CN113817033B - Application of ZmELF3.1 protein and its functional deletion mutant in regulating and controlling crop aerial root number or layer number - Google Patents

Abstract

The invention discloses an application of ZmELF3.1 protein and a functional deletion mutant thereof in regulating and controlling the number of aerial roots or layers of crops. The invention uses the protein sequence of Arabidopsis thaliana ELF3 as the basis, and obtains 2 maize ELF3 genes which are named ZmELF3.1 and ZmELF3.2 respectively through homologous comparison in a maize genome database. The invention further utilizes RISPR/Cas9 gene editing technology to mutate the ZmELF3.1 gene of the corn, and the function deletion mutant of the ZmELF3.1 gene shows a phenotype of increasing the number of aerial roots and increasing the total number of aerial roots under the conditions of long sunlight and short sunlight, so that the ZmELF3.1 gene of the corn is determined to play a vital role in regulating and controlling the number of aerial roots and the number of aerial roots of the corn. The invention has application prospect in controlling the number of layers of the aerial roots of the corn, and can be applied to the improvement of the corn inbred line and the crossbreeding.

Description

Application of ZmELF3.1 protein and its functional deletion mutant in regulating and controlling crop aerial root number or layer number

Technical Field

The invention relates to a new application of ZmELF3.1 protein and a function deletion mutant thereof, in particular to an application of ZmELF3.1 protein and a function deletion mutant thereof in regulating and controlling the number of aerial roots or/and layers of crops, belonging to the field of new application of ZmELF3.1 functional protein and mutants thereof.

Background

Corn is the grain crop with the largest planting area worldwide, important feed and industrial raw materials, and the improvement and stabilization of the yield directly affect the global grain supply safety. Research shows that whether corn populations with the same density and different varieties or different densities of the same variety have more aerial roots and total roots, more dry matter accumulation after flowers and more dry matter accumulation for a whole life; the number of the aerial roots is large, so that the variety is more beneficial to increasing the production and accumulation of dry matters of the post-flowers population, thereby increasing the accumulation of a life of the dry matters. The number of the aerial roots and the total roots of the populations with the same density or different densities of the same variety are in an extremely obvious positive correlation with the yield, the number of the aerial roots is more favorable for the increase of the number of the grains per ear, and the number of the aerial roots is an important sign of the variety yield. Thus, whether it be cultivar or population, increased aerial root is the most pronounced feature of root systems that increases the total number of grains in the population and increases yield. Meanwhile, as one of the most important factors affecting corn yield, the lodging degree of plants is mainly affected by stalk traits and root structures. As an important component of root systems, the role of aerial roots in lodging resistance of maize plants is gaining increasing attention. Research shows that three important properties of the aerial roots, namely the number of aerial roots, the number of aerial roots and the ground grabbing radius, are different in different corn subgroups, the range of the aerial roots in the tropical and subtropical blood edges is large, the aerial roots and the ground grabbing radius are more extreme values in the tropical and subtropical blood edge subgroups, the aerial roots are obviously related to each other, the correlation coefficient between the aerial roots and the ground grabbing radius is highest, and the fact that in certain tropical and subtropical environments, plants need more aerial roots, ground grabbing radius and number, and fixation and support are provided for the plants. However, no report exists on the number of layers or/and the number of aerial roots regulated by the ELF3 of the corn at present.

Disclosure of Invention

One of the purposes of the invention is to provide the application of ZmELF3.1 protein in regulating the number of layers or/and the number of aerial roots of crops;

the above object of the present invention is achieved by the following technical solutions:

the invention utilizes CRISPR/Cas9 gene editing technology to edit mutant zmelf3.1 which creates ZmELF3.1 protein defect, and the number of layers and the number of the mutant zmelf3.1 are increased by 400-500% compared with wild C01 aerial roots under the conditions of short sunlight and long sunlight; the invention also carries out the function defect mutation on the ZmELF3.2 protein to obtain a mutant zmelf3.2, and the result shows that compared with a wild type, the phenotype of the mutant zmelf3.2 does not show obvious increase in the number of aerial root layers and the number of aerial root layers; therefore, the ZmELF3.1 protein or the mutant with the function defect has the application in regulating and controlling the number of aerial roots or/and layers of corn and the like.

The amino acid sequence of the ZmELF3.1 protein is shown as SEQ ID No. 1; the polynucleotide sequence of the coding gene of the ZmELF3.1 protein is shown as SEQ ID No. 2.

More specifically, the regulation of the number of the aerial roots and/or the number of the layers of the crops comprises the steps of increasing the number of the aerial roots and/or the number of the layers of the crops or reducing the number of the aerial roots and/or the number of the layers of the crops.

The invention provides a method for increasing the number of aerial roots or/and layers of crops, which comprises the following steps: constructing a gene editing vector of the ZmELF3.1 gene or a gene knockout vector of the ZmELF3.1 gene; transferring the gene editing vector or the gene knockout vector into a receptor plant to obtain a transgenic crop with ZmELF3.1 protein function defects; the number of aerial roots and the number of layers of the obtained transgenic crops are obviously more than those of wild plants.

The invention also provides a cultivation method of the new corn variety with the number of aerial roots and/or layers being significantly more than that of wild corn varieties, which comprises the following steps: constructing a gene editing vector of the ZmELF3.1 gene or a gene knockout vector of the ZmELF3.1 gene; transferring the gene editing vector or the gene knockout vector into recipient crop corn to obtain transgenic corn with ZmELF3.1 protein function defect; the transgenic corn with the number of aerial roots and/or the number of layers being obviously more than that of wild plants obtained by screening is hybridized with different corn materials and backcrossed and bred, the hybrid seeds are improved, and the novel corn variety with the number of aerial roots and/or the number of layers being obviously more than that of wild plants is obtained.

Wherein, the gene editing vector of ZmELF3.1 gene or the gene knockout vector of ZmELF3.1 gene can be obtained according to the conventional construction method in the art.

As a preferred embodiment, the present invention provides a method for constructing a gene editing vector of ZmELF3.1 gene, comprising:

(1) Preparing a corn U6-2 promoter fragment, wherein the primers shown in SEQ ID No.3 and SEQ ID No.4 are adopted for PCR amplification to obtain the corn U6-2 promoter fragment;

(2) Preparation of sgRNA expression cassette

Fusing a target sequence of the ZmELF3.1 gene with a linker and an sgRNA framework sequence together by using an overlay PCR method, and obtaining a PCR product named as a ZmELF3.1-1 fragment; wherein the primer sequence of the overlay PCR is shown as SEQ ID No.5, SEQ ID No.6 and SEQ ID No. 7; the sgRNA skeleton sequence is shown in SEQ ID No. 8;

fusing the fusion PCR fragment obtained in the previous step and the U6-2 promoter fragment into a fragment by using an overlay PCR method, wherein the obtained PCR product is the sgRNA expression cassette; wherein the PCR primer sequences used are shown as SEQ ID No.9, SEQ ID No.10 and SEQ ID No. 11;

(3) The sgRNA expression cassette was ligated to the CPB-pUbi-hspcas9 vector: and (3) connecting the sgRNA expression cassette to a CPB-Ubi-hspcas9 vector to obtain a connection product.

The invention also provides a method for increasing the number of aerial roots or/and layers of crops, comprising: (1) Performing function defect mutation on ZmELF3.1 protein to obtain a ZmELF3.1 protein function defect mutant; (2) Constructing a recombinant plant expression vector containing the coding gene of the ZmELF3.1 protein function defect mutant; (2) Transforming the constructed recombinant plant expression vector into plant tissue or plant cells; (3) The gene encoding the functionally deficient mutant of zmlff 3.1 protein is overexpressed in plant tissues or cells.

The functionally deficient variants of the zmelf3.1 protein of the invention may be produced by genetic polymorphisms or by human manipulation, such manipulation methods being generally known in the art. For example, the amino acid shown in SEQ ID No.1 may be functionally deficient variants derived by substitution, deletion or/and insertion of one or more amino acid residues.

The invention also provides a method for reducing the number of aerial roots and layers of crops, comprising: (1) Constructing a recombinant plant expression vector containing the coding gene of the ZmELF3.1 protein; (2) Transforming the constructed recombinant plant expression vector into plant tissue or plant cells; (3) The gene encoding zmlff 3.1 protein is overexpressed in plant tissues or cells.

Operably linking the coding gene of the ZmELF3.1 protein with an expression regulatory element to obtain a recombinant plant expression vector capable of expressing the coding gene in plants; the recombinant plant expression vector can consist of a 5' non-coding region, a polynucleotide sequence shown in SEQ ID No.2 and a 3' non-coding region, wherein the 5' non-coding region can comprise a promoter sequence, an enhancer sequence or/and a translation enhancing sequence; the promoter may be a constitutive promoter, an inducible promoter, a tissue or organ specific promoter; the 3' non-coding region may comprise a terminator sequence, an mRNA cleavage sequence, and the like. Suitable terminator sequences can be taken from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase termination regions.

The recombinant plant expression vector may also contain a selectable marker gene for selection of transformed cells. Selectable marker genes are used to select transformed cells or tissues. The marker genes include: genes encoding antibiotic resistance, genes conferring resistance to herbicidal compounds, and the like. In addition, the marker gene also includes phenotypic markers such as beta-galactosidase and fluorescent protein.

In addition, one skilled in the art can optimize the polynucleotide shown in SEQ ID No.2 to enhance expression efficiency in plants. For example, polynucleotides may be synthesized using optimization of preferred codons of the target plant to enhance expression efficiency in the target plant.

The transformation protocol described in the present invention and the protocol for introducing the polynucleotide or polypeptide into a plant may vary depending on the type of plant (monocot or dicot) or plant cell used for transformation. Suitable methods for introducing the polynucleotide or polypeptide into a plant cell include: microinjection, electroporation, agrobacterium-mediated transformation, direct gene transfer, high-velocity ballistic bombardment, and the like. In particular embodiments, the genes of the invention may be provided to plants using a variety of transient transformation methods. The transformed cells can be regenerated into stably transformed plants by conventional methods (McCormick et al plant Cell reports 1986.5:81-84).

Crop species described in the present invention include, but are not limited to, monocotyledonous or dicotyledonous plants, preferably maize.

The invention uses the protein sequence of Arabidopsis thaliana ELF3 as the basis, and obtains 2 maize ELF3 genes which are named ZmELF3.1 and ZmELF3.2 respectively through homologous comparison in a maize genome database. By using CRISPR/Cas9 gene editing technology, the ZmELF3.1 or ZmELF3.2 genes of corn are respectively mutated, and the result shows that the function deletion mutant of the ZmELF3.1 protein shows a phenotype of obviously increasing the number of aerial roots and the number of layers under long sunlight and short sunlight conditions. The phenotype of the loss-of-function mutant of zmelf3.2 protein showed no significant increase in aerial root number and number of layers compared to the wild type; therefore, the ZmELF3.1 gene of the corn plays a vital role in regulating the number of aerial roots or/and layers of the corn. The invention not only has important application prospect for improving the number of aerial roots and the layer number of corn, but also can be applied to rice inbred line improvement and cross breeding.

Definition of terms in connection with the present invention

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described.

The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof in either single-or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNAs (peptide nucleic acids), DNA analogs used in antisense technology (phosphorothioates, phosphoroamidites, etc.). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. In particular, degenerate codon substitutions may be achieved by generating sequences in which the 3 rd position of one or more selected (or all) codons is substituted with mixed bases and/or deoxyinosine residues (Batzer et al, nucleic Acid Res.19:5081 (1991); ohtsuka et al, J.biol. Chem.260:2605-2608 (1985); and Cassol et al, (1992); rossolini et al, mol cell. Probes 8:91-98 (1994)).

The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to mean a polymer of amino acid residues. That is, the description for polypeptides applies equally to the description of peptides and to the description of proteins, and vice versa. The term applies to naturally occurring amino acid polymers and to amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens) in which the amino acid residues are linked via covalent peptide bonds.

The term "plurality" as used herein generally means 2 to 8, preferably 2 to 4; "substitution" refers to the substitution of one or more amino acid residues with different amino acid residues, respectively; by "deletion" is meant a reduction in the number of amino acid residues, i.e., the absence of one or more amino acid residues therein, respectively; by "insertion" is meant an alteration in the sequence of amino acid residues that results in the addition of one or more amino acid residues relative to the native molecule.

The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the invention, regardless of the method used to insert to produce a recombinant host cell, such as direct uptake, transduction, f-pairing, or other methods known in the art. The exogenous polynucleotide may remain as a non-integrating vector, such as a plasmid, or may integrate into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

The term "transformation" refers to the genetic transformation of a polynucleotide or polypeptide into a plant in such a way that the coding gene is introduced into the interior of the plant cell. Methods of introducing the polynucleotide or polypeptide into a plant are well known in the art and include, but are not limited to, stable transformation methods, transient transformation methods, virus-mediated methods, and the like.

The term "stable transformation" refers to the integration of an introduced polynucleotide construct into the genome of a plant cell and the ability to inherit through its progeny.

The term "transient transformation" refers to the introduction of a polynucleotide into a plant but only temporary expression or presence in the plant.

The term "operably linked" refers to a functional linkage between two or more elements that may be contiguous or non-contiguous.

The term "transformation": methods of introducing heterologous DNA sequences into host cells or organisms.

The term "expression": transcription and/or translation of endogenous genes or transgenes in plant cells.

The term "coding sequence": a nucleic acid sequence transcribed into RNA.

The term "recombinant plant expression vector": one or more DNA vectors for effecting plant transformation; these vectors are often referred to in the art as binary vectors. Binary vectors, together with vectors with helper plasmids, are most commonly used for agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selectable markers engineered to be capable of expression in plant cells, heterologous DNA sequences to be transcribed, and the like.

Drawings

FIG. 1 is a mutant zmelf3.1 obtained by CRISPR/Cas9 gene editing method; sequencing results, as can be seen from the figure: mutant zmelf3.1 produced a 136bp long base large fragment deletion or 1bp insertion on the second exon of the edited zmelf3.1 gene, resulting in a protein frameshift mutation.

FIG. 2 shows that the gene ZmELF3.1 in zmelf3.1 is hardly transcribed by qPCR detection of the gene ZmELF3.1 by identifying T2 generation plants and selecting homozygous plants (FIG. 2-A).

FIG. 3 shows the number of aerial root layers and the number phenotype of homozygous mutant zmelf3.1; a: the number of layers and the number of phenotypes of mutant zmelf3.1 and wild type C01 aerial roots; b: the number of the aerial root layers is counted and compared; c: and (5) carrying out statistics comparison on the number of the aerial roots.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. These examples are merely exemplary and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions can be made in the details and form of the invention without departing from the spirit and scope of the invention, but these modifications and substitutions are intended to be within the scope of the invention.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Wild type C01 in the following examples is a maize inbred transformation material of the Chinese seed group (Wuhan).

EXAMPLE 1 obtaining of ZmELF3.1 Gene and creation of mutant zmelf3.1

1. Acquisition of ZmELF3.1 Gene

The test was based on the protein sequence of Arabidopsis ELF3, and the ELF3 genes of 2 maize were obtained by homology alignment in the maize genome database, designated ZmELF3.1 and ZmELF3.2, respectively.

2. Creation of mutant Zmelf3.1

Firstly, obtaining a genome sequence of ZmELF3.1 (Zm 00001d 044232) from a corn Gramen database, marking a CDS sequence in the genome sequence, then designing 2 target sites in the CDS sequence by using Snap Gene Viewer software, and carrying out BLAST comparison in the Gramen corn database after the target sites are found, so that the specificity of the two target sites is ensured. The target sequences are respectively:

ZmELF3.1-Guide 1：GTCCTCACAGACCAAGAACAAGG

ZmELF3.1-Guide 2：GTAGACTGTCGATAAAATCTAGG

then extracting genome DNA of the corn wild type inbred line C01 by using a CTAB method. Primer is used:

ZmELF3.1-F2:5'TGGCTGTAATGATATGCTTGGG 3'

ZmELF3.1-R2:5'TTCTCTTAGCACCAACTTCCCG 3'

PCR amplification was performed on the genomic DNA and the amplified products were sequenced. Sequencing results were aligned with the B73 reference sequence and the zmelf3.1 target site sequence of C01 was found to be identical to the B73 reference sequence.

And then synthesizing a primer for constructing the CRISPR-Cas9 vector of ZmELF3.1 according to a sequencing result, wherein the primer is as follows:

ZmELF3.1-1F:

5'GAGCCGCAAGCACCGAATTGTCCTCACAGACCAAGAACAGTTTTAGAGCTAGAAATAGCAAGTT 3'

ZmELF3.1-2F:

5'GAGCCGCAAGCACCGAATTGTAGACTGTCGATAAAATCTGTTTTAGAGCTAGAAATAGCAAGTT 3'

then, constructing a CRISPR-Cas9 vector of ZmELF3.1, which comprises the following specific steps:

(1) The CPB-pUbi-hspcas9 vector was digested with HindIII and recovered

(2) Preparation of maize U6-2 promoter fragment:

primer sequence:

MU62-1F：5'TGCACTGCACAAGCTGCTGTTTTTGTTAGCCCCATCG 3'MU62-1R:5'AATTCGGTGCTTGCGGCTC 3'

the PCR amplification system is shown in Table 1.

TABLE 1PCR amplification System

Composition of the components	Volume of
		2×PCR Buffer for KOD Fx	25μL
2mM dNTPs	10μL
		MU62-1F	1.5μL
MU62-1R	1.5μL
		KOD Fx	1μL
B73DNA	1μL
		Add ddH 2 O	Up to 50μL

The PCR reaction procedure was as follows:

and (3) carrying out agarose gel electrophoresis on the PCR product, and then cutting and recovering the agarose gel to obtain the corn U6-2 promoter fragment.

(3) Preparation of sgRNA expression cassette

The target sequence with the linker and the sgRNA backbone sequence are fused together by using an overlay PCR method, and the obtained PCR products are named ZmELF3.1-1 fragment and ZmELF3.1-2 fragment respectively.

Primer sequence:

ZmELF3.1-1F:

5'GAGCCGCAAGCACCGAATTGTCCTCACAGACCAAGAACAGTTTTAGAGCTAGAAATAGCAAGTT 3'

ZmELF3.1-2F:

5'GAGCCGCAAGCACCGAATTGTAGACTGTCGATAAAATCTGTTTTAGAGCTAGAAATAGCAAGTT 3'

MUsgR-2R:5'GGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCG3'

the PCR amplification system is shown in Table 2.

TABLE 2PCR amplification System

Composition of the components	Volume of
		2×PCR Buffer for KOD Fx	25μL
2mM dNTPs	10μL
		ZmELF3.1-1F/ZmELF3.1-2F	1.5μL
MUsgR-2R	1.5μL
		KOD Fx	1μL
Synthetic sgRNA backbone sequences	1μL
		Add ddH 2 O	Up to 50μL

The sequence of the artificially synthesized sgRNA framework fragment is as follows:

GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT

the PCR reaction procedure was as follows:

and then fusing the fusion PCR fragment obtained in the last step and the U6-2 promoter fragment into a fragment by using an overlay PCR method, wherein the obtained PCR product is the sgRNA expression cassette, which is named as a U62-ZmELF3.1-1 fragment and a U62-ZmELF3.1-2 fragment respectively. The primer sequences are as follows:

MU62-1F：5'TGCACTGCACAAGCTGCTGTTTTTGTTAGCCCCATCG3'(U62-ZmELF3.1-1)

MU62-2F:5'TGCTTTTTTTAAGCTGCTGTTTTTGTTAGCCCCATCG3'(U62-ZmELF3.1-2)

MUsgR-2R:5'GGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCG3'

the PCR amplification system is shown in Table 3.

TABLE 3PCR amplification System

Composition of the components	Volume of
		2×PCR Buffer for KOD Fx	25μL
2mM dNTPs	10μL
		MU62-1F/MU62-2F	1.5μL
MUsgR-2R	1.5μL
		KOD Fx	1μL
U6-2 promoter fragment	1μL
		ZmELF3.1-1 fragment/ZmELF3.1-2 fragment	1μL
Add ddH 2 O	Up to 50μL

(4) Ligation of sgRNA expression cassette to CPB-pUbi-hspcas9 vector

The following reaction system and procedure were followed to ligate 2 sgRNA expression cassettes sequentially to CPB-Ubi-hspcas9 vector to obtain ligation products.

The reaction system and the process are shown in Table 4.

TABLE 4 reaction System and Process

Composition of the components	Volume of
		sgRNA expression cassette	1μL
CPB-pubi-hspcas9 vector fragment	1μL
		Recombinant enzyme	0.5μL

The recombinase is an In-Fusion enzyme from Clontech under reaction conditions of 50℃for 30min.

Note that: the CPB-pubi-hspcas9 vector fragment was used for the ligation of the U62-ZmELF3.1-1 fragment, and the CPB-pubi-hspcas9-U62-ZmELF3.1-1 vector fragment (both HindIII cleavage) was used for the ligation of the U62-ZmELF3.1-2 fragment.

(5) Transformation of E.coli DH 5. Alpha. And verification

The ligation product was transformed into E.coli DH 5. Alpha. By heat shock at 42℃and the bacterial solution was spread on a plate containing 50mg/L kanamycin and incubated at 37℃for about 12-16h. And (5) picking single colonies growing on the flat plate, and shaking for propagation. And (5) performing PCR verification by taking the bacterial liquid as a template.

The PCR amplification system is shown in Table 5.

TABLE 5PCR amplification System

Composition of the components	Volume of
		ddH 2 O	5.75μL
2XTsinGKE master mix	7.5μL
		Ubi-4F	0.375μL
PstI-R	0.375μL
		Bacterial liquid	1μL
Total	15μL

Wherein the upstream primer designed according to the vector is Ubi-4F, 5 'CTTAGACATGCAATGCTATTATCTC3', and the downstream primer is PstI-R, 5'CTGGCGAAAGGGGGATGT3', which are used for detecting positive clones.

The PCR reaction procedure was as follows:

bacterial solutions with correct PCR bands were sent to the company for sequencing. The plasmid with correct sequencing result is subjected to single enzyme digestion by HindIII to obtain a first ligation product carrier fragment, and then the steps (4) and (5) are repeated, and the U62-ZmELF3.1-2 fragment is ligated to a CPB-pubi-hspcas9 carrier.

(6) The constructed CPB-pubi-hspcas9-ZmELF3.1 gene editing vector is introduced into agrobacterium EHA105 by an electric shock method.

(7) CPB-pubi-hspcas 9-ZmELF3.1T-DNA is introduced into a corn inbred line C01 receptor (consigned to the China seed group Limited company life science and technology center, address: high and New technology development area Gao Xin Dai 888 biological garden way 3 of Wuhan City, hubei province) by using an agrobacterium-mediated corn immature embryo genetic transformation method. Obtaining transgenic T0 generation seeds.

(8) The T0 generation seeds were sown in the field, and when corn grows to 4 expanded leaves, leaf tips were spread 1000-fold diluted with Basta reagent (200 g/L oxadiazon, purchased from Sanchun autumn agricultural shops of Taobao), and T1 generation plants without T-DNA inserted (Basta spread sites die) were selected. Then sampling and extracting genomic DNA of T1 generation plants, and carrying out PCR amplification and sequencing to identify whether mutation occurs at the target site.

The PCR amplification system is shown in Table 6.

TABLE 6PCR amplification System

Composition of the components	Volume of
		ddH 2 O	5.75μL
2XTsinGKE master mix	7.5μL
		ZmELF3.1-F3	0.375μL
ZmELF3.1-R3	0.375μL
		Genomic DNA	1μL
Total	15μL

ZmELF3.1-F3:5'GACAGAGTTTCTTCATCCAGGTTT 3'

ZmELF3.1-R3:5'CCACAGCTTTTGATCCTTGC 3'

The PCR reaction procedure was as follows:

since the zmlff 3.1 gene designs two targets, it is theorized that if Cas9 is cleaved at both targets, the zmelf3.1 homozygous mutant should obtain a single small band fragment after PCR amplification. Wild type plants should be PCR amplified to obtain single large band fragments without cleavage, whereas heterozygous plants should be amplified with 2 bands (large and small fragments) (see FIG. 2-A), as shown in Table 7 below:

TABLE 7 amplified bands

Big band bp	Small band bp
		516	382

After preliminary PCR screening and identification, single small band fragments are selected and sent to a company for sequencing. As a result of sequencing (FIG. 1-C), zmelf3.1 homozygous mutants derived from 3 independent events were identified, 2 deleted 136bp, one inserted with a base T, and all of them had frame shift mutations, thereby disabling the ZmELF3.1 protein.

Phenotypic analysis of test example 1Zmelf3.1 mutant

Performing functional defect mutation on Zmelf3.2 protein according to the method of example 1 to obtain a Zmelf3.2 homozygous mutant; hybridization of one zmelf3.1 homozygous mutant from example 1 with a zmelf3.2 homozygous mutant gave the double mutant elf3.1elf3.2.

Homozygous zmelf3.1 maize mutants, homozygous zmelf3.2 maize mutants, double mutant elfs 3.1 elfs 3.2 and wild maize were planted in the Hebei province gallery city guang Yang Oumo Zhuang Zhenyi command Yingcun international high new technology industry garden base and Hainan three-city ledong Li Zu autonomous county peak town Weng Maocun Mo Zhong company obstetric demonstration garden base, 3 lines of wild type and each mutant were planted, 15 plants per line. Investigation of the number of layers and numbers of aerial roots of wild-type and mutant maize plants in the field revealed that zmelf3.1 mutants had significantly more layers and numbers of aerial roots than wild-type (P<10 ^-10 ) The number of layers and numbers of aerial roots of maize after the mutation of the elf3.2 did not significantly affect the number of layers and numbers of aerial roots of maize compared with the wild type (fig. 3), and this result showed that the zmelf3.1 gene of maize inhibited the number of layers and numbers of aerial roots.

SEQUENCE LISTING

<110> institute of biotechnology at national academy of agricultural sciences, university of agricultural in south China

<120> ZmELF3.1 protein and application of its functional deletion mutant in regulating and controlling plant aerial root number or layer number

<130> BJ-2002-210508A

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 756

<212> PRT

<213> Zea mays

<400> 1

Met Thr Arg Gly Gly Gly Gly Gln Gly Gly Lys Glu Glu Pro Gly Lys

1 5 10 15

Val Met Gly Pro Leu Phe Pro Arg Leu His Val Ser Asp Ala Gly Lys

20 25 30

Gly Gly Gly Pro Arg Ala Pro Pro Arg Asn Lys Met Ala Leu Tyr Glu

35 40 45

Gln Phe Thr Val Pro Ser Asn Arg Phe Ser Ser Pro Ala Ala Ser Ala

50 55 60

Arg Ala Ala Gly Ala Ser Leu Val Pro Ser Thr Ala Ala Ala Gln Val

65 70 75 80

Tyr Gly Tyr Asp Arg Thr Leu Phe Gln Pro Phe Asp Val Pro Ser Asn

85 90 95

Glu Pro Pro Arg Ser Ser Glu Lys Phe Lys Gly Asn Thr Ile Asn Gly

100 105 110

Gln Ser Asn Ser Thr Arg Arg Glu Pro Leu Arg Met Ser Ser Gln Thr

115 120 125

Lys Asn Lys Asp Val Cys Ala Ser Lys Ser Ile Ala Lys Cys Thr Ser

130 135 140

Gln His Arg Val Gly Asn Thr Ile Met Ser Ser Gly Lys Lys Val Val

145 150 155 160

Ser Asp Asp Glu Phe Met Val Pro Ser Ile Cys Tyr Pro Arg Phe Tyr

165 170 175

Arg Gln Ser Thr Gln Asp His Ala Asp Lys Ser Lys Pro Gln Ser Thr

180 185 190

Thr Asn Pro His Lys Ser Pro Ala Met Ser Lys Ser Ser Val Glu Cys

195 200 205

Tyr Ser Thr Val Asn Lys His Leu Asp Lys Ile Asn Glu Ala Asp Arg

210 215 220

Arg Leu Met Asn Ser Pro Lys Val Lys Glu Lys Glu Ala Val Gln Gly

225 230 235 240

Ser Lys Ala Val Glu Val Lys Glu Lys Ser Ser Ser Phe Gln Ala Ser

245 250 255

Glu Lys Phe Lys Asp Lys Tyr Ala Lys Leu Cys Gln Met Arg Asn Lys

260 265 270

Ala Ser Asn Ile Asn His Cys Asp Asn Asn Gly Cys Gln Pro Ala Ser

275 280 285

Val Asn Gly Asn Phe Thr Glu Ala Lys Asn Pro Thr Ala Ala Arg Asn

290 295 300

Thr Ser Ser Cys Lys Pro Cys Thr Asp Val Asp Ser Ser Asn Arg Lys

305 310 315 320

Ser Asn Leu Leu Glu Arg Ser Pro Arg Glu Val Gly Ala Lys Arg Lys

325 330 335

Arg Gly His His Asn Gly Glu Gln Asn Asp Asp Leu Ser Asp Ser Ser

340 345 350

Val Glu Cys Ile Pro Gly Gly Glu Ile Ser Pro Asp Glu Ile Val Ala

355 360 365

Ala Ile Gly Pro Lys His Phe Trp Lys Ala Arg Arg Ala Ile Gln Asn

370 375 380

Gln Gln Arg Val Phe Ala Val Gln Val Phe Glu Leu His Lys Leu Ile

385 390 395 400

Lys Val Gln Lys Leu Ile Ala Ala Ser Pro His Leu Leu Ile Glu Gly

405 410 415

Asp Pro Val Leu Gly Asn Ala Leu Thr Gly Lys Arg Asn Lys Leu Pro

420 425 430

Lys Gly Asn Ser Lys Val Gln Thr Leu Ser Ile Thr Asn Lys Asp Asp

435 440 445

Ile Gln Pro Thr Leu Glu Gln Pro Glu Leu Ser Lys Gln Asp Thr Glu

450 455 460

Gly Asn Leu Leu Ala His Ser His Asp Asp Gly Leu Gly Asp Asn His

465 470 475 480

His Asn Gln Ala Ala Thr Asn Glu Thr Phe Thr Ser Asn Pro Pro Ala

485 490 495

Met His Val Ala Pro Asp Asn Lys Gln Asn Asn Trp Cys Met Asn Pro

500 505 510

Pro Gln Asn Gln Trp Leu Val Pro Val Met Ser Pro Ser Glu Gly Leu

515 520 525

Val Tyr Lys Pro Phe Ala Gly Pro Cys Pro Pro Val Gly Asn Leu Leu

530 535 540

Thr Pro Phe Tyr Ala Asn Cys Ala Pro Ser Arg Leu Pro Ser Thr Pro

545 550 555 560

Tyr Gly Val Pro Ile Pro His Gln Pro Gln His Met Val Pro Pro Gly

565 570 575

Ala Pro Ala Met His Met Asn Tyr Phe Pro Pro Phe Ser Met Pro Val

580 585 590

Met Asn Pro Gly Thr Pro Ala Ser Ala Val Glu Gln Gly Ser His Ala

595 600 605

Ala Ala Pro Gln Pro His Gly His Met Asp Gln Gln Ser Leu Ile Ser

610 615 620

Cys Asn Met Ser His Pro Ser Gly Val Trp Arg Phe Leu Ala Ser Arg

625 630 635 640

Asp Ser Glu Pro Gln Ala Ser Ser Ala Thr Ser Pro Phe Asp Arg Leu

645 650 655

Gln Val Gln Gly Asp Gly Ser Ala Pro Leu Ser Phe Phe Pro Thr Ala

660 665 670

Ser Ala Pro Asn Val Gln Pro Pro Pro Ser Ser Gly Gly Arg Asp Arg

675 680 685

Asp Gln Gln Asn His Val Ile Arg Val Val Pro Arg Asn Ala Gln Thr

690 695 700

Ala Ser Val Pro Lys Ala Gln Pro Gln Pro Ser Ser Gly Gly Arg Asp

705 710 715 720

Gln Lys Asn His Val Ile Arg Val Val Pro His Asn Ala Gln Thr Ala

725 730 735

Ser Glu Ser Ala Ala Trp Ile Phe Arg Ser Ile Gln Met Glu Arg Asn

740 745 750

Gln Asn Asp Ser

755

<210> 2

<211> 2271

<212> DNA

<213> Zea mays

<400> 2

atgacgaggg gaggcggtgg acaaggaggc aaggaggagc cggggaaggt gatgggtccg 60

ctgttcccgc ggctccacgt cagcgacgca ggcaagggcg gcggcccgcg ggctccgcca 120

aggaacaaga tggcgctcta cgagcagttc accgtgccgt ccaaccgctt cagctccccc 180

gcggcctccg cccgcgccgc gggggccagc ctcgtgccct ccacggcggc tgcccaggtt 240

tatggttatg acaggacgct gttccagccc ttcgacgtgc cttcaaatga gcctcctcgt 300

tcatctgaaa agttcaaagg aaacactatc aacgggcagt ctaatagtac aagaagagaa 360

cctttgagga tgtcctcaca gaccaagaac aaggacgtct gtgcttcaaa atcaattgcc 420

aagtgcacct cacagcatag agtgggcaac accatcatgt cttctggaaa gaaagtggtc 480

agtgatgatg aatttatggt tccttccatc tgttatccta gattttatcg acagtctact 540

caagatcatg cagataaatc aaaaccccaa tctactacaa acccacacaa aagtcctgca 600

atgtccaaat catctgtaga gtgctatagt actgtgaaca agcacttgga caaaatcaat 660

gaagctgata ggaggttaat gaactctcca aaggttaagg agaaagaagc agtgcaagga 720

tcaaaagctg tggaagttaa agaaaagagt tcatcatttc aggcatcaga aaagttcaaa 780

gacaaatatg ctaagctatg tcaaatgagg aataaggcaa gtaatataaa tcattgtgac 840

aacaacggtt gccaacctgc aagcgtgaat ggaaatttca cagaagcaaa gaaccctaca 900

gcagctagaa atacatcttc ctgtaaacca tgtactgatg tagatagctc taacaggaag 960

tctaatttac tggaaagaag cccacgggaa gttggtgcta agagaaaaag aggacatcac 1020

aatggagagc aaaatgatga tttatctgac tcctcagtgg aatgcatacc tgggggggag 1080

atctctccag atgaaattgt tgctgctatt ggtccaaagc atttctggaa agcaagaaga 1140

gctattcaga atcagcagag ggtttttgct gtccaagtgt tcgagctgca taagctgata 1200

aaagtgcaga aattaatcgc ggcatctcca catctgctta ttgaaggtga tcctgtcctt 1260

ggcaatgcat taacaggaaa aaggaacaaa cttcctaaag gaaattcgaa agttcagacc 1320

ctgtcaatca caaacaaaga tgatatccag ccaaccctag agcaaccaga gttatcaaaa 1380

caagacacag aaggaaactt attggcccat tctcatgatg atggacttgg tgacaaccat 1440

cataatcaag ctgcaacaaa tgaaaccttt acaagcaacc ctccagctat gcatgttgct 1500

cctgacaaca aacagaataa ctggtgcatg aatccaccgc agaatcaatg gcttgtccca 1560

gttatgtcgc cttctgaagg tcttgtctat aagccttttg ccggcccttg tcccccagtt 1620

ggaaatctgc tgacaccatt ttacgccaac tgtgctccgt caaggctgcc ttctacacca 1680

tatggcgttc ctattcctca ccagccacag cacatggtcc ctcctggtgc ccctgccatg 1740

catatgaact acttcccgcc tttcagtatg ccagtgatga atccaggaac accagcatct 1800

gcagtggagc aagggagcca tgctgctgcg ccacagcctc atgggcacat ggaccagcag 1860

tcgctgatct catgtaacat gtcacacccg agtggcgttt ggaggtttct tgcatcaagg 1920

gacagcgagc cacaggccag cagcgccacc agccctttcg acaggctcca agtccaaggt 1980

gatggaagtg ctccgttgtc attctttccc acggcttcag ctccgaatgt ccagcctccg 2040

ccctcatctg gaggccggga ccgggaccag cagaaccatg taatcagggt tgttccgcgt 2100

aacgcacaga ctgcttcagt cccgaaagcc caacctcagc cgtcatccgg aggccgggac 2160

caaaagaacc atgtaatcag ggttgttccg cataacgcgc agactgcttc ggagtcagca 2220

gcgtggatct tccggtcaat acaaatggag aggaaccaaa atgattcgta g 2271

<210> 3

<211> 37

<212> DNA

<213> Artifical sequence

<400> 3

tgcactgcac aagctgctgt ttttgttagc cccatcg 37

<210> 4

<211> 19

<212> DNA

<213> Artifical sequence

<400> 4

aattcggtgc ttgcggctc 19

<210> 5

<211> 64

<212> DNA

<213> Artifical sequence

<400> 5

gagccgcaag caccgaattg tcctcacaga ccaagaacag ttttagagct agaaatagca 60

agtt 64

<210> 6

<211> 64

<212> DNA

<213> Artifical sequence

<400> 6

gagccgcaag caccgaattg tagactgtcg ataaaatctg ttttagagct agaaatagca 60

agtt 64

<210> 7

<211> 34

<212> DNA

<213> Artifical sequence

<400> 7

ggccagtgcc aagcttaaaa aaagcaccga ctcg 34

<210> 8

<211> 83

<212> DNA

<213> Artifical sequence

<400> 8

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt ttt 83

<210> 9

<211> 37

<212> DNA

<213> Artifical sequence

<400> 9

tgcactgcac aagctgctgt ttttgttagc cccatcg 37

<210> 10

<211> 37

<212> DNA

<213> Artifical sequence

<400> 10

tgcttttttt aagctgctgt ttttgttagc cccatcg 37

<210> 11

<211> 34

<212> DNA

<213> Artifical sequence

<400> 11

ggccagtgcc aagcttaaaa aaagcaccga ctcg 34

Claims (7)

1. The ZmELF3.1 protein functional defect mutant is applied to the regulation of the number of aerial roots or/and the number of layers of corn; the amino acid sequence of the ZmELF3.1 protein is shown as SEQ ID No. 1.
2. 2. The use according to claim 1, wherein the modulation is an increase in the number of aerial roots or/and layers of corn.
3. 3. A method of increasing the number of aerial roots or/and layers of corn comprising: constructionZmELF3.1Gene editing vector or geneZmELF3.1A gene knockout vector of the gene; editing the geneTransferring the vector or the gene knockout vector into recipient crop corn to obtain transgenic crop corn with ZmELF3.1 protein function defect; the saidZmELF3.1The amino acid sequence of the coding protein of the gene is shown as SEQ ID No. 1.
4. 4. A method according to claim 3, wherein saidZmELF3.1The construction method of the gene editing vector of the gene comprises the following steps:

   (1) Preparing a corn U6-2 promoter fragment;

   (2) Preparing an sgRNA expression cassette;

   adapter-carrying method by using Overlap PCRZmELF3.1The target sequence of the gene and the sgRNA framework sequence are fused together, and the obtained PCR product is named ZmELF3.1-1 fragment;

   (3) Fusing the fusion PCR fragment obtained in the previous step and the U6-2 promoter fragment into a fragment by using an overlay PCR method, wherein the obtained PCR product is the sgRNA expression cassette;

   (4) The sgRNA expression cassette was ligated to the CPB-pUbi-hspcas9 vector: and (3) connecting the sgRNA expression cassette to a CPB-Ubi-hspcas9 vector to obtain a connection product.
5. 5. The method according to claim 4, wherein the primers of SEQ ID No.3 and SEQ ID No.4 are used for PCR amplification in the step (1) to obtain a maize U6-2 promoter fragment; the primer sequences of the overlay PCR in the step (2) are shown as SEQ ID No.5, SEQ ID No.6 and SEQ ID No. 7; the sgRNA skeleton sequence is shown in SEQ ID No. 8; the sequence of the overlay PCR primer used in the step (3) is shown as SEQ ID No.9, SEQ ID No.10 and SEQ ID No. 11.
6. 6. A method for increasing the number of aerial roots or/and layers of corn comprising: carrying out functional defect mutation on the ZmELF3.1 protein of the corn to obtain a mutant corn with the ZmELF3.1 protein functional defect; the amino acid sequence of the ZmELF3.1 protein is shown as SEQ ID No. 1.
7. 7. Aerial rootThe cultivation method of the new corn variety with the number or/and the layer number more than that of the wild corn variety comprises the following steps: constructionZmELF3.1Gene editing vector or geneZmELF3.1A gene knockout vector of the gene; transferring the gene editing vector or the gene knockout vector into recipient plant corn to obtain transgenic corn with ZmELF3.1 protein function defect; the transgenic corn with the number of aerial roots and the number of layers being obviously more than that of wild plants is hybridized with different corn materials and backcrossed, the hybrid seeds are improved, and a new corn variety with the number of aerial roots and/or the number of layers being obviously more than that of wild plants is obtained; the saidZmELF3.1The amino acid sequence of the coding protein of the gene is shown as SEQ ID No. 1.