 deg.C in 14h/10h light culture room, and performing various stress and hormone treatments at four-leaf stage: 20% PEG6000, 200mM NaCl, 4 ℃ and 100. mu.M abscisic acid (ABA). The treated samples were sampled in roots and aerial parts before and after treatment for 1h, 3h, 6h, 12h and 24h, respectively.

RNA extraction and first Strand cDNA Synthesis

The same as in example 1.

3. Quantitative PCR analysis

Quantitative analysis is carried out on the OsTZF7 gene by using gene specific primers Ubi5-qF/Ubi5-qR and OsTZF7-qF/OsTZF7-qR respectively. By using 2^-ΔΔCTRelative quantitative Methods (Livak, K.J.and T.D.Schmittgen (2001). "Analysis of relative gene expression data-time quantitative PCR and the 2(-Delta Delta Delta C (T)) method" Methods 25(4): 402-. Each sample was replicated 3 times and each experiment was replicated 2 more times. The reaction system of the fluorescent quantitative PCR is as follows:

Premix Ex Taq^TMII 5. mu.L, Primer-F/R (10. mu. mol/L) each 0.4. mu.L, ROX Reference Dye 0.2. mu.L, cDNA template 1. mu.L, ddH₂O3 mu L; reaction conditions are as follows: 30s at 95 ℃, 5s at 95 ℃, 30s at 60 ℃, 40 cycles, and fluorescence collection at 60 ℃ for the last 5s of extension in each cycle.

The primer sequences are as follows (SEQ ID Nos: 5-8):

OsTZF7-qF：GCGGAGATGGAAGAGTTGAT

OsTZF7-qR：TACATCACAAGCTCGGACAC

Ubi5-qF：CCTCTGTGAAGATTGTGATGCCCTAC

Ubi5-qR：CAAGACCACGCCAACGGATAAA

the results show that: when the rice seedlings are stressed by PEG, the expression level of OsTZF7 in leaves is up-regulated to 5 times of the original expression level after being stressed for 1h, while OsTZF7 can quickly react in roots to cause the expression level to be up-regulated to 4 times of the original expression level and restore to the normal level after 24 h; when the rice seedlings are stressed by salt, the expression level of OsTZF7 is up-regulated to 4-10 times of that in a normal growth state after being stressed for 1 h; when rice is subjected to cold stress, the expression level of the OsTZF7 gene is obviously reduced, wherein the influence of the gene expression level in leaves is larger, and the expression level of the OsTZF7 can be restored to a normal level after the leaves are subjected to cold damage for 24 hours; when rice is interfered by exogenous ABA, the expression of OsTZF7 is rapidly reduced to about 0.3 time of the original expression level within 1h, then the expression level of OsTZF7 in leaves is increased to about 3 times of the original expression level after 12h of treatment along with the continuous influence of exogenous ABA, and finally the expression level of OsTZF7 in roots is continuously increased along with the increase of treatment time (figure 1). The results show that the OsTZF7 gene participates in salt stress and drought stress response of rice and may play a role in stress response.

Example 3 overexpression of OsTZF7 Gene in Rice and identification of CRISPR/Cas9 and transgenic plants

1. Overexpression of rice OsTZF7 gene and construction of CRISPR/Cas9 vector

According to the full-length sequence of the rice OsTZF7 gene, a primer for amplifying a complete coding open reading frame is designed, and an additional base is introduced to an upstream primer so as to construct an overexpression vector. The amplified product obtained in example 1 is used as a template, after PCR amplification, cDNA of the OsTZF7 gene of rice is cloned to an overexpression vector (such as pCXUN), sequencing is carried out, the overexpression vector is transferred into agrobacterium under the premise of ensuring the correct reading frame, and the model plant rice Nipponbare is transformed.

According to a PAM site designed in Rice Information GateWay (RIGW) Rice database Information, a CRISPR target site (sgRNA) is designed. The target site primer is (SEQ ID No: 9-10):

OsTZF7-sgRNA-F：ggcatTGGGTGAGTACCTGTCCGCC

OsTZF7-sgRNA-R：aaacGGCGGACAGGTACTCACCCAt

after synthesizing a primer dimer, carrying out enzyme digestion connection on the primer dimer and a purified and recovered BsaI enzyme digestion CRISPR/Cas9 entry vector pU3-sgRNA, transforming escherichia coli DH5 alpha, and carrying out PCR identification on a bacterial liquid and positive monoclonal sequencing to obtain an entry vector recombinant plasmid pU3-OsTZF 7-sgRNA. And then the LR reaction is carried out with the target carrier pH-ubi-cas9 through a Gateway system.

The LR reaction system (5. mu.L) was as follows:

components	Volume of
		Entrance clone (100 ng/. mu.L)	3μL
Target vector (150 ng/. mu.L)	1μL
		LR Clonase^TM II Enzyme Mix	1μL

Incubate at 25 ℃ for 2 h. Through escherichia coli transformation and identification, the final sequencing is correct, and then the CRISPR/Cas9-Os39 gene editing vector is successfully constructed. After the recombinant vector is transformed into the agrobacterium EHA105 by heat shock, the recombinant vector is transformed into the Nipponbare rice by an agrobacterium-mediated transformation method.

2. The agrobacterium-mediated method is used for rice transgenosis.

After shelling mature rice seeds, sterilizing the surfaces of the mature rice seeds for 30min by using a 15% sodium hypochlorite solution, and cleaning the mature rice seeds for 4-6 times by using sterile water; airing on sterile filter paper, and performing dark culture on an induction culture medium NBD at 26 ℃ for 14-20 d to induce callus; transferring the callus after bud pinching to a subculture medium NBD for subculture for 10-14 d, selecting fresh yellow and fruity callus to culture in an AAM culture medium of agrobacterium for 1h, drying, transferring to a co-culture medium NBD-AS for co-culture for 3d at 23 ℃ under a dark condition, cleaning the callus with sterile water for several times (until a cleaning solution is transparent and has no turbidity), and transferring to a screening culture medium NBS containing antibiotics for screening culture; after 2-3 rounds of screening (about 15 days each time), light yellow resistant callus grows on dead callus; transferring the resistant callus to a differentiation medium RGH to differentiate under the condition of illumination at 23 ℃; and when the adventitious bud grows to 5-8 cm, transferring the adventitious bud into a rooting culture medium MSR to induce rooting, and transplanting the transgenic seedling with the grown root system into a field for culture after water culture seedling hardening. Wherein the AAM culture solution, NBD induction medium, NBD-AS co-culture medium, NBS screening medium, RGH differentiation medium, MSR rooting medium are formulated in accordance with Hiei et al (Hiei, Y., et al (1994), "effective transformation of edge (Oryza sativa L.)" medium by Agrobacterium and sequence analysis of the nucleic acids of the T-DNA, "Plant J6 (2): 271. 282.), and Lin et al (Lin 540, Y.J.and Q.Zhang (2005)." optimizing the tissue transformation of high efficiency transformation of edge "Plant Rep 23(8): 547).

After rooting, removing the rooting culture medium, soaking the seedlings in water for several days for hardening, and then transplanting the seedlings into soil for growing.

3. Detection of expression level of target gene in over-expression positive plant

RNA extraction and quantitative PCR methods are described in example 1 and example 2.

Transgenic T0 generation plant leaf RNA is extracted, the expression level of a target gene in an OsTZF7 overexpression plant is detected by adopting a quantitative PCR method (figure 2A), and the expression level is more than 40 times in 3 detected transgenic plants.

4. Detection of knockout site of gene knockout transgenic rice

Extracting genome DNA of a transgenic plant and a non-transgenic plant by a CTAB method, taking the extracted genome DNA as a template, performing PCR amplification by using primers OsTZF7-F/OsTZF7-R at two ends of a gene, detecting an amplification product by gel electrophoresis, sequencing, performing sequence comparison according to a sequencing result, and detecting the mutation condition of a knockout site. The result shows that two strains knocked out by the OsTZF7 gene are homozygous mutation, wherein the No. 4 strain is subjected to base deletion, and one base is deleted from both chromosomes; line 6 is a base insertion, with one base inserted in both chromosomes (FIG. 2B).

Example 4 salt stress and PEG treatment of transgenic rice at seedling stage.

OsTZF7 overexpressed and gene knocked out transgenic family seeds were dehulled and sterilized (75% alcohol treatment for 1min, 1.5% NaClO treatment for 20min, 5 times of sterile water washing), germinated on 1/2MS medium containing 50mg/L hygromycin, and wild type controls were sown overnight on 1/2MS medium without hygromycin. Selecting seeds which well germinate and have consistent growth vigor after 2-3 days of germination, transferring the seeds to a 96-plate, putting the seeds into a rice nutrient solution for culture, transferring the seedlings to a medium containing 120mM NaCl for salt stress treatment when the seedlings grow to a 4-leaf stage, transferring the seedlings to a normal nutrient solution for rehydration after 3 days of treatment, observing the phenotype after 4 days of growth in a light culture room, and counting the survival rate of the plants. (ii) a And transferring the seedlings into a rice nutrient solution containing 20% PEG for simulated drought stress treatment, transferring the seedlings into a normal nutrient solution for rehydration after 15 days of treatment, observing the phenotype after 7 days of growth in an illumination culture chamber, and counting the survival rate of the plants. Phenotypes were observed and photographed during the treatment.

The result shows that under the normal growth condition, the OsTZF7 transgenic plant has no obvious difference with the wild plant; after 3 days of stress treatment with 120mM NaCl, compared with the wild type, the OsTZF7 overexpression transgenic plant rice leaves are verdure, the stem is upright, and obvious salt tolerance is shown, while the OsTZF7 gene knockout plant has the phenomenon of withered and yellow leaves earlier and shows salt sensitivity (fig. 3A). After 4 days of rehydration, the survival rate of OsTZF7 over-expressed plants was 27.08%, the survival rate of WT was 10.415%, and the survival rate of OsTZF7 knockout plants was 0, i.e., the survival rates of various lines, OsTZF7OE > WT > OsTZF7Cas9 (FIG. 3B). After 15 days of PEG simulated drought treatment, the leaves of OsTZF7 overexpression transgenic plants are more stiff and straight, and the curling degree is lower than that of wild plants; in contrast, the wilting degree of the gene knockout transgenic plant is higher than that of the wild type; i.e., the survival rate of the over-expression transgenic plant is higher than that of the wild type, while the survival rate of the gene knockout transgenic plant is lower than that of the wild type (FIG. 4). The result shows that the overexpression of OsTZF7 improves the resistance of rice to salt stress and simulated drought stress in the seedling stage.

From the foregoing, although the present invention has been described in detail with reference to specific examples thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof.

Sequence listing

<110> research institute for subtropical plants in Fujian province; xiamen university

<120> rice stress resistance related gene OsTZF7 and encoding protein and application thereof

<130> OsTZF7

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 768

<212> DNA

<213> Oryza sativa

<400> 1

atggcgagcc gagagcacct cctgctcgac ccggcggcgc tggccgtctc ttgggctgac 60

cccgctgcgg tggagatccc gcccgagctc ctcgccgcgc tgggtgagta cctgtccgcc 120

aggcgtagcg acggggaggc cgaggccgac gccgaggcgg aggctgatga tgagttcatg 180

atgtacgagt tcaaggtgcg gcggtgcgcg cgggcgcgga gccacgactg gacggcgtgc 240

ccgtacgcgc accctggcga ggccgcgagg cggcgtgacc cgaggcgcgt ggcgtacacg 300

ggcgagccgt gcccggactt ccgccgccgg ccgggcgccg cgtgcccgag gggcagcacg 360

tgcccgttcg cgcacggcac gttcgagctc tggctccacc cgtcgcgcta ccgcacgcgg 420

ccgtgccgcg cgggcgtcgc gtgccgccgc cgcgtctgct tcttcgcgca caccgccggc 480

gagctccgcg ccgggtccaa ggaagactcg ccgctgtcgc tctcccccaa gtcgaccctg 540

gcctccctct gggagtcgcc gccggtgtcg ccggtggagg ggcggaggtg ggtggacggc 600

atcgatgaat gcgacgcgga cgcggagatg gaagagttga tgttcgcaat gcgggagctc 660

ggcctccgga aggtgaggcc gtcggcatcg tccgtaacgc cggtgctacc gccggtgacg 720

gacgaggacg ggccggattt cgggtgggtg tccgagcttg tgatgtag 768

<210> 2

<211> 255

<212> PRT

<213> Oryza sativa

<400> 2

Met Ala Ser Arg Glu His Leu Leu Leu Asp Pro Ala Ala Leu Ala Val

1 5 10 15

Ser Trp Ala Asp Pro Ala Ala Val Glu Ile Pro Pro Glu Leu Leu Ala

20 25 30

Ala Leu Gly Glu Tyr Leu Ser Ala Arg Arg Ser Asp Gly Glu Ala Glu

35 40 45

Ala Asp Ala Glu Ala Glu Ala Asp Asp Glu Phe Met Met Tyr Glu Phe

50 55 60

Lys Val Arg Arg Cys Ala Arg Ala Arg Ser His Asp Trp Thr Ala Cys

65 70 75 80

Pro Tyr Ala His Pro Gly Glu Ala Ala Arg Arg Arg Asp Pro Arg Arg

85 90 95

Val Ala Tyr Thr Gly Glu Pro Cys Pro Asp Phe Arg Arg Arg Pro Gly

100 105 110

Ala Ala Cys Pro Arg Gly Ser Thr Cys Pro Phe Ala His Gly Thr Phe

115 120 125

Glu Leu Trp Leu His Pro Ser Arg Tyr Arg Thr Arg Pro Cys Arg Ala

130 135 140

Gly Val Ala Cys Arg Arg Arg Val Cys Phe Phe Ala His Thr Ala Gly

145 150 155 160

Glu Leu Arg Ala Gly Ser Lys Glu Asp Ser Pro Leu Ser Leu Ser Pro

165 170 175

Lys Ser Thr Leu Ala Ser Leu Trp Glu Ser Pro Pro Val Ser Pro Val

180 185 190

Glu Gly Arg Arg Trp Val Asp Gly Ile Asp Glu Cys Asp Ala Asp Ala

195 200 205

Glu Met Glu Glu Leu Met Phe Ala Met Arg Glu Leu Gly Leu Arg Lys

210 215 220

Val Arg Pro Ser Ala Ser Ser Val Thr Pro Val Leu Pro Pro Val Thr

225 230 235 240

Asp Glu Asp Gly Pro Asp Phe Gly Trp Val Ser Glu Leu Val Met

245 250 255

<210> 3

<211> 21

<212> DNA

<213> Oryza sativa

<400> 3

tatggcgagc cgagagcacc t 21

<210> 4

<211> 21

<212> DNA

<213> Oryza sativa

<400> 4

ctacatcaca agctcggaca c 21

<210> 5

<211> 20

<212> DNA

<213> Oryza sativa

<400> 5

gcggagatgg aagagttgat 20

<210> 6

<211> 20

<212> DNA

<213> Oryza sativa

<400> 6

tacatcacaa gctcggacac 20

<210> 7

<211> 26

<212> DNA

<213> Oryza sativa

<400> 7

cctctgtgaa gattgtgatg ccctac 26

<210> 8

<211> 22

<212> DNA

<213> Oryza sativa

<400> 8

caagaccacg ccaacggata aa 22

<210> 9

<211> 25

<212> DNA

<213> Oryza sativa

<400> 9

ggcattgggt gagtacctgt ccgcc 25

<210> 10

<211> 25

<212> DNA

<213> Oryza sativa

<400> 10

aaacggcgga caggtactca cccat 25

Claims

1. The rice stress resistance related gene OsTZF7 is characterized by comprising the following components in percentage by weight: (1) 1, a DNA sequence shown in SEQ ID NO; or (2) a DNA sequence at least 90% homologous to SEQ ID NO 1; or (3) a subfragment functionally equivalent to the sequence shown in SEQ ID NO: 1.

2. The rice stress-resistance-associated gene OsTZF7 as claimed in claim 1, which has a nucleotide sequence as shown in SEQ NO:1 is represented by 1-768 bases.

3. The rice stress resistance related gene OsTZF7 encoding protein is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO. 2, or is the homologous sequence, or conservative variant, or allelic variant, or natural mutant, or induced mutant of the SEQ ID NO. 2 sequence.

4. The recombinant vector containing the gene code of the rice stress-resistance related gene OsTZF7 as claimed in claim 1.

5. The recombinant vector as claimed in claim 4, wherein the vector selected for constructing the recombinant vector is Ti plasmid or plant virus vector, and the OsTZF7 gene is overexpressed in rice through transgenosis for improving the drought and salt stress tolerance of rice.

6. A transformant obtained by introducing the rice stress-resistance-associated gene OsTZF7 of claim 1 or the recombinant vector of claim 4 into a host cell, wherein the host is rice.

7. The application of the rice stress resistance related gene OsTZF7 in improving the stress resistance of plants as claimed in claim 1.