CN111575252A

CN111575252A - Identification and application of rice fertility-related gene OsLysRS

Info

Publication number: CN111575252A
Application number: CN202010646041.3A
Authority: CN
Inventors: 于鲲; 刘春霞; 魏娟; 陈希; 梁大伟; 刘宇博
Original assignee: Syngenta Crop Protection AG Switzerland; Syngenta Biotechnology China Co Ltd
Current assignee: Syngenta Crop Protection AG Switzerland; Syngenta Biotechnology China Co Ltd
Priority date: 2020-07-07
Filing date: 2020-07-07
Publication date: 2020-08-25
Anticipated expiration: 2040-07-07
Also published as: CN111575252B

Abstract

The application relates to the technical field of plant genetic engineering and rice molecular breeding, in particular to application of a gene OsLysRS in breeding a male sterile line, preventing transgenic pollen from diffusing and improving the proportion of non-transgenic progeny in transgenic progeny. The application identifies a gene related to fertility of a male gametophyte of rice, and verifies the function of the gene through transgenosis.

Description

Identification and application of rice fertility-related gene OsLysRS

Technical Field

The invention relates to the technical field of plant genetic engineering and rice molecular breeding, in particular to identification and application of a rice fertility-related gene OsLysRS.

Background

Rice (Oryza sativa L.) with improved resistance to stressIs one of the most important food crops in the world, and more than half of the world population uses rice as staple food. In order to meet the increasing requirements of people on the yield and quality of rice, hybrid breeding is an effective way for improving the yield of crops, hybrid seeds generally have obvious advantages in the aspects of yield, stress resistance, quality and the like compared with common seeds, the breeding period of the hybrid seeds is generally shorter and takes effect quickly compared with the breeding period of the common seeds, and the development of a male sterile system becomes a sustainable requirement. Currently, commercial hybrid rice production includes a three-line system based on Cytoplasmic Male Sterility (CMS) and a two-line system based on photo-thermo-genic male sterility (PTGMS)^[1]. The three-line method, i.e. the cultivation and production of hybrid rice, must be matched with a male sterile line (sterile line for short), a male sterile maintainer line (maintainer line for short) and a male sterile restorer line. However, the breeding procedure and production link of the three-line method are complex, so that the breeding of new combinations is long in period, low in efficiency, multiple in popularization link, low in speed, high in seed cost and high in price. However, the PTGMS system also has some inherent problems, mainly in that its fertility rate is regulated by environmental conditions. Therefore, propagation of PTGMS seeds and production of hybrid seeds both require stringent environmental conditions and are susceptible to unpredictable environmental changes. Furthermore, the critical temperature for fertility transitions in PTGMS lines tends to increase after several generations of propagation. The critical temperature character of fertility conversion is influenced by genetic background, so that the difficulty and uncertainty of breeding practical PTGMS new lines are obviously increased^[2]. Fully utilizes recessive cell nucleus sterile genes to construct a stable sterile line with fertility not influenced by environment, relieves the restriction of environmental factors on cross breeding and eliminates potential risks in production. The sterile line technology controlled by the single recessive genic male sterile gene overcomes the defects of a three-line method and a two-line method, and has important market utilization value^[3]。

Plant male reproductive development involves a series of events, from development of the stamen meristem to pollen grain formation and pollination, any defect of which may lead to male sterility^[4]. Over 40 rice nuclear male sterility genes have been identified in rice. These genes involved in rice pollen development encode multiple types of proteins, packagesIncluding transcriptional regulators, signal transduction proteins, regulators of protein degradation and enzymes in hormone biosynthesis^[5]. Therefore, the research of the rice fertility related gene has important significance. At present, no report has been made on the study of the OsLysR gene, and the function of the OsLysR gene is unknown.

Disclosure of Invention

The invention aims to provide a novel rice fertility-related gene LysRS (LOC 4333345: lysine-tRNA ligase-like), the expression level of which can influence the rice fertility, and rice sterile lines can be generated by over-expressing the gene in wild rice. The obtained genic sterile mutant can be applied to theoretical research on rice fertility regulation, creation of sterile lines, transgenic pollen control, hybrid seed preparation and the like.

The above object of the present invention is achieved by the following technical processes.

In previous studies, it was found that, among mutants produced by gene editing for OsMATL knock-out of rice gene, the progeny of T0 mutant with a single insertion of T-DNA had a specific T-DNA segregation ratio, and the ratio of 2 copies (homozygous) to single copy (heterozygous) to T1 progeny without T-DNA was 0:1: 1. The results indicate that T-DNA transmission in gametophytes is hindered, i.e.defects may be generated in male or female gametophytes in which the mutant contains the T-DNA insertion. Through the subsequent wild type and the mutant positive and negative hybridization experiments, the male gametophyte containing the T-DNA insertion can not transmit the T-DNA to the offspring through the hybridization with the wild type, and the fact that the fertility of the male gametophyte containing the T-DNA insertion is influenced due to the insertion of the T-DNA is shown.

The invention locates T-DNA at the position of chromosome 3 23920880 of mutant genome by genome walking method, and inserts two genes LysRS (LOC4333345) and SMUBP-2(LOC4333346) into non-coding region in reverse direction. The invention compares the expression conditions of LysRS and SMUBP-2 in leaves and anthers of wild plants and T-DNA insertion mutants by RT-PCR and finds that: in contrast to the wild type, the expression of LysRS is up-regulated in the anthers and leaf tissues of the T-DNA insertion mutants, especially in the anthers. While the other gene, SUMBP-2, was unchanged, it was concluded that the 35S enhancer on T-DNA increased expression of LysRS near the insertion, thereby affecting fertility of male gametophytes containing the T-DNA insertion.

Since the 35S enhancer can affect gene expression in the range of 20KB from RB and LB to each other^[6]The expression of five candidate genes in the region in wild type and T-DNA insertion mutants is compared by RT-PCR, and the expression comprises the following steps: LysRS, SUMBP-2, paladin (LOC4333344), inositol monophosphatase 3(LOC4333347) and KIN-12C (LOC 4333349). The results showed that only LysRS was up-regulated in the T-DNA insertion mutants.

Since the OsMATL gene was knocked out in the T-DNA insertion mutant, to exclude that the expression of LysRS was up-regulated not due to OsMATL gene mutation, we compared the expression of LysRS in roots, leaves and anthers of wild-type, OsMATL mutant with T-DNA insertion and OsMATL mutant without T-DNA insertion by QRT, and found that the expression of LysRS in T-DNA insertion mutant was up-regulated in leaves and anthers except in roots, compared to wild-type, OsMATL mutant without T-DNA.

In order to further verify that the expression up-regulation of LysRS influences the fertility of male gametes, the invention uses a constitutive expression promoter UBI to over-express the LysRS gene in rice by a transgenic function verification method. As a result, it was found that the T-DNA segregation ratio of the progeny of 4 transgenic overexpressing plants with single insertion of T-DNA was identical to that of the previously found OsMATL mutant with single insertion of T-DNA, i.e., the ratio of 2 copies (homozygous) to single copy (heterozygous) to T1 progeny without T-DNA was 0:1: 1. The results show that the up-regulation of the OsLysRS gene can influence the fertility of the rice male gametophyte.

The experimental results prove that the over-expression of the OsLysRS gene leads to male sterility and female fertility, and can be used for cross breeding, transgenic pollen control and hybrid seed production of a rice nuclear male sterility system.

In one aspect, the invention relates to the use of a rice fertility-associated gene LysRS gene with a nucleotide sequence shown in SEQ ID NO. 1 or 2 or a rice development-associated protein LysRS protein with an amino acid sequence shown in SEQ ID NO. 3 to create male sterile rice.

In another aspect, the invention relates to the use of a rice fertility-associated gene LysRS gene with a nucleotide sequence as shown in SEQ ID NO. 1 or 2 or a rice development-associated protein LysRS protein with an amino acid sequence as shown in SEQ ID NO. 3 for interfering with fertility of transgenic pollen.

In another aspect, the invention relates to the use of a rice fertility-associated gene LysRS gene with a nucleotide sequence shown in SEQ ID NO. 1 or 2 or a rice development-associated protein LysRS protein with an amino acid sequence shown in SEQ ID NO. 3 for preventing the spread of transgenic pollen.

In another aspect, the present invention relates to a method for creating a male sterile rice, comprising overexpressing in the rice a rice fertility-associated gene LysRS gene having a nucleotide sequence set forth in SEQ ID No. 1 or 2, or an rice development-associated protein LysRS protein having an amino acid sequence set forth in SEQ ID No. 3.

In another aspect, the invention relates to a method for interfering with fertility of transgenic pollen, comprising overexpressing in rice a rice fertility-associated gene LysRS gene having a nucleotide sequence set forth in SEQ ID No. 1 or 2, or overexpressing a rice development-associated protein LysRS protein having an amino acid sequence set forth in SEQ ID No. 3.

In another aspect, the present invention relates to a method for preventing the spread of transgenic pollen, which comprises overexpressing in rice a rice fertility-associated gene LysRS gene having a nucleotide sequence set forth in SEQ ID NO. 1 or 2 or overexpressing a rice development-associated protein LysRS protein having an amino acid sequence set forth in SEQ ID NO. 3.

Drawings

FIG. 1 shows the result of the second round of PCR amplification by the genome walking method. BL: amplifying a T-DNA left border sequence; BR: amplifying the right border sequence of the T-DNA;

numbers

2, 3, 4 represent genomic templates digested by restriction enzymes PvuII, StuI and EcoRV, respectively; none: and (5) negative control.

FIG. 2 is a schematic diagram of the insertion position of T-DNA in the genome.

FIG. 3. two pairs of primers were used to verify the consistency of insertion of T-DNA in the mutant population at the T1 generation. A: amplification results with primers SP10110 and SP 10111; b: amplification results with primers SP10110 and SP 10112.

FIG. 4 analysis of expression changes of candidate genes SMUBP-2 and LysRS gene in T-DNA insertion mutants by RT-PCR.

FIG. 5 is a schematic representation of candidate gene names and positions in the genome within 25KB up-and-down from the T-DNA insertion site.

FIG. 6. analysis of the expression changes of candidate genes within 25KB up-and-down stream of the T-DNA insertion site in T-DNA insertion mutants by RT-PCR.

FIG. 7 shows comparison of the expression level of the LysRS gene in leaves and anthers of a wild-type mutant containing a T-DNA insertion and a mutant not containing a T-DNA insertion by RT-PCR. W: a wild type; t-: mutants not containing a T-DNA insertion; t +: mutants containing a T-DNA insertion.

FIG. 8 comparison of the expression level of LysRS gene in leaves, anthers and roots of wild type, mutant containing T-DNA insertion and mutant without T-DNA insertion by QRT. W: a wild type; t-: mutants not containing a T-DNA insertion; t +: mutants containing a T-DNA insertion.

FIG. 9 is a schematic diagram of a vector for overexpressing LysRS.

FIG. 10 QRT detection and seed set for LysRS expression of T0 transgenic lines.

FIG. 11 shows the heading date strain pattern of wild type rice varieties IR58025B and T0 overexpressing transgenic strains.

Detailed Description

The invention is further described below in conjunction with the drawings and the specific examples which are not to be construed as limiting the invention in any way. The reagents, methods and apparatus employed in the present invention are those conventional in the art, unless otherwise specified. Unless otherwise specified, the reagents and materials used in the examples below are all commercially available.

Example 1 genetic analysis of OsMATL mutant T1 progeny with single insertion of T-DNA

We analyzed the T-DNA segregation of E1 progeny of one single T-DNA insertion OsMATL mutant by Taqman and found that in three independent experiments no 2-copy homozygous T-DNA insertion was detected in the progeny, whereas the ratio of heterozygous T-DNA mutant to wild type progeny was close to 1:1 (Table 1). According to the experimental results, the inheritance of T-DNA is hampered either in the female gametophyte or in the male gametophyte, i.e.the development or fertility of the male gametophyte or female gametophyte containing the T-DNA insertion is affected.

TABLE 1T-DNA segregation ratio in the T1 progeny

Example 2 validation of Positive and negative crossing experiments between T-DNA single-insertion mutant and wild type

To determine whether this defect is due to problems in the development and production of male or female gametophytes, the present invention performed positive and negative cross validation using the T-DNA hybrid mutant and the corresponding IR58025B wild type as parent material and Taqman analysis of the T-DNA of the progeny of the resulting hybrids, the results of which are shown in Table 2. When the T-DNA heterozygous mutant is used as a female parent, offspring heterozygous for the wild type and the T-DNA are obtained respectively. Whereas when the T-DNA hybrid mutant is used as a pollen donor, only wild-type progeny are obtained. The results show that the male gametophyte containing the T-DNA is defective.

TABLE 2 genetic analysis of T-DNA transfer in Male and female gametes

Example 3 genome Walking method to obtain flanking sequences of a gene and to locate the position of the insertion of the T-DNA in the genome

To determine the position of insertion of the T-DNA in the mutant genome, the flanking sequences of the gene of interest were obtained by genome walking. The genome walking kit is Clontech product (Cat.No.636405), and the specific method is as follows:

(1) the genome of rice is extracted by CTAB method.

(2) The genome was digested with the restriction enzymes EcoRV, PvuII and StuI.

(3) And adding linkers at two ends of the enzyme digestion product.

(4) Two nested anchor primers were designed at the RB and LB positions of the T-DNA, respectively:

LB-gsp1：GCATGACAGCAACTTGATCACACCAGC

LB-gsp2：ATACACATTCTTGCCAGTCTTGGTTAGAG

RB-gsp1：CGTCAGTGGAGATATCACATCAATCCAC

RB-gsp2：TTGGGACCACTGTCGGCAGAGGCATCTTC。

(5) the first round of amplification was performed using gsp1 and AP1 under the same conditions as described in the specification.

(6) The amplification products were recovered and then subjected to a second round of amplification using gsp2 and AP2 under the same conditions as described above, and are shown in FIG. 1.

(7) The amplified product was ligated to Blunt zero vector for sequencing.

(8) The sequencing result removes the sequences at the left and right boundaries on the vector, and then the sequences are compared with the genome sequence, and the genome sequence is shown as SEQ ID NO. 4 and SEQ ID NO. 5.

(9) The sequences were aligned at NCBI and T-DNA was inserted between the two genes on chromosome 3 as shown in FIG. 2.

(10) The consistency of the insertion of the T-DNA in the mutant population of the T1 generation is verified through two pairs of primers, the primers are designed at the position of the T-DNA insertion, one common primer SP10110 is arranged on the T-DNA, the other two primers SP10111 and SP10112 are respectively arranged on the genome position, and the sizes of the amplified target fragments are 690bp and 899bp respectively. The primer sequences are as follows:

SP10110：TGGCCTTTCCTTTATCGCAA

SP10111：AACTCCTGCAGCGACACCATCCTC

SP10112：ATGACGCAACCCCTCCTCTCGA。

the results are shown in FIG. 3, where all T1 generation populations had the same T-DNA insertion pattern.

Example 4 detection of changes in expression of candidate genes upstream and downstream of the T-DNA insertion site in mutants by RT-PCR and QRT

In the mutant, the insertion position of T-DNA was located at the position of chromosome 3 23920880, which is located at a non-coding region between exactly two genes, the DNA binding protein gene SMUBP-2(LOC433346) and the lysine-like tRNA ligase gene LysRS (LOC433345) (FIG. 2). In order to confirm which gene expression was changed by insertion of T-DNA and the phenotype described above, the expression of SMUBP-2 and LysRS was detected by semi-quantitative RT-PCR analysis using wild-type and single-insertion of T-DNA into the leaf and anther cDNAs of OsMATL mutant as templates and actin as an internal reference, using the following gene-specific primers:

SMUBP-2 (size of the fragment of interest: 1884 bp):

SMUBP-F：5’-CAGGAGTTCGTCTCTCCA-3’

SMUBP-R：5’-TCAGCTCTGGTATTCTGATGC-3’

LysRS (target fragment size: 1805 bp):

LYSRS-F：5’-CGGAGTCGGGCTCGT-3’

LYSRS-R：5’-CTAATCTTGAGGCTTCATAGCC-3’

reference gene actin (target fragment size 889 bp):

ACTIN-F：5’-GCAGAAGGATGCCTATGTTG-3’

ACTIN-R：5’-GGACCCTCCTATCCAGACAC-3’。

the reaction system of RT-PCR was 1.0. mu.l of cDNA template, 2.0. mu.l of 10 × KOD buffer, 0.5. mu.l each of upstream and downstream specific primers (10. mu.M), 1.0. mu.l of dNTPs (2 mM each), MgSO₄1. mu.l (25mM), 1.0. mu.l of KOD DNA polymerase (1U/. mu.l) with ddH₂Make up to 12. mu.l of O. The procedure used for RT-PCR was: pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 2 min, annealing at 58 ℃ for 30 sec, extension at 68 ℃ for 1 min, 28 cycles of extension at 68 ℃ for 10 min, and storage at 4 ℃. The PCR product was detected by electrophoresis on 1.0% agarose gel and photographed. To ensure the accuracy of the results, the validation experiment was repeated 2 times.

The results show that the expression of SMUBP-2 gene has no obvious difference in anthers and leaves of wild type and T-DNA insertion mutants. The expression of the LysRS gene was up-regulated in both leaves and anthers of the T-DNA insertion mutants compared to the wild type, and was more pronounced, especially in anthers (FIG. 4). Thus, it is presumed that the expression of the LysRS gene is up-regulated by the 35S enhancer of T-DNA, since the T-DNA is inserted in the reverse direction between the two genes and the transcription direction of the T-DNA is identical to that of the LysRS gene. Since the 35S enhancer can affect gene expression within about 20kb of each upstream and downstream of LB and RB, we searched a total of five genes including SMUBP-2 and LysRS in this region (FIG. 5). The expression of these 5 genes in leaves and anthers of wild-type and T-DNA mutants was compared by RT-PCR (FIG. 6). The results showed that only the expression of the LysRS gene was up-regulated in the leaves and anthers of the T-DNA insertion mutants, which is consistent with the previous results.

To exclude the possible effect of the OsMATL mutation on the expression of the LysRS gene, in the second round of RT-PCR validation, the OsMATL mutant without T-DNA insertion was added as a control, and the results also showed that the expression of the LysRS gene was not different in leaves and anthers of the wild-type and OsMATL mutants without T-DNA insertion, but was up-regulated in the mutant with T-DNA insertion (FIG. 7). The above experimental results show that the expression level of the LysRS gene in the mutant is increased due to the insertion of a single copy of T-DNA, and particularly, the expression level in anthers is increased to cause male gametes containing T-DNA to be affected, so that T-DNA cannot be transmitted through the male gametes, resulting in that homozygous T-DNA progeny cannot be obtained in progeny, and the ratio of single-copy progeny to wild-type progeny becomes 1: 1.

The relative amount of upregulation of the LysRS gene in different tissues of the mutant was detected by QRT. The PrimeExpress3.0 software is used for designing gene-specific qPCR primers and probes, and the reference gene is rice OsEF1a gene, and has the following sequence:

TABLE 3 sequence of qPCR primers and probes

The reaction system of qPCR was 5.0. mu.L of DNA template, 12.5. mu.L of 2 × jumpstartMasterMix, 0.5. mu.L of qPCR primer probe set (300 nM primer, 100nM probe) with ddH₂Make up to 25. mu.L of O. The program used for qPCR was: 5 minutes at 95 ℃; 5 seconds at 95 ℃; 30 seconds at 60 ℃; 40 cycles。

The results of the experiment show (FIG. 8) that the LysRS gene was not changed in the roots among the wild type, the mutant containing the T-DNA insertion and the mutant without the T-DNA insertion. The expression level of LysRS was increased 3078.93% and 2760.52% in the leaves of the mutant and 367.81% and 188.50% in the anther, respectively, compared to the wild-type and the mutant without T-DNA insertion.

Example 6 Gene function verification by overexpression of OsLysRS

6.1. Binary vector construction

The OsLysRS gene used in the experiment was synthesized from Kinsley (GenScript), and the vector was constructed by a standard enzymatic ligation method. The red fluorescent protein was ligated to a binary vector containing the maize Ubi promoter and Nos terminator, and also containing the expression cassette for red fluorescent protein and the expression cassette for PMI selection marker (fig. 9).

6.2. Agrobacterium transformation of rice

The rice variety transformed in the experiment was IR 58025B. The agrobacterium transformation method is adopted, and the concrete operation is shown in the reference literature^[7]. The positive strain of the transformation is detected by Taqman, and the transformation strain with single insertion of T-DNA is selected and sent to a greenhouse for cultivation.

OsLysRS gene expression analysis and phenotype observation of T0 transgenic plants

By analyzing the expression of the OsLysRS gene of the transgenic plant through QRT (figure 10), 94% of the OsLysRS gene of the T0 transgenic plant is over-expressed, the expression level is 22-156 times of that of the wild type, and the expression level of the LysRS gene of the OsMATL mutant with single insertion of T-DNA is 6 times of that of the wild type. The maturing rate of the transgenic overexpression lines is reduced to different degrees compared with the wild type (figure 10 and figure 11), the average maturing rate is 45.61%, the maturing rate is reduced by 46.34%, and 2 transgenic lines are sterile, which indicates that the OsLysRS gene is a fertility-related gene, and the fertility of rice is influenced by the up-regulation of the expression amount of the OsLysRS gene.

Genetic analysis of descendants of the LysRS overexpressing transgenic line T1

We performed genetic analysis of T-DNA segregation of partial T-DNA single and multiple insertions of progeny of the T0 transgenic line by Taqman and red fluorescent protein expression (Table 4). The segregation ratio of four offspring heterozygous for the single-insertion transgenic line and the wild-type offspring was 1:1, and this result confirmed that the up-regulation of expression of LysRS resulted in the defect of the male gametophyte containing the T-DNA insertion, thereby preventing the transfer of T-DNA to offspring through the male gametophyte. In the progeny of the T-DNA multiple-insertion transgenic line, RFP expression was not detected in 45% (5/11) of the progeny (Table 5), suggesting that upregulation of the LysRS gene may prevent inheritance of T-DNA into the progeny. Therefore, the results show that the LysRS gene can be applied to prevent transgene diffusion and increase the proportion of non-transgenic offspring.

TABLE 4 progeny genetic analysis of T-DNA Single-insertion transgenic lines

TABLE 5 progeny genetic analysis of T-DNA multiple insertion transgenic lines

The above examples are only for illustrating the present invention, and the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, simplifications, etc. which are made without departing from the spirit and principle of the present invention should be regarded as equivalent embodiments. All of which are included within the scope of the present invention.

Reference to the literature

Cheng, S.H. et al, Progress in research and maintenance on hybrid a super-biomedical in China, Ann Bot 2007.100(5): p.959-66.

2.Chen L,L.D.,Tang W,Xiao Y,Thoughts and practice on some problemsabout research and application of two-line hybrid rice.Chin J Rice Sci,2011.18(2):p.79-85.

3. Wangchao, Anschli, Zhang Zeng et al, research progress and prospect of plant recessive nuclear male sterility gene breeding technical system, journal of biological engineering in China 2013.33(10) p.124-130.

Chang, Z, et al, Construction of a master system for hybrid weaving and seed production using a nuclear master build Sci U S A,2016.113(49): p.14145-14150.

5. Tanshun, Wen iron bridge, Zhang soldier, molecular mechanism of rice pollen development, report of botany, 2007.24(3), p.330-339.

Lu, G.H. et al, Application of T-DNA activation tagging to identification genes transmitters-like genes in plants [ J ] Plant Cell Reports,2014,33(4):617-

Plant Cell Rep,2006.25(5): p.392-402, Ge, X, et al, A tissue culture system for differential plastics of the index rice.

Sequence Listing information

1, SEQ ID NO: gene sequence of fertility-related gene OsLysRS

2, SEQ ID NO: cDNA sequence of fertility-related gene OsLysRS

3, SEQ ID NO: amino acid sequence of fertility-related gene OsLysRS

4, SEQ ID NO: T-DNA flanking sequence near left border sequence

5, SEQ ID NO: T-DNA flanking sequence near right border sequence

6 of SEQ ID NO: primer LB-gsp1

GCATGACAGCAACTTGATCACACCAGC

7, SEQ ID NO: primer LB-gsp2

ATACACATTCTTGCCAGTCTTGGTTAGAG

8, SEQ ID NO: primer RB-gsp1

CGTCAGTGGAGATATCACATCAATCCAC

9 of SEQ ID NO: primer RB-gsp2

TTGGGACCACTGTCGGCAGAGGCATCTTC

10, SEQ ID NO: primer SP10110

TGGCCTTTCCTTTATCGCAA

11, SEQ ID NO: primer SP10111

AACTCCTGCAGCGACACCATCCTC

12, SEQ ID NO: primer SP10112

ATGACGCAACCCCTCCTCTCGA

13 in SEQ ID NO: primer SMUBP-F

CAGGAGTTCGTCTCTCCA

14, SEQ ID NO: primer SMUBP-R

TCAGCTCTGGTATTCTGATGC

15, SEQ ID NO: primer LYSRS-F

CGGAGTCGGGCTCGT

16 in SEQ ID NO: primer LYSRS-R

CTAATCTTGAGGCTTCATAGCC

17 in SEQ ID NO: primer ACTIN-F

GCAGAAGGATGCCTATGTTG

18, SEQ ID NO: primer ACTIN-R

GGACCCTCCTATCCAGACAC

19, SEQ ID NO: OsLysRS forward primer

CACGTTTATTATCAACCATCCAGAGA

20, SEQ ID NO: OsLysRS reverse primer

GCTCAAACCTCTCAGTCAATCCAG

21, SEQ ID NO: OsLysRS probe

ATGAGTCCATTGGCAAAGTGGCATAGGTC

22, SEQ ID NO: OsEF1a forward primer

AGCCCAAGAGGCCATCAGA

23, SEQ ID NO: OsEF1a reverse primer

GCCAATACCACCGATCTTGTACA

24, SEQ ID NO: OsEF1a probe

AAGCCCCTGCGTCTTCCCCTTCA

Sequence listing

<110> Xianzhengda crops Protection shares company (Syngenta Crop Protection AG)

Syngenta Biotechnology China Co., Ltd. (Syngenta Biotechnology China Co., Ltd.)

<120> identification and application of rice fertility related gene OsLysRS

<130>82126-CN-REG-ORG-NAT-1

<141>2020-07-07

<160>24

<170>PatentIn version 3.5

<210>1

<211>7262

<212>DNA

<213> Rice

<220>

<223> Gene sequence of fertility-associated Gene OsLysRS

<400>1

atggcggagt cgggctcgtc gggtctggag gagaagctgg cgggtctctc cgcgggcggc 60

ggcgaggagc cgcagcagct ctcgaagaag tgcgctttct catcgcgcac gcagccggca 120

tttcttctta ttgttttttt tttcctccgt agtgtggctt ttgtttaata tgagttttgt 180

ggcgggtgca gtgccaagaa gagggaggag aaaaggaaga agcaggagga ggagcgccgg 240

ttgaaggagg aagagaagaa gaagaaggtg aagcagtttg aacttaacct ttgccgattt 300

ttttccagtg ttgtttttat ggagcgagtt ttggatgcgt tcatttgtag atgatgccaa 360

tgtgacaagc aacactcttt gctcttgtta gatacggata tacctctgca gctagggtgt 420

gagagagagt tttccatatc atgattgcta agctctaaat atatatacac ccttttttta 480

aaaaaatttt gtaggccgct gcaacagcag ctgctagtgg agagcccccg aaggaatctg 540

ccgccgacga tgaggaaatg gatcccactg tatgtgatat tgatgcccct ttggtgctgc 600

tgtgctattt gttgtattga attcttttgt ttaggaaaat tcagacatgt gtttcttgct 660

gcagcaatat tatgagaatc gcctcaaggc acttgattca ctcaaggcca cgggtgtaaa 720

cccctatccc cataagttcc tggctaatat taccgtagcc gattatattg agaaatacaa 780

gagcatgaat gttggggata agcttgttga cgtcaccgag tgcctagcag gtatttttcg 840

ttctctttga ctagatatga tagtgtagtt gattagagat acatttgggt gggatttgta 900

tttattattt ttttttatta aagggaggat catgaccaag agagcgcaat cttccaagct 960

cttattttat gatctttatg gtggtggtga gaaagttcaa gtttttgctg atgccaggta 1020

aaactttgtc tgttcaactg tattgcttac cttttatgcc atttagctgg tttgttccca 1080

gacactttca gcatttcact aaaatctcac tatgtgcaga tatgcctgac taaaatgcat 1140

cctttggtta attttcatat cagttaaatc tattttttaa tgttggtgaa tttcataaag 1200

tttgtatcag ttaaatatat ttttcaacat tggtgaattt cataaagttt attgccaaag 1260

aattctcact gcaactttat aaacatatgc taggccatgg attgtgatga atgtcataga 1320

tttagagcaa ggtttctgta gcttattatc ttcctgcaaa tgtgtcaata gtacgccggg 1380

tgctactcat gcttggcata gctggctact tatgtgtggt ccgtattggc aataatcaca 1440

ttatgcacaa aacccccctt cttttacata gttgggtttt cttcttgttt tgtacatgtt 1500

aatgcttaga atttttcttc ttgttatttt tgcatgcttt cccaacttgg gtaatatgct 1560

tcatgattat gtacataaca gtatgtatgc ttgtacatag taaaagtgta aaatacacga 1620

ggttgcatac aatccatatc tcataaagtc tgggggcttg ctgacttgca attttctatt 1680

agttataatg tttaaacaaa caaaaaggtg cattcttttt tgttattttg actaactgtt 1740

ctttggctat cgttgttatc tcgtggctat catttcgctc atgtttaagt actacgccgt 1800

ttactgccta ctattgtcgg tctcataaaa agtaaactaa tgatttaact gattttacct 1860

gatataggac ctcagagttg gaagataatg aattcattaa gtttcactct actctgaaac 1920

gaggtgatat tgttggtgta tgtggttatc caggtttgta agcatctatt caagttcatt 1980

ttgaaattat tacatagtca gatgttccaa catcaaaatt aagtaggtac ttatattctt 2040

tcagttggaa tgccaatagg acattttgag tacatggatc cttatctgat tgagtttgta 2100

attttattta ataaataact taaactttat atgtagctta tgcccatact tgattgtaca 2160

gtttgtttgt tttaaaacaa ttaggagtat aaatagtttg atggttactg gaaattctta 2220

tattgtttta ctgtgtctga taatgacgac ttctcaattt tgatgaatac caggaaagag 2280

caagagaggg gagctcagta tattcccaaa gaaaattgtt gtgctctccc catgccttca 2340

tatgatgcct cgacaggtga gaatcagatt ttttaggaag agatgtttcc agatgatata 2400

cctaatatct cagagcaatt tacttcatat taatctgaac ttttatattt aaatctgtac 2460

atactaacat agagaccata aaataactag agttaagtct gatttacccc catcccccct 2520

ctctctctct aactatagaa ccggacattt gacaccccta aaattttgga accgtacgaa 2580

ttaccttcct aaacataatc taggtggttt tgtcctatgt ggcagacagg tggcaataat 2640

ctgaccatgt ggcaacccag tcagcaaaac aatcaattgt ttttaggaaa aaatatgtta 2700

gcccacattg tcatccacct agttgtcttc ttccgcccat tctcccattt ctcacattag 2760

gcatgggctg caaactgcca gatcctttgc ctcgttagtc tcagtgctcc ttgcttcgga 2820

ggaagtccat ggacaagcgc ctcaaagcag tgctccggcc tgcttgagac ggccgagctt 2880

gagtgctcga cgggacatag cagcgctggc accgcctcgc ctccatcagt gcgcccgtgc 2940

aacagttcgt ggtggttgtg gggagcatat gtttgcccct gccggagtat gccaccatgt 3000

cagctgcaca gcagcaggtg cagctagccg ccactgccag ggagctgaag caccagcaag 3060

gacggagaca ctctggctcc gaaggccgcg gagcggggac gccagggacg gcagcttgtc 3120

ctccccggcc gtctcatggt cgtcacagac cacctccgct tcattacatg tgcgaatgag 3180

agagcagctt tgatttcttg gagttttttt ttttcaaaga gtgatttttc agaactatct 3240

agcttgatta catgtacgta tgacaacaac cgtcttgtgg atcttgaggg ctgcaggtaa 3300

gctagtgctt acacaggctt gggtagagat tggaacagaa aggatagagg aagaagtgca 3360

tgccactgat tgctgggtcc catggagagg gagaagcatg ttgctgatga tgcacctcct 3420

ccctcatatt ggactgtcat gtgtgatagc tttagatcga aaccacctaa aaaagagccc 3480

caggggggtt aagtatccgg attgaatagt ttaggggtgt ccaatatctg gtttcgtagt 3540

taaggggggt aagtcgtact tctgtgatag ttgagggggt aaatcggact tgacccaaat 3600

aattatgact gaaactaaag acattttgtg tagcgatgcc ttctcttttt ctgggtgtca 3660

cacacacaca ttagcagcac aagaaagcac aacagccatt attctggttt gcagacccca 3720

gacaggtcat ttgattaaac ccacaaatgc acctcatatt tgcctagctt cttttctcaa 3780

gtgcaatgca atacagacac tcactcacac ctgtttatgc atttgttacg tgctacgcat 3840

tctaggacta gtagaggcat agataaatgc ataatttgtc catcacctca tggagtatgg 3900

gcgtgtcctg cacttgcatg tgtgtagtat atagtgagcc atgcttgctt gacttgatgc 3960

taggattgaa cgttggcatt ttgcatgcac gattgaactg caaaacaccc aactgctgag 4020

tccagcatgc caagcttctg agatatcaaa atatttcgtg tacacccaac cattgaccct 4080

ttgctttcct tccaagttct tatgctaatt atatttgttg aattgtagtc tacatgatca 4140

tttacatgta ttttatacat ctttacagaa gagtgaggga agtgctgttc ccactccatg 4200

ggctccagga atgggtagga acatcgaaaa gtatgttttg agggaccagg tttgttcatt 4260

ctccgtataa ttattgattg atctctcgtc tatgtaaatg ctaattactg tgagttcttt 4320

gtcagcaagt aaatacattg tcggtagtgt gattaatcat aattaacaaa tatctaggcg 4380

gattttaagg ttctggatgt gcatatgtga tccgctttgt tgtatgcaca acaaaatcat 4440

ttaaatttag attgaggcag ctatgcaatt tagtgcaaag ttagattcag gtggatgaac 4500

taatcatggg atcagattct atctgaacaa gtggataggt ggcgcatgtc tagtccatta 4560

agagagattt gcaatgttct taaaattagt gaactcattt gctgacatga atgccatatt 4620

tggcatgcta atagaaatct gtccaatttt attgactatc tcatgcattc attctattta 4680

aaaatctgca tttctaattt acatgagcaa atcataaatt tggtgcaggt tgctttaagt 4740

agcttgatca ctcagtgact atcaattata tatctgtctt gttgcctttg gtgcttagta 4800

gcgatttgat tatcaattgt ttgtcttgtg atatcaggaa acccgatatc gtcaacgata 4860

tcttgatctc atggtaaacc atgaagtgag gcatatattc aagacaagat caaaagttgt 4920

ctcttttatt cggaaatttc ttgatggtct tgacttttta gaggtgggcc tgtgcaatct 4980

attctgttat tcttcttttg tatattcttc cagtccttca aatctgaata ttctatgtct 5040

tttctaggtg gagactccaa tgatgaacat gattgcaggt ggagcagctg caaggccttt 5100

tgtcacacat cataatgagt taaacatgag gctttatatg cgtattgctc ctgagctcta 5160

tctgaaggaa ttggttgttg gggggctgga tcgtgtttat gaaattggga agcagttcag 5220

gaatgaagga attgacctga cgcacaatcc tgaattcaca acatgtgaat tttatatggc 5280

atatgcagat tacaatgact tgatgaagct tactgaaacc atgttatctg gtgattatct 5340

cttgatgtct ctgaaacatc tttttttttt ctttttattt taggaagtaa tagtatcttc 5400

atgtcaattt tgtatgcaac tgcaaaatga cctaaatgca ttttccttgt tccgtaggca 5460

attcatgatt tgctattgtt ctgtcatatc atttttttgc cgtcctatct tgtttttact 5520

gaaatcaaca tgaagcagcc tgttcatttt atctaatgat ctgattttat ggttgacagg 5580

tatggttaag gagttgacag gtggctacaa gattaaatat catgctaacg gagttgagaa 5640

accaccaata gagattgatt tcacacctcc cttcaggtag agacattggg atgtatttgg 5700

attacatgta ttgctctata tgcactttta actggtaatg ttcagttgct acaatgttac 5760

tttgccttta ccttgctgca gaaagataga catgattgac caattagagg ctatggctaa 5820

actcaatata cctaaagatc tctcaagtga tgaagcaaac aagtatttga tagatgcctg 5880

tgccaaatat gatgtcaaat gcccacctcc ccagactaca acacggttgc ttgataaggt 5940

tgtttcttta cccactacac attcttttta cactgtattt tgatatgatt ttcgttaggt 6000

gattttgcta tcttataata tcttatttac atatatgata agctagccac tttgatatga 6060

agaagaatgt ccggtgtaat cctttttgtt gcttccataa tgtacagtac atttctgaac 6120

attttcacat tagctcacaa acaaataaaa gatctggggt atattgcaaa atccaacctg 6180

aagctatttg cttaaatttt aatatacctt ttgcttttgt ttcccttttg gtattcctta 6240

gccaaattaa taaggtatat gctctgctct aacagctagt tggccatttc ttggaggaga 6300

catgtgtgaa tcccacgttt attatcaacc atccagagat aatgagtcca ttggcaaagt 6360

ggcataggtc tcgacctgga ttgactgaga ggtttgagct ctttgttaac aagcatgagg 6420

tatatactaa gtcttcattg atactttcat acttgtcctc ctttctgttt ccttacagtg 6480

ttctgaaatc cattttttag gtgtgcaatg catatacaga gttaaatgat cctgttgttc 6540

agaggcaacg gtttgaggaa caactaaagg tacttgttag attttgtgaa catttgcaaa 6600

ttgtatattt ttctttggta ccagcctgct cccaagcttc gagttatttt tggtattttg 6660

gaacatctaa atagctttgc atagtatata attgttggaa accaacctac tcccatatgt 6720

ggtatatttt ggtccatcat tttaaccagc gtactcatta tgcttgggag ttttggatcc 6780

atcagatata tacacacact tgtgtttgca ttgttaaaag tagtggtaag tcattggaag 6840

ggtgggatat gaagtgtcaa acagacaaac agagtatgga cccttacacc agtggcagat 6900

ttattgttgc atggtgtttc cctagcttcc tatgtggctt gctgaaaaac tgtacatgtt 6960

cttacgtata ttatgtgcca ggatcgtcaa tctggtgatg atgaagctat ggcattggat 7020

gaaacattct gcacagccct tgagtatggc ctaccaccga ctggtggttg gggattggga 7080

attgatcgcc ttacaatgtt gctgactgat tctcagaata tcaaggtcta attatttctt 7140

catttgtact tttgttcctg gcatttttta tttggtcttt attcagttga ggtatttaaa 7200

atgctctttt gatgcaaatt caggaagttc ttctattccc ggctatgaag cctcaagatt 7260

ag 7262

<210>2

<211>1809

<212>DNA

<213> Rice

<220>

<223> cDNA sequence of fertility-associated Gene OsLysRS

<400>2

atggcggagt cgggctcgtc gggtctggag gagaagctgg cgggtctctc cgcgggcggc 60

ggcgaggagc cgcagcagct ctcgaagaat gccaagaaga gggaggagaa aaggaagaag 120

caggaggagg agcgccggtt gaaggaggaa gagaagaaga agaaggccgc tgcaacagca 180

gctgctagtg gagagccccc gaaggaatct gccgccgacg atgaggaaat ggatcccact 240

caatattatg agaatcgcct caaggcactt gattcactca aggccacggg tgtaaacccc 300

tatccccata agttcctggc taatattacc gtagccgatt atattgagaa atacaagagc 360

atgaatgttg gggataagct tgttgacgtc accgagtgcc tagcagggag gatcatgacc 420

aagagagcgc aatcttccaa gctcttattt tatgatcttt atggtggtgg tgagaaagtt 480

caagtttttg ctgatgccag gacctcagag ttggaagata atgaattcat taagtttcac 540

tctactctga aacgaggtga tattgttggt gtatgtggtt atccaggaaa gagcaagaga 600

ggggagctca gtatattccc aaagaaaatt gttgtgctct ccccatgcct tcatatgatg 660

cctcgacaga agagtgaggg aagtgctgtt cccactccat gggctccagg aatgggtagg 720

aacatcgaaa agtatgtttt gagggaccag gaaacccgat atcgtcaacg atatcttgat 780

ctcatggtaa accatgaagt gaggcatata ttcaagacaa gatcaaaagt tgtctctttt 840

attcggaaat ttcttgatgg tcttgacttt ttagaggtgg agactccaat gatgaacatg 900

attgcaggtg gagcagctgc aaggcctttt gtcacacatc ataatgagtt aaacatgagg 960

ctttatatgc gtattgctcc tgagctctat ctgaaggaat tggttgttgg ggggctggat 1020

cgtgtttatg aaattgggaa gcagttcagg aatgaaggaa ttgacctgac gcacaatcct 1080

gaattcacaa catgtgaatt ttatatggca tatgcagatt acaatgactt gatgaagctt 1140

actgaaacca tgttatctgg tatggttaag gagttgacag gtggctacaa gattaaatat 1200

catgctaacg gagttgagaa accaccaata gagattgatt tcacacctcc cttcagaaag 1260

atagacatga ttgaccaatt agaggctatg gctaaactca atatacctaa agatctctca 1320

agtgatgaag caaacaagta tttgatagat gcctgtgcca aatatgatgt caaatgccca 1380

cctccccaga ctacaacacg gttgcttgat aagctagttg gccatttctt ggaggagaca 1440

tgtgtgaatc ccacgtttat tatcaaccat ccagagataa tgagtccatt ggcaaagtgg 1500

cataggtctc gacctggatt gactgagagg tttgagctct ttgttaacaa gcatgaggtg 1560

tgcaatgcat atacagagtt aaatgatcct gttgttcaga ggcaacggtt tgaggaacaa 1620

ctaaaggatc gtcaatctgg tgatgatgaa gctatggcat tggatgaaac attctgcaca 1680

gcccttgagt atggcctacc accgactggt ggttggggat tgggaattga tcgccttaca 1740

atgttgctga ctgattctca gaatatcaag gaagttcttc tattcccggc tatgaagcct 1800

caagattag 1809

<210>3

<211>602

<212>PRT

<213> Rice

<220>

<223> amino acid sequence of fertility-associated gene OsLysRS

<400>3

Met Ala Glu Ser Gly Ser Ser Gly Leu Glu Glu Lys Leu Ala Gly Leu

1 5 10 15

Ser Ala Gly Cys Gly Glu Glu Pro Gln Gln Leu Ser Lys Asn Ala Lys

20 25 30

Lys Arg Glu Glu Lys Arg Lys Lys Gln Glu Glu Glu Arg Arg Leu Lys

35 40 45

Glu Glu Glu Lys Lys Lys Lys Ala Ala Ala Thr Ala Ala Ala Ser Gly

50 55 60

Glu Pro Pro Lys Glu Ser Ala Ala Asp Asp Glu Glu Met Asp Pro Thr

65 70 75 80

Gln Tyr Tyr Glu Asn Arg Leu Lys Ala Leu Asp Ser Leu Lys Ala Thr

85 90 95

Gly Val Asn Pro Tyr Pro His Lys Phe Leu Ala Asn Ile Thr Val Ala

100 105 110

Asp Tyr Ile Glu Lys Tyr Lys Ser Met Asn Val Gly Asp Lys Leu Val

115 120 125

Asp Val Thr Glu Cys Leu Ala Gly Arg Ile Met Thr Lys Arg Ala Gln

130 135 140

Ser Ser Lys Leu Leu Phe Tyr Asp Leu Tyr Gly Gly Gly Glu Lys Val

145 150 155 160

Gln Val Phe Ala Asp Ala Arg Thr Ser Glu Leu Glu Asp Asn Glu Phe

165 170 175

Ile Lys Phe His Ser Thr Leu Lys Arg Gly Asp Ile Val Gly Val Cys

180 185 190

Gly Tyr Pro Gly Lys Ser Lys Arg Gly Glu Leu Ser Ile Phe Pro Lys

195 200 205

Lys Ile Val Val Leu Ser Pro Cys Leu His Met Met Pro Arg Gln Lys

210 215 220

Ser Glu Gly Ser Ala Val Pro Thr Pro Trp Ala Pro Gly Met Gly Arg

225 230 235 240

Asn Ile Glu Lys Tyr Val Leu Arg Asp Gln Glu Thr Arg Tyr Arg Gln

245 250 255

Arg Tyr Leu Asp Leu Met Val Asn His Glu Val Arg His Ile Phe Lys

260 265 270

Thr Arg Ser Lys Val Val Ser Phe Ile Arg Lys Phe Leu Asp Gly Leu

275 280 285

Asp Phe Leu Glu Val Glu Thr Pro Met Met Asn Met Ile Ala Gly Gly

290295 300

Ala Ala Ala Arg Pro Phe Val Thr His His Asn Glu Leu Asn Met Arg

305 310 315 320

Leu Tyr Met Arg Ile Ala Pro Glu Leu Tyr Leu Lys Glu Leu Val Val

325 330 335

Gly Gly Leu Asp Arg Val Tyr Glu Ile Gly Lys Gln Phe Arg Asn Glu

340 345 350

Gly Ile Asp Leu Thr His Asn Pro Glu Phe Thr Thr Cys Glu Phe Tyr

355 360 365

Met Ala Tyr Ala Asp Tyr Asn Asp Leu Ile Glu Leu Thr Glu Thr Met

370 375 380

Leu Ser Gly Met Val Lys Glu Leu Thr Gly Gly Tyr Lys Ile Lys Tyr

385 390 395 400

His Ala Asn Gly Val Glu Lys Pro Pro Ile Glu Ile Asp Phe Thr Pro

405 410 415

Pro Phe Arg Lys Ile Asp Met Ile Glu Glu Leu Glu Ala Met Ala Lys

420 425 430

Leu Asn Ile Pro Lys Asp Leu Ser Ser Asp Glu Ala Asn Lys Tyr Leu

435 440 445

Ile Asp Ala Cys Ala Lys Tyr Asp Val Lys Cys Pro Pro Pro Gln Thr

450455 460

Thr Thr Arg Leu Leu Asp Lys Leu Val Gly His Phe Leu Glu Glu Thr

465 470 475 480

Cys Val Asn Pro Thr Phe Ile Ile Asn His Pro Glu Ile Met Ser Pro

485 490 495

Leu Ala Lys Trp His Arg Ser Arg Pro Gly Leu Thr Glu Arg Phe Glu

500 505 510

Leu Phe Val Asn Lys His Glu Val Cys Asn Ala Tyr Thr Glu Leu Asn

515 520 525

Asp Pro Val Val Gln Arg Gln Arg Phe Glu Glu Gln Leu Lys Asp Arg

530 535 540

Gln Ser Gly Asp Asp Glu Ala Met Ala Leu Asp Glu Thr Phe Cys Thr

545 550 555 560

Ala Leu Glu Tyr Gly Leu Pro Pro Thr Gly Gly Trp Gly Leu Gly Ile

565 570 575

Asp Arg Leu Thr Met Leu Leu Thr Asp Ser Gln Asn Ile Lys Glu Val

580 585 590

Leu Leu Phe Pro Ala Met Lys Pro Gln Asp

595 600

<210>4

<211>423

<212>DNA

<213> Rice

<220>

<223> flanking sequence of T-DNA near left border sequence

<400>4

agcgtcaatt tcatgacaat ttgtttaccc tagctaaacc ccccttctcc cttgcgcctc 60

cgcttcgcga gcctcatctc ctcgatctct ttcgattcag tggaaaacct aggagaccgg 120

cgcggcatgg cggagtcggg ctcgtcgggt ctggaggaga agctggcggg tctctccgcg 180

ggcggcggcg aggagccgca gcagctctcg aagaagtgcg ctttctcatc gcgcacgcag 240

ccggcatttc ttcttattgt tttttttttc ctccgtagtg tggcttttgt ttaatatgag 300

ttttgtggcg ggtgcagtgc caagaagagg gaggaaaaaa ggaagaagca ggaggaggag 360

cgccggttga aggaggaaga aaataagaag aaggtgaagc agtttgaact taacctttgc 420

cga 423

<210>5

<211>285

<212>DNA

<213> Rice

<220>

<223> T-DNA flanking sequence near the right border sequence

<400>5

ggctgccgcc gccgccgccg cgacgtcacg gaataaaaag ccctggattc tcactttctc 60

acatggacta ggcccacgaa acctgcttta aaatgggcct ggattagact acgcgggcct 120

ggcccatgaa atgcgctttg cttgggcgaa tcgcaaggcg attacgccgt ggacgagacg 180

agtgagagga ggagagcggc catggcgggg cggagtggcg gcggcggcgg cgggagctcc 240

gggaagagcg ggacggggag gatggtgtcg cgccaaggag ttaaa 285

<210>6

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> primer LB-gsp1

<400>6

gcatgacagc aacttgatca caccagc 27

<210>7

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> primer LB-gsp2

<400>7

atacacattc ttgccagtct tggttagag 29

<210>8

<211>28

<212>DNA

<213> Artificial sequence

<220>

<223> primer RB-gsp1

<400>8

cgtcagtgga gatatcacat caatccac 28

<210>9

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> primer RB-gsp2

<400>9

ttgggaccac tgtcggcaga ggcatcttc 29

<210>10

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> primer SP10110

<400>10

tggcctttcc tttatcgcaa 20

<210>11

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223> primer SP10111

<400>11

aactcctgca gcgacaccat cctc 24

<210>12

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223> primer SP10112

<400>12

atgacgcaac ccctcctctc ga 22

<210>13

<211>18

<212>DNA

<213> Artificial sequence

<220>

<223> primer SMUBP-F

<400>13

caggagttcg tctctcca 18

<210>14

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> primer SMUBP-R

<400>14

tcagctctgg tattctgatg c 21

<210>15

<211>15

<212>DNA

<213> Artificial sequence

<220>

<223> primer LYSRS-F

<400>15

cggagtcggg ctcgt 15

<210>16

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223> primer LYSRS-R

<400>16

ctaatcttga ggcttcatag cc 22

<210>17

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> primer ACTIN-F

<400>17

gcagaaggat gcctatgttg 20

<210>18

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> primer ACTIN-R

<400>18

ggaccctcct atccagacac 20

<210>19

<211>26

<212>DNA

<213> Artificial sequence

<220>

<223> OsLysRS forward primer

<400>19

cacgtttatt atcaaccatc cagaga 26

<210>20

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223> OsLysRS reverse primer

<400>20

gctcaaacct ctcagtcaat ccag 24

<210>21

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> OsLysRS probe

<400>21

atgagtccat tggcaaagtg gcataggtc 29

<210>22

<211>19

<212>DNA

<213> Artificial sequence

<220>

<223> OsEF1a forward primer

<400>22

agcccaagag gccatcaga 19

<210>23

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223> OsEF1a reverse primer

<400>23

gccaatacca ccgatcttgt aca 23

<210>24

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223> OsEF1a Probe

<400>24

aagcccctgc gtcttcccct tca 23

Claims

1. The application of rice fertility-related gene LysRS gene with a nucleotide sequence shown in SEQ ID NO. 1 or 2 or rice development-related protein LysRS protein with an amino acid sequence shown in SEQ ID NO. 3 in creating male sterile rice.

2. The application of the rice fertility related gene LysRS gene with the nucleotide sequence shown as SEQ ID NO. 1 or 2 or the rice development related protein LysRS protein with the amino acid sequence shown as SEQ ID NO. 3 in interfering the fertility of transgenic pollen.

3. The application of the rice fertility-related gene LysRS gene with the nucleotide sequence shown as SEQ ID NO. 1 or 2 or the rice development-related protein LysRS protein with the amino acid sequence shown as SEQ ID NO. 3 in preventing the diffusion of transgenic pollen.

4. A method for creating male sterile rice comprises overexpressing a rice fertility-related gene LysRS gene whose nucleotide sequence is shown in SEQ ID NO. 1 or 2 in rice or overexpressing a rice development-related protein LysRS protein whose amino acid sequence is shown in SEQ ID NO. 3.

5. A method for interfering fertility of transgenic pollen comprises overexpressing a rice fertility-related gene LysRS gene with a nucleotide sequence shown in SEQ ID NO. 1 or 2 in rice or overexpressing a rice development-related protein LysRS protein with an amino acid sequence shown in SEQ ID NO. 3.

6. A method for preventing the spread of transgenic pollen comprises over-expressing a rice fertility-associated gene LysRS gene whose nucleotide sequence is shown in SEQ ID NO. 1 or 2 in rice or over-expressing a rice development-associated protein LysRS protein whose amino acid sequence is shown in SEQ ID NO. 3.