CN106148297B - rice plastid development regulatory gene FLN2 and application thereof - Google Patents

Abstract

the invention belongs to the field of plant genetic engineering. Specifically, the invention relates to a method for cloning rice FLN2 gene by using map-based cloning technology and identifying the function of the gene by using a transgenic complementation experiment; meanwhile, the gene research is also related to the influence on the development of rice chloroplasts, and the gene research can be used for eliminating hybrid in the breeding process of hybrid rice and improving the purity of seeds. Specifically, the invention discloses a protein encoded by a rice plastid development regulatory gene FLN2, which is SEQ ID No: 3. The invention also discloses a gene FLN2 for coding the protein, wherein the gene FLN2 is SEQ ID No: 1 and 2. The gene can be used for constructing transgenic rice, and the color of leaves of the transgenic rice is improved.

Description

rice plastid development regulatory gene FLN2 and application thereof

Technical Field

The invention belongs to the field of plant genetic engineering. Specifically, the invention relates to a method for cloning rice FLN2 gene by using map-based cloning technology and identifying the function of the gene by using a transgenic complementation experiment; meanwhile, the gene research is also related to the influence on the development of rice chloroplasts, and the gene research can be used for eliminating hybrid in the breeding process of hybrid rice and improving the purity of seeds.

Background

Photosynthesis provides a material source and an energy source for the growth of rice, chloroplasts are important places for photosynthesis, and are carriers of photosynthetic pigments and widely distributed in green tissue cells of leaves. The development of the chloroplast of higher plants needs to be completed through a series of complex change processes, and the protein encoded by the nuclear gene and the protein encoded by the chloroplast are coordinated and involved. Under dark condition, the non-photosynthetic proplastid in the leaf develops into etiolated plastid, which contains latticed original sheet layer, and the etiolated plastid is continuously differentiated and developed to form chloroplast under illumination. The albino mutant of the rice discovered at present is usually related to the development defect of chloroplast, thereby influencing the photosynthesis of the rice and causing the yield reduction and even death of the rice. The root cause of the albinism of the rice leaf is genetic gene mutation in nucleus or cytoplasm, a plurality of genes related to the albinism of the rice are separated at present, and most of the genes are found to be trigonal pentapeptide repeat protein PPR family genes, most of proteins encoded by the genes are transported to plastids and mitochondria to be involved in regulating and controlling RNA splicing, RNA editing, translation and RNA stability in chloroplasts and mitochondria, and the genes also comprise NUS1 protein involved in regulating and controlling the RNA metabolism of the chloroplasts and ornithine kinase GK positioned in cytoplasm. RNA reductase containing ATP cone domain and RNR1 domain and Mi-2-like protein chromatin remodeling factor have also been identified to be involved in rice plastid development.

disclosure of Invention

The invention aims to provide a protein related to rice leaf color variation and a gene thereof, a transgenic plant cell obtained by the protein, and a method for modifying rice leaf color by using the gene.

In order to solve the technical problems, the invention provides a protein encoded by a rice plastid development regulatory gene FLN2, which is a protein represented by SEQ ID No: 3 (full length protein).

Improvement of the protein encoded by the rice plastid development regulatory gene FLN2 of the invention: the amino acid sequence is also included in SEQ ID No: 3, one or more amino acids or homologous sequences of other species are added, substituted, inserted or deleted in the amino acid sequence shown in the formula (3), and the obtained amino acid sequence or derivative is obtained.

the invention also provides a gene FLN2 for coding the protein, wherein the gene FLN2 is SEQ ID No: 1 and 2.

Namely, the gene FLN2 has the sequence shown in SEQ ID No: 1 and the full-length sequence of the cDNA shown in SEQ ID No: 2, and gDNA shown in (2).

Improvement of FLN2 gene according to the present invention: the nucleotide sequence is also included in SEQ id no: 1 and 2, and a mutant, allele or derivative thereof produced by adding, substituting, inserting or deleting one or more nucleotides in the nucleotide sequences shown in 1 and 2.

the invention also provides a plasmid containing the gene.

The invention also provides a plant expression vector containing the gene.

The invention also provides a host cell containing the gene sequence.

As an improvement of the host cell of the present invention: the cell is an escherichia coli cell, an agrobacterium cell or a plant cell.

The invention also provides the application of the gene: the method is used for constructing the transgenic rice, and the color of the leaves of the transgenic rice is improved (the color of the leaves of the rice is influenced, including the color of the leaves of the transgenic plants is recovered to be normal green, and the like), so that the method is suitable for various requirements of producers. The invention can utilize the gene to research the influence on the development of rice chloroplast, can solve the problem of hybrid elimination in the breeding process of hybrid rice and improve the purity of seeds. Namely, due to the discovery and application of the gene, people can directionally change the color of the leaves according to the needs of people, thereby meeting the requirements of practical production.

The invention also provides a method for improving the color of rice leaves and improving the photosynthetic efficiency, which comprises the following steps: comprises the use of a peptide having the sequence of SEQ ID No: 1 and 2, and then culturing the transformed rice cells into plants.

Further detailed description is as follows:

The invention aims to provide a novel gene FLN2 cloned from a rice albino mutant, which has the nucleotide sequence shown in SEQ ID No: 1 and the cDNA sequence shown in SEQ ID No: 2, and also includes a gDNA corresponding to SEQ ID No: 1 and SEQ ID No: 2, and a gene sequence having at least 70% homology with the DNA sequence shown in the sequence table 2. SEQ ID No: 3 belonging to phosphofructokinase analogous proteins, wherein one or more substitutions, insertions or deletions are made to obtain a functional analogue. In addition, also included in SEQ ID No: 1 and SEQ ID No: 2 by adding, substituting, inserting or deleting one or more nucleotides, and sequences with the same function can also achieve the purpose of the invention.

it is another object of the present invention to provide a method for efficient plant transformation with the FLN2 gene, in particular, the present invention provides a plant having the sequence of SEQ ID No: 1 and SEQ ID No: 2, wherein the vector can express a polypeptide encoded by the nucleotide sequence or a homologous analog thereof, such as pCAMBIA1300-FLN2 shown in fig. 4.

The invention also provides a method for transforming plant cells to influence the leaf color of rice by using the plant expression vector. In particular to a method for transforming plant cells by using a plant expression vector to influence the leaf color of rice.

the specific technical steps for realizing the invention are as follows:

First, the isolation and genetic analysis of the rice leaf albino mutant st 10:

The rice leaf albino mutant st10 is derived from mutation generated by Nipponbare (NIP) EMS (ethyl Methyl sulfonate) mutagenesis. The mutant exhibited a completely albino phenotype upon initial germination (FIG. 1A); after 3 leaves, the newly-extracted leaves start to turn green partially, and the tillering stage shows a phenotype of partial leaf whitening (fig. 1B); after the ear emergence period, 90% of the leaves returned to green, but the ear was white (fig. 1C). st10 the mutant is proved to be controlled by recessive monogene by orthogonal experiment with wild rice.

Secondly, cloning FLN2 gene for controlling rice albinism character in map position:

1) Primary localization of FLN2 gene:

In order to separate FLN2 gene, the invention firstly establishes a positioning population, which is hybridized with indica rice variety cultivar 64s (indica) by st10 to form an F2 positioning population (F1 generation obtained by hybridization is selfed to obtain F2), then uses molecular markers such as STS, SSR and the like to preliminarily position FLN2 locus by a map-based cloning method, preliminarily positions the FLN2 locus on the short arm of chromosome 3 and is between STR20 and STR15 STS markers, and is shown in figure 2.

2) Fine localization and gene prediction of FLN2 gene:

By analyzing BAC sequences between two markers of STR20 and STR15, new SSR and STS markers are developed to finely position FLN2 on BAC clone OJ1519_ A12 within 48-kb between STR11 and STR12 markers (FIG. 3B, C), and candidate genes are presumed by analyzing Open Reading Frames (ORFs) of the segment.

3) identification and functional analysis of the FLN2 gene:

To determine the mutant gene, we sequenced the 48-kb localization interval and showed that a possible base substitution in exon 5 of the gene encoding fragment-like protein 2(FLN2) resulted in a mutation of the 536 th amino acid of the FLN2 protein from tryptophan to the stop codon, resulting in an early termination of the protein coding (FIG. 3D, E, F), thus concluding that the mutant phenotype of albino mutant st10 was probably due to mutation of the FLN2 gene. The complementary vector shown in figure 4 is constructed for verifying the function of a candidate gene, the complementary vector is transferred into a mutant st10 by a transgenic technology, the result shows that the transgenic rice which enables the mutant to recover the normal phenotype is obtained (figure 5), the FLN2 gene is correctly cloned, and the amino acid sequence analysis shows that the FLN2 encodes the fructokinase analogous protein in pfkB family. In addition, because the protein coded by the gene has an effect on the development of chloroplasts, a subcellular localization vector shown in figure 6 is constructed, and the FLN2 protein is proved to be localized in the chloroplasts in the cells by a rice protoplast transformation technology.

The invention utilizes rice albino mutant st10, clones FLN2 gene in rice for the first time through map-based cloning technology, the gene codes fructokinase analogous protein in pfkB family, influences the development of proplastid and chloroplast in rice, but as glycolysis important rate-limiting enzyme-fructokinase analogous protein, how it plays a role in plant chloroplast development, how the response mechanism to environment after FLN2 mutation is, more research work is needed to clarify, through reading the function of FLN2 gene, enriches the molecular regulation mechanism of chloroplast development, and lays the foundation for researching the development of proplastid and chloroplast and the transformation mechanism of the proplastid and chloroplast of rice.

Chloroplasts are important sites for photosynthesis of plants and are widely distributed in leaf green tissue cells. Albino mutation is typically characterized in that chloroplast is dysplastic, most albino mutants lack chlorophyll and can not normally carry out photosynthesis, seedlings grow depending on endosperm nutrition in seeds, when nutrition is exhausted, plants die, and the mechanism of generating plant leaf color albino mutation is very complex, and the processes such as hormone regulation, nuclear-plastid genome interaction, plastid gene and interaction between genes and the environment are involved, so that the research on albino molecular mechanism only stays at the level of chlorophyll metabolism at present, and a more complex regulation mode is not clear. The albino-green mutant obtained by the invention is a special one of numerous albino mutants, shows albino character in seedling stage, but can restore green in new leaves in later development stage, so that the normal growth of the mutant is ensured. The invention clones related gene FLN2 in rice for the first time by map-based cloning technology, the gene codes fructokinase analogous protein, belongs to pfkB family, and influences the development of proplastids and chloroplasts in rice. By reading the function of the FLN2 gene, the method lays a foundation for deeply researching a chloroplast development mechanism, clarifying a molecular mechanism of plant photosynthesis system action and further laying a foundation for high photosynthetic breeding of rice.

In conclusion, the present invention utilizes the rice albino mutant st10, clones FLN2 gene in rice for the first time through map-based cloning technology, and the gene codes fructokinase similar protein in pfkb family, and affects the early development of plastid and chloroplast in rice. Through the functional interpretation of the FLN2 gene, the influence of FLN2 on the plastid development is further clarified, and a foundation is laid for the research of a molecular mechanism of proplastid-to-chloroplast transformation.

Drawings

the following describes embodiments of the present invention in further detail with reference to the accompanying drawings.

FIG. 1 shows the phenotypes of albino greening mutant st10 and wild type NIP (Nipponbare) at seedling stage, tillering stage and heading stage;

a: the rice albino-green-turning mutant st10 has a completely white phenotype with the seedling stage of a wild type NIP;

B: the phenotype that the rice albino greening mutant st10 and a wild type NIP have green reversion in tillering period;

C: the rice albino greening mutant st10 has a greening phenotype with the heading date of the wild-type NIP.

FIG. 2 is a preliminary mapping of FLN2 gene on rice chromosome 3.

FIG. 3 is a schematic diagram of the fine localization and mutation sites of FLN2 gene;

a and B are FLN2 gene fine localization intervals;

C, D, candidate gene exon and intron distribution and mutation site schematic diagram;

E, FLN2DNA sequence mutation site alignment;

F, aligning mutation sites of the FLN2 protein sequence.

FIG. 4 is a map of the complementary vector pCAMBIA1300-FLN 2.

FIG. 5 shows the phenotype and sequencing verification of transgenic rice plants of the T0 generation in functional complementation test;

From front to back are: st10 transgenic strain with empty vector; st10 transgenic complementation vector p1300-FLN2 transgenic strain; st10 close-up of transgenic leaves of the empty vector; st10 transgenic complementation vector p1300-FLN2 transgenic leaf features; st10 transgenic vector p1300-FLN2T0 transgenic strain sequencing results.

FIG. 6 shows the results of the construction of the sub-cellular localization vector of FLN2 and the transformation of protoplasts;

FIG. A: a pBI221FLN2 subcellular localization vector constructed by taking pBI221-GFP as a framework;

And B: FLN2 is localized in chloroplasts in cells; fig. B shows photographs taken under different viewing conditions.

FIG. 7 shows photosynthetic pigment contents of mutant st10 in the two-leaf stage of Nippon under high-temperature and low-temperature cultivation conditions;

The graph A is as follows: the st10 mutant has little difference from the wild type in the aspects of chlorophyll a, chlorophyll b, carotenoid content and the like under the culture condition of 24 ℃;

The graph B is as follows: compared with the wild type, the st10 mutant has obviously reduced contents of chlorophyll a, chlorophyll b and carotenoid under the culture condition of 32 ℃.

FIG. 8 shows TEM results of mutant and wild types;

the graph A is as follows: the development of the proplastids of control NIP and mutant st10 under different magnifications; the proplastid development of the mutant is inhibited;

the graph B is as follows: under different magnifications, the development of the chloroplasts of the NIP and the mutant st10 are contrasted, the mutant chloroplasts are abnormal, and the substrate layer disappears.

Detailed Description

example 1:

1. Rice material:

the rice (Oryza sativa L.) mutant st10, the original wild material was japonica rice variety "Nipponbare".

The rice albino greening mutant st10 is derived from mutation generated by mutagenesis of Japanese Qing EMS (ethyl Methyl sulfate) (shown in figure 1), and is obtained in Zhejiang province in China.

the mutagenesis mode is as follows: soaking and mutagenizing 1% EMS solution; the partially re-greened seedlings after albino 3 leaves at seedling stage were selected and identified as mutant st 10.

st10 this mutant was shown to be under recessive monogenic control by orthogonal experiments with indica varieties (i.e., indica cultivar dwarf 64 s). The results of the experiment were: 72 individuals were randomly selected from the M2 generation population for genetic analysis, 51 were wild type phenotype, 21 were mutant phenotype, chi square test results (chi 2 ═ 0.63< chi 20.05 ═ 3.84), segregation ratio was 3: 1, indicating that the mutant phenotype is controlled by a single recessive nuclear gene.

All plants of F1 generation, which are obtained by taking indica rice cultivar dwarf 64s as a female parent and st10 as a male parent through orthogonal crossing, show normal phenotype, and F1 generation is selfed to obtain F2 generation; four weeks after the seeds of the F2 generation were sown, 300 individuals were randomly selected, 215 of which exhibited the wild type phenotype and 85 exhibited the mutant type phenotype. The chi-square test result (chi 2 ═ 1.77< chi 20.05 ═ 3.84), the segregation ratio of the normal plant phenotype and the mutant plant phenotype is 3: 1; it was further demonstrated that this mutant phenotype is controlled by a recessive, single recessive nuclear gene.

2. analysis and localization of populations:

And (3) hybridizing the homozygous st10 mutant with wild indica rice cultivar dwarf 64s, and selfing the F1 generation to obtain an F2 population. And 2885 albino mutant individuals (recessive individuals) are selected from the population as a positioning population. About 0.2g of young leaves are taken from each plant in the trefoil stage to extract total DNA.

3. SSR and STS markers for locating FLN2 gene

The rapid extraction method of rice trace DNA is adopted to extract the genome DNA for gene localization from rice leaves. Approximately 0.2g of rice leaves were taken, frozen with liquid nitrogen, pulverized in a small mortar having a diameter of 5cm, transferred to a 1.5ml centrifuge tube to extract DNA, and the obtained DNA precipitate was dissolved in 150. mu.l of ultrapure water as a DNA sample. Mu.l of DNA sample was used for each PCR reaction.

Preliminary localization of FLN2 gene: selecting 30 recessive individuals from an F2 population combined by st10 and Mitsubishi 64s, selecting SSR primers approximately and uniformly distributed on each chromosome according to a published molecular genetic map created by japonica rice and indica rice, carrying out PCR amplification according to known reaction conditions, carrying out 5% agarose gel electrophoresis separation and Ethidium Bromide (EB) staining, detecting polymorphism of a PCR product, and preliminarily positioning FLN2 between two STS markers of a short arm STR20 and STR15 of a No. 3 chromosome (as shown in figure 2).

the PCR reaction system is as follows: a10. mu.l reaction included: 1. mu.l of DNA template; 10. mu.l of xPCR buffer 1. mu.l; dNTP (2.5mmol/l) 1. mu.l; primer F (2.5. mu. mol/l) 1. mu.l; primer R (2.5. mu. mol/l) 1. mu.l; 0.5. mu.l of rTaq polymerase from TAKARA; ddH2O 4.5. mu.l. And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 4 min; 30s at 94 ℃, 30s of annealing (the annealing temperature is different with different marks and is in the range of 48-60 ℃), and 30s of extension at 72 ℃; a total of 40 cycles; extending for 10min at 72 ℃, and keeping the temperature at 15 ℃. The reaction product is separated by 4% -5% agarose gel electrophoresis, and is observed under an ultraviolet lamp after being dyed by ethidium bromide.

Fine localization of FLN2 gene: selecting 2885 recessive individuals in an F2 population combined by st10 and Pedophyt 64s, further designing SSR and STS markers on the basis of initial positioning, finally accurately positioning FLN2 within a 48-kb range on a precise BAC with the number OJ1519_ A12, and marking the molecular markers at two sides as STR11 and STR12 primer sequences as follows:

STR11：F：GGAAGTAGCCCTGTCTCAAA，R：CCTTGAACCTGTGCTCCT；

STR12：F：GGTTACATCTCCTTTTCGTT，R：CTTTGTTTGCTGCCATCT；

Remarks explanation: as shown in FIG. 3, the primer sequences are shown in Table 1.

TABLE 1 location marker sequence of FLN2 Gene

Marke	Primers(5’to 3’)
				Sense	Anti-sense
CHL-8	GTTTTACCGATGGTTGATG	ATCGTGGATGCCTTTGGAG
			STR6	GCGAGTGTCTTCGTTTGTT	GACTTGTTCCACTCCACTCT
STR11	GGAAGTAGCCCTGTCTCAAA	CCTTGAACCTGTGCTCCT
			STR12	GGTTACATCTCCTTTTCGTT	CTTTGTTTGCTGCCATCT
STR15	GTCGCCCTCTCCTCCG	CGTCGTTGTAGTGGCTCTGT
			STR16	TCTAAAAGTGGATGACAAGGG	CCACGGCTAATGTTGTTT
STR17	TTTTCGTTAGCATCACTTTG	GCACACATTTCAAGATTCAA
			STR19	TCCATTGTCAAAAGGTAGG	TATTTGGTGAGTGGGATG
STR20	GCCACTTTCAATCTTATGC	AAATGTGAACCCGGACTA
			STR21	AGGCAGAGGAAGAAGGAG	TTTTTGGTGGACTGGAAG
STR22	CTTCTTCCGCCATTGTCT	GTTTTGTTTGGCTTGCTG
			STR24	GGACTAAGGAGCAACAGCC	CCCAACAACACCTACCACAT

Remarks explanation: CHL8, STR6, STR20, STR15, STR16 and STR17 are markers used for initial localization, and STR19, STR11, STR21, STR12, STR22 and STR24 are markers used for fine localization.

4. Gene prediction and comparative analysis:

from the results of the fine localization, a total of 7 candidate genes were found in this interval in the 48-kb range, as predicted by the Rice Automated Annotation System (http:// Rice GAAS. dna. affrc. go. jp). Based on the number of the remaining recombinant individuals of the two markers, sequencing primers of each gene are designed, and candidate genes are amplified from the genomes of st10 and the wild type variety respectively by a PCR method for sequencing analysis. The st10 mutant was found to have a 1-base substitution mutation at exon 5 of LOC _ Os03G40550 from G to A, which leads to premature termination of protein translation. This was verified in triplicate with different mutant individuals and individuals of mutant phenotype in the population, with the mutant site stably present (see Table 2 for sequencing primer sequences). Based on the gene annotation information (NCBI) of BAC clone OJ1519_ A12 sequence, this gene was predicted to encode a Fructokinase in the pfkB family, so we named it as the Fructokinase-like protein coding gene (Fructokinase-like protein 2) FLN2, which is 4534bp in length and contains 5 exons and 4 introns. The cDNA sequence of the gene FLN2 is shown as SEQ ID No: 1, the gDNA sequence is shown as SEQ ID No: 2, respectively. The amino acid sequence of the protein coded by the gene is shown as SEQ ID No: 3, respectively.

TABLE 2 sequencing primer sequences of FLN2 Gene

Example 2:

1. plant transformation:

Taking the genome of a japonica rice variety 'Nipponbare' as a template, designing primers F-5'-aaggtaccTGGCCCATATCTTAGCAGCTT-3' and R-5'-cctctagaGTATGGCCAGTTGACCACGA-3', PCR according to a target gene, wherein the amplification systems are as follows: 50 μ L of PCR reaction: template DNA (0.2. mu.g/. mu.L) 2. mu.L; 2 × PCR buffer 25 μ L; 2mmol dNTP (Roche) 10. mu.L; KOD FX (TOYOBO) enzyme (1U/. mu.L) 1. mu.L; 10 μ M Primer F3 μ L; 10 μ M Primer R3 μ L; ddH2O 6 μ L; the PCR amplification conditions were: pre-denaturation at 94 ℃ for 2 min; denaturation at 98 deg.C for 10s, annealing at 60 deg.C for 30s, and extension at 68 deg.C for 8 min; a total of 35 cycles; extending for 10min at 68 ℃, and keeping the temperature at 15 ℃. After PCR amplification, the DNA fragment of 7354bp was recovered and cleaved with KpnI and XbaI double enzymes, and then ligated with pCAMBIA1300(p1300), to obtain the complementary vector pCAMBIA1300-FLN2, which covers the entire genomic region of the ORF (i.e., contains the nucleotide sequence shown in SEQ ID No: 2), and also includes the ATG upstream 2029-bp promoter sequence and the TGA downstream 1208-bp terminator sequence (shown in FIG. 4). This plasmid was transformed into rice by electric shock method into Agrobacterium tumefaciens strain EHA 105. The mature mutant seeds are used for inducing callus, and after 3 weeks of culture in an induction culture medium, the vigorous growing callus is selected to be used as a transformation receptor. The rice calli were infected with EHA105 strain containing binary plasmid vector, co-cultured in the dark at 25 ℃ for 3 days, and then cultured on a selection medium containing 300mg/L hygromycin. Resistant calli (i.e., calli that can regenerate on a resistant medium) were selected and cultured on a pre-differentiation medium containing 250mg/L hygromycin under light at 25 ℃ for about 10 days. Transferring the pre-differentiated callus to a differentiation culture medium, and culturing at 25 ℃ under illumination until differentiation and seedling emergence are achieved, so as to obtain a resistance transgenic plant in about one month. The plants are identified and continuously observed, and compared with the mutants at the same time, the leaf color of the transgenic plants is recovered to be normal green, and is consistent with the Nipponbare phenotype transferred to the unloaded p 1300.

Remarks explanation:

The fragment of interest referred to above is the genomic region covering the entire ORF (i.e.comprising the nucleotide sequence shown in SEQ ID No: 2), as well as the 2029-bp promoter sequence upstream of the ATG and the 1208-bp terminator sequence downstream of the TGA.

Reference is made to Toki S., Hara N., Ono K, Onodera H, Tagiri A, Oka S., Tanaka H (2006) Early infection of culture with Agrobacterium crown high-speed transformation of Plant Journal 47: 969-.

through the transgenic technology, the results show that: the present invention obtained transgenic rice that restored the normal phenotype of the mutant (FIG. 5). Namely, the color of the leaf of the transgenic rice is improved.

2. Construction of rice subcellular localization vector

Primers were designed based on the sequence of FLN2cDNA (i.e., containing the nucleotide sequence shown in SEQ ID No: 1), 40550cds-221F: gcggatccATGCACCGAATGGCTTCTCTTC, 40550cds-221R: caaagcttCTCCACATATAAAAGCTCACTC, and NIP cDNA was used as a template for amplification, and the target fragment was double-digested with BamH I and Hind III and pBI221-GFP vector, followed by ligation, to obtain the subcellular localization vector pBI221FLN2 (shown in FIG. 6A).

3. Transformation of rice protoplast and localization observation of FLN2 green fluorescent fusion protein:

(1) Seedling stems and leaves of rice (NIP) seedlings growing for about 15 days are cut into pieces by a sharp blade on a plastic culture dish plate and transferred into 200ml of cleaned conical flasks (generally, about 60 plants of 20ml of enzymolysis liquid are used each time; the enzymolysis liquid is poured into the flasks in advance, and is reasonably distributed according to the size of the bottom of the flasks), and the amount of the enzymolysis liquid in each flask is not too large. Placing into a shaking table at 28 ℃ and 60-80rpm for 4-6 hours.

(2) Before the enzymolysis time is finished, preparing PEG 400040% solution, placing the solution in a 65-degree water bath kettle or dissolving the solution at room temperature, and taking out the solution to oscillate once when the solution is dissolved at 65 degrees.

(3) after the completion of the enzymatic hydrolysis, about 15ml of W5 solution was added to the bottle after the enzymatic hydrolysis. The crushed leaves are filtered by a steel filter screen with 300 meshes (or 400 meshes), and the protoplast after enzymolysis is collected by a clean plastic culture dish. And slowly pouring the protoplast into a 50ml centrifuge tube (or sucking the protoplast by using a gun head of a gun tip), weighing and balancing the protoplast by using a balance, putting the protoplast into a horizontal centrifuge, and fully collecting the protoplast at 150g for 5 min. After centrifugation, the supernatant was slowly aspirated.

(4) 1ml of W5 solution was added to the protoplast pellet, gently mixed and resuspended by gentle tilting, and then pipetted into a 2ml centrifuge tube using a pipette tip. At this point, a small amount of non-resuspended protoplast may be added to the 50ml centrifuge tube and dissolved in 1ml W5, pipetted into the previous 2ml centrifuge tube, 150g, 3min, and the supernatant removed.

(5) The MMG is used for resuspension, depending on the amount of protoplasts and the number of plasmids to be transferred, typically 100ul of diluted protoplasts (obtained in step 3 above) are added to each plasmid. Or slightly observing the yield and the number proportion of the intact individuals after enzymolysis by using a microscope, and then determining the MMG dosage according to the state of the protoplast.

(6) Plasmids for transformation were prepared at about 10-15ug or 10ul in 2ml centrifuge tubes.

Namely, two plasmids, "p 35s:: GFP" and "p 35s:: FLN2:: GFP" were transferred into protoplasts, respectively.

(7) 100ul of resuspended protoplast was added, then 40% PEG 110ul was added and mixed well.

(8) Standing at 28 deg.C in dark for 15 min.

(9) Sufficient (i.e., 5 times the volume of protoplasts) W5 was added to dilute, mix well, then centrifuge for 150g for 3min, remove the supernatant slowly, and wash once more with W5 (with losses in between, but without affecting the results). The resulting pellet was resuspended in W5 (filled with a 2ml tube), gently mixed, and transferred to a cell culture plate. Wrapping with tin foil paper, standing and culturing at 28 deg.C in dark place for 14 hr.

(10) After the culture time is finished, the protoplasts precipitated in each hole of the culture plate are gently mixed, the mixture is pipetted into a 2ml tube, then the centrifugation is carried out for 3min at 150g, the supernatant is removed, about 100ul of supernatant is reserved, and the protoplasts are resuspended.

(11) The photographs were observed by confocal microscopy.

the results showed that the positive control was expressed in all parts of the cell, indicating that the experimental expression system worked normally, the FLN2GFP fusion protein was specifically expressed in the chloroplast, and no expression was found in other parts, indicating that FLN2 is a protein localized in the chloroplast (fig. 6B). In FIG. 6B, "p 35s:: GFP" corresponds to "p 35s:: GFP" which was taken after transfer into protoplasts, i.e., a positive control; the expression "p 35 s:" FLN2: "GFP" corresponds to "p 35 s:" FLN2: "GFP" transferred into protoplast, and the photograph is taken, i.e. the result of cell localization of FLN 2.

remarks explanation: the formulation of the various solutions referred to above can be referred to Zhang et al A high level effective green tissue protocol system for transformed gene expression and student light chlorinated-related processes plant Methods 2011,7:30.

4. Photosynthetic pigment content determination:

NIP and mutants were cultured in a light incubator (Panasonic, MLR-352H-PC) in high and low temperature dark to the diphasic stage according to the following conditions: high temperature 32 deg.c for 10 hr and 30 deg.c for 14 hr; the temperature is low at 24 ℃ for 10 hours and at 20 ℃ for 14 hours; then, the cultivation conditions are as follows: high temperature 32 deg.C for 10 hr, and dark at 30 deg.C for 14 hr; high temperature 24 deg.C for 10 hr, and dark at 20 deg.C for 14 hr; the illumination intensity is 200 mu mol/m2.s, the culture is carried out until the four-leaf stage, the fourth leaf of the mutant and the wild type is taken out of the main vein, the fourth leaf is cut into segments of about 1cm, 0.2g is weighed and soaked in 10ml of 80 percent acetone, and the dark culture is carried out for 48 hours under the condition of 26 ℃. Measuring optical density values of chlorophyll a, chlorophyll b and carotenoid in ultraviolet spectrophotometer (DU800, BECKMAN COULTER) at 663nm, 645nm and 470 nm. After 3 times of repetition, the content of chlorophyll a (Chl a), chlorophyll b (Chl b) in each detected leaf is calculated according to the method of Amon (1949), and the content of carotenoid (Car) is calculated according to Wellburn (1994), wherein the calculation formula is as follows:

chl a＝(12.7×OD－2.69×OD)×V/W

chl b＝(22.9×OD－4.68×OD)×V/W

car＝(1000×OD×V/W－3.27×Chl a－104×Chl b)/198

wherein: v is the extract volume (10ml), W is the leaf mass 0.2g, OD663, OD645 and OD470 are the values of optical density read on a spectrophotometer in units: mg/g.

The results showed that the content of chlorophyll a, chlorophyll b, chlorophyll a + b, carotenoid and chlorophyll a/b ratio were slightly reduced, but did not change much in general, in the mutant cultured under low temperature conditions, compared to NIP (fig. 7A); compared with NIP, the content of chlorophyll a, chlorophyll B, chlorophyll a + B and carotenoid of the mutant cultured under the high-temperature condition is obviously reduced, the ratio of chlorophyll a to B is slightly increased (figure 7B), and the results show that the albino phenotype of the mutant st10d is caused by the deletion of chlorophyll and carotenoid, and the high-temperature condition delays the mutant from being green again in relation to the ambient temperature.

5. Preparing and observing a chloroplast transmission electron microscope:

(1) sampling proplastid: culturing the mutant and the NIP at 30 ℃ for 12 hours and 24 ℃ for 12 hours in a dark condition until the two leaves are reached, taking the mutant and the control NIP leaves, and cutting the mutant and the control NIP leaves into small pieces with the diameter of about 0.5-1 mm 3; chloroplast sampling: culturing the mutant and the NIP under the illumination condition at 30 ℃ for 12 hours and 24 ℃ for 12 hours until the two leaves are obtained, taking the mutant and the control NIP leaves, and cutting the mutant and the control NIP leaves into small pieces with the diameter of about 0.5-1 mm 3;

(2) fixing: the cut sample pieces were placed in a 2ml centrifuge tube, 2.5% glutaraldehyde solution (PH 7.2) was added, and vacuum was applied in the vacuum apparatus until the leaves completely subsided. Rinsing with 0.1M phosphoric acid for three times, and adding 1% osmic acid for fixation for 2-3 hours until the sample turns black;

(3) And (3) dehydrating: sequentially dehydrating with 50%, 70% and 90% ethanol solution, treating for 20 min at each concentration, treating with ethanol and acetone (1: 1) solution for 20 min at 4 deg.C in a refrigerator, and treating with pure acetone at room temperature for 20 min;

(4) And (3) infiltration: reacting the sample in a mixed solution of anhydrous acetone and embedding agent (3: 1) for 4 hours, treating the sample in the mixed solution of anhydrous acetone and embedding agent (1: 1) for 3 hours, and finally reacting the sample in pure embedding agent for 12 hours;

(5) Embedding: in the embedding box selected by the samples in the steps, the samples are treated at 37 ℃ overnight, at 45 ℃ for 12 hours and at 60 ℃ for 24 hours to obtain embedded samples;

(6) Slicing and photographing: the embedded samples were cut into ultrathin sections of about 60-70nm with a microtome, then the sections were stained with lead citrate solution for 10 minutes, followed by uranium acetate solution for 30 minutes, washed three times with double distilled water and then air dried, observed with a transmission electron microscope of the HitachiH-7650 type and selectively photographed in multiples.

the results show that NIP has full proplast development and regular arrangement, while st10 proplast development is obviously inhibited, the number is greatly reduced, and the shape is malformed (FIG. 8A); the observation results of chloroplasts showed that the number of chloroplasts in mesophyll cells of wild-type leaves was large, the chloroplast structure was complete, and the basal lamina layer in chloroplasts was aligned and compact, while the complete chloroplast structure was hardly seen in mutant leaves, and the very individual chloroplasts had their internal structure disordered and the arrangement of basal lamina layer could not be identified at all (fig. 8B). These results indicate that mutation of FLN2 gene results in a reduction in chloroplast number and structural disruption in the mutant.

Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

<110> institute of Rice research in China

FLN2<120> rice plastid development regulatory gene FLN2 and application thereof

<160> 3

<210> 1

<211> 1770

<212> cDNA

<213> Rice (Oryza sativa)

<400> 1

atgcaccgaa tggcttctct tcttctcccc ccgcagtttc tttgctccct gccttgtagt 60

accaactcaa tcaggagcca tttacattat aagccccact tcttgggaaa cattatgact 120

aagcctaaag ctaaaatgag gctgctcaac cgaaacgtaa gttccatggc aaagaagagc 180

tctcaagatg tagcagaagg ttcaagtgat gatgagagtg acggcgagac atcaaaaacc 240

aagaaaagag ctccgagacg tggaagaaag aaagccacca tacaagcatc agaaggggaa 300

acacaagaag gtcaagtgag cactgaagaa gatgaatccc ctgaagggac taagaaaata 360

aaaaggaggg gccgcaagaa agctgcaact actgcaagct catcggaaga gaaggacaaa 420

gcaaaagaac caaagaagag gggcagaaga aaagttaaga ctgtagagga attgagtgac 480

aatgaagggg aagatctggg tgaagatcta gtgccctcca atgacaggca ggagaaaatt 540

tcagcaaatg acctagaaag taaaatagca gcattgctat tagaagatac tgatgataat 600

gatattaaca atttaatccc tcttgtgtgc tgctttgggc ctgctaagta ctcatttatt 660

ccttctggaa gacctgctaa taggctgata gatcatgaaa ttcatgaggg aatgaaagac 720

atgttctggt ctccagatca atttgtaagg gcaccaggag gatcatcatc caatgttgct 780

cttgctttag cagcttctgg tggccgggtt gaattcatgg gaaaactagg cgatgatgat 840

tatggtcaaa gtacattata tcacttgaac gtcaatggag ttcaaactcg ggcaattaaa 900

atggaccctt cagcgtttac tgccatgtcc ttgatgaagg tcacaggtag gggtagcttg 960

aaaatgagct gtgctaaacc ttgtgcagag gattgttttg tccaaactga tatcaaccca 1020

gctgttttaa aagaggctaa gatgttttac tacaattctt cagctttgct tgagcccacg 1080

acacgatcat cattgtcgaa agcaattgag gtttccaaga aatttggtgg tgtaacattc 1140

tttgatctca atcttccact gccattatgg tcgtccagta aggagaccaa gtcacttgtc 1200

aaggaagcat gggaagctgc tgatattatt gaaatcacta agcaggaact tgagttcttg 1260

tgtggcatta aaccatctga gaaatttggt acgaaggata atgataaatc caaattcact 1320

cactacagcc cagaagttgt tacgaaattg tggcatgaaa atctcaaggt cctttttgtg 1380

acaaacggca cttctaagat tcattattac acaaaagagc atgatggctg ggttcgtggc 1440

acagaagatg caccaattac tcctttcacc ggtgacatgt cacaatcagg tgacgccatt 1500

gttgcagctc tgatgaagat gctggcaatt aaccctcacc tggtcactga caaggattac 1560

ttgcatactg caatgaaaca tgctattaca tgtggtgtca ttgaccagtg gttacttgca 1620

cgagaacgag ggttccttcc cagagaaaga gcagatccaa ccagtgaaca gtttggagtg 1680

agattcgtca cagagaagga ataccgtaca cttcctgatt ccatacatac agaggattca 1740

tcagagagtg agcttttata tgtggagtga 1770

<210> 2

<211> 4534

<212> gDNA

<213> Rice (Oryza sativa)

<400> 2

ctgctcagct ctgagcttct tcgtttgagg gattttcttc tcccgggagg cggaagaggc 60

gtaggcgagg attcttgtag gaatcctctc ctctccattg atgcaccgaa tggcttctct 120

tcttctcccc ccgcagtttc tttgctccct gccttgtagt accaactcaa tcaggtatgt 180

aatgcttcat ttttctgtgt aatgcagctt cttcttcttc ttcttctggt agtagctgat 240

atgagtgcgt gtggcgatct ctttcggatt gtttgagtcg ccaccatatg gatcctaggt 300

tagggaaggg aaaggagcag cacatggagt ggagattgtg gcatctttct ttggtcccaa 360

atttccaata gatcttgggt ctatgttttg tttcattttt tgataacaac tatttgattc 420

ttacaagatg aacaatatgt catcaaattg tgatgtgtac tcgatgaaat atatatatat 480

accgcttgta cctagccttg tctgaatatg ctcccacgtg gtatggtagc agcttcatat 540

ttgaatcgtg tgataacatt agttctatct tacattcact tattctttat tttttaacac 600

atcactactt acattatggt ttaaattcca acagttatta gtgacttgct tccgatgtgt 660

aatgtgcagg agccatttac attataagcc ccacttcttg ggaaacatta tgactaagcc 720

taaagctaaa atgaggctgc tcaaccgaaa cgtaagttcc atggcaaaga agagctctca 780

agatgtagca gaaggttcaa gtgatgatga gagtgacggc gagacatcaa aaaccaagaa 840

aagagctccg agacgtggaa gaaagaaagc caccatacaa gcatcagaag gggaaacaca 900

agaaggtcaa gtgagcactg aagaagatga atcccctgaa gggactaaga aaataaaaag 960

gaggggccgc aagaaaggta catcttgctt gcatattttc agtagagtac ttccttcaat 1020

aacttaagaa aaaaattatc gtaaaccctt agcaagtcat gacttctctc ctatgttgca 1080

gctgcaacta ctgcaagctc atcggaagag aaggacaaag caaaagaacc aaagaagagg 1140

ggcagaagaa aagttaagac tgtagaggaa ttgagtgaca atgaagggga agatctgggt 1200

gaagatctag tgccctccaa tgacaggcag gagaaaattt cagcaaatga cctagaaagt 1260

aaaatagcag cattgctatt agaagatact gatgataatg atattaacaa tttaatccct 1320

cttgtgtgct gctttgggcc tgctaagtac tcatttattc cttctggaag acctgctaat 1380

aggctgatag atcatgaaat tcatgaggga atgaaagaca tgttctggtc tccagatcaa 1440

tttgtaaggg caccaggagg atcatcatcc aatgttgctc ttgctttagc agcttctggt 1500

ggccgggttg aattcatggg aaaactaggc gatgatgatt atggtcaaag tacattatat 1560

cacttgaacg tcaatggagt tcaaactcgg gcaattaaaa tggacccttc agcgtttact 1620

gccatgtcct tgatgaaggt cacaggtagg ggtagcttga aaatgagctg tgctaaacct 1680

tgtgcagagg attgttttgt ccaaactgat atcaacccag ctgttttaaa agaggtaaag 1740

acgagtacat caaacaatat tttgattaca ccttatcctc tacaatatta tctattacta 1800

catggtttaa tgataaactg tatgcacact tgattggtct tgagaaaagt ttgtttgtgc 1860

catgcacatt gtggcaacaa taaattgttt aaatgttcac atggtaaagt tattttacta 1920

tgctgaccta tcattatgtt gtggtgcatt ttcttttgtc agagatgatt agttaatgaa 1980

agagtactac acggatcaga agatttgtat gtcacacatt gttttgttag ttataattaa 2040

tctggtatgg aaattttacc acataaaagc aaattttgtt gaataattct gttccttata 2100

cagttagaaa gattctattt ttctttatca caagaagagc ttgctaaagt gaagaagttg 2160

ctttcagctg atggcatatt atactgttta gatgtgcaat tcataattca gttgcaacat 2220

tgtttgcaat acagaagtca ttatatttat atcaaaagac ttaaggaaca actagggcta 2280

tactgctaaa ttaatgtact tgtccaaaaa gataataaga ggaaattact caactcgatt 2340

tctatcaatt caaacttgct atctattagt tgaccatgaa tgtgtcaaaa tgatactatg 2400

tactataaac aaatgggagg tttacctgtt ttcattgccg tgctttggta ggttcagaaa 2460

aagaagtaaa taaaacactt tcagttcaca actgtgcttt ttctacatgt ttgcacttag 2520

catggttatt ttttagtcag aagacacata aacctgtacc ataatgatct taattttttg 2580

taaaaaacct tttagcagtt agggcactac aagctgctct gtactggaac ttgttggata 2640

atatctttgc taatgctgaa tgtctgaaaa ttcccaaact caaaataata tgaacattaa 2700

aaagcaacta cttaaaatat taggtcccta tgggcaggcc atatctgaaa ttaggtaaat 2760

caaagatatc tacaatccct gaagaaaata ctgtccactt atgtgttata tcttatgtaa 2820

aaatcagttg tttctgtttg ttaatgcagg ctaagatgtt ttactacaat tcttcagctt 2880

tgcttgagcc cacgacacga tcatcattgt cgaaagcaat tgaggtttcc aagaaatttg 2940

gtggtgtaac attctttgat ctcaatcttc cactgccatt atggtcgtcc agtaaggaga 3000

ccaagtcact tgtcaaggaa gcatgggaag ctgctgatat tattgaaatc actaagcagg 3060

aacttgagtt cttgtgtggc attaaaccat ctgagaaatt tggtacgaag gataatgata 3120

aatccaaatt cactcactac agcccagaag ttgttacgaa attgtggcat gaaaatctca 3180

aggtcctttt tgtgacaaac ggcacttcta agattcatta ttacacaaaa gagcatgatg 3240

gctgggttcg tggcacagaa gatgcaccaa ttactccttt caccggtgac atgtcacaat 3300

caggtgacgc cattgttgca ggtactgcat ctgatgttct tttttttttc tacttctgca 3360

ggatatgcca ttttcattaa tgacaccaaa ggatagcaaa tgcatcatta catatgtgtt 3420

ctactttcat aaagcaggaa catacaaatt ctttcttggg agtagctata gaactgtcga 3480

cagtttttgg gatgaaaaac tttcaaatgt aactactata taattgcatt ataactacta 3540

tgtaactaat atgtaactga tatgtaaatc gagtgtaact caaaaaagca tgatggagca 3600

gctggttagt tgaacaaaca tccaagttgg aggtgttggg ttagatccct gctgcacgcg 3660

tctgattttt ttttcccgtt ttccttcacc agcacaaatc tcaaagcata ttagatggct 3720

taaaatttga aagttttcac ccctgttaac tgtcgacact agtatagcaa atccgttctt 3780

tcaaacactg tatacaagtt ttttttttta aaaaaattac agcttcagcc ttttatagct 3840

tatatcatca gatgccagca tgataataat ttagtgacac ttcattttgt gttcatgttt 3900

attttgtttg tgtatcttga actagctctg atgacatttt aatgtgttct tcagctctga 3960

tgaagatgct ggcaattaac cctcacctgg tcactgacaa ggattacttg catactgcaa 4020

tgaaacatgc tattacatgt ggtgtcattg accagtggtt acttgcacga gaacgagggt 4080

tccttcccag agaaagagca gatccaacca gtgaacagtt tggagtgaga ttcgtcacag 4140

agaaggaata ccgtacactt cctgattcca tacatacaga ggattcatca gagagtgagc 4200

ttttatatgt ggagtgaaca aagaaaatgc agaggcatgt aattttcaat agagggaaaa 4260

acctacagac atctggtgat ttttcttgaa gcaccattta tgggaactgc tgctcttaac 4320

tggagttggt atttagaaga actagttgta acctgcaggc tctaggttta ttttttaaca 4380

cagggtaata gcctcaagat aaactaacac atctgtattg tcaaattttg ggttaagatt 4440

ttgttgtaaa tgtgcatgat tatgggtgtc agaaattttt cctagaacag atggatgcta 4500

attatatatt tcactgcaac tccactattc tacc 4534

<210> 3

<211> 589

<212> PRT

<213> Rice (Oryza sativa)

<400> 3

Met His Arg Met Ala Ser Leu Leu Leu Pro Pro Gln Phe Leu Cys Ser Leu Pro Cys Ser

1 5 10 15 20

Thr Asn Ser Ile Arg Ser His Leu His Tyr Lys Pro His Phe Leu Gly Asn Ile Met Thr

21 25 30 35 40

Lys Pro Lys Ala Lys Met Arg Leu Leu Asn Arg Asn Val Ser Ser Met Ala Lys Lys Ser

41 45 50 55 60

Ser Gln Asp Val Ala Glu Gly Ser Ser Asp Asp Glu Ser Asp Gly Glu Thr Ser Lys Thr

61 65 70 75 80

Lys Lys Arg Ala Pro Arg Arg Gly Arg Lys Lys Ala Thr Ile Gln Ala Ser Glu Gly Glu

81 85 90 95 100

Thr Gln Glu Gly Gln Val Ser Thr Glu Glu Asp Glu Ser Pro Glu Gly Thr Lys Lys Ile

101 105 110 115 120

Lys Arg Arg Gly Arg Lys Lys Ala Ala Thr Thr Ala Ser Ser Ser Glu Glu Lys Asp Lys

121 125 130 135 140

Ala Lys Glu Pro Lys Lys Arg Gly Arg Arg Lys Val Lys Thr Val Glu Glu Leu Ser Asp

141 145 150 155 160

Asn Glu Gly Glu Asp Leu Gly Glu Asp Leu Val Pro Ser Asn Asp Arg Gln Glu Lys Ile

161 165 170 175 180

Ser Ala Asn Asp Leu Glu Ser Lys Ile Ala Ala Leu Leu Leu Glu Asp Thr Asp Asp Asn

181 185 190 195 200

Asp Ile Asn Asn Leu Ile Pro Leu Val Cys Cys Phe Gly Pro Ala Lys Tyr Ser Phe Ile

201 205 210 215 220

Pro Ser Gly Arg Pro Ala Asn Arg Leu Ile Asp His Glu Ile His Glu Gly Met Lys Asp

221 225 230 235 240

Met Phe Trp Ser Pro Asp Gln Phe Val Arg Ala Pro Gly Gly Ser Ser Ser Asn Val Ala

241 245 250 255 260

Leu Ala Leu Ala Ala Ser Gly Gly Arg Val Glu Phe Met Gly Lys Leu Gly Asp Asp Asp

261 265 270 275 280

Tyr Gly Gln Ser Thr Leu Tyr His Leu Asn Val Asn Gly Val Gln Thr Arg Ala Ile Lys

281 285 290 295 300

Met Asp Pro Ser Ala Phe Thr Ala Met Ser Leu Met Lys Val Thr Gly Arg Gly Ser Leu

301 305 310 315 320

Lys Met Ser Cys Ala Lys Pro Cys Ala Glu Asp Cys Phe Val Gln Thr Asp Ile Asn Pro

321 325 330 335 340

Ala Val Leu Lys Glu Ala Lys Met Phe Tyr Tyr Asn Ser Ser Ala Leu Leu Glu Pro Thr

341 345 350 355 360

Thr Arg Ser Ser Leu Ser Lys Ala Ile Glu Val Ser Lys Lys Phe Gly Gly Val Thr Phe

361 365 370 375 380

Phe Asp Leu Asn Leu Pro Leu Pro Leu Trp Ser Ser Ser Lys Glu Thr Lys Ser Leu Val

381 385 390 395 400

Lys Glu Ala Trp Glu Ala Ala Asp Ile Ile Glu Ile Thr Lys Gln Glu Leu Glu Phe Leu

401 405 410 415 420

Cys Gly Ile Lys Pro Ser Glu Lys Phe Gly Thr Lys Asp Asn Asp Lys Ser Lys Phe Thr

421 425 430 435 440

His Tyr Ser Pro Glu Val Val Thr Lys Leu Trp His Glu Asn Leu Lys Val Leu Phe Val

441 445 450 455 460

Thr Asn Gly Thr Ser Lys Ile His Tyr Tyr Thr Lys Glu His Asp Gly Trp Val Arg Gly

461 465 470 475 480

Thr Glu Asp Ala Pro Ile Thr Pro Phe Thr Gly Asp Met Ser Gln Ser Gly Asp Ala Ile

481 485 490 495 500

Val Ala Ala Leu Met Lys Met Leu Ala Ile Asn Pro His Leu Val Thr Asp Lys Asp Tyr

501 505 510 515 520

Leu His Thr Ala Met Lys His Ala Ile Thr Cys Gly Val Ile Asp Gln Trp Leu Leu Ala

521 525 530 535 540

Arg Glu Arg Gly Phe Leu Pro Arg Glu Arg Ala Asp Pro Thr Ser Glu Gln Phe Gly Val

541 545 550 555 560

Arg Phe Val Thr Glu Lys Glu Tyr Arg Thr Leu Pro Asp Ser Ile His Thr Glu Asp Ser

561 565 570 575 580

Ser Glu Ser Glu Leu Leu Tyr Val Glu ***

581 585 589

Claims (2)

1. the application of a rice plastid development regulatory gene FLN2 is characterized in that: the nucleotide sequence of the gene is shown as SEQ ID No: 1 or SEQ ID No: 2, the amino acid sequence of the protein coded by the gene is shown as SEQ ID No: 3, respectively.

2. A method for improving the color of rice leaves is characterized in that: comprises the nucleotide sequence shown as SEQ ID No: 1 or SEQ ID No: 2, and then culturing the transformed rice cells into plants.