CN109456396B

CN109456396B - Rice leaf senescence and panicle type regulation gene HK73, and protein, molecular marker and application encoded by gene HK73

Info

Publication number: CN109456396B
Application number: CN201811636548.XA
Authority: CN
Inventors: 胡培松; 胡时开; 唐绍清; 焦桂爱; 魏祥进; 圣忠华; 谢黎红; 邵高能
Original assignee: China National Rice Research Institute
Current assignee: China National Rice Research Institute
Priority date: 2018-12-29
Filing date: 2018-12-29
Publication date: 2021-05-25
Anticipated expiration: 2038-12-29
Also published as: CN109456396A

Abstract

The invention discloses a rice leaf senescence and panicle type regulation gene HK73, and a protein coded by the gene HK73, a molecular marker and application of the gene HK 73; the invention utilizes the rice leaf senilism and the short spike mutant, clones HK73 gene (Seq ID No: 1) in rice for the first time by a map-based cloning technology, and the gene encodes an ATP functional domain containing protein (Seq ID No: 2) to regulate the senescence process and spike type of the rice leaf. Through the functional analysis of the HK73 gene, the genetic mechanism of the leaf senescence process, the leaf senilism and the ear development of plants, particularly gramineous plants, is further determined, and a foundation is laid for improving the photosynthesis efficiency of crops and improving the yield increasing potential of rice.

Description

Rice leaf senescence and panicle type regulation gene HK73, and protein, molecular marker and application encoded by gene HK73

Technical Field

The invention relates to the field of plant genetic engineering and breeding, in particular to a rice leaf senescence and panicle type regulatory gene HK73, and a protein, a molecular marker and application coded by the gene HK 73.

Background

The rice leaves are important places for synthesizing organic substances, and dry matter accumulation can be increased by delaying senescence of the leaves and prolonging the function of a photosynthetic organ; especially in the late growth period of rice, the photosynthesis time of plant leaves is prolonged, and more organic substances are accumulated, so that the yield increasing potential of rice can be improved. An important leaf color mutant, namely evergreen leaves, exists in rice, and is a functional evergreen mutant, and the main phenotypic characteristics of the mutant are that the leaf senescence is delayed in the later growth stage, and the chlorophyll content and the photosynthetic capacity are kept unchanged. Therefore, the effective utilization of the leaf senescence or development genes can not only improve the production capacity of rice, but also provide a new approach and method for super rice breeding in the future.

The spike type characteristics of rice including spike grain number, branch number, spike length and the like are one of the important factors for determining the formation of rice yield. The development process of the rice ears comprises two stages of the morphogenesis of young ears and the pollen development. The morphogenesis of young ears begins with the transition from vegetative to reproductive growth of the shoot apical meristem, and then includes the bud differentiation phase, the primary shoot primordium differentiation phase, the secondary shoot primordium differentiation phase, the spikelet primordium differentiation phase and the stamen-stamen formation phase. The most direct influence of development of young panicles on rice yield is reflected in panicle size (length), number of branches, panicle density and the like. Therefore, the research on the development and morphological characteristics of the rice ears not only is a basic theoretical problem in the aspect of plant development, but also has important application value and practical significance in the aspects of improving and increasing the grain number of the rice ears, the weight of the single ears and the like.

Disclosure of Invention

The invention aims to provide a rice leaf senescence and panicle type regulation gene, and a protein, a molecular marker and application coded by the gene.

In order to achieve the purpose, the invention adopts the following technical scheme:

in one aspect, the present invention provides a protein encoded by rice leaf senescence and panicle type regulatory gene HK73, the protein having the sequence shown in (a) or (B):

(A) seq ID No: 2;

(B) protein which is derived from (A) and has functions of leaf senescence and panicle type regulation of rice, wherein one or more amino acids are added and/or substituted and/or deleted in the amino acid sequence defined by (A).

Seq ID No: 2 and 6 belong to the ATP functional domain containing proteins, wherein functional analogs obtained by one or more substitutions, insertions or deletions can also achieve the object of the invention.

In another aspect, the present invention provides a gene encoding the above protein.

Further, the gene has a sequence shown as (a), (b) or (c):

(a) seq ID No: 1;

(b) and Seq ID No: 1, and a nucleotide sequence complementary to the nucleotide sequence shown in 1;

(c) a mutant gene, allele or derivative which can code a protein with functions of leaf senescence and panicle type regulation of rice and is generated by adding and/or substituting and/or deleting one or more nucleotides in the nucleotide sequence defined in (a) or (b).

In a further aspect, the present invention provides a plasmid, plant expression vector or host cell comprising the above gene, which may be an E.coli cell, an Agrobacterium cell or a plant cell.

In another aspect, the present invention provides a method for regulating and controlling leaf senescence and panicle type of rice, comprising transforming rice cells with the above gene, and then culturing the transformed rice cells into plants. Specifically, the present invention provides a polypeptide having the sequence Seq ID No: 1 and 5, wherein the vector can express a polypeptide fragment encoded by the above nucleotide sequence or a homologous analog thereof, such as pCambia1300-HK73 shown in figure 3.

In a further aspect, the invention provides the use of a protein, gene, plasmid, plant expression vector or host cell as described above: (a1) regulating and controlling the aging of plant leaves; or (a2) regulating plant panicle type; the leaf senescence rate and the ear type (particularly the ear length) of the plant can be influenced.

In another aspect, the invention provides a molecular marker linked with rice leaf senescence and panicle type regulatory gene HK73, wherein the upstream primer and the downstream primer of the molecular marker are respectively:

(A) the upstream primer is CTGGCCTCTAGCTACAACCTTGC, and the downstream primer is AAACTCTCGCTGGATTCGATAGG;

or (B) the upstream primer is ACGAGAGGGAGGAGAGAGAAACG, and the downstream primer is GGAGAGCCACAGGAACAGATCG;

or (C) the upstream primer is AGCCAAAACCAAATCCAAAA, and the downstream primer is CTTCGAGTTGGCCATATTCAC;

or (D) the upstream primer is GACCTTCTCCCTCCTCCAAC, and the downstream primer is GTGTGGGACTTGAACACGG.

In still another aspect, the present invention provides a use of the above molecular markers, wherein the molecular markers are used alone or in combination, and the leaf senescence and/or panicle type trait of a plant is selectively bred through the plant molecular marker-assisted selective breeding.

Further, the spike type is spike grain number, branch number and/or spike length.

Further, the plant is a gramineous plant, and the gramineous plant is rice.

The specific technical steps for realizing the invention are as follows:

(1) isolation and genetic analysis of mutant hk 73:

the rice leaf senilism and short spike mutant hk73 is derived from mutation generated by mutation of japonica rice variety Wuyunjing No. 7 (Oryza sativa L.cv Wuyuunjing 7) EMS (ethyl Methyl sulfonate). The mutant is proved to be controlled by recessive single gene through positive and negative cross experiments with wild type, as shown in figure 1.

(2) Map-based clone HK73 gene:

1) initial positioning of HK 73:

in order to isolate HK73 gene, the invention firstly constructs a positioning population, and F is formed by the combination of mutant HK73 and local No. 1 hybrid in indica rice variety table₂And (5) positioning the population. Then, the HK73 site is preliminarily marked by utilizing molecular markers such as STS, SSR and the like by a map-based cloning methodLocated in the region of chromosome 12 between the 12-26 and K73-22 markers (FIG. 2).

2) Fine positioning of HK 73:

development of a novel STS marker HK73 was refined to be located between the K73-24 and K73-31 markers on chromosome 12 (FIG. 2), and candidate genes were predicted by analyzing the Open Reading Frames (ORFs) of this segment and sequencing.

3) Identification and functional analysis of HK73 gene:

the result of the transgenic technology shows that the transgenic rice which enables the mutant HK73 to recover the normal phenotype is obtained (figure 4), and the HK73 gene is proved to be correctly cloned by the invention.

The HK73 gene is firstly cloned in rice by using the rice leaf senilism and the short spike mutant through a map-based cloning technology, and the gene encodes an ATP functional domain containing protein to regulate the rice leaf senescence process and the spike size. Through the functional analysis of the HK73 gene, the genetic mechanism of the leaf senescence process, the leaf senilism and the ear development of plants, particularly gramineous plants, is further determined, and a foundation is laid for improving the photosynthesis efficiency of crops and improving the yield increasing potential of rice.

Drawings

The foregoing is only an overview of the technical solutions of the present invention, and in order to make the technical solutions of the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and the detailed description.

FIG. 1 shows the ear sprouting leaf (A) and maturity ear (B) phenotypes of rice leaf senescence material hk73 and wild type material Wuyujing No. 7; boxes indicate leaf senescence areas; the scale is 2 cm;

FIG. 2 is a fine mapping and cloning map of HK73 gene;

FIG. 3 is a map of the pCambia1300-HK73 vector;

FIG. 4 is transgene complement T₁Comparison of leaf (A) and ear (B) phenotypes in rice generation plants, wild type WYJ7 and hk73 mutant plants; wherein in (A) and (B): left, wild-type WYJ 7; the hk73 mutant; right, transgene complementation T₁Generation; boxes indicate mutant leaf senescence areas; scale 2 cmRice;

FIG. 5 is a nucleotide sequence diagram of HK73 gene;

FIG. 6 is the amino acid sequence encoded by the HK73 gene.

Detailed Description

The following examples further illustrate the present invention but should not be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The biochemical reagents, carriers, consumables and the like used in the examples are all commercially available products unless otherwise specified.

Example 1 cloning of Rice leaf senescence and panicle type regulatory Gene HK73

(1) Rice material:

the original wild material of the rice mutant hk73 is japonica rice No. 7 Wuyunjing (Oryza sativa L. cv Wuyuunking 7). As shown in FIG. 1, mutant hk73 showed early senescence of the upper leaves at heading stage and decreased ear size at maturation stage.

(2) Analysis and localization of populations:

the homozygous hk73 mutant is crossed with the wild type indica rice variety No. 1, F₁Selfing to obtain F₂And (4) the population, and 1148 individuals with the hk73 phenotype are selected as a positioning population. About 1-2 g of tender leaves of each plant are taken in the seedling stage and used for extracting the total DNA of the plant.

(3) Localization of HK73 gene:

SSR analysis is carried out on a small population consisting of hk73 phenotype individuals selected from a positioning population, SSR primers which are approximately and uniformly distributed on each chromosome are selected for PCR amplification according to a published molecular genetic map created by japonica rice and indica rice, and the following amplification procedures are adopted: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 35 seconds, extension at 72 ℃ for 10 seconds, and 33 cycles; finally, the extension was carried out at 72 ℃ for a further 8 minutes. The PCR products were separated by 5% agarose gel electrophoresis and stained with ethidium bromide to detect polymorphisms in the PCR products, and HK73 was initially located between markers of chromosome 12, chromosome 12-26 and K73-22. The SSR and STS markers are designed continuously on the basis of primary localization, and finally HK73 is precisely located between molecular markers K73-24 and K73-31 on chromosome 12 (FIG. 2) and is co-separated from K73-31. The primer sequences are as follows:

12-26F：AGAGAGCCCCTAAATTTCCG R：AGGTACGCTCACCTGTGGAC

K73-22F：ACGAGAGGGAGGAGAGAGAAACG R：GGAGAGCCACAGGAACAGATCG

K73-24F：AGCCAAAACCAAATCCAAAA R：CTTCGAGTTGGCCATATTCAC

K73-31F：GACCTTCTCCCTCCTCCAAC R：GTGTGGGACTTGAACACGG

(4) gene prediction and sequencing analysis:

according to the result of fine positioning, in the candidate range according to Rice Automated indication System (b) ((b))http://RiceGAAS.dna.affrc.go.jp) According to the number of the remaining recombinant individuals marked by the two markers and the coseparation marker, a sequencing primer of each gene is designed, and each candidate gene is amplified from hk73 and wild type Wuyujing No. 7 genomes by a PCR method for sequencing analysis. The amplified product of the mutant hk73 in 1 DNA fragment of 1 candidate gene is found to have 1 base of guanine G to adenine A compared with wild type variety Wuyujing No. 7. The above sequencing procedure was verified twice repeatedly, all yielding the same results. Therefore, this candidate gene was named HK 73. Based on the gene annotation information, the candidate gene was predicted to encode a functional ATP domain comprising protein (fig. 6).

Example 2 construction of pCAMBIA1300-HK73 plant expression vector

According to the whole genome sequence of a rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided in NCBI, a specific amplification primer for amplifying the full-length sequence of the HK73 candidate gene is designed, and specific enzyme cutting sites are added at two ends of the specific primer according to the selected pCambia1300 expression vector and the characteristics of the HK73 candidate gene sequence (figure 3). The specifically designed primers are: the forward primer (P1F) has a KpnI cleavage site (GGTACC) added at its 5 'end, and the reverse primer (P1R) has a SalI cleavage site (GTCGAC) added at its 5' end, and the primer sequences are as follows:

P1f, forward primer: 5' -CTGGTACCAAATTTGTAATTGCCTCTAAT-3’

P1R reverse primer: 5' -CAGTCGACGTGTATAAGGACTACTTTAG-3’

Then, genomic DNA of Wuyujing No. 7 of the rice variety is extracted, and the total sequence of HK73 candidate genes is amplified to 6224bp by using the primers (P1F and P1R) designed above by taking the genomic DNA of Wuyujing No. 7 as a template: including the full length of HK73 genomic DNA and its upstream and downstream sequences. The following amplification procedure was used: pre-denaturation at 95 ℃ for 3 min; denaturation at 98 ℃ for 40 seconds, annealing at 55 ℃ for 40 seconds, extension at 68 ℃ for 7 minutes, 38 cycles; finally, extension was carried out at 72 ℃ for a further 15 minutes. The target fragment amplified by PCR was recovered, ligated to ZERO BLANT TOPO vector (Invitrogen), transformed into E.coli DH5a competent cells, and then subjected to colony PCR identification to select positive clones, which were sequenced by Hangzhou Shanghai corporation. The positive clones identified by sequencing were subjected to plasmid extraction, the extracted plasmid was double digested with KpnI and SalI, and the HK73 complementary fragment was recovered. At the same time, KpnI and SalI are utilized to carry out double enzyme digestion linearization on pCambia1300, and a pCambia1300 skeleton is recovered, a HK73 complementary fragment recovered after enzyme digestion and the pCambia1300 skeleton recovered after enzyme digestion are connected by T4 ligase (purchased from NEB company) to obtain an HK73 complementary expression vector pCAMBIA1300-HK73 (figure 3), and the pCAMBIA1300-HK73 expression vector is transferred into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 by adopting an electric shock transformation method.

Example 3 transformation of the plant expression vector pCAMBIA1300-HK73 Rice callus

The agrobacterium-mediated rice mature embryo callus dip-dyeing transformation method is adopted to transfer the recombinant expression vector pCAMBIA1300-HK73 into the rice mature embryo, and the transformation method is as follows: (1) induction of rice mature embryo callus: mature seeds of hk73 mutant were dehulled, then surface-sterilized with 70% alcohol for 1-2min, then shaken with 30% NaClO solution for 15min, and repeated once, and then washed with sterilized water more than 5 times. Then, the seeds are placed on an induction culture medium for culture, and callus is induced for transformation by 28-degree light-shielding culture. (2) Co-culturing rice callus and agrobacterium: the EHA105 strain identified in example 2 as containing the pCAMBIA1300-HK73 expression vector was activated and enrichedThen, the suspension was resuspended and the OD600 was adjusted to 0.5-0.7. The callus was collected in a 200ml sterilized conical flask, poured into the resuspended agrobacterium suspension, and the callus was impregnated. After soaking for 15-30min, the suspension is poured off, and the impregnated callus is placed on sterile filter paper to suck off the excess agrobacterium liquid. Then, the callus was placed in a petri dish with sterile filter paper and incubated at 26 ℃ in the dark for 2-3 days. (3) Screening of resistant calli: after the co-culture was completed, the callus was transferred to a selection medium containing 50mg/ml hygromycin and subjected to resistant callus selection at 26-30 ℃. (4) Differentiation of resistant calli: and (3) placing the callus with good growth state in the screening culture medium in a differentiation culture medium, and performing differentiation culture under the conditions of 15 hours of illumination/9 hours of darkness and the environment temperature of 26-30 ℃ until the callus grows out by differentiation. (5) And (3) differentiated plantlet rooting: when the differentiated plantlet grows to about 4cm, transferring the plantlet into a rooting culture medium for rooting culture. Transplanting the seedlings with the grown root systems into a greenhouse or a transgenic safe garden to grow. Identification and continuous observation of the plants revealed that the transgenes complement T compared to the contemporaneous mutants₁The leaf shape of the generation plant at heading stage and the ear shape of the generation plant at mature stage are restored to normal state (figure 4).

The invention is based on self-obtaining of a rice mutant HK73, a positioning population is constructed on the basis, map-based cloning is carried out, a new gene HK73 and a protein thereof are finally cloned, and a molecular marker tightly linked with the gene is obtained.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the present invention in any way, and it will be apparent to those skilled in the art that the above description of the present invention can be applied to various modifications, equivalent variations or modifications without departing from the spirit and scope of the present invention.

Sequence listing

<110> institute of Rice research in China

<120> rice leaf senescence and panicle type regulation gene HK73, and protein, molecular marker and application encoded by gene HK73

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3408

<212> DNA

<213> Oryza sativa (Oryza sativa)

<400> 1

atggcgcgga agaagatccg ggagtacgac tccaagcgcc tcctaaggga gcacctcaag 60

cgcctcgccg ccatcgacct ccacatcctc tccgcccagg tacaccacat ccatctacct 120

ctctgttcct cgcgcttgga tcggctcgtg gtttggtgga attccgcgtg gatctcggcg 180

ctcggggatc ggagcgtgtg gattcggcga cctctcgcgg tttggcctcg taggatcttc 240

gggggggggg ggggggggga gggggggtaa gggttggagt tctgaggtgt tttggactcg 300

gaggtgtgct ccgattaggc gaaattctgc tcaaagaggg ctcaatttcg tgttgtcaac 360

tggtgattgt agctgtggct gtagctgccg gctgatgtgg aagtatatgt gatttgttag 420

aatggttagt acctggcaac gaaatctgtt tgggtgattg ggcaaaatac atttgaattg 480

gataaaatga gaatggggaa ttgtttacag caatcgtaca cttccactgc tgctaagctt 540

ttcgcatatt tgatgcaacc tgcgatcatc ggagcatcct ttgtgctatg ggatctcatt 600

agtggtatga tggtatgatg cttttgtttg tgggttggat gggtcatgtg atgcacaagg 660

tgtgtcttag atctgttgcg atgatggtgt aaactctgtc tgaggtattg ctttattgtc 720

cttaccaagg ttttggtttc ggtgtctggt tttcctaatg aaattccact gctggtaggt 780

gaactggttg gtagcttttg acttggagtg ctctgctttt gatatttggt tacctttctt 840

ttgattttta accataatgg tagacgttta atgtgcgcta ccgaggtcca aagcttcatc 900

ttggatctga gattcaacat ctctagtttg ggttaggata atcttgctct gatggtgtag 960

gctcatgttg aatttcagta ccatctatga aaagctaagt gttgtcatat ttctaaatac 1020

cagataggaa caagcaatct attctgattt cctttgaact caaaagcaca ctcagctgtg 1080

ttagaatagc tacgcttatg ggtgaaaaag agtgaagtta gttttgatat attcttgact 1140

gcattagctt ttgttctgca gtagtttgtg tttaatagtg ccgcaatcca tgactaattt 1200

gaactgtact ttttcttagg tcacggaatc aactgatttc acagagctcg tcaaccaaga 1260

gccatggctc tcgtctatga agttggttgt gaaacccgac atgctgtttg gcaaacgtgg 1320

gaagagtggc cttgtggccc tcaacctaga tcttgctcaa gtccgccaat tcgtcaaaga 1380

gcggttggga gttgaggtag ttatacattt tcccatgctt tgcctctaaa accttgttag 1440

ttataactat tctaagctat ccggtatgcc tgttatgcag gttgagatgg gtggctgcaa 1500

ggctcctatt acaacattca tagttgagcc atttgttcca catgatcaag agtactatct 1560

ttctattgta tcagagaggc ttggttccac cattagcttc tcggagtgtg gaggtattga 1620

gatcgaggag aactgggata aggtcaagac agtttttctt cccaccgaga aagcaatgac 1680

acctgatgcg tgtgctccat tgattgccac cctaccgtta gaggtacgct tatacattgt 1740

atcaccttcc ccatgtcacg ttgttttttt tttaacatgt tgacttttct cccattctgg 1800

actcaattcc tctagtgtta gaacttatta ttgatgatac ctattttggt ctgcattagc 1860

catcttgtgc tcatgtcatt cacgtcttct gtctgaattt caggttcgga caaaaatagg 1920

tgatttcatc agaggtgtat attctgtttt ccaaggtaat tcacagttga aaaataaaaa 1980

taatctggaa ttgttgtttt ccaagataac tcagttcatt ctattgatct tctggcagac 2040

ttggatttct cattccttga gatgaatccg ttcaccatgg tgaatgggga accatatcct 2100

ctagacatga gaggagaatt ggacgacaca gctgccttta agaactttaa gaagtatgat 2160

tcaggctttt ttttttctag cttacatagt gtccagttca atcctttcac catgcttgtc 2220

atgctaacca gagcttccat ggcataggtg gggaaacatt cagttccctc tgcctttcgg 2280

aagagtcctc agcccctctg aaagctttat ccatgaactg gatgagaagg taacctcata 2340

tttctttctt tcccctctga agtctgctgc ctgttagtac atatcactta aatttggata 2400

caaattgaat ttcactgcct ctgcatgcaa aatattgaat cttgaattga ggttgatgta 2460

atttttcaga caagctcatc gctcaaattc acagtcctga acccgaaagg gcgcatttgg 2520

acaatggttg caggtggtgg tgctagtgtc atatatgctg atactgtaag tctaactcta 2580

tccagatctt ttttaggtta agttttgaag tttatcagtg ccattcacac actggacaat 2640

atcaccaggt tggagatttg ggatatgcgt cagagcttgg aaattatgca gaatacagcg 2700

gcgctcccaa cgaggaggag gttctgcagt atgctagagt ggttttggat gtaagggctc 2760

cagaggaacc ttttcggctg acagtttgat cattatgttt ccgctctgac aaaatgatat 2820

ttgaatcttt gtagtgtgcc actgctgatc ctgatggccg taagagagct cttctcattg 2880

gaggtggtat agcgaacttc actgatgtcg ctgctacatt cagtggcatc attcgagctt 2940

taagagagaa ggcaagtttc gattggatcg ttgttctgtc cccaaccact cccacttgtt 3000

gccattaaaa tcttcatcca tcttattatt gtctggcttc caaatctggt ggcaggaatc 3060

caaattgaag gctgcacgga tgaacattta cgttcggaga ggtggtccaa actaccaaac 3120

tggccttgcc aaaatgcgta cactaggtgc agaacttggt gttccaattg aggtatggac 3180

ctactggcta cttactatgt tcttccagca aaccttagct cagccatttc ctacactatt 3240

tatcagaatt cgtcagagat taactttatt agacatagga caccattgga ccatccccat 3300

gatcataacg gacgagctga attcactgaa ttgcaggtat atggaccaga ggcaacaatg 3360

actggaatct gcaagcaagc cattgattgc atcatggctg aagcataa 3408

<210> 2

<211> 423

<212> PRT

<213> Oryza sativa (Oryza sativa)

<400> 2

Met Ala Arg Lys Lys Ile Arg Glu Tyr Asp Ser Lys Arg Leu Leu Arg

1 5 10 15

Glu His Leu Lys Arg Leu Ala Ala Ile Asp Leu His Ile Leu Ser Ala

20 25 30

Gln Val Thr Glu Ser Thr Asp Phe Thr Glu Leu Val Asn Gln Glu Pro

35 40 45

Trp Leu Ser Ser Met Lys Leu Val Val Lys Pro Asp Met Leu Phe Gly

50 55 60

Lys Arg Gly Lys Ser Gly Leu Val Ala Leu Asn Leu Asp Leu Ala Gln

65 70 75 80

Val Arg Gln Phe Val Lys Glu Arg Leu Gly Val Glu Val Glu Met Gly

85 90 95

Gly Cys Lys Ala Pro Ile Thr Thr Phe Ile Val Glu Pro Phe Val Pro

100 105 110

His Asp Gln Glu Tyr Tyr Leu Ser Ile Val Ser Glu Arg Leu Gly Ser

115 120 125

Thr Ile Ser Phe Ser Glu Cys Gly Gly Ile Glu Ile Glu Glu Asn Trp

130 135 140

Asp Lys Val Lys Thr Val Phe Leu Pro Thr Glu Lys Ala Met Thr Pro

145 150 155 160

Asp Ala Cys Ala Pro Leu Ile Ala Thr Leu Pro Leu Glu Val Arg Thr

165 170 175

Lys Ile Gly Asp Phe Ile Arg Gly Val Tyr Ser Val Phe Gln Asp Leu

180 185 190

Asp Phe Ser Phe Leu Glu Met Asn Pro Phe Thr Met Val Asn Gly Glu

195 200 205

Pro Tyr Pro Leu Asp Met Arg Gly Glu Leu Asp Asp Thr Ala Ala Phe

210 215 220

Lys Asn Phe Lys Lys Trp Gly Asn Ile Gln Phe Pro Leu Pro Phe Gly

225 230 235 240

Arg Val Leu Ser Pro Ser Glu Ser Phe Ile His Glu Leu Asp Glu Lys

245 250 255

Thr Ser Ser Ser Leu Lys Phe Thr Val Leu Asn Pro Lys Gly Arg Ile

260 265 270

Trp Thr Met Val Ala Gly Gly Gly Ala Ser Val Ile Tyr Ala Asp Thr

275 280 285

Val Gly Asp Leu Gly Tyr Ala Ser Glu Leu Gly Asn Tyr Ala Glu Tyr

290 295 300

Ser Gly Ala Pro Asn Glu Glu Glu Val Leu Gln Tyr Ala Arg Val Val

305 310 315 320

Leu Asp Cys Ala Thr Ala Asp Pro Asp Gly Arg Lys Arg Ala Leu Leu

325 330 335

Ile Gly Gly Gly Ile Ala Asn Phe Thr Asp Val Ala Ala Thr Phe Ser

340 345 350

Gly Ile Ile Arg Ala Leu Arg Glu Lys Glu Ser Lys Leu Lys Ala Ala

355 360 365

Arg Met Asn Ile Tyr Val Arg Arg Gly Gly Pro Asn Tyr Gln Thr Gly

370 375 380

Leu Ala Lys Met Arg Thr Leu Gly Ala Glu Leu Gly Val Pro Ile Glu

385 390 395 400

Val Tyr Gly Pro Glu Ala Thr Met Thr Gly Ile Cys Lys Gln Ala Ile

405 410 415

Asp Cys Ile Met Ala Glu Ala

420

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (12-26F)

<400> 3

agagagcccc taaatttccg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (12-26R)

<400> 4

aggtacgctc acctgtggac 20

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence (K73-22F)

<400> 5

acgagaggga ggagagagaa acg 23

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence (K73-22R)

<400> 6

ggagagccac aggaacagat cg 22

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (K73-24F)

<400> 7

agccaaaacc aaatccaaaa 20

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence (K73-24R)

<400> 8

cttcgagttg gccatattca c 21

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (K73-31F)

<400> 9

gaccttctcc ctcctccaac 20

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence (K73-31R)

<400> 10

gtgtgggact tgaacacgg 19

Claims

1. The application of a protein encoded by a rice leaf senescence and panicle type regulation gene HK73 in regulation of panicle type of rice is characterized in that the protein is represented by Seq ID No: 2, or a pharmaceutically acceptable salt thereof.

2. Use according to claim 1, wherein the spike type is spike grain number, branch number and/or spike length.

3. The application of a gene in regulating the panicle type of rice, wherein the gene codes Seq ID No: 2 in sequence shown in the figure.

4. The use of the gene according to claim 3 for regulating the panicle type of rice, wherein the gene is selected from the group consisting of Seq ID No: 1.

5. Use according to claim 3 or 4, wherein the spike type is spike grain number, branch number and/or spike length.

6. The application of a molecular marker linked with rice leaf senescence and panicle type regulatory gene HK73 is characterized in that an upstream primer and a downstream primer of the molecular marker are respectively as follows:

The molecular markers are used singly or in combination, and the panicle type character of the rice is bred by the aid of plant molecular marker-assisted selective breeding.

7. Use according to claim 6, wherein the spike type is spike grain number, branch number and/or spike length.