WO2013023623A1

WO2013023623A1 - Isolation, cloning and application of pms3, a gene for photoperiod-sensitive genic male-sterility in rice

Info

Publication number: WO2013023623A1
Application number: PCT/CN2012/080385
Authority: WO
Inventors: Qifa Zhang; Jihua DING; Qing Lu
Original assignee: Huazhong Agricultural University
Priority date: 2011-08-18
Filing date: 2012-08-20
Publication date: 2013-02-21
Also published as: CN102952795A; CN102952795B

Abstract

Through a map-based cloning approach, a long-RNA -encoding gene for photoperiod-sensitive genie male sterility, pms3, which can regulate the pollen fertility in rice, is isolated. The nucleotide acid sequence of pms3 is a shown in SEQ ID NO: 2. The nucleotide acid sequence of its allele is shown in SEQ ID NO: 3, which contains an allelic mutation of C to G at position 790bp. A molecular marker for selectively breeding the genes for rice photoperiod-sensitive genie male sterility is also identified. SEQ ID NO: 1 represents the nucleotide acid sequence of this molecular marker, which contains a point mutation at position 4730bp. Uses of the said pms3 gene, its allele and molecular marker in breeding and genetic improvement of rice, especially in the production of new rice male sterile lines and the selective breeding of rice photoperiod-sensitive male sterile lines are provided.

Description

ISOLATION, CLONING AND APPLICATION OF PMS3, A GENE FOR PHOTOPERIOD-SENSITIVE GENIC MALE-STERILITY IN RICE

TECHNICAL FIELD

The present invention relates to the technical field of plant genetic engineering, in particular to the isolation and cloning of pms3, a gene for photoperiod-sensitive genie male sterility in rice, to the verification of its function, and to its application in the improvement of rice.

BACKGROUND ART

Rice is one of the major staple foods for the world's human population. As the world population increases and the cultivated land decreases, to improve the productivity and total output of rice has once become the objective for rice breeders and geneticists. The successful development and application of hybrid rice based on the "three-line system" using male-sterile-lme, maintainer-line, and restorer-line had been called "a great revolution" in the history of the breeding of rice. However, as the human population continuously increases and the standard of human life improves, the demand for crops production also increases. The drawback of three-line hybrid rice, namely the limited sources of the sterility-inducing cytoplasma, has gradually emerged as well, becoming a crucial factor impeding the further popularization and application of the three-line hybrid rice. In 1973, the photoperiod- and thermo-sensitive genie male sterile rice was first discovered by Mingsong Shi as a natural mutant of a japonica rice cultivar "Nongken 58", and was named "Nongken 58S" (Shi, Mingsong, The discovery and preliminary studies of the photoperiod-sensitive recessive male sterile rice. Sci. Agric. Sin., 1985, 2:44-48). Nongken 58S has been found to be male-sterile under long-day cycles and to be fertile in short-day cycles. Because of this remarkable characteristic, Nongken 58S can be used, under long-day and high-temperature conditions, as a male-sterile line to produce hybrid seeds; and it can also be self-pollinated, under short-day and low-temperature conditions, to produce sterile seeds. Therefore, the maintainer line, which used to be required to produce sterile seeds in the "three-line" system, is no longer necessary in the production of hybrid seeds, simplifying the conventional "three-line" system to a "two-line" system. Moreover, since Nongken 58 S produces fertile Fj progenies when crossed with other rice varieties, it gives the scientists more leeway in selecting a crossing partner for it. Therefore, the restoration of Nongken 58S fertility is not limited by the cytoplasmic genes, leading to a broader spectrum of restoring sources for Nongken 58S as compared with CMS rice. Therefore, isolating and cloning the gene responsible for the photoperiod- and thermo-sensitive male sterility, studying the mechanism of the gene's action, revealing the principles, and accordingly transforming it into desired genetic backgrounds will facilitate the development of desirable hybrid rice varieties, which can be applied in crops production and can improve the output of rice. SUMMARY OF THE INVENTION

The objectives of the present invention are to isolate and clone the gene for photoperiod-sensitive genie male sterility in rice— pms3, to verify its functions, and to apply it in the breeding of hybrid rice. The pms3 gene encodes a long non-protein-coding RNA (see Example 5). Implementation of information regarding this gene will significantly accelerate the breeding of desirable male-sterile lines, accelerate the development of two-line hybrids, and further increase the biological production of rice.

The present invention relates to the isolation and application of a ms^-containing DNA fragment and describes the mechanism of its function. The nucleotide acid sequence of a such DNA fragment is shown in SEQ ID NO: 1. The present invention relates to the isolation and application of a long-RNA-encoding gene for photoperiod-sensitive genie male sterility, pms3, which possesses a nucleotide acid sequence as shown in SEQ ID NO: 2, including any sequence having more than 90% homology to the nucleotide acid sequence as shown in SEQ ID NO:2, as well as any allelic variations or derivatives resulted from the insertion, substitution, or deletion of one or more nucleotides. An allele of this gene has a nucleotide acid sequence as shown in SEQ ID NO: 3 (allele pms3 gene).

The pollen fertility of the plant strains mutated in pms3 gene (allele pms3 gene) (for rice photoperiod-sensitive genie male sterility and as cloned in the present invention) is regulated by the length of photoperiod: the strains are completely sterile under long-day conditions, while they are partially or fully fertile under short-day conditions. Introducing the ?njjJ-containing DNA fragment from the mutated stains into a normal rice variety by genetic transformation may lead to pollen sterility in the normal rice variety (see Example 1). The allele pms3 gene and DNA fragment comprising the same thus may be utilized in the breeding of new male-sterile lines. The present invention relates to a molecular marker which is developed on the basis of the sequence information of the wijJ-containing DNA fragment and is useful in breeding rice photoperiod-sensitive genie male sterile lines. Comparative sequencing of the jwisi-containing region from wild type rice and photoperiod-sensitive mutant strains detected a single nucleotide substitution mutation in the mutant strains' pms3 gene (allele pms gene). Basing on this single nucleotide mutation, we developed a molecular marker useful in facilitating the breeding of hybrid rice (see Example 2). In the present invention, enhanced expression of pms3 gene can restore the pollen fertility in the photoperiod-sensitive genie male sterile lines. In constructing pms3 into a plant expression vector, a strong promoter or an inducible promoter may be added upstream to the transcription start site, rendering the overexpression or inducible expression of pms3 gene in male sterile varieties. This may artificially alter the pollen fertility of rice which can be utilized in rice breeding (see Example 4).

BRIEF DESCRIPTION OF THE DRAWINGS SEQ ID NO: l represents the nucleotide acid sequence of the pmsJ-containing DNA fragment that is isolated and cloned in the present invention (full length is 6440 bp; C has been mutated to G at position 4730 bp).

SEQ ID NO:2 represents the nucleotide acid sequence of pms3 gene that is isolated and cloned in the present invention (full length is 1236 bp; no intron, non-protein coding, the DNA sequence will be transcribed into an RNA that is functional).

SEQ ID NO:3 represents the nucleotide acid sequence of allele pms3 gene (full length is 1236 bp; no intron, non-protein coding, the DNA sequence will be transcribed into an RNA that is functional; corresponding to the "C" at position 790 bp of die nucleotide acid sequence represented by SEQ ID NO:2, SEQ ID NO:3 has an allelic mutation at position 790 bp— C has been mutated to G).

Fig.l . Schematic diagram of the complementation vector pCAMBIA1301. Fig.2. Complementation test of the function of pms3 gene. A: Comparison of the plant appearance of mature negative plant (left) and positive plant (right) in the S6K complementation test; B: Comparison of the fertility of spikelet from mature negative plant (left) and positive plant (right); C: Comparison of the appearance of flowers from flowering negative plant (left) and positive plant (right); D: Comparison of the appearance of anthers from flowering negative plant (left) and positive plant (right); E: Iodine stain of pollens from negative plant, bar = 50 H m; F: Iodine stain of pollens from negative plant, bar = 50 U m; G: Statistics of pollen fertility and spikelet fertility of Ti generation negative plants (-) and positive plants (+) (3 lines), numbers represent average value +/- standard error.

Fig.3. The molecular marker developed from Nongken 58 S mutant sequence. A: the principle of CAPS marker in the present invention; B: genotyping of CAPS marker in Nongken 58, Nongken 58S, and DH80;

C: genotyping of CAPS marker in 6 typical rice varieties and 42 wild type rice varieties, wherein the rice resources concerned in C are as follows (for particular origins, see "Disclosure Tables of Origins of Genetic

Resources", these genetic resources are not for the genetic uses of the present invention, but are only as controls of the tested materials):

1-Zhenshan 97; 2-Minghui 63; 3-Ribenqing; 4-Zhonghua 11; 5-Mudanjiang 8; 6-Nongken 58S;

7-Nongken 58; 8-DH80; 9-mPA64s; 10-IRGC 1012; 11-IRGC 1034; 12-IRGC 14619; 13-IRGC 17376;

14-IRGC 26977; 15-IRGC 27635; 16-IRGC 30346; 17-IRGC 53453; 18-IRGC 53454; 19-IRGC 66515;

20-IRGC 66528; 21-IRGC 66560; 22-IRGC 66627; 23-IRGC 66809; 24-IRGC 66813; 25-IRGC 66831 ;

26-IRGC 77144; 27-IRGC 73118; 28-IRGC 74730; 29-IRGC 76290; 30-IRGC 76404; 31-IRGC 77143; 32-IRGC 77144; 33-IRGC 77529; 34-IRGC 77636; 35-IRGC 77645; 36-IRGC 77665; 37-IRGC 78269;

38-IRGC 80180; 39-IRGC 81586; 40-IRGC 82097; 41-IRGC 84154; 42-IRGC 104921; 43-IRGC 113509;

44-IRGC 80622; 45-IRGC 81831; 46-IRGC 81845; 47-IRGC 81883; 48-IRGC 81915; 49-IRGC 81928;

50-IRGC 82037; 51-IRGC 83795.

The above Accession Numbers starting with "IRGC" refer to wild type rice varieties systematically numbered by International Rice Research Institute.

;A. Schematic diagram of the overexpression vector pCAMBIA 1301 A.

Fig.5. Phenotypes of transgenic plants overexpressing pms3 gene. A: Relative expression level of pms3 in single strain of Tj generation of wi55-overexpressing transgenic plants (top), and measurement of GUS marker (bottom); B: Statistics of pollen fertility and spikelet fertility of T] generation of negative plants (-) and positive plants (+) (3 lines), numbers represent average value +/- standard error. C: Comparison of the whole plant appearance of mature ^nwi-overexpressing transgene-positive and -negative plants; D: Comparison of the appearance of anthers from flowering >ms3-overexpressing transgene-positive and -negative plant, anther from negative plant is on the left, anther from positive plant is on the right; Bars = 0.5 mm. E: Comparison of the appearance of spikelet from msi-overexpressing transgene-positive and -negative plant, spikelet from negative plant are on the left, spikelet from positive plant are on the right; F: Comparison of pollen fertility of /?ms3-overexpressing transgene-positive and -negative plant, pollen from negative plant is on the top, pollen from positive plant is on the bottom; Bars = 50 μιη.

Fig.6. Analysis of the expression of pms3 in different organs of rice at all growth stages. No. 1-15 respectively represent different organs of rice in different growth stages: 1, root at the seedling stage; 2. leaf at the seedling stage; 3, leaf at the tillering stage; 4, leaf sheath at the secondary panicle branch differentiation stage; 5, stem at the pistil and stamen formation stage; 6, leaf at the secondary panicle branch differentiation stage; 7, leaf at the pistil and stamen fonnation stage; 8, leaf at the pollen mother cell formation stage; 9, flag leaf at the pollen mother cell mitosis stage; 10, young panicle at the secondary panicle branch differentiation stage; I I , young panicle at the pistil and stamen formation stage; 12, young panicle at the pollen mother cell stage; 13, young panicle at the pollen mother cell meiosis stage; 14, young panicle at the mitosis stage; 1 , spikelet at the heading stage.

Fig.7. Determination of the expression pattern of pms3 in rice by in situ hybridization. A: the gene is slightly expressed in the leaf sheath of Nongken 58; B: The gene is slightly expressed in the leaf of Nongken 58; C: The gene is expressed in the pollen mother cells of Nongken 58; D: The gene is expressed in the pollens of Nongken 58 at the meiosis stage; E: The gene is expressed in the vacuolated microspores of Nongken 58 after the meiosis stage; F: negative control, bar = 15μι^η.

Fig.8. Comparison of paraffin sections of anthers of Nongken 58 and Nongken 58S. A, B, C, D, E, and F illustrate the cross sections of anthers of Nongken 58 at the spore mother cell stage, the dyad stage of meiosis, the tetrad stage of meiosis, the microspore stage, the vacuolated pollen stage and the mature pollen stage, respectively; G, H, I, J, K and L illustrate the cross sections of anthers of Nongken 58S at the spore mother cell stage, the dyad stage of meiosis, the tetrad stage of meiosis, the microspore stage, the vacuolated pollen stage and the mature pollen stage, respectively.

English letters represent the structure of anther. E, epidennis; En, endothecium; ML, middle layer; T, tapetum; Ms, microsporocyte; Msp, microspore; Mp, mature pollen; Bars = 15μιη. DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to an isolated nucleic acid comprising, or consisting of, a nucleotide sequence as shown in SEQ ID NO. l , SEQ ID NO:2 or SEQ ID NO:3 or a variant sequence or fragment thereof as described below. The present invention also relates to a recombinant DNA construct, host cell or transgenic plant comprising the nucleic acid of the present invention.

The present invention generally is related to the use of an isolated long-RNA-encoding gene for photoperiod-sensitive genie male sterility, pms3 or allele pms3 gene, in the regulation of rice pollen fertility. Particularly, the gene for photoperiod-sensitive genie male sterility of the present invention comprises a nucleotide acid sequence as shown in SEQ ID NO: 2 or SEQ ID NO:3.

The present invention provides a method for producing a rice plant with photoperiod-sensitive genie male sterility, comprising transforming a rice plant with a DNA construct containing allele pms 3 gene and selecting resultant transgenic plants with photoperiod-sensitive genie male sterility, wherein the nucleotide sequence of said gene is shown in SEQ ID NO: 3. Preferably, in the method of the present invention, the DNA construct comprises a DNA fragment of SEQ ID NO.1. Preferably, in the method of present invention, the DNA construct is a recombinant expression vector. Preferably, in the method of the present invention, a callus of the rice plant is transformed and cultivated into a transgenic plant.

The present invention further provides a rice plant with photoperiod-sensitive genie male sterility, or cells or plant parts thereof. The rice plant with photoperiod-sensitive genie male sterility of the present invention can be obtained according to the method of the present invention as described above.

The present invention also relates to a recombinant DNA construct comprising the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:3, operably linked to a heterologous promoter functional in a plant; and a host cell comprising the recombinant DNA construct of the present invention. Preferably, the host cell of the present invention is a bacterial cell or a plant cell. More preferably, the host cell of present invention is a rice plant cell. In one aspect of the invention, it is provided with a rice plant cell transformed with a recombinant DNA construct comprising a nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:3.

The present invention also relates to the use of an allele of the pms3 of the present invention in the regulation of rice pollen fertility. Particularly, said allele pms3 comprises a nucleotide acid sequence as shown in SEQ ID NO: 3.

Particularly, the present invention provides a method for restoring pollen fertility of a rice plant with photoperiod-sensitive genic male sterility, comprising overexpressing in said plant a gene comprising a nucleotide sequence of SEQ ID NO:2. Preferably, in the method according to the present invention, the overexpression is achieved by transforming said plant with a recombinant DNA construct comprising a nucleotide sequence of SEQ ID NO:2. The present invention is also related to a molecular marker useful for detecting rice photoperiod-sensitive genic male sterile genes, wherein the molecule marker is a mutation of nucleotide C to G at a position corresponding to position 790 of SEQ ID NO:2, which is indicative of a gene of photoperiod-sensitive genic male sterility. Particularly, the molecule marker may comprise a DNA fragment of SEQ ID NO:3 containing the mutation at position 790 from C to G The marker as a DNA fragment can be for example of length of about 200bp, preferably at least about 300bp, about 500bp, 600bp or lOOObp. Preferably, the molecular marker comprises a nucleotide acid sequence as in shown in SEQ ID NO: 1 of the Sequence Listing or relevant fragment thereof.

The use of the molecular marker of the present invention in marker-assisted breeding of rice photoperiod-sensitive genic male sterile lines is another subject matter of the present invention.

Particularly, the present invention relates to a method of detecting a rice gene of photoperiod-sensitive genic male sterility, comprising amplifying a DNA fragment comprising the position corresponding to position 790bp of SEQ ID NO:2 or SEQ ID NO:3 from a rice sample by using primers designed based on the sequence of SEQ ID NO:2 or SEQ ID NO:3, where a nucleotide G at a position corresponding to position 790 of SEQ ID NO:2 or SEQ ID NO:3 is indicative of a gene of photoperiod-sensitive genic male sterility. Preferably, in the method of present invention, the presence of said nucleotide G is confirmed by treating the amplified DNA fragment with restriction enzyme Accl, wherein the absence of Accl cleavage fragments or fewer fragments than that is expected based on the genomic sequence comprising SEQ ID NO:2 is indicative of the presence of said nucleotide G at said position and then a gene of photoperiod-sensitive genie male sterility.

Based on the rice gene of photoperiod-sensitive genie male sterility represented by SEQ ID NO:2 or SEQ ID NO:3, similar genes or DNA sequences of photoperiod-sensitive genie male sterility can be easily obtained, e,g, by making at least one mutation on a nucleic acid of SEQ ID NO: 2 or SEQ ID NO: 3 and selecting a mutant having at least about 90% of sequence identity with SEQ ID NO:2 or SEQ ID NO:3 or capable of hybridization with a nucleic acid of SEQ ID NO:2 or SEQ ID NO:3 under high stringent condition and retaining the property of photoperiod-sensitive genie male sterility. As appreciated by one skilled in the art, if a small number of nucleotides of a gene is mutated such as by substitution, deletion and/or addition, for example keeping at least about 90% of sequence identity with SEQ ID NO:2 or SEQ ID NO: 3 or capable of hybridization with a nucleic acid of SEQ ID NO:2 or SEQ ID NO:3 under high stringent condition, in a majority of cases, the properties of the gene will be retained. Therefore, it will not involve undue experimentation for a person skilled in the art to prepare a variant of photoperiod-sensitive genie male sterility gene by mutating on SEQ ID NO.2 or SEQ ID NO:3. It will be appreciated that the nucleotide at position 790 of SEQ ID NO:2 or SEQ ID NO:3 will remain unchanged.

Therefore, the present invention also relates to a rice gene of photoperiod-sensitive genie male sterility obtainable or obtained by the method of the present invention as described above. Particularly, the present invention relates to a rice gene of photoperiod-sensitive genie male sterility comprising a nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:3 wherein one or more nucleotides are added, substituted by different nucleotide(s), or deleted, where the gene still retained the property of photoperiod-sensitive genie male sterility. In a preferred embodiment, the variant gene has at least about 90%, e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, of sequence identity with DEQ ID NO:2 or SEQ ID NO:3. In a preferred embodiment of the present invention, the vatiant gene is capable of hybridization with a nucleic acid of SEQ ID NO:2 or SEQ ID NO:3 under high stringent conditions (which is known in the art). In a preferred embodiment of the present invention, the variant gene has nucleotide C at a position corresponding to position 790 of SEQ ID NO:2. In a more preferred embodiment of the present invention, the variant gene has nucleotide G at a position corresponding to position 790 of SEQ ID NO:3. It will be appreciated that the embodiments of the present invention as described above are also applicable to other species of monocotyledonous plants such as com and wheat considering their similarity. The sequences of SEQ ID NO: l , SEQ ID NO:2 or SEQ ID NO:3 derived from rice can be used in transformation of other monocotyledonous species for the regulation of pollen fertility in such species such as corn and wheat. Preferably, pms 3 genes or allele pms 3 genes can be identified and isolated based on the sequences of the pins 3 genes drived from rice and disclosed herein. Therefore, a gene "corresponding" to that shown in SEQ ID NO: 2 or SEQ ID NO:3 refers to a pms 3 gene drived from rice or other species of monocotyledonous plants such as corn and wheat. As used herein, an "isolated nucleic acid" refers to a RNA or DNA molecule that is at least partially separated from other molecules normally associated with it in its native state. In one embodiment, the term "isolated" is also used herein in reference to a polynucleotide molecule that is at least partially separated from nucleic acids which normally flank the polynucleotide in its native state. Thus, polynucleotides fused to regulatory or coding sequences with which they are not normally associated, for example as the result of recombinant techniques, are considered isolated herein. Such molecules are considered isolated even when present, for example in the chromosome of a host cell, or in a nucleic acid solution. The tenn "isolated" as used herein is not intended to encompass molecules present in their native state. A nucleic acid is an "isolated" molecule if it occurs as a component of a transgene in a transgenic plant. Percent sequence identity between SEQ ID NO:2 or SEQ ID NO:3 and homologous variant sequences is determined by aligning the SEQ ID NO:2 or SEQ ID NO:3 polynucleotides with the variant to obtain the greatest number of nucleotide matches, as is known in the art, counting the number of nucleotide matches between SEQ ID NO:2 or SEQ ID NO:3 and the variant, and dividing the total number of matches by the total number of nucleotides of the SEQ ID NO:2 or SEQ ID NO:3 sequence. A preferred algorithm for calculating percent identity is the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty of 12, and gap extension penalty of 1.

Examples of high stringent hybridization conditions are overnight incubation in a solution comprising 50% formamide, 5 <SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5^xDenhardt's solution, 10% dextran sulfate, and 20

denatured, sheared carrier DNA such as salmon sperm DNA, followed by washing the hybridization support in 0.1 *SSC at approximately 65°C, e.g. for about 10 min (twice). Other hybridization and wash conditions are well known and are exemplified in Sambrook et al, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y. (1989), particularly chapter 11.

The techniques used to isolate or clone a polynucleotide encoding a polypeptide are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof. The cloning of the polynucleotides of the present invention from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligated activated transcription (LAT) and nucleotide sequence-based amplification (NASBA) may be used. The polynucleotides may be cloned from a strain of Myceliophthora, or another or related organism and thus, for example, may be an allelic or species variant of the polypeptide encoding region of the nucleotide sequence. Numerous methods for transfonning plant cells with recombinant DNA are known in the art and may be used in the present invention. Two commonly used methods for plant transformation are Agrobacterium-mediated transformation and microprojectile bombardment. Microprojectile bombardment methods are illustrated in U.S. Patents 5,015,580; 5,550,318; 5,538,880; 5,914,451; 6,160,208; 6,399,861 and 6,153,812 and Agrobacterium-mediated transformation is described in U.S. Patents 5,159,135; 5,824,877; 5,591 ,616; and 6,384,301 , all of which are incorporated herein by reference. For Agrobacterium tumefaciens based plant transfonnation system, additional elements present on transformation constructs will include T-DNA left and right border sequences to facilitate incorporation of the recombinant polynucleotide into the plant genome.

In general it is useful to introduce recombinant DNA randomly, i.e. at a non-specific location, in the genome of a target plant line. In special cases it may be useful to target recombinant DNA insertion in order to achieve site-specific integration, for example to replace an existing gene in the genome, to use an existing promoter in the plant genome, or to insert a recombinant polynucleotide at a predetermined site known to be active for gene expression. Several site specific recombination systems exist which are known to function implants include cre-lox as disclosed in U.S. Patent 4,959,317 and FLP-FRT as disclosed in U.S. Patent 5,527,695.

Transformation methods of this invention are preferably practiced in tissue culture on media and in a controlled environment. "Media" refers to the numerous nutrient mixtures that are used to grow cells in vitro, that is, outside of the intact living organism. Recipient cell targets include, but are not limited to, meristem cells, callus, immature embryos and gametic cells such as microspores, pollen. It is contemplated that any cell from which a fertile plant may be regenerated is useful as a recipient cell. Callus may be initiated from tissue sources including, but not limited to, immature embryos, seedling apical meristems, microspores and the like. Cells capable of proliferating as callus are also recipient cells for genetic transformation. Practical transformation methods and materials for making transgenic plants of this invention, for example various media and recipient target cells, transfonnation of immature embryo cells and subsequent regeneration of fertile transgenic plants are disclosed in U.S. Patents 6,194,636 and 6,232,526, which are incorporated herein by reference.

The seeds of transgenic plants can be harvested from fertile transgenic plants and be used to grow progeny generations of transformed plants of this invention including hybrid plants line for selection of plants having an enhanced trait. In addition to direct transformation of a plant with a recombinant DNA, transgenic plants can be prepared by crossing a first plant having a recombinant DNA with a second plant lacking the DNA. For example, recombinant DNA can be introduced into first plant line that is amenable to transformation to produce a transgenic plant which can be crossed with a second plant line to introgress the recombinant DNA into the second plant line, A transgenic plant with recombinant DNA providing an enhanced trait, e.g. enhanced yield, can be crossed with transgenic plant line having other recombinant DNA that confers another trait, for example drought resistance or pest resistance, to produce progeny plants having recombinant DNA that confers both traits. In the practice of transformation DNA is typically introduced into only a small percentage of target plant cells in any one transformation experiment. Marker genes are used to provide an efficient system for identification of those cells that are stably transfonned by receiving and integrating a transgenic DNA construct into their genomes. Preferred marker genes provide selective markers which confer resistance to a selective agent, such as an antibiotic or herbicide. Any of the herbicides to which plants of this invention may be resistant are useful agents for selective markers. Potentially transfon ed cells are exposed to the selective agent. In the population of surviving cells will be those cells where, generally, the

resistance-conferring gene is integrated and expressed at sufficient levels to pennit cell survival. Cells may be tested further to confirm stable integration of the exogenous DNA. Commonly used selective marker genes include those conferring resistance to antibiotics such as kanamycin and paromomycin (nptll), hygromycin B (aph IV) and gentamycin (aac3 and aacCA) or resistance to herbicides such as glufosinate {bar or pat) and glyphosate (aroA or EPSPS). Examples of such selectable are illustrated in U.S. Patents 5,550,318; 5,633,435; 5,780,708 and 6,118,047. Selectable markers which provide an ability to visually identify transfomiants can also be employed, for example, a gene expressing a colored or fluorescent protein such as a luciferase or green fluorescent protein (GFP) or a gene expressing a fteto-glucuronidase or uidA gene (GUS) for which various chromogenic substrates are known. Plant cells that survive exposure to the selective agent, or plant cells that have been scored positive in a screening assay, may be cultured in regeneration media and allowed to mature into plants. Developing plantlets regenerated from transformed plant cells can be transferred to plant growth mix, and hardened off, for example, in an environmentally controlled chamber at about 85% relative humidity, 600 ppm C0₂, and 25-250 microeinsteins nfV¹ of light, prior to transfer to a greenhouse or growth chamber for maturation. Plants are regenerated from about 6 weeks to 10 months after a transformant is identified, depending on the initial tissue. Plants may be pollinated using conventional plant breeding methods known to those of skill in the art and seed produced, for example self-pollination is commonly used with transgenic com. The regenerated transformed plant or its progeny seed or plants can be tested for expression of the recombinant DNA and selected for the presence of enhanced agronomic trait.

EMBODIMENTS

The following examples further define the present invention and describe die methods for isolating and cloning pms3 gene and for verifying the function of pms3 gene based on the preliminary work stated above. According to the following descriptions and examples, those skilled in the art can determine the basic technical features of the present invention, and can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention in order to adopt to various uses and conditions. .

EXAMPLE 1: ISOLATING AND CLONING A DNA FRAGMENT CONTAINING THE ENCODING REGION OF pms3 GENE

1. Identification of pms3, a gene for photo period-sensitive genie male sterility, by map-based cloning

Nongken 58S and DH80 were used as the parents in generating the mapping population of the gene in the present invention, wherein DH80 was developed by anther culture of F] plants from a cross between Nongken 58S and 1514 (reference for the origin of rice variety Nongken 58S: Li X., Lu Q., Wang R, Xu C, Zhang Q. 2001, Separation of the two-locus inheritance of photoperiod-sensitive genie male sterility in rice and precisely mapping the pms3 locus. Euphytica 119: 343-348). In locating the gene of the present invention, a Nongken 58S DH80 F₂ random population of 7000 plants was planted individually on the Experimental Farm of Huazhong Agricultural University in Wuhan, China. After two-year field study of fertility, 892 highly sterile individual plants were obtained (origin of rice: Nongken 58S/DH80 F₂: Lu Q., Li X., Guo D., Xu C, Zhang Q. 2005, Localization of pms3, a gene for photoperiod-sensitive genie male sterility, to a 28.4-kb DNA fragment. Mol Genet Genomics 273: 507-51 1). Fresh leaves were harvested from these highly sterile individuals and total DNA was extracted by using the conventional CTAB method, followed by enzymatic cleavage, film transfer, and molecular marker analysis in the pms3 region. DNA extraction was conducted by following the CTAB method described by Murray and Thompson (Murray M. G, Thompson W. F. 1980, Rapid isolation of high molecular weight plant DNA. Nucl Acids Res. 8: 4321-4325). RFLP analysis of the molecular marker, including DNA digestion, electrophoresis, Southern blotting, was conducted by following the protocol described by Liu et al. (Liu K et al. 1997, A genomic-wide analysis of wide compatibility in rice and the precise location of the S5 locus in the molecular map. Theor Appl Genet. 95:809-814). The pms3 gene was located within a region between molecular markers 237295/HAaI (self-named) and 148125L/177182R/-55i"BI (self-named), the physical distance between the two molecular markers is 12 kb. Results are provided in Table 1.

2. Construction of genetic transformation vector

We adopted complementary transformation and overexpression transformation to further verify the gene's function. In the present invention, the pollen fertility is regulated by a pair of alleles. In the summer of Wuhan under long-day conditions, Nongken 58 is fertile and Nongken 58S is completely sterile, whereas the spikelet fertility of hybrids of Nongken 58 and Nongken 58S are 50% or even less. Therefore, we could not directly determine the dominance/recessiveness relationship between the two alleles and had to adopt the bidirectional complementary transformation strategy to verify the gene's function. Complementary vector was constructed as follows: pCAMBIA1301 vector was used as the backbone vector. BAC of Nongken 58 (BAC No: 1 17H5) was first digested with Sad and Sail to obtain a 6440-bp-long gene fragment which located within the 12-kb region mentioned above. This gene fragment was then ligated into the pCAMBIA1301 vector to obtain N6 complementary transformation vector. N6 vector was subjected to single restriction enzymatic digestion with Kpnl and the vector was recovered. In the meantime, with the 58S DNA as template, PCR amplification was conducted using primers SNP-F1 and pms3-F4 to obtain an 18 2-bp long PCR product, the sequence of which was verified by TA clone-sequencing. The PCR product was then digested with Kpnl to obtain a 1477-bp long fragment, which was ligated with the recovered vector to obtain positive S6K clone. N6K differs from S6K by one SNP, otherwise the two constructs are identical and both are 6440 bp long (the DNA sequence of this fragment is shown in SEQ ID NO:l of the Sequence Listing, wherein at position 4730 bp, N6 has the nucleotide C, S6K has G).

Table 1. Results of Molecular Marker Analysis in Locating Regions on Recombinant Individual Plants (Partial Data)

5 H H H H A A A A A A A A

7 H H H H A A A A A A A A

19 H H H H A A A A A A A A

22 H H H H A A A A A A A A

3 H H A A A A A A A A A A

8 H H A A A A A A A A A A

1 H H A A A A A A A A A A

20 H H A A A A A A A A A A

17 H A A A A A A A A A A A

9 H A A A A A A A A A A A

29 H A A A A A A A A A A A

48 A A A A A A A A A A H A

33 A A A A A A A A A H H A

54 A A A A A A A A A H H A

Έ 63 A A A A A A A A A H H A

^'>

¾ 72 A A A A A A A A A H H A

74 A A A A A A A A A H H A

31 A A A A A A A A H H H A

35 A A A A A A A A H H H A

36 A A A A A A A A H H H A

40 A A A A A A A A H H H A

57 A A A A A A A A H H H A

65 A A A A A A A A H H H A

75 A A A A A A A A H H H A

76 A A A A A A A A H H H A

78 A A A A A A A A H H H A

80 A A A A A A A A H H H A

81 A A A A A A A A H H H A

52 A A A A A A A H H H H H

62 A A A A A A H H H H H H Note: A refers to band type of sterile parent; H represents band of heterozygosis

In the present invention, the binary vector pCAMBIA1301 (Fig. 1.) was obtained from the CAMBIA lab in Australia (Center for the Application of Molecular Biology to International Agriculture). The restriction enzymes and the alkaline phosphatase were purchased from TaKaRa Biotechnology (Dalian) Co, Ltd. and the ligase was purchased from Promega Co. For the methods of use and dosages of the enzymes, see the instructions from the manufacturers. By means of electrotransfonnation (the electrotransfonnation apparatus was purchased from Eppendorf Co.; the transfonnation voltage was set at 1800V; see the instruction from the manufacturer for specific directions), the ligation product was transfonned into E. coli DH10B (purchased from Promega Co.). The competent cells were then recovered for 30 min in 800μ1 LB media. Subsequently, 80μ1 media was plated on LA plate containing kanamycin, 5-bromo-4-chloro-3-indoIyl- -D-galactopyranose (Χ-β-gal), and isopropyl^-D-thiogalactoside (IPTG), and the plate was incubated in 37°C incubator for 14-16 hours (recipes of LA and LB: Sambrook, Molecular Cloning III, Science Press, Beijing, 2002). White single clones were selected and amplified in media. Plasmid was extracted and the sequence was verified by restriction enzyme digesting and sequencing to obtain the desired clones. The final constructs were transformed into Agrobacterium tumefaciens EHA105 (donated by the CAMBIA lab in Australia) by electrotransfonnation. The transfonned strains were named EHA105-pCAMBIA1301-N6K and EHA105-pCAMBIA1301-S6K, respectively. The primers used in the construction of the vectors are as follows:

SNP-F1 : 5'-ACTCAGATCATCCCATTCAC-3'

Pms3-F4: 5 ' -AC ATTGGATCTAGCGATTGG-3 '

3. Genetic transformation and the phenotype of the transgenic plant.

By using the Agrobacterium mediated genetic transfonnation approach, the strain EHA105-pCAMBIA1301-N6 was introduced into the callus of Nongken 58S and the strain EHA105-pCAMBIA1301-S6K was introduced into the callus of Nongken 58. The transgenic plants were obtained after precultivation, infestation, co-culture, screening for callus with hygromycin B (an antibiotic used in screening positive transgenic callus, purchased from Beijing Yuanpinghao Biotechnology Co. Ltd.) resistance, differentiation, rooting, seedling training and transplanting into the field (the reagents and recipes used in the Agrobacterium mediated genetic transfonnation were optimized based on the method reported by Hiei, et al (Hiei, Y., Ohta, S., omari, T., and Kumashiro, T. 1 94, Efficient transformation of rice (Otyza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6, 271-282. Lin, Y., and Zhang , Q. 2005, Optimizing the tissue culture conditions for high efficiency transformation of indica rice. Plant Cell Rep 23, 540-547), or based on the methods reported in Applicants' prior patent, Patent No. ZL200710053552.9 (Entitled "isolation, cloning, and application of the wide-compatibility gene S5 in Rice" filed on 2007-10-15, published on 2008-06- 18 with publication No.: CN101200725 and issued on 2010-04-21)).

The results of the present example demonstrated that, a T₀ population of totally 25 individual transgenic plants was obtained by introducing the complementary vector— pCAMBIA1301-N6K— into the callus of Nongken 58S through the Agrobacterium mediated method. Under long-day conditions, positive examination and study of pollen fertility were conducted on these transgenic plants (GUS marker was used in the positive examination, the primers are: GUS 1.6F: 5 '-CCAGGCAGTTTTAACG ATC AGTTCGC-3 ' ; GUS 1.6R: 5 ' -GAGTGAAGATCCCTTTCTTGTTACCG-3 ') . The average positive rate of iodine staining of the 19 positive plants was 3.7%, while the average rate of the 6 negative plants was 2.1%. t test indicated that there was no significant difference of pollen sterility between the positive plants and the negative plants (i=0.77, =0.2233), which means that transfonning Nongken 58S with the genomic DNA fragment N6K of Nongken 58 cannot result in the restoration of the fertility in Nongken 58S. On the contrary, introducing the complementary vector— CAMBIA1301-S6K— into the callus of Nongken 58 through the Agrobacterium mediated method rendered a T₀ population of totally 43 individual transgenic plants. Using the same method, positive examination was conducted on these transgenic plants under long-day conditions. 36 positive plants and 7 negative plants were obtained. The study of spikelet fertility on the T₀ generation of these transgenic plants indicated that, the average seed setting rate of the negative plants was 89.0%, while the average seed setting rate of the positive plants was 56.1 %. t test indicated that there was very significant difference of pollen sterility between the transgene-positive plants and -negative plants (t=-63, =0.0000). Three Ti families randomly selected from T₀ plants with single-copy transgene were further planted. There was perfect co-segregation between the transgene and pollen fertility: all positive plants were sterile and all negative were nonnal (Fig.2.). The above results demonstrate that transfonning Nongken 58 with the genomic DNA fragment S6K from Nongken 58S can decrease the pollen fertility of Nongken 58.

The results of the genetic transformations demonstrate that the ^mii-containing DNA fragment from the sterile Nongken 58S can reduce the pollen fertility of Nongken 58.

EXAMPLE 2: THE IDENTIFICATION OF A MOLECULAR MARKER FOR PHOTOPERIOD-SENSITIVE GENIC MALE STERILITY

The physical distance between LJ25 and LK40 is 28 kb. Applicants conducted comparative sequencing analysis of Nongken 58, Nongken 58S, and DH80, and found that there was only one single nucleotide substitution between the fertile line Nongken 58 and the sterile line Nongken 58S in the 28-kb region: the basic group C in Nongken 58 is changed to G in Nongken 58S. Applicants took advantage of this single nucleotide mutation and developted it as a CAPS (Cleaved Amplified Polymorphic Sequence) marker. The mutation of C in Nongken 58 and DH80 (TTTGTCTACCA to G in Nongken 58S (TTTGTGTACCA) results in the loss of the recognition site of the restriction enzyme Accl (GTMKAC). PCR was conducted on the three rice varieties using a pair of primers flanking the above sequence: 210225F (CAGTAGGGACACTTGTATCCA)/210225 R (TGC ACCGTGCAAATGTACC A) . PCR products were digested with Accl and then examined by gel electrophoresis (Fig.3. A), The results of the enzymatic digestion demonstrate that, since there lies an Accl site in the fragments from Nongken 58 and DH80, the PCR products were cleaved into two pieces of 451 bp and 920 bp; whereas the PCR product from Nongken 58S could not be cleaved, resulting in one 1371 bp band on the gel (Fig.3. B). The recipe of PCR reaction is as follows: DNA template 1 μΐ, lOxbuffer 1.5 μΐ, 2 mM dNTP 1 μΐ, 25 mM MgCl₂ 1.2 μΐ, 10 μΜ primers (F/R) 0.2 μΐ each, rTaq polymerase 0.2 μΐ (TaKaRa 5 u/μΐ), add ddH₂0 to 1 μΐ. The PCR program: 94 °C 5 min; 94^"C 45 sec, 59°C 45 sec, 72^°C 1 min 30 sec, 32 cycles; 72^°C 5 rain; 25°C store. Enzymatic digestion reaction: PCR product 15 μΐ, 10xM buffer 1.7 μΐ, Accl 0.2 μΐ (TaKaRa Biotechnology (Dalian) Co., Ltd, 10 u/μΐ), dd¾0 0.1 μΐ. 37^°C digestion 2 hr or overnight. PCR product and digestion product were examined by 1.0% agarose gel.

To verify that this SNP is specific to Nongken 58S, Applicants selected 6 typical rice varieties and 42 wild type rice varieties (for origins of the materials, See supra "Brief Description of the Drawings", Fig.3.) and detected them using the CAPS marker. The results demonstrated that only mPA64S has the identical genotype to Nongken 58S, whereas all the other varieties have the same genotype with 58N. Intriguingly, mPA64s is a photoperiod-sensitive genie male sterile line resulted from the cross between Nongken 58S and a japonica rice cultivar (Fig.3. C). Therefore, the CAPS marker developed from the single nucleotide difference between Nongken 58 and Nongken 58S will facilitate the breeding of new photoperiod-sensitive genic male sterile lines and the development of photoperiod- and thenno-sensitive male sterile line ("two-line") hybrids.

EXAMPLE 3: THE ISOLATION OF FULL-LENGTH cD A OF pms3

The above results resolved the locus of the photoperiod-sensitive genic male sterile gene pms3 to a

12-kb region between two molecular markers, 237295/H l and 148125L/177182R/¾rBI. Software RGAP {http://rice.plantbiolgoy.msu.edu ) was employed to predict genes located within this 12-kb region, but revealed no complete gene predicted in this region. To obtain the pms3 gene, Applicants designed a series of primers surrounding the SNP and conducted PCR using cDNAs from young panicles of Nongken 58 as template. Applicants found that new transcripts exist in this region which was unpredictable by the software. To obtain the candidate of full-length pms3 cDNA, the present invention further used the SMART™ RACE cDNA Amplificaiot Kit produced by Clontech Co. Young panicles from Nongken 58 and Nongken 58S at the pollen mother cell formation stage were collected, frozen in liquid nitrogen, and stored at -70 °C . Total RNA was extracted according to the instruction of TRIZOL kit and was stored at -70 °C before use. The step of reverse transcription was performed according to the instruction of the kit with a slightly modified. First round PCR system: reverse transcription template 1 μΐ, 2*GCI buffer 10 μΐ, 2 mM dNTP 2 μΐ, 10* UPM 2 μΐ, 10 μΜ GSP1 0.5 μΐ, LA Taq polymerase 0.2 μΐ (TaKaRa 5 u μΐ), add ddH₂0 to 20 μΐ. First round PCR program: 94°C 3 min; 94 ^°C 30 sec, 72^"C 3 min, 5 cycles; 94^"C 30 sec, 67^°C 3 min, 32 cycles; 67°C 5 min; 25 ^°C store. Second round PCR system: 50xdilution of the product of the first round PCR as the template 1 μΐ, 2xGCI buffer 10 μΐ, 2 mM dNTP 2 μΐ, 10 μΜ NUP 0.5 μΐ, 10 μΜ GSP2 0.5 μΐ, LA Taq polymerase 0.2 μΐ (TaKaRa Biotechnology (Dalian) Co., Ltd, 5 u/μΐ), add ddH₂0 to 20 μΐ. Second round PCR program: 94'C 5 min; 94^°C 45 sec, 59^"C 45 sec, 72^°C 3 min, 35 cycles; 72^"C 5 min; 25°C store. The DNA band was excised from the gel and the amplification product was extracted. The product was then constructed into the pGEM-T vector (purchased from Promega Co.). The construct was transformed into E. coli and the extracted plasmid was verified by sequencing. Accoding to the RACE and PCR amplification results, applicants finally determined that pms3 was 1236-bp in length with no intron. The nucleotide sequence of pms3 gene from the Nongken 58 (fertile) is shown in SEQ ID NO:2 and the nucleotide sequence of pms3 allele gene from Nongken 58S (sterile) is shown in SEQ ID NO:3. The references and sequences of related primers are as follows:

5' UTR: pms3-R : 5 '-AACATGGCATGAGCACTGGA-3 '

210214R: 5 '-GGAAGAACCATGGACGAACA-3 '

pms3 -R6 : 5 ' -CC AAGCTCTAGCTGCTCTAC-3 '

3' UTR:

225240F: 5 '-CTGAGTTGGATGTGCAACCA-3 '

SNP-R1 : 5 '-ACAAGACTATTTCATAGCACCT-3 ^!

Primers provided by the Kit:

UPM-long: 5'-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3¹ UPM-short: 5 '-CTAATACGACTCACTATAGGGC-3 '

NUP: 5 ' -AAGC AGTGGTATC AACGC AGAGT-3 ' .

EXAMPLE 4: THE CONSTRUCTION OF pms3 OVEREXPRESSION VECTOR AND THE PHENOTYPES OF TRANSGENIC PLANTS

In the present example, Applicants constructed the overexpression vector of pms3. The detail protocol of the vector construction is showed as follows: According to the obtained full-length cDNA sequence of pms3 (DNA sequence of this gene is shown in SEQ ID NO:2), a pair of PCR primers was designed:

OSNPF (GTTGGATCCGTATCAGAAGCTACAACATGT)/ OSNPR

(AGGCTGCAGCTGAGTAGGAAAATCATCTGA). Using the reverse transcription cDNA of the RNA extracted from the young panicles of Nongken 58 as the template, the pms3 gene was amplified and double digested with B mHl and Pstl. The digestion product was then ligated into the binary vector pCAMBIA1301A (Fig.4.)- pCAMBIA1301A was developed by Xiao, Benze et al using pCAMBIA1301 as the backbone (Xiao B, Huang Y, Tang N, Xiong L. 2007, Over-expression of a LEA gene in rice improves drought resistance under the field conditions. Theor Appl Genet 115: 35-46). The promoter of the rice actin gene was constructed into the pCAMBIA1301 vector so that the constitutive expression of the target gene would be driven by the actin promoter. Genetic transformation was conducted using the callus of Nongken

58S as the recipient. The procedure of genetic transformation is identical to that of complementary transformation provided above. A T₀ generation of totally 26 transgenic plants was obtained and the GUS marker was used in confirming the genotype of these plants. The seed-setting rate of these plants was then examed under the long-day conditions in the natural field in Wuhan, Hubei. The average spikelet fertility of

1 positive plants was 48.7%, whereas the average spikelet fertility of 7 negative plants was 2,9%. Statistic analysis indicated that the difference of the spikelet fertility between transgene-positive and -negative plants was highly significant (f=6 , ^=0.0000). T, families were randomly chosen for further examination. Similarly, there was a perfect co-segregation between the transgene and pollen fertility. All positive transgenic plants produced noraial pollen grains and were fertile, while negative plants produced smaller anthers and were highly sterile (Fig.5).

Overexpression analysis of pms3 demonstrates that die enhanced expression of pms3 can recover the pollen fertility of Nongken 58S under long-day conditions.

EXAMPLE 5: THE PHOTOPERIOD-SENSITIVE GENIC MALE STERILE GENE pms3 ENCODES A LONG NON- CODING RNA

To further study the molecular mechanism of pms3, Applicants analyzed pms3 with bioinformatics approaches. Applicants discovered that the gene could only be predicted encoding a short peptide containing 77aa, which has no homolog in known proteins. Therefore, Applicants predicted that pms3 does not encode a protein but functions as RNAs. Applicants proved this hypothesis by genetic transformation experiment. First, the start codon of the peptide presumably encoded by pms3 was mutated from ATG to CTG according to following steps: First, designed primers ASNPF (TTCTTTCATCAAATTGCCTGCTTCACCAGCACGTCCATATTGAAT) and ASNPR

(ATTCAATATGGACGTGCTGGTGAAGCAGGCAATTTGATGAAAGAA); then, using cDNAs from young panicles of Nongken 58 as template, two partial fragments of pms3 was amplified using the primer pairs OSNPF/ASNPR and ASNPF/OSNPR, respectively; the resulted PCR products were mixed and used as a template, followed by PCR with a pair of primer OSNPF/OSNPR. The PCR system was: DNA template 1 μΐ, lOxbuffer 1.5 μΐ, 2 mM dNTP 1 μΐ, 25 mM MgCl₂ 1.2 μΐ, 10 μΜ primers (F/R) 0.2 μΐ each, rTaq polymerase 0.2 μΐ (TaKaRa Biotechnology (Dalian) Co., Ltd. 5 u/μΐ), add ddH₂0 to 15 μΐ. PCR program: 94 ^°C 5 min; 94 ^"C 45 sec, 59 "C 45 sec, 72 ^°C 1 min 30 sec, 32 cycles; 72 °C 5 min; 25 "C store. The resulted PCR product was double digested with Bam l and Pstl. The digestion product was then ligated into the binary vector pCAMBIA OlA (Fig.4.). In accordance with the procedure of genetic transformation provided in Example 1, the pms3 gene mutated with the predicted start codon was overexpressed in Nongken 58S. Totally 22 T₀ transgenic plants were obtained. Positive test and spikelet fertility examination were performed on these plants. The average seed-setting rate of 14 positive plants was 43.6%, whereas the average seed-setting rate of 8 negative plants was 2.9%. Statistic analysis indicated that the difference of the spikelet fertility between transgene-positive and -negative plants was highly significant (/=-3.7, P=0.0000). Therefore, mutating the predicted start codon of pms3 did not affect its function in recovering the spikelet fertility of Nongken 58S under long-day conditions. These results suggested that pms3 may not encode a protein but a long non-coding RNA.

EXAMPLE 6: EXPRESSION ANALYSIS OF THE PHOTOPERIOD-SENSITIVE GENIC MALE STERILE GENE pms3

The present example analyzed the expression profile of pms3. Different tissues were collected from Nongken 58 and Nongken 58S. Total RNA was extracted using the Trizol kit produced by Invitrogen Co. The RNA extraction was conducted by following the instruction of the kit. Reverse transcription of RNA was conducted with DNase I and the reverse transcriptase Superscript™ III from Invitrogen Co, in accordance with the instruction of the kit. Using the product of the reverse transcription as template, PCR was performed to examine the expression of pms3 in different tissues as follows: cDNA template 1 μΐ, 2xGC I buffer 7.5 μΐ, 2 mM dNTP 1 μΐ, 10 μΜ primers (SNP-F5/SNP-R1 or UBQFl/UBQRl) 0.2 μΐ each, rTaq polymerase 0.2 μΐ (TaKaRa Biotechnology (Dalian) Co., Ltd, 5 u/μΐ), add ddH₂0 to 15 μΐ. The PCR program: 94 V 5 min; 94°C 30 sec, 59^°C 30 sec, 72°C 1 min, 3(pms3)/21(Ubiquitin. UBQ) cycles; 72^°C 5 min; 25 ^°C store. PCR products were examined by 2% agarose gel. The results demonstrate that, pms3 is expressed in every tissue with obviously increased level in the young panicle of growing rice (Fig.6.). The references and sequences of primers used in the expression analysis are as follows:

SNP-F : 5 ' -TAGAGTATCTGAACTGCGTGTTG-3 '

SNP-R1 : 5 ' -AC AAGACTATTTC ATAGC ACCT-3 '

UBQF 1 : '-GAAGAAGTGTGGTCACAGCA-3 '

UBQR1 : 5 ' -GAGATAAC AACGGAAGCATAA-3 '

To further reveal die expression pattern of pms3, the present example employed in situ hybridization. The signals of the RNA hybridization probe demonstrate the trace of pms3 in leaf and remarkable expression of p s3 in microspore mother cells and microspores (Fig.7.). Protocol of RNA in situ hybridization is provided in Drews' publication (Drews G.N. 1998, In situ hybridization. Methods Mol Biol 82:353-71).

EXAMPLE 7: CYTOLOGICAL OBSERVATION OF THE ANTHER DEVELOPEMENT IN NONGKEN 58 AND NONGKEN 58S. Flowers in different differentiation stages were collected from Nongken 58 and Nongken 58S. The flowers were first fixed in 50% FAA fixing solution (formaldehyde : glacial acetic acid : 50% ethanol = volume ratio 5:5:90) for 24 hours, then dehydrated through serially concentrated alcohol, followed by xylene wash and paraffin gradient, and finally embedded in 100% paraffin. A paraffin microtome was used to obtain cross-sections of the anthers with a thickness of 8 μιη. Anther sections were then placed on slides and incubated in 37°C incubator for 24 h, and were deparaffinized through gradient, followed by mounting. A LEICA fluoresce microscope (Leica DM 4000B) was used for observation and photography.

The results demonstrate that, during the differentiation of anther in Nongken 58S, the degeneration of tapetum cells starts earlier and proceeds more slowly, leading to a delayed consummation of tapetum degeneration (Fig.8.). Therefore, the observation of paraffin sections indicates that the pollen sterility of Nongken 58S is the result of abnormal degeneration of tapetum in the anthers.

Claims

What is claimed is:

1. A method for producing a monocotyledonous plant with photoperiod-sensitive genic male sterility, comprising transforming a monocotyledonous plant with a DNA construct containing an allele pms 3 gene and selecting resultant transgenic plants with photoperiod-sensitive genic male sterility, wherein the nucleotide sequence of said gene corresponds to that shown in SEQ ID NO: 3.

2. The method of claim 1 , wherein said DNA construct comprises a DNA fragment of SEQ ID NO.1.

3. The method of claim 1 or 2, wherein said DNA construct is a recombinant expression vector.

4. The method of claim 1 , wherein a callus of the monocotyledonous plant is transformed and cultivated into a transgenic plant.

5. The method of any one of claims 1-4, wherein the monocotyledonous plant is rice, com or wheat.

6. A monocotyledonous plant, such as rice, corn or wheat, with photoperiod-sensitive genic male sterility obtainable or obtained according to a method of any one of claims 1-5, or cells or plant parts thereof.

7. A recombinant DNA construct comprising the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:3, operably linked to a heterologous promoter functional in a plant.

8. A host cell comprising the recombinant DNA construct of claim 7.

9. The host cell of claim 8, wherein the host cell is a bacterial cell or a plant cell.

10. The host cell of claim 9, where in the plant cell is a plant cell or rice, com or wheat.

1 1. An isolated nucleic acid which a) has a nucleotide sequence as shown in SEQ ID NO.1 , SEQ ID NO:2 or SEQ ID NO:3; b) has a nucleotide sequence having at least about 90% sequence identity with SEQ ID NO.l , SEQ ID NO:2 or SEQ ID NO:3 and retains the property of photoperiod-sensitive genic male sterility; or c) is capable of hybridization with a nucleic acid of SEQ ID NO:2 or SEQ ID NO: 3 under high stringent conditions and retaining the property of photoperiod-sensitive genic male sterility.

12. Use of an isolated long-KNA-encoding gene for photoperiod-sensitive genic male sterility, p s3, in the regulation of pollen fertility of monocots such as rice, com or wheat, wherein the nucleotide acid sequence of said gene corresponds to that shown in SEQ ID NO: 2.

13. The use of an allele pms3 in the regulation of pollen fertility of monocots such as rice, com or wheat, wherein the nucleotide sequence of said allele pms3 corresponds to that shown in SEQ ID NO: 3.

14. A method for restoring pollen fertility of a monocotyledonous plant with photoperiod-sensitive genie male sterility, comprising overexpressing in said plant a gene comprising a nucleotide sequence corresponding to SEQ ID NO:2.

15. The method according to claim 14, wherein the overexpression is achieved by transforming said plant with a recombinant DNA construct comprising a nucleotide sequence corresponding to SEQ ID NO:2.

16. A molecular marker useful for detecting a monocotyledonous photoperiod-sensitive genie male sterile gene, wherein the molecule marker is a mutation of nucleotide C to G at a position corresponding to position 790bp of SEQ ID NO:2.

17. The molecule marker of claim 16, wherein it comprises a DNA fragment of SEQ ID NO:3 comprising said mutation.

18. The molecule marker of claim 17, wherein the marker as a DNA fragment is of a length of at least about 200bp, preferably at least about 300bp, and more preferably at least about 500bp.

19. The use of the molecular marker of any one of Claims 16-18 in marker-assisted breeding of monocotyledonous photoperiod-sensitive genie male sterile lines.

20. A method of detecting a monocotyledonous gene of photoperiod-sensitive genie male sterility, comprising amplifying a DNA fragment comprising the position corresponding to position 790bp of SEQ ID NO:2 or SEQ ID NO:3from a plant sample by using primers designed based on the sequence of SEQ ID NO:2 or SEQ ID NO:3, where a nucleotide G at a position corresponding to position 790bp of SEQ ID NO:2 or SEQ ID NO:3 is indicative of a gene of photoperiod-sensitive genie male sterility.

21. The method of claim 20, wherein the presence of said nucleotide G is confirmed by treating the amplified DNA fragment with restriction enzyme Accl, wherein the absence of Accl cleavage fragments or fewer Accl cleavage fragments than that is expected based on the genomic sequence comprising SEQ ID NO:2 is indicative of the presence of said nucleotide G and then a gene of photoperiod-sensitive genie male sterility.

22. A method of producing a monocotyledonous gene of photoperiod-sensitive genie male sterility, comprising making at least one mutation on a nucleic acid of SEQ ID NO:2 or SEQ ID NO:3 and selecting a mutant having at least about 90% of sequence identity with SEQ ID NO:2 or SEQ ID NO:3 or capable of hybridization with a nucleic acid of SEQ ID NO:2 or SEQ ID NO:3 under high stringent condition and retaining the property of photoperiod-sensitive genie male sterility.

23. A monocotyledonous gene of photoperiod-sensitive genie male sterility obtainable or obtained by the method according to claim 22.