WO2021159727A1 - Zmphycs mutant protein related to flowering period of maize, encoding gene, recombinant vector and use thereof - Google Patents

Abstract

A ZmPHYCs mutant protein related to a flowering period of maize, an encoding gene, a recombinant vector, and use thereof. A CRISPR/Cas9 gene editing technology is used for mutating maize ZmPHYC1 and ZmPHYC2 genes together to create a novel early-flowering maize allele and delete an exogenous sequence of a CRISPR vector so as to obtain a strain with phenotype-stable inheritance. A functional deletion double mutant thereof exhibits an early-flowering phenotype under long-day conditions, so that it is determined that the ZmPHCYs mutant protein produced after the simultaneous mutation of the maize ZmPHYC1 and ZmPHYC2 genes have the effect of promoting the flowering of maize under long-day conditions. The present invention has great significance for regulating the flowering period of maize, can also be applied to maize inbred line improvement and cross breeding, and has advantages such as precision and high efficiency compared with conventional breeding.

Description

ZmPHYCs mutant protein related to maize flowering period, its coding gene, recombinant vector and application Technical field

The present invention relates to ZmPHYCs mutant proteins and their coding genes. The present invention further relates to their application in the regulation of plant flowering period, and belongs to the field of corn ZmPHYCs mutant proteins and their applications.

Background technique

Maize is the world's most productive crop, and it was domesticated from its ancestor's dwarf grass from southwestern Mexico about 9,000 years ago (Matsuoka et al., 2002). Buddleia is a tropical species that exhibits strict photoperiod sensitivity and requires short-day conditions to bloom. Flowering period is a complex trait that maize adapts to the local planting environment (Buckler et al. 2009), and it is a key factor that determines the ecological distribution of maize. Modern corn grows in a wide range of latitudes and is generally considered a day-neutral plant. Tropical corn planting shows delayed flowering under long-day conditions (Hung and Holland 2012). For temperate maize, it adapts to the long-day environment by reducing the sensitivity to photoperiod and optimizing the flowering time (Yang et al. 2013).

In order to regulate the flowering time, plants regard the length of the day as a key environmental signal that triggers the transition of the flowering period. There are several types of photoreceptors involved in the perception of daylight, of which the most important is the phytochrome. Phytochromes (phy) are a family of pigment proteins that sense red light and far-red light, and regulate many developmental processes throughout the life cycle of plants. Corn contains 6 phytochrome members, namely ZmPHYA1, ZmPHYA2, ZmPHYB1, ZmPHYB2, ZmPHYC1 and ZmPHYC2. Studies have found that phytochrome C (PHYC) can sense the length of the photoperiod and adjust the flowering time of plants.

There has not been any report about the function of ZmPHYC1 and ZmPHYC2 gene mutation on maize flowering. Using gene editing technology to study the specific functions of ZmPHYC1 and ZmPHYC2 gene mutations for maize flowering is not only of great significance for regulating the flowering period of maize, but also can be applied to maize inbred line improvement and cross breeding.

Summary of the invention

One of the objectives of the present invention is to provide maize ZmPHYCs mutant protein and its coding gene;

The second objective of the present invention is to provide ZmPHYCs gene editing vector;

The third purpose of the present invention is to apply the ZmPHYCs mutant protein and its coding gene and the constructed ZmPHYCs gene editing vector to maize molecular improvement breeding.

The above objectives of the present invention are achieved through the following technical solutions:

The present invention utilizes CRISPR/Cas9 gene editing technology to mutate the ZmPHYC1 and ZmPHYC2 genes of maize together, and the double mutant with loss of function exhibits an early flowering phenotype under long-day conditions, thereby confirming that the maize ZmPHYC1 and ZmPHYC2 genes are mutated at the same time. The ZmPHYCs mutant protein has the effect of promoting maize flowering under long-day conditions.

The present invention first provides corn ZmPHYCs mutant protein, which is composed of ZmPHYC1 mutant protein and ZmPHYC2 mutant protein; wherein the amino acid sequence of the ZmPHYC1 mutant protein is SEQ ID No. 27-SEQ ID No. 29 As shown, the nucleotide sequence of the coding gene is shown in SEQ ID No. 30-SEQ ID No. 32; the amino acid sequence of the ZmPHYC2 mutant protein is shown in SEQ ID No. 33-SEQ ID No. 35, which The nucleotide sequence of the coding gene is shown in SEQ ID No. 36-SEQ ID No. 38.

The present invention also provides a recombinant plant expression vector containing the coding gene and a host cell containing the recombinant plant expression vector; the coding gene can be operably connected with an expression control element to obtain a gene that can express the coding gene in a plant Recombinant plant expression vector.

The recombinant plant expression vector may also contain a selectable marker gene for selecting transformed cells; the selectable marker gene is used for selecting transformed cells or tissues; the marker gene includes: genes encoding antibiotic resistance and conferring Herbicide resistance genes, etc. In addition, the marker genes also include phenotypic markers, such as β-galactosidase and fluorescent protein.

The transformation scheme described in the present invention and the scheme for introducing the polynucleotide or polypeptide into a plant may vary depending on the type of plant (monocot or dicot) or plant cell used for transformation. Suitable methods for introducing the polynucleotide or polypeptide into plant cells include: microinjection, electroporation, Agrobacterium-mediated transformation, direct gene transfer, and high-speed ballistic bombardment. Using conventional methods, the transformed cells can regenerate stable transformed plants (McCormick et al. Plant Cell Reports. 1986.5:81-84).

The present invention can be used to transform any plant species, including but not limited to: monocotyledonous plants or dicotyledonous plants, preferably maize.

The present invention further provides a ZmPHYCs gene editing vector, the construction method of which includes:

(Ⅰ) Obtain maize U6-1 and U6-2 promoter fragments;

(Ⅱ) Preparation of sgRNA expression cassette:

(III) Connect the two sgRNA expression cassettes obtained in step (II) to the CPB-Ubi-hspcas9 vector in sequence to obtain.

Wherein, the preparation of the sgRNA expression cassette described in step (II) includes the following steps:

(A) Using overlapping PCR method to fuse the target sequence with linker and the sgRNA backbone sequence to obtain 2 PCR products; among them, the upstream primers of PCR are shown in SEQ ID No.11-SEQ ID No.12 ; The downstream primer is shown in SEQ ID No. 17, and the template sequence is shown in SEQ ID No. 18;

The overlapping PCR reaction procedure is as follows: (1) 94°C for 2 minutes; (2) 98°C for 10s; 46°C for 30s; 68°C for 10s; a total of 35 cycles; (3) 68°C for 5 minutes.

(B) The two fusion PCR fragments obtained in step (A) are connected with the U6-1 promoter fragment and the U6-2 promoter fragment respectively by overlapping PCR to obtain two PCR products, which are sgRNA ligation products; where , The upstream and downstream primer sequences used in this overlap PCR are shown in SEQ ID No.19/SEQ ID No.17 and SEQ ID No.19/SEQ ID No.20; the template used is U6-1 or U6 -2 promoter fragment and the 2 PCR products amplified in step (A); the overlapping PCR reaction procedure is as follows: (1) 94℃ 2min; (2) 98℃, 10s; 52-55℃, 30s; 68℃ 40s; 35 cycles in total; (3) 68℃ 5min.

The present invention uses CRISPR/Cas9 gene editing technology to knock out the ZmPHYCs gene, and finally obtain the mutant ZmphyCs protein, which belongs to the loss-of-function mutation; therefore, as long as the ZmPHYCs gene mutation (mutated) is caused by CRISPR/Cas9 technology The sequence may be diversified) will lead to the appearance of the phenotype: the present invention selects the background material as ZC01, and uses the constructed CRISPR/Cas9 gene editing vector to simultaneously target the two target genes of ZmPHYC1 and ZmPHYC2 in maize for targeted editing, after screening The ZmphyC1ZmphyC2#1, ZmphyC1ZmphyC2#3, and ZmphyC1ZmphyC2#7 mutant materials that have early flowering compared to the wild-type material have been eliminated; the selected ZmphyC1ZmphyC2#1, ZmphyC1ZmphyC2#3, and Zmphy2#7ZmphyC1 The abnormal function of the gene ZmPHYCs in the mutant material caused the tassel flowering date to be 4-6 days earlier than that of the wild-type material, which indicated that the lack of ZmPHYCs protein played a vital role in the regulation of the tassel flowering stage of maize.

Therefore, the present invention further applies the obtained ZmPHYCs mutant protein or the constructed ZmPHYCs gene editing vector to the breeding of improved corn tassel flowering period; specifically, the ZmPHYCs mutant protein or ZmPHYCs gene editing vector can be applied to cultivate new plant varieties ; Wherein, the new plant variety is a new early-flowering maize variety.

The present invention provides a method for advancing the flowering period of plant tassels, which includes:

(1) The selected gene encoding the ZmPHYCs mutant protein is operably connected with regulatory elements to construct a recombinant plant expression vector; (2) The constructed recombinant plant expression vector is transformed into plants and selected to obtain an early flowering New plant varieties; alternatively, transform the constructed ZmPHYCs gene editing vector into plants to obtain new plant varieties with early flowering.

The recombinant plant expression vector may also contain a selectable marker gene for selecting transformed cells. Selective marker genes are used to select transformed cells or tissues. Marker genes include genes encoding antibiotic resistance and genes conferring herbicide resistance. In addition, the marker genes also include phenotypic markers, such as β-galactosidase and fluorescent protein.

The transformation scheme described in the present invention and the scheme for introducing the polynucleotide or polypeptide into plants can be used in transformed plants (such as monocots), and conventional methods can be used to regenerate transformed cells into stable transformed plants (McCormick et al. Plant Cell Reports. 1986.5:81-84).

The present invention can be used to transform any plant species, including but not limited to: monocotyledonous plants or dicotyledonous plants, preferably maize.

The present invention uses gene editing technology to perform site-directed mutation on the maize ZmPHYCs gene for the first time to create new early-flowering maize new alleles and remove the foreign sequence of the CRISPR vector to obtain a phenotypic stable genetic strain; the present invention is not only useful for regulating the flowering period of maize It is of great significance. It can also be applied to maize inbred line improvement and cross breeding. It has advantages that are not available in conventional breeding such as precision and high efficiency, and has a wide range of application prospects.

Description of the drawings

Figure 1 The construction of CRISPR/Cas9 vector of ZmPHYC1 and ZmPHYC2 genes and the result of mutation sequence alignment; A. Gene structure and target location of ZmPHYC1 and ZmPHYC2; B. Construction model diagram of CRISPR/Cas9 vector of ZmPHYC1 and ZmPHYC2 genes; C. Maize Sequencing comparison results of ZmPHYC1 and ZmPHYC2 genes in ZmphyC1 and ZmphyC2 double mutants.

Figure 2 shows the early flowering (earlier pollination period) phenotype of the ZmphyC1ZmphyC2 double knockout mutant; the plant phenotype of the A.ZmphyC1ZmphyC2 double mutant earlier than the wild-type (WT) powder under long-day conditions. B. A partial close-up view of the phenotype of tassel flowering (flour loose); C. Statistical data graph of the pollen-spreading period under long-day conditions; D. Statistical data graph of the pollen-spreading period under short-day conditions.

Figure 3 Detection of the expression levels of maize flowering-related genes ZCN8 and CONZ1 in ZmphyC1, ZmphyC2 double knockout mutants and wild-type maize; the gray shaded part represents the dark cycle.

Detailed ways

The present invention will be further described below in conjunction with specific embodiments, and the advantages and characteristics of the present invention will become clearer with the description. However, these embodiments are only exemplary, and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that the details and forms of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and substitutions fall within the protection scope of the present invention.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

The wild-type ZC01 in the following examples is a maize inbred line transformation material of China Seed Group (Wuhan).

Example 1 Construction of ZmphyC1ZmphyC2 mutant

1. Design of target sites for maize ZmPHYC1 and ZmPHYC2 genes

First obtain ZmPHYC1 (GRMZM2G057935-T01) (the nucleotide sequence is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 2) and ZmPHYC2 (GRMZM2G129889-T01) (its nucleoside The acid sequence is shown in SEQ ID No. 3, and its amino acid sequence is the genome sequence shown in SEQ ID No. 4), and then use Snap Gene Viewer 3.2 software to design 2 targets, these 2 targets are in ZmPHYC1 and ZmPHYC2 It is highly conservative, that is, ZmPHYC1 and ZmPHYC2 can share these two targets. The target sequences are:

Guide 1: GTTCTGGAGGTAGGTGGAGA CGG (SEQ ID No. 5)

Guide 2: GCACATCGCACAGCAACGAC AGG (SEQ ID No. 6)

The underlined sequence is the PAM sequence.

Then the genomic DNA of corn wild-type inbred line C01 was extracted by the method of CTAB.

ZmPHYC1-F1: 5'GCCGCTGCCCCGCGCGGGCC3' (SEQ ID No. 7),

ZmPHYC1-R1: 5'ACCTTAGTGGGAAAGGGACG3' (SEQ ID No. 8);

ZmPHYC2-F1: 5'GCCCAAGAGTATCGTCGCTG3' (SEQ ID No. 9),

ZmPHYC2-R1: 5'CTTAGCGGGAAAGGGACAAA3' (SEQ ID No. 10);

The aforementioned primers (SEQ ID No. 7-SEQ ID No. 10) were used to perform conventional PCR amplification on the genomic DNA, and the amplified products were sent to a sequencing company for sequencing. The sequencing results were compared with the reference sequences of ZmPHYC1 and ZmPHYC2 in the maize Gramene database, and it was found that the target sequences designed for ZmPHYC1 and ZmPHYC2 of the recipient corn material ZC01 used for transformation were identical to the reference genome B73 to confirm the transgenic receptor The target sequence of material ZC01 is completely consistent with the target sequence designed according to the B73 genome sequence.

Finally, the target sequence primers with linkers are synthesized for subsequent vector construction. The primer sequence is as follows:

ZmPHYC-1F:

ZmPHYC-2F:

Among them, the black bold font part is the linker primer sequence connecting the U6-1 promoter (ZmPHYC-1F primer part in bold) or U6-2 promoter (ZmPHYC-2F primer part in bold), the underlined sequence is the designed target Dot sequence, black bold italic part is the linker primer sequence connecting the sgR backbone fragment.

2. CRISPR/Cas9 gene editing vector construction

The gene editing vector construction refers to the report method of Li C et al. (Li C, et al., Plant Biotechnol J, 2017, 15:1566-1576), and proceed as follows:

(1) Preparation of maize U6-1 promoter fragment

The primer sequence is

MU61-1F: 5'TGCTTTTTTTAAGCTGCTGTTTTTGTTAGCCCCATCG3' (SEQ ID No. 13)

MU61-1R: 5'AATTCGGTGCTTGCGGCTC3' (SEQ ID No. 14);

The template is B73 genomic DNA,

The PCR amplification system is shown in Table 1

Table 1 PCR amplification system

Element		volume
2×PCR Buffer for KOD Fx	25μL
2mM dNTPs	10μL
MU61-1F	1.5μL
MU61-1R	1.5μL
KOD Fx	1μL
Template: B73 gDNA	1μL
Add ddH 2 O	Up to 50μL

The PCR reaction procedure is as follows:

The PCR product obtained is the maize U6-1 promoter fragment.

(2) Preparation of maize U6-2 promoter fragment

The primer sequence is

MU62-1F: 5'GGATCCCTAATTGGCCCTTACA 3'(SEQ ID No. 15)

MU62-1R: 5'GGAGCGGTGGTCGCAGCTGAA 3'(SEQ ID No. 16)

The template is B73 genomic DNA,

The PCR amplification system is shown in Table 2.

Table 2 PCR amplification system

Element		volume
2×PCR Buffer for KOD Fx	25μL
2mM dNTPs	10μL
MU62-1F	1.5μL
MU62-1R	1.5μL
KOD Fx	1μL
Template: B73 gDNA	1μL
Add ddH 2 O	Up to 50μL

The PCR reaction procedure is as follows:

The obtained PCR product is the maize U6-2 promoter fragment.

(3) Preparation of sgRNA expression cassette

First, the two PCR products obtained by fusing the target sequence with the linker and the sgR backbone sequence together by overlapping PCR are named as the ZmPHYC-1 fragment and the ZmPHYC-2 fragment. The PCR amplification system is shown in Table 3.

Table 3 PCR amplification system

Element		volume
2×PCR Buffer for KOD Fx	25μL
2mM dNTPs	10μL
Upstream primer	1.5μL
Downstream primer	1.5μL
KOD Fx	1μL
template	1μL
Add ddH 2 O	Up to 50μL

The upstream primers are ZmPHYC-1F, ZmPHYC-2F, and the downstream primers are

MUsgR-1R: TGTAAGGGCCAATTAGGGATCCAAAAAAAGCACCGACTCG (SEQ ID No. 17);

The template sequence is the sgR skeleton sequence, and the artificially synthesized sgR skeleton fragment sequence is as follows:

The PCR reaction procedure is as follows:

Then use the overlap PCR method to connect the fusion PCR fragments obtained in the previous step to the U6-1 promoter and U6-2 promoter fragments respectively, and the PCR products obtained are the sgRNA ligation products, respectively named U61-ZmPHYC-1 Fragment, U62-ZmPHYC-2 fragment.

The primer sequence is:

MU61-2F: TGCACTGCACAAGCTGCTGTTTTTGTTAGCCCCATCG (SEQ ID No. 19)

MUsgR-2R: 5'GGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCG 3'(SEQ ID No. 20)

The PCR amplification system is shown in Table 4.

Table 4 PCR amplification system

Element		volume
2×PCR Buffer for KOD Fx	25μL
2mM dNTPs	10μL
Upstream primer	1.5μL
Downstream primer	1.5μL
KOD Fx	1μL
Fragment 1	1μL
Fragment 2	1μL
Add ddH 2 O	Up to 50μL

When connecting to obtain the U61-ZmPHYC-1 fragment, use MU61-2F for the upstream primer, MusgR-1R for the downstream primer, fragment 1 for the U6-1 promoter fragment, and fragment 2 for the ZmPHYC-1 fragment; obtain U62-ZmPHYC after the connection For the -2 fragment, use MU62-1F for the upstream primer, MusgR-2R for the downstream primer, fragment 1 for the U6-2 promoter fragment, and fragment 2 for the ZmPHYC-2 fragment.

The PCR reaction procedure is as follows:

(4) Connect the sgRNA expression cassette to the CPB-Ubi-hspcas9 vector

According to the following reaction system and process, each sgRNA expression cassette was sequentially connected to the CPB-Ubi-hspcas9 vector to obtain the connected product. Since ZmPHYC1 and ZmPHYC2 genes can share two targets, a total of two ligation reactions are required to connect the two targets to the CPB-Ubi-hspcas9 vector. The reaction system and process are shown in Table 5.

Table 5 Reaction system and process

Element	volume
sgRNA ligation product	1μL
CPB-pubi-hspcas9 vector fragment	1μL
Recombinase	0.5μL

The recombinant enzyme is In-Fusion enzyme from Clontech, and the reaction conditions are 50°C for 30 min.

The CPB-pubi-hspcas9 vector fragment is obtained by single digestion of the CPB-pubi-hspcas9 plasmid with HindIII. The sgRNA ligation products are U61-ZmPHYC-1 fragment, U62-ZmPHYC-2 fragment, but it should be noted that only one fragment can be connected at a time. After each fragment is connected, it needs to be sequenced and verified before using HindIII single enzyme Cut the ligated plasmid vector for subsequent ligation construction.

(4) Transformation of Escherichia coli DH5α and verification

The ligation product was transformed into Escherichia coli DH5α by heat shock at 42°C, the bacterial solution was spread on a plate containing 50mg/L kanamycin, and incubated at 37°C for about 12 hours. Pick the single colony grown on the plate and shake the bacteria to multiply. Use bacterial liquid as a template for PCR verification. The PCR amplification system is shown in Table 6.

Table 6 PCR amplification system

Element		volume
10×Taq Buffer	2.5μL
dNTPs(2.5mM each)	2μL
Upstream primer	0.5μL
Downstream primer	0.5μL
rTaq(2.5U/μL)	0.5μL
Bacteria	1μL
Add ddH 2 O	Up to 25μL

The primers designed according to the vector are as follows:

The upstream primer is

Ubi-4F: 5’CTTAGACATGCAATGCTCATTATCTC3’(SEQ ID No.21),

The downstream primer is

PstI-R: 5’CTGGCGAAAGGGGGATGT3’(SEQ ID No.22),

For detecting positive clones, the PCR reaction procedure is as follows:

Extract and detect the plasmid of the bacterial solution containing the target band and send it to the company for sequencing. The plasmid with the correct sequencing result was digested with HindIII to obtain the first ligation product vector fragment, and then repeat steps (3) and (4), and then ligate a second time, ligate the U62-ZmPHYC-2 fragment to CPB- pubi-hspcas9 vector.

3. Obtaining homozygous ZmphyC1ZmphyC2 mutants with exogenous marker genes removed

The above-mentioned positive plasmid was transformed into Agrobacterium EHA105. The conventional Agrobacterium-mediated method was used to transform the maize inbred line ZC01 to obtain the T0 generation transgenic plants. The T0 generation plants are harvested as a single plant, and the harvested seeds are sown in the field. When the corn grows to two leaves and one heart, use Basta reagent (1/1000, V/V) to smear the leaf tips, and select the ones that remove the carrier (Basta smear Show negative) T1 generation plants. Then, samples were taken to extract the genomic DNA of the T1 generation plant as a template to identify the size of the deleted fragment at the editing site. The PCR amplification system is shown in Table 7 as follows.

Table 7 PCR amplification system

Element		volume
2×Msater Mix	7.5μL
Upstream primer	0.3μL
Downstream primer	0.3μL
Template DNA	1μL
Add ddH 2 O	Up to 15μL

Among them, each ZmPHYC gene detection primer is used separately

ZmPHYC1-F2: 5’GTGTATTCCCTCTTCTCCCCCC 3’ (SEQ ID No.23)

ZmPHYC1-R2: 5’GGCTTGTATGATGGCAGACGAC 3’ (SEQ ID No. 24)

ZmPHYC2-F2: 5’CTCGCTGAAATTCCCTCTTCTT 3’(SEQ ID No.25)

ZmPHYC2-R2: 5’GTTGGTCACTGTCGGTATCCC 3’ (SEQ ID No.26)

The template DNA is the genomic DNA of the wild-type plant ZC01 and the mutant plant. The PCR reaction procedure is as follows:

Since each ZmPHYC gene is designed with two targets, in theory, if Cas9 cuts accurately at two targets at the same time, each ZmphyC1ZmphyC2 homozygous mutant should obtain a single small band fragment after PCR detection. For wild-type plants, a single large band fragment without cutting should be obtained after PCR amplification (Table 8).

Table 8 PCR amplification results

Large band bp	Small band bp	Test gene
1353bp	914bp	ZmPHYC1
1312bp	855bp	ZmPHYC2

After preliminary PCR screening and identification, a single mutation band was selected and connected to the cloning vector for sequencing identification. The sequencing comparison result is shown in Figure 1C. In the ZmphyC1ZmphyC2 mutant material, the ZmPHYC1 and ZmPHYC2 genes were cut between the two designed target sites by Cas9, resulting in deletion mutations, and the deletion of the sequence resulted in frameshift mutations, and the stop codon appeared in advance. In the ZmphyC1ZmphyC2-KO#1 material, the CDS length after ZmPHYC1 mutation is 198bp, encoding 66 amino acids in total; the CDS length after mutation of ZmPHYC2 is 255bp, encoding 85 amino acids in total. In the ZmphyC1ZmphyC2-KO#3 material, the CDS length after ZmPHYC1 mutation is 2982bp, which encodes a total of 994 amino acids; the CDS length after ZmPHYC2 mutation is 240bp, which encodes a total of 80 amino acids. In the ZmphyC1ZmphyC2-KO#7 material, the CDS length after the mutation of ZmPHYC1 is 258bp, encoding a total of 86 amino acids; the CDS length after the mutation of ZmPHYC2 is 246bp, encoding a total of 82 amino acids.

It can be seen from the figure that the ZmPHYC1 and ZmPHYC2 genes in the ZmphyC1 and ZmphyC2 double mutants of maize both produce base deletions or individual base insertions after editing, resulting in frameshift mutations in the coding region, and ultimately mutant proteins.

Example 2 Phenotypic analysis of ZmphyC1 and ZmphyC2 mutants

1. The wild type and the negative homozygous ZmphyC1ZmphyC2 mutants (#1, #3, #7) identified in Example 1 were planted in Wanzhong Company, Wengmao Village, Jianfeng Town, Ledong Li Autonomous County, Sanya City, Hainan Province. In the production-study-research demonstration park and the International High-tech Industrial Park Base in Yidongying Village, Wanzhuang Town, Guangyang District, Langfang City, Hebei Province, wild type and mutants were planted in the same plot, with 15 seedlings in each row, repeated three times. The investigation of the flowering period of wild-type and mutant plants in the field found that under long-day conditions, the powder-spreading period of ZmphyC1ZmphyC2 mutant was significantly earlier than that of wild-type (Figure 2A, B, C), while under short-day conditions, the mutant There is no significant difference in the powdering stage of the wild-type plant. This result indicates that the corn ZmPHYCs mutant protein can promote the flowering of corn (Figure 2D).

(2) Plant the wild-type and the negative homozygous ZmphyC1ZmphyC2 mutant (KO#7) identified in Example 1 in an artificial incubator, and set the long-day and short-day light conditions, and take the leaves at the V6 stage Sample, extract RNA, then reverse transcribe cDNA and detect the expression of flowering-related genes in the sample. It can be seen from Figure 3 that in the V6 stage, the expression of the flowering gene ZCN8 (the homologous gene of the FT gene) in the ZmphyC1ZmphyC2 mutant was significantly inhibited under LD conditions, which was lower than the expression in the wild type; There was no significant difference in the expression of ZCN8 gene under SD conditions between mutant and wild-type, so the mutant material had early flowering under LD conditions, but had no early flowering phenotype under SD conditions. Similarly, the expression of CO gene, the transcription factor directly upstream of the positive regulation of FT gene (the homologous gene in corn is the CONZ1 gene) and the expression pattern of ZCN8 gene can be well matched, that is, the CONZ1 gene is mutated under LD conditions. The expression in the body is higher than the expression in the wild type.

Claims (10)

1. Corn ZmPHYCs mutant protein, characterized in that the mutant protein consists of ZmPHYC1 mutant protein and ZmPHYC2 mutant protein; wherein the amino acid sequence of the ZmPHYC1 mutant protein is SEQ ID No. 27-SEQ ID No. 29 , The nucleotide sequence of the coding gene is shown in SEQ ID No. 30-SEQ ID No. 32; the amino acid sequence of the ZmPHYC2 mutant protein is shown in SEQ ID No. 33-SEQ ID No. 35, and its code The nucleotide sequence of the gene is shown in SEQ ID No. 36-SEQ ID No. 38.
2. The corn ZmPHYCs mutant protein encoding gene of claim 1, wherein the nucleotide sequence of the ZmPHYC1 mutant protein encoding gene is shown in SEQ ID No. 30-SEQ ID No. 32; the ZmPHYC2 mutation The nucleotide sequence of the gene encoding the type protein is shown in SEQ ID No. 36-SEQ ID No. 38.
3. A recombinant plant expression vector containing the coding gene of claim 2.
4. A ZmPHYCs gene editing vector, which is characterized in that its construction method includes:

   (Ⅰ) Obtain maize U6-1 and U6-2 promoter fragments;

   (Ⅱ) Preparation of sgRNA expression cassette:

   (III) Connect the two sgRNA expression cassettes obtained in step (II) to the CPB-Ubi-hspcas9 vector in sequence to obtain.
5. The ZmPHYCs gene editing vector according to claim 4, wherein the preparation of the sgRNA expression cassette in step (II) comprises the following steps:

   (A) Using overlapping PCR method to fuse the target sequence with linker and the sgR backbone sequence to obtain 2 PCR products; among them, the upstream primers of PCR are shown in SEQ ID No.11-SEQ ID No.12. ; The downstream primer is shown in SEQ ID No. 17, and the template sequence is shown in SEQ ID No. 18;

   (B) The two fusion PCR fragments obtained in step (A) are connected with the U6-1 promoter fragment and the U6-2 promoter fragment respectively by overlapping PCR to obtain two PCR products, which are sgRNA ligation products; where , The upstream and downstream primer sequences used in this overlap PCR are shown in SEQ ID No.19/SEQ ID No.17 and SEQ ID No.19/SEQ ID No.20; the template used is U6-1 or U6- 2 The promoter fragment and the 2 PCR products amplified in step (A).
6. The use of the corn ZmPHYCs mutant protein of claim 1 in regulating the flowering period of corn.
7. The use of the coding gene of claim 2 in regulating the flowering period of maize tassels.
8. The use of the ZmPHYCs gene editing vector of claim 3 in regulating the flowering period of maize tassels.
9. The use according to claim 6 or 7, characterized in that the regulation of the flowering period of maize is to advance the flowering period of maize tassels under long-day conditions.
10. A method for advancing the flowering period of plant tassels, which is characterized in that it comprises: (1) operably linking the coding gene of claim 2 with regulatory elements to construct a recombinant plant expression vector; (2) The constructed recombinant plant expression vector is transformed into plants to screen to obtain new plant varieties with early flowering; or, the constructed ZmPHYCs gene editing vector is transformed into plants to screen to obtain new plant varieties with early flowering; preferably, the plant is corn .

Images